>Feature sequence001 220 870 gene locus_tag LOCUS_00010 220 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2019 928 gene locus_tag LOCUS_00020 2019 928 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312389.1 protein_id gnl|my_center|LOCUS_00020 2346 3674 gene locus_tag LOCUS_00030 2346 3674 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530213.1 protein_id gnl|my_center|LOCUS_00030 3682 4431 gene locus_tag LOCUS_00040 3682 4431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533087.1 protein_id gnl|my_center|LOCUS_00040 4428 5156 gene locus_tag LOCUS_00050 4428 5156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_00050 5153 6043 gene locus_tag LOCUS_00060 5153 6043 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530210.1 protein_id gnl|my_center|LOCUS_00060 6091 7125 gene locus_tag LOCUS_00070 6091 7125 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_00070 7129 7908 gene locus_tag LOCUS_00080 7129 7908 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_00080 7905 8663 gene locus_tag LOCUS_00090 7905 8663 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_00090 8644 9420 gene locus_tag LOCUS_00100 8644 9420 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229260.1 protein_id gnl|my_center|LOCUS_00100 9451 10650 gene locus_tag LOCUS_00110 9451 10650 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 protein_id gnl|my_center|LOCUS_00110 10647 11717 gene locus_tag LOCUS_00120 10647 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11801 13765 gene locus_tag LOCUS_00130 11801 13765 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_00130 13762 15471 gene locus_tag LOCUS_00140 13762 15471 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_00140 15905 16546 gene locus_tag LOCUS_00150 15905 16546 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730225.1 protein_id gnl|my_center|LOCUS_00150 16676 17662 gene locus_tag LOCUS_00160 16676 17662 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_00160 17995 17702 gene locus_tag LOCUS_00170 17995 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18246 18674 gene locus_tag LOCUS_00180 18246 18674 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_00180 18974 20428 gene locus_tag LOCUS_00190 18974 20428 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244111.1 protein_id gnl|my_center|LOCUS_00190 20510 21529 gene locus_tag LOCUS_00200 20510 21529 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_00200 21576 22607 gene locus_tag LOCUS_00210 21576 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22604 22981 gene locus_tag LOCUS_00220 22604 22981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23310 22948 gene locus_tag LOCUS_00230 23310 22948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23194 23730 gene locus_tag LOCUS_00240 23194 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23736 24218 gene locus_tag LOCUS_00250 23736 24218 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720035.1 protein_id gnl|my_center|LOCUS_00250 24215 26542 gene locus_tag LOCUS_00260 24215 26542 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_00260 26539 27462 gene locus_tag LOCUS_00270 26539 27462 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505124.1 protein_id gnl|my_center|LOCUS_00270 27528 28289 gene locus_tag LOCUS_00280 27528 28289 CDS product 4-pyridoxolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529871.1 protein_id gnl|my_center|LOCUS_00280 28378 29250 gene locus_tag LOCUS_00290 28378 29250 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088979.1 protein_id gnl|my_center|LOCUS_00290 29261 29938 gene locus_tag LOCUS_00300 29261 29938 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141279381.1 protein_id gnl|my_center|LOCUS_00300 29945 30718 gene locus_tag LOCUS_00310 29945 30718 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463438.1 protein_id gnl|my_center|LOCUS_00310 30774 31514 gene locus_tag LOCUS_00320 30774 31514 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529873.1 protein_id gnl|my_center|LOCUS_00320 31554 31949 gene locus_tag LOCUS_00330 31554 31949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 32009 33037 gene locus_tag LOCUS_00340 32009 33037 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172490.1 protein_id gnl|my_center|LOCUS_00340 33034 34224 gene locus_tag LOCUS_00350 33034 34224 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529872.1 protein_id gnl|my_center|LOCUS_00350 34385 35758 gene locus_tag LOCUS_00360 34385 35758 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099715.1 protein_id gnl|my_center|LOCUS_00360 35955 36839 gene locus_tag LOCUS_00370 35955 36839 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_00370 36880 37836 gene locus_tag LOCUS_00380 36880 37836 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_00380 37833 38621 gene locus_tag LOCUS_00390 37833 38621 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140955.1 protein_id gnl|my_center|LOCUS_00390 39996 38638 gene locus_tag LOCUS_00400 gene gabT 39996 38638 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112244.1 protein_id gnl|my_center|LOCUS_00400 40934 40080 gene locus_tag LOCUS_00410 40934 40080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 41213 42298 gene locus_tag LOCUS_00420 41213 42298 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228266.1 protein_id gnl|my_center|LOCUS_00420 42678 43115 gene locus_tag LOCUS_00430 42678 43115 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_00430 43665 43234 gene locus_tag LOCUS_00440 43665 43234 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_00440 44061 43696 gene locus_tag LOCUS_00450 44061 43696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 45253 44075 gene locus_tag LOCUS_00460 45253 44075 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_00460 46659 45250 gene locus_tag LOCUS_00470 46659 45250 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031169.1 protein_id gnl|my_center|LOCUS_00470 47819 46725 gene locus_tag LOCUS_00480 gene glpX 47819 46725 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_00480 47870 49249 gene locus_tag LOCUS_00490 gene murA 47870 49249 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084647.1 protein_id gnl|my_center|LOCUS_00490 49246 50238 gene locus_tag LOCUS_00500 gene meaB 49246 50238 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_00500 50249 52114 gene locus_tag LOCUS_00510 gene treS 50249 52114 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897929.1 protein_id gnl|my_center|LOCUS_00510 52111 53373 gene locus_tag LOCUS_00520 52111 53373 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_00520 53420 54469 gene locus_tag LOCUS_00530 53420 54469 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_00530 55460 54486 gene locus_tag LOCUS_00540 gene galT 55460 54486 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_00540 55688 56185 gene locus_tag LOCUS_00550 55688 56185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57568 56210 gene locus_tag LOCUS_00560 57568 56210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58568 57570 gene locus_tag LOCUS_00570 gene cysD 58568 57570 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730229.1 protein_id gnl|my_center|LOCUS_00570 58830 59537 gene locus_tag LOCUS_00580 58830 59537 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 protein_id gnl|my_center|LOCUS_00580 59664 60371 gene locus_tag LOCUS_00590 59664 60371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60506 60580 gene locus_tag LOCUS_t00010 60506 60580 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 1977 727 gene locus_tag LOCUS_00600 1977 727 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400620.1 protein_id gnl|my_center|LOCUS_00600 3218 2040 gene locus_tag LOCUS_00610 3218 2040 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_00610 4768 3278 gene locus_tag LOCUS_00620 4768 3278 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964170.1 protein_id gnl|my_center|LOCUS_00620 5454 4765 gene locus_tag LOCUS_00630 5454 4765 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_00630 5999 5721 gene locus_tag LOCUS_00640 5999 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 7132 5996 gene locus_tag LOCUS_00650 7132 5996 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086213.1 protein_id gnl|my_center|LOCUS_00650 8028 7243 gene locus_tag LOCUS_00660 8028 7243 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445567.1 protein_id gnl|my_center|LOCUS_00660 9143 8151 gene locus_tag LOCUS_00670 9143 8151 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479639.1 protein_id gnl|my_center|LOCUS_00670 10338 9175 gene locus_tag LOCUS_00680 10338 9175 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878464.1 protein_id gnl|my_center|LOCUS_00680 10896 10402 gene locus_tag LOCUS_00690 10896 10402 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_00690 11807 10893 gene locus_tag LOCUS_00700 11807 10893 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_00700 14130 11800 gene locus_tag LOCUS_00710 14130 11800 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_00710 15067 14246 gene locus_tag LOCUS_00720 15067 14246 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230091.1 protein_id gnl|my_center|LOCUS_00720 15171 16646 gene locus_tag LOCUS_00730 15171 16646 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970546.1 protein_id gnl|my_center|LOCUS_00730 17950 16727 gene locus_tag LOCUS_00740 17950 16727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 18809 18012 gene locus_tag LOCUS_00750 18809 18012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970224.1 protein_id gnl|my_center|LOCUS_00750 20812 18806 gene locus_tag LOCUS_00760 20812 18806 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247367.1 protein_id gnl|my_center|LOCUS_00760 21876 20866 gene locus_tag LOCUS_00770 21876 20866 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_00770 23243 21924 gene locus_tag LOCUS_00780 23243 21924 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392450.1 protein_id gnl|my_center|LOCUS_00780 24500 23415 gene locus_tag LOCUS_00790 24500 23415 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_00790 25830 24577 gene locus_tag LOCUS_00800 25830 24577 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_00800 27019 25892 gene locus_tag LOCUS_00810 gene hisC 27019 25892 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_00810 28211 27054 gene locus_tag LOCUS_00820 28211 27054 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113728.1 protein_id gnl|my_center|LOCUS_00820 29254 28208 gene locus_tag LOCUS_00830 29254 28208 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_00830 30282 29209 gene locus_tag LOCUS_00840 gene pdhA 30282 29209 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_00840 31502 30501 gene locus_tag LOCUS_00850 gene mer 31502 30501 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_00850 32566 31499 gene locus_tag LOCUS_00860 32566 31499 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_00860 32718 32563 gene locus_tag LOCUS_00870 32718 32563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 33395 32685 gene locus_tag LOCUS_00880 gene garL 33395 32685 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 protein_id gnl|my_center|LOCUS_00880 36961 33407 gene locus_tag LOCUS_00890 36961 33407 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_00890 37143 36961 gene locus_tag LOCUS_00900 37143 36961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 37884 37195 gene locus_tag LOCUS_00910 37884 37195 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730864.1 protein_id gnl|my_center|LOCUS_00910 40385 37884 gene locus_tag LOCUS_00920 40385 37884 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_00920 40911 40387 gene locus_tag LOCUS_00930 gene cutC 40911 40387 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_00930 41813 40911 gene locus_tag LOCUS_00940 41813 40911 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_00940 43039 42035 gene locus_tag LOCUS_00950 43039 42035 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_00950 43818 43036 gene locus_tag LOCUS_00960 43818 43036 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_00960 45530 43953 gene locus_tag LOCUS_00970 45530 43953 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527970.1 protein_id gnl|my_center|LOCUS_00970 46688 45546 gene locus_tag LOCUS_00980 46688 45546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 47702 46779 gene locus_tag LOCUS_00990 47702 46779 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_00990 48871 47699 gene locus_tag LOCUS_01000 48871 47699 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_01000 49778 48882 gene locus_tag LOCUS_01010 49778 48882 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728150.1 protein_id gnl|my_center|LOCUS_01010 51046 49775 gene locus_tag LOCUS_01020 51046 49775 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_01020 52113 51043 gene locus_tag LOCUS_01030 52113 51043 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234306381.1 protein_id gnl|my_center|LOCUS_01030 52224 53852 gene locus_tag LOCUS_01040 52224 53852 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_01040 55038 53890 gene locus_tag LOCUS_01050 55038 53890 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533159.1 protein_id gnl|my_center|LOCUS_01050 55919 55035 gene locus_tag LOCUS_01060 55919 55035 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528427.1 protein_id gnl|my_center|LOCUS_01060 56713 55916 gene locus_tag LOCUS_01070 56713 55916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870166.1 protein_id gnl|my_center|LOCUS_01070 57486 56710 gene locus_tag LOCUS_01080 57486 56710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533156.1 protein_id gnl|my_center|LOCUS_01080 58710 57490 gene locus_tag LOCUS_01090 58710 57490 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970052.1 protein_id gnl|my_center|LOCUS_01090 58879 60186 gene locus_tag LOCUS_01100 58879 60186 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462762.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence003 <1 581 gene locus_tag LOCUS_01110 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114537.1:FAD-dependent oxidoreductase 1284 625 gene locus_tag LOCUS_01120 1284 625 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892083.1 protein_id gnl|my_center|LOCUS_01120 1548 3689 gene locus_tag LOCUS_01130 1548 3689 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748465.1 protein_id gnl|my_center|LOCUS_01130 3745 5154 gene locus_tag LOCUS_01140 3745 5154 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_01140 6093 5227 gene locus_tag LOCUS_01150 6093 5227 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_01150 7405 6107 gene locus_tag LOCUS_01160 gene ccrA 7405 6107 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_01160 9300 7492 gene locus_tag LOCUS_01170 9300 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 9546 10712 gene locus_tag LOCUS_01180 9546 10712 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727109.1 protein_id gnl|my_center|LOCUS_01180 10771 12825 gene locus_tag LOCUS_01190 10771 12825 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530454.1 protein_id gnl|my_center|LOCUS_01190 14293 12839 gene locus_tag LOCUS_01200 14293 12839 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_01200 15677 14430 gene locus_tag LOCUS_01210 15677 14430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 16364 15750 gene locus_tag LOCUS_01220 16364 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978012.1 protein_id gnl|my_center|LOCUS_01220 16627 18333 gene locus_tag LOCUS_01230 16627 18333 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228668.1 protein_id gnl|my_center|LOCUS_01230 20812 18509 gene locus_tag LOCUS_01240 20812 18509 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_01240 21285 20848 gene locus_tag LOCUS_01250 21285 20848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 22821 21403 gene locus_tag LOCUS_01260 22821 21403 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_01260 23756 23052 gene locus_tag LOCUS_01270 23756 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 24592 23801 gene locus_tag LOCUS_01280 gene garL 24592 23801 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064097.1 protein_id gnl|my_center|LOCUS_01280 25784 24627 gene locus_tag LOCUS_01290 25784 24627 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_01290 27467 25806 gene locus_tag LOCUS_01300 27467 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 28280 27504 gene locus_tag LOCUS_01310 28280 27504 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_01310 29308 28301 gene locus_tag LOCUS_01320 gene mer 29308 28301 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_01320 30129 29503 gene locus_tag LOCUS_01330 30129 29503 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969630.1 protein_id gnl|my_center|LOCUS_01330 32579 30135 gene locus_tag LOCUS_01340 32579 30135 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_01340 33093 32593 gene locus_tag LOCUS_01350 33093 32593 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807630.1 protein_id gnl|my_center|LOCUS_01350 33968 33090 gene locus_tag LOCUS_01360 33968 33090 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_01360 35455 33983 gene locus_tag LOCUS_01370 35455 33983 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_01370 35629 36144 gene locus_tag LOCUS_01380 35629 36144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 37028 36171 gene locus_tag LOCUS_01390 gene rapZ 37028 36171 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_01390 39121 37025 gene locus_tag LOCUS_01400 gene uvrC 39121 37025 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_01400 39555 40694 gene locus_tag LOCUS_01410 gene nadA 39555 40694 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_01410 40780 42003 gene locus_tag LOCUS_01420 40780 42003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 45062 42174 gene locus_tag LOCUS_01430 gene uvrA 45062 42174 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_01430 46436 45240 gene locus_tag LOCUS_01440 46436 45240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 47431 47186 gene locus_tag LOCUS_01450 47431 47186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 49001 47448 gene locus_tag LOCUS_01460 49001 47448 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_01460 49187 49858 gene locus_tag LOCUS_01470 49187 49858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 49894 52242 gene locus_tag LOCUS_01480 49894 52242 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930210.1 protein_id gnl|my_center|LOCUS_01480 52380 53018 gene locus_tag LOCUS_01490 gene satP 52380 53018 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368353.1 protein_id gnl|my_center|LOCUS_01490 <53909 53167 gene locus_tag LOCUS_01500 <53909 53167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229993.1:propionyl-CoA synthetase >Feature sequence004 577 11 gene locus_tag LOCUS_01510 577 11 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530298.1 protein_id gnl|my_center|LOCUS_01510 1476 589 gene locus_tag LOCUS_01520 1476 589 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112326.1 protein_id gnl|my_center|LOCUS_01520 1862 1473 gene locus_tag LOCUS_01530 1862 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 2457 1870 gene locus_tag LOCUS_01540 2457 1870 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 protein_id gnl|my_center|LOCUS_01540 3773 2454 gene locus_tag LOCUS_01550 3773 2454 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665723.1 protein_id gnl|my_center|LOCUS_01550 4676 3777 gene locus_tag LOCUS_01560 4676 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 4969 4673 gene locus_tag LOCUS_01570 4969 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 4990 5184 gene locus_tag LOCUS_01580 4990 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 5190 6146 gene locus_tag LOCUS_01590 5190 6146 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528532.1 protein_id gnl|my_center|LOCUS_01590 7379 6153 gene locus_tag LOCUS_01600 7379 6153 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950389.1 protein_id gnl|my_center|LOCUS_01600 8281 7385 gene locus_tag LOCUS_01610 8281 7385 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462180.1 protein_id gnl|my_center|LOCUS_01610 9176 8283 gene locus_tag LOCUS_01620 9176 8283 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401865.1 protein_id gnl|my_center|LOCUS_01620 11566 9173 gene locus_tag LOCUS_01630 11566 9173 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_01630 12093 11563 gene locus_tag LOCUS_01640 12093 11563 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 protein_id gnl|my_center|LOCUS_01640 12974 12096 gene locus_tag LOCUS_01650 12974 12096 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_01650 13831 13133 gene locus_tag LOCUS_01660 13831 13133 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727165.1 protein_id gnl|my_center|LOCUS_01660 14774 13896 gene locus_tag LOCUS_01670 14774 13896 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731497.1 protein_id gnl|my_center|LOCUS_01670 15214 14771 gene locus_tag LOCUS_01680 15214 14771 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230122.1 protein_id gnl|my_center|LOCUS_01680 17339 15216 gene locus_tag LOCUS_01690 17339 15216 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729528.1 protein_id gnl|my_center|LOCUS_01690 17547 18659 gene locus_tag LOCUS_01700 17547 18659 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727711.1 protein_id gnl|my_center|LOCUS_01700 18802 19452 gene locus_tag LOCUS_01710 18802 19452 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103336743.1 protein_id gnl|my_center|LOCUS_01710 19449 20243 gene locus_tag LOCUS_01720 19449 20243 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230125.1 protein_id gnl|my_center|LOCUS_01720 20248 21879 gene locus_tag LOCUS_01730 20248 21879 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_01730 21883 22158 gene locus_tag LOCUS_01740 21883 22158 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417918.1 protein_id gnl|my_center|LOCUS_01740 22158 22550 gene locus_tag LOCUS_01750 22158 22550 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_01750 23921 22545 gene locus_tag LOCUS_01760 23921 22545 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_01760 22634 22643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24782 23961 gene locus_tag LOCUS_01770 24782 23961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 25066 26325 gene locus_tag LOCUS_01780 25066 26325 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_01780 26393 27475 gene locus_tag LOCUS_01790 26393 27475 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092926.1 protein_id gnl|my_center|LOCUS_01790 29226 27583 gene locus_tag LOCUS_01800 29226 27583 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226313.1 protein_id gnl|my_center|LOCUS_01800 31020 29317 gene locus_tag LOCUS_01810 31020 29317 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533474.1 protein_id gnl|my_center|LOCUS_01810 31877 31032 gene locus_tag LOCUS_01820 31877 31032 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_01820 32902 31961 gene locus_tag LOCUS_01830 32902 31961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_01830 33852 32899 gene locus_tag LOCUS_01840 33852 32899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_01840 35807 33951 gene locus_tag LOCUS_01850 35807 33951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 36120 37748 gene locus_tag LOCUS_01860 36120 37748 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_01860 38694 37879 gene locus_tag LOCUS_01870 38694 37879 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897426.1 protein_id gnl|my_center|LOCUS_01870 40316 38691 gene locus_tag LOCUS_01880 40316 38691 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_01880 41230 40316 gene locus_tag LOCUS_01890 gene pcaD 41230 40316 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_01890 42378 41227 gene locus_tag LOCUS_01900 42378 41227 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_01900 43208 42378 gene locus_tag LOCUS_01910 43208 42378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 43909 43205 gene locus_tag LOCUS_01920 43909 43205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_01920 46788 43906 gene locus_tag LOCUS_01930 46788 43906 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_01930 48087 46852 gene locus_tag LOCUS_01940 48087 46852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 49364 48141 gene locus_tag LOCUS_01950 49364 48141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 50136 50618 gene locus_tag LOCUS_01960 50136 50618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 50983 50768 gene locus_tag LOCUS_01970 50983 50768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 51807 51517 gene locus_tag LOCUS_01980 51807 51517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 52110 52973 gene locus_tag LOCUS_01990 52110 52973 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence005 258 992 gene locus_tag LOCUS_02000 258 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 1269 2564 gene locus_tag LOCUS_02010 1269 2564 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776220.1 protein_id gnl|my_center|LOCUS_02010 2865 2632 gene locus_tag LOCUS_02020 2865 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 4238 5785 gene locus_tag LOCUS_02030 4238 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 6231 5794 gene locus_tag LOCUS_02040 6231 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 6258 7817 gene locus_tag LOCUS_02050 6258 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 7850 7774 gene locus_tag LOCUS_t00020 7850 7774 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8028 8807 gene locus_tag LOCUS_02060 8028 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 9436 8843 gene locus_tag LOCUS_02070 9436 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 9513 11867 gene locus_tag LOCUS_02080 9513 11867 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_02080 11864 13132 gene locus_tag LOCUS_02090 11864 13132 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_02090 13129 14718 gene locus_tag LOCUS_02100 13129 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 14715 15599 gene locus_tag LOCUS_02110 14715 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 15618 16385 gene locus_tag LOCUS_02120 15618 16385 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_02120 17122 16355 gene locus_tag LOCUS_02130 17122 16355 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_02130 18414 17113 gene locus_tag LOCUS_02140 18414 17113 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742179.1 protein_id gnl|my_center|LOCUS_02140 18829 19770 gene locus_tag LOCUS_02150 18829 19770 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748902.1 protein_id gnl|my_center|LOCUS_02150 19782 21278 gene locus_tag LOCUS_02160 19782 21278 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_02160 21275 22657 gene locus_tag LOCUS_02170 21275 22657 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_02170 23106 24548 gene locus_tag LOCUS_02180 23106 24548 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_02180 25109 25017 gene locus_tag LOCUS_t00030 25109 25017 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 25476 27758 gene locus_tag LOCUS_02190 25476 27758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 29044 27797 gene locus_tag LOCUS_02200 29044 27797 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_02200 30234 29041 gene locus_tag LOCUS_02210 30234 29041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 30313 31794 gene locus_tag LOCUS_02220 30313 31794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 31791 32480 gene locus_tag LOCUS_02230 31791 32480 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338834.1 protein_id gnl|my_center|LOCUS_02230 32485 33102 gene locus_tag LOCUS_02240 32485 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 33099 33293 gene locus_tag LOCUS_02250 33099 33293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 33853 33335 gene locus_tag LOCUS_02260 33853 33335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 34431 33919 gene locus_tag LOCUS_02270 34431 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 35176 34508 gene locus_tag LOCUS_02280 35176 34508 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_02280 36662 35232 gene locus_tag LOCUS_02290 36662 35232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 36839 37852 gene locus_tag LOCUS_02300 36839 37852 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142395.1 protein_id gnl|my_center|LOCUS_02300 39872 37896 gene locus_tag LOCUS_02310 39872 37896 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980561.1 protein_id gnl|my_center|LOCUS_02310 41252 40110 gene locus_tag LOCUS_02320 41252 40110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 42568 41354 gene locus_tag LOCUS_02330 42568 41354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 43054 44007 gene locus_tag LOCUS_02340 43054 44007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 44165 45520 gene locus_tag LOCUS_02350 44165 45520 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_02350 46982 45579 gene locus_tag LOCUS_02360 46982 45579 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_02360 47216 49120 gene locus_tag LOCUS_02370 47216 49120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 50247 49297 gene locus_tag LOCUS_02380 50247 49297 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895400.1 protein_id gnl|my_center|LOCUS_02380 <51558 50382 gene locus_tag LOCUS_02390 <51558 50382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062822354.1:oxaloacetate-decarboxylating malate dehydrogenase >Feature sequence006 <1 1060 gene locus_tag LOCUS_02400 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005093506.1:Nramp family divalent metal transporter 1236 3680 gene locus_tag LOCUS_02410 1236 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3920 5251 gene locus_tag LOCUS_02420 3920 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 5300 7297 gene locus_tag LOCUS_02430 gene ftsH 5300 7297 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_02430 7327 8433 gene locus_tag LOCUS_02440 7327 8433 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730164.1 protein_id gnl|my_center|LOCUS_02440 8509 9090 gene locus_tag LOCUS_02450 gene pdxH 8509 9090 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_02450 10130 9129 gene locus_tag LOCUS_02460 10130 9129 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529848.1 protein_id gnl|my_center|LOCUS_02460 10550 10257 gene locus_tag LOCUS_02470 10550 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 10637 11143 gene locus_tag LOCUS_02480 10637 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 13724 11295 gene locus_tag LOCUS_02490 13724 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 15844 14015 gene locus_tag LOCUS_02500 15844 14015 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466576.1 protein_id gnl|my_center|LOCUS_02500 16458 15937 gene locus_tag LOCUS_02510 16458 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 16783 17343 gene locus_tag LOCUS_02520 16783 17343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 18129 17374 gene locus_tag LOCUS_02530 18129 17374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225676.1 protein_id gnl|my_center|LOCUS_02530 18890 18126 gene locus_tag LOCUS_02540 18890 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02540 20918 18891 gene locus_tag LOCUS_02550 20918 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02550 22226 20943 gene locus_tag LOCUS_02560 22226 20943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 23104 22589 gene locus_tag LOCUS_02570 23104 22589 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_02570 23383 23817 gene locus_tag LOCUS_02580 23383 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 23826 24458 gene locus_tag LOCUS_02590 23826 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 24452 25543 gene locus_tag LOCUS_02600 24452 25543 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532793.1 protein_id gnl|my_center|LOCUS_02600 25540 25956 gene locus_tag LOCUS_02610 25540 25956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 26493 25963 gene locus_tag LOCUS_02620 26493 25963 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_02620 27632 26490 gene locus_tag LOCUS_02630 27632 26490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 27906 28283 gene locus_tag LOCUS_02640 27906 28283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 28933 28259 gene locus_tag LOCUS_02650 28933 28259 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_02650 30867 29008 gene locus_tag LOCUS_02660 30867 29008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 31125 32066 gene locus_tag LOCUS_02670 31125 32066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 32237 32836 gene locus_tag LOCUS_02680 32237 32836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 33053 33556 gene locus_tag LOCUS_02690 33053 33556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 33750 36134 gene locus_tag LOCUS_02700 gene lon 33750 36134 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 protein_id gnl|my_center|LOCUS_02700 36175 36423 gene locus_tag LOCUS_02710 36175 36423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 36501 36893 gene locus_tag LOCUS_02720 36501 36893 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388728.1 protein_id gnl|my_center|LOCUS_02720 36907 37704 gene locus_tag LOCUS_02730 36907 37704 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228354.1 protein_id gnl|my_center|LOCUS_02730 38793 37741 gene locus_tag LOCUS_02740 38793 37741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 39314 38808 gene locus_tag LOCUS_02750 39314 38808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 40534 39311 gene locus_tag LOCUS_02760 40534 39311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 42384 40531 gene locus_tag LOCUS_02770 42384 40531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 42608 43171 gene locus_tag LOCUS_02780 42608 43171 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221471091.1 protein_id gnl|my_center|LOCUS_02780 43361 45328 gene locus_tag LOCUS_02790 43361 45328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 46292 45297 gene locus_tag LOCUS_02800 gene egtD 46292 45297 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419799.1 protein_id gnl|my_center|LOCUS_02800 47623 46295 gene locus_tag LOCUS_02810 gene egtB 47623 46295 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_02810 47906 48577 gene locus_tag LOCUS_02820 gene msrA 47906 48577 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_02820 48616 48903 gene locus_tag LOCUS_02830 48616 48903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 >Feature sequence007 <1 711 gene locus_tag LOCUS_02840 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003410049.1:class I SAM-dependent methyltransferase 746 1018 gene locus_tag LOCUS_02850 746 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1122 2672 gene locus_tag LOCUS_02860 1122 2672 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_02860 2663 3190 gene locus_tag LOCUS_02870 2663 3190 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730198.1 protein_id gnl|my_center|LOCUS_02870 3378 3716 gene locus_tag LOCUS_02880 3378 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 3713 4318 gene locus_tag LOCUS_02890 3713 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 4315 4980 gene locus_tag LOCUS_02900 4315 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 5292 5083 gene locus_tag LOCUS_02910 5292 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 5207 5695 gene locus_tag LOCUS_02920 5207 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 7502 5901 gene locus_tag LOCUS_02930 7502 5901 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_02930 7906 7499 gene locus_tag LOCUS_02940 7906 7499 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 protein_id gnl|my_center|LOCUS_02940 9116 8082 gene locus_tag LOCUS_02950 9116 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 9296 10525 gene locus_tag LOCUS_02960 gene ilvA 9296 10525 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_02960 10644 11924 gene locus_tag LOCUS_02970 10644 11924 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978775.1 protein_id gnl|my_center|LOCUS_02970 12078 12419 gene locus_tag LOCUS_02980 12078 12419 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234816983.1 protein_id gnl|my_center|LOCUS_02980 13328 12474 gene locus_tag LOCUS_02990 13328 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14371 13553 gene locus_tag LOCUS_03000 14371 13553 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_03000 15317 14397 gene locus_tag LOCUS_03010 15317 14397 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 protein_id gnl|my_center|LOCUS_03010 16114 15314 gene locus_tag LOCUS_03020 16114 15314 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222024.1 protein_id gnl|my_center|LOCUS_03020 17577 16111 gene locus_tag LOCUS_03030 17577 16111 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284833.1 protein_id gnl|my_center|LOCUS_03030 18605 17574 gene locus_tag LOCUS_03040 18605 17574 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_03040 19815 18607 gene locus_tag LOCUS_03050 19815 18607 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475542.1 protein_id gnl|my_center|LOCUS_03050 19919 20764 gene locus_tag LOCUS_03060 19919 20764 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222017.1 protein_id gnl|my_center|LOCUS_03060 20826 22475 gene locus_tag LOCUS_03070 20826 22475 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_03070 22567 23472 gene locus_tag LOCUS_03080 22567 23472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284829.1 protein_id gnl|my_center|LOCUS_03080 23469 24374 gene locus_tag LOCUS_03090 23469 24374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015039.1 protein_id gnl|my_center|LOCUS_03090 24374 26401 gene locus_tag LOCUS_03100 24374 26401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730244.1 protein_id gnl|my_center|LOCUS_03100 26517 27896 gene locus_tag LOCUS_03110 26517 27896 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227712.1 protein_id gnl|my_center|LOCUS_03110 27946 28308 gene locus_tag LOCUS_03120 27946 28308 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528941.1 protein_id gnl|my_center|LOCUS_03120 30119 28440 gene locus_tag LOCUS_03130 30119 28440 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_03130 30558 32387 gene locus_tag LOCUS_03140 30558 32387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 32437 33378 gene locus_tag LOCUS_03150 32437 33378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_03150 33371 34369 gene locus_tag LOCUS_03160 33371 34369 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_03160 35911 34412 gene locus_tag LOCUS_03170 35911 34412 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_03170 36216 35953 gene locus_tag LOCUS_03180 36216 35953 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_03180 37982 36213 gene locus_tag LOCUS_03190 37982 36213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 39790 37979 gene locus_tag LOCUS_03200 gene acsA 39790 37979 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_03200 40141 40515 gene locus_tag LOCUS_03210 40141 40515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 41350 40640 gene locus_tag LOCUS_03220 41350 40640 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_03220 <42072 41331 gene locus_tag LOCUS_03230 <42072 41331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909376.1:LysR family transcriptional regulator >Feature sequence008 <1 1338 gene locus_tag LOCUS_03240 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880673.1:methyltransferase domain-containing protein 1483 3528 gene locus_tag LOCUS_03250 gene flhA 1483 3528 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392311.1 protein_id gnl|my_center|LOCUS_03250 3506 4663 gene locus_tag LOCUS_03260 3506 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4663 4911 gene locus_tag LOCUS_03270 4663 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 5467 4865 gene locus_tag LOCUS_03280 5467 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 6003 5455 gene locus_tag LOCUS_03290 6003 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 6939 6013 gene locus_tag LOCUS_03300 6939 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 8309 6936 gene locus_tag LOCUS_03310 8309 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 8815 8312 gene locus_tag LOCUS_03320 8815 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 9391 8873 gene locus_tag LOCUS_03330 9391 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 10290 9388 gene locus_tag LOCUS_03340 10290 9388 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_03340 11078 10287 gene locus_tag LOCUS_03350 11078 10287 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081357594.1 protein_id gnl|my_center|LOCUS_03350 11556 11173 gene locus_tag LOCUS_03360 11556 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 12430 11636 gene locus_tag LOCUS_03370 gene whiG 12430 11636 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_03370 15280 12485 gene locus_tag LOCUS_03380 15280 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 16469 15831 gene locus_tag LOCUS_03390 16469 15831 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730704.1 protein_id gnl|my_center|LOCUS_03390 16586 16921 gene locus_tag LOCUS_03400 16586 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 17384 18505 gene locus_tag LOCUS_03410 17384 18505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 18510 19352 gene locus_tag LOCUS_03420 18510 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 19650 19315 gene locus_tag LOCUS_03430 19650 19315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 20033 19960 gene locus_tag LOCUS_t00040 20033 19960 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20156 21553 gene locus_tag LOCUS_03440 gene lysA 20156 21553 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_03440 21674 22516 gene locus_tag LOCUS_03450 21674 22516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 22598 23989 gene locus_tag LOCUS_03460 22598 23989 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933544.1 protein_id gnl|my_center|LOCUS_03460 24142 25710 gene locus_tag LOCUS_03470 24142 25710 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805070.1 protein_id gnl|my_center|LOCUS_03470 27577 25814 gene locus_tag LOCUS_03480 gene argS 27577 25814 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228472.1 protein_id gnl|my_center|LOCUS_03480 27750 30443 gene locus_tag LOCUS_03490 gene acnA 27750 30443 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_03490 31741 30515 gene locus_tag LOCUS_03500 31741 30515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 31911 32375 gene locus_tag LOCUS_03510 gene bcp 31911 32375 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_03510 32423 33541 gene locus_tag LOCUS_03520 32423 33541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 34122 33529 gene locus_tag LOCUS_03530 34122 33529 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_03530 34233 34862 gene locus_tag LOCUS_03540 34233 34862 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 protein_id gnl|my_center|LOCUS_03540 34775 35347 gene locus_tag LOCUS_03550 34775 35347 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_03550 35344 36045 gene locus_tag LOCUS_03560 35344 36045 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014087.1 protein_id gnl|my_center|LOCUS_03560 <36923 36089 gene locus_tag LOCUS_03570 <36923 36089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899889.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence009 53 125 gene locus_tag LOCUS_t00050 53 125 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1155 106 gene locus_tag LOCUS_03580 1155 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1490 1170 gene locus_tag LOCUS_03590 1490 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1611 2291 gene locus_tag LOCUS_03600 1611 2291 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804965.1 protein_id gnl|my_center|LOCUS_03600 2288 3022 gene locus_tag LOCUS_03610 2288 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3118 3597 gene locus_tag LOCUS_03620 3118 3597 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_03620 4299 3655 gene locus_tag LOCUS_03630 4299 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4558 5658 gene locus_tag LOCUS_03640 4558 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 5712 7115 gene locus_tag LOCUS_03650 5712 7115 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223633.1 protein_id gnl|my_center|LOCUS_03650 7192 7698 gene locus_tag LOCUS_03660 7192 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7695 8537 gene locus_tag LOCUS_03670 7695 8537 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225542.1 protein_id gnl|my_center|LOCUS_03670 8883 9587 gene locus_tag LOCUS_03680 8883 9587 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_03680 10588 9656 gene locus_tag LOCUS_03690 10588 9656 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_03690 10637 11500 gene locus_tag LOCUS_03700 10637 11500 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 protein_id gnl|my_center|LOCUS_03700 11981 11526 gene locus_tag LOCUS_03710 gene arfB 11981 11526 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_03710 12058 13056 gene locus_tag LOCUS_03720 12058 13056 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_03720 14790 13075 gene locus_tag LOCUS_03730 14790 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 15138 17042 gene locus_tag LOCUS_03740 15138 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 17801 17058 gene locus_tag LOCUS_03750 gene phnF 17801 17058 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_03750 18022 17798 gene locus_tag LOCUS_03760 18022 17798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 21179 18309 gene locus_tag LOCUS_03770 21179 18309 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_03770 23252 21435 gene locus_tag LOCUS_03780 gene fadD11 23252 21435 CDS product fatty acid--CoA ligase FadD11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083132908.1 protein_id gnl|my_center|LOCUS_03780 24059 23379 gene locus_tag LOCUS_03790 24059 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 25168 24080 gene locus_tag LOCUS_03800 25168 24080 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_03800 25619 25176 gene locus_tag LOCUS_03810 25619 25176 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_03810 26821 25658 gene locus_tag LOCUS_03820 26821 25658 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_03820 27040 26843 gene locus_tag LOCUS_03830 27040 26843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 27543 27139 gene locus_tag LOCUS_03840 27543 27139 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104445.1 protein_id gnl|my_center|LOCUS_03840 28060 27551 gene locus_tag LOCUS_03850 28060 27551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 28880 28104 gene locus_tag LOCUS_03860 28880 28104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 30321 28948 gene locus_tag LOCUS_03870 30321 28948 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_03870 31734 30400 gene locus_tag LOCUS_03880 31734 30400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 32399 31731 gene locus_tag LOCUS_03890 32399 31731 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820363.1 protein_id gnl|my_center|LOCUS_03890 32513 33013 gene locus_tag LOCUS_03900 32513 33013 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877784.1 protein_id gnl|my_center|LOCUS_03900 33772 33014 gene locus_tag LOCUS_03910 33772 33014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 33893 34690 gene locus_tag LOCUS_03920 33893 34690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 34687 34965 gene locus_tag LOCUS_03930 34687 34965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 34981 35931 gene locus_tag LOCUS_03940 34981 35931 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence010 <1 664 gene locus_tag LOCUS_03950 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105083.1:TDT family transporter 756 1472 gene locus_tag LOCUS_03960 756 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 1510 2805 gene locus_tag LOCUS_03970 1510 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2923 3357 gene locus_tag LOCUS_03980 2923 3357 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_03980 3383 5029 gene locus_tag LOCUS_03990 3383 5029 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_03990 5029 8616 gene locus_tag LOCUS_04000 gene nifJ 5029 8616 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_04000 8616 9626 gene locus_tag LOCUS_04010 8616 9626 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_04010 9691 12123 gene locus_tag LOCUS_04020 gene ppsA 9691 12123 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 protein_id gnl|my_center|LOCUS_04020 12201 12965 gene locus_tag LOCUS_04030 12201 12965 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_04030 12974 17398 gene locus_tag LOCUS_04040 12974 17398 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909023.1 protein_id gnl|my_center|LOCUS_04040 17879 17403 gene locus_tag LOCUS_04050 gene trxA 17879 17403 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228708.1 protein_id gnl|my_center|LOCUS_04050 18532 17897 gene locus_tag LOCUS_04060 18532 17897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 19530 18529 gene locus_tag LOCUS_04070 19530 18529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 22044 19666 gene locus_tag LOCUS_04080 22044 19666 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927044.1 protein_id gnl|my_center|LOCUS_04080 22390 24870 gene locus_tag LOCUS_04090 22390 24870 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_04090 25322 24921 gene locus_tag LOCUS_04100 25322 24921 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296233.1 protein_id gnl|my_center|LOCUS_04100 27065 25389 gene locus_tag LOCUS_04110 27065 25389 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030294.1 protein_id gnl|my_center|LOCUS_04110 27748 27062 gene locus_tag LOCUS_04120 gene ureA 27748 27062 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030293.1 protein_id gnl|my_center|LOCUS_04120 29712 27775 gene locus_tag LOCUS_04130 gene oatA 29712 27775 CDS product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932001.1 protein_id gnl|my_center|LOCUS_04130 29884 31449 gene locus_tag LOCUS_04140 29884 31449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 31955 31506 gene locus_tag LOCUS_04150 31955 31506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 32788 31952 gene locus_tag LOCUS_04160 32788 31952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 32883 34043 gene locus_tag LOCUS_04170 32883 34043 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_04170 34065 34253 gene locus_tag LOCUS_04180 34065 34253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 34310 34906 gene locus_tag LOCUS_04190 34310 34906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence011 1841 840 gene locus_tag LOCUS_04200 gene mer 1841 840 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_04200 4468 1874 gene locus_tag LOCUS_04210 gene xdh 4468 1874 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869184.1 protein_id gnl|my_center|LOCUS_04210 4597 5229 gene locus_tag LOCUS_04220 4597 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6387 5260 gene locus_tag LOCUS_04230 6387 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 6396 7784 gene locus_tag LOCUS_04240 gene hydA 6396 7784 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_04240 7882 8160 gene locus_tag LOCUS_04250 7882 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 9783 8245 gene locus_tag LOCUS_04260 9783 8245 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230704.1 protein_id gnl|my_center|LOCUS_04260 9827 10975 gene locus_tag LOCUS_04270 9827 10975 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_04270 10984 11859 gene locus_tag LOCUS_04280 10984 11859 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865474.1 protein_id gnl|my_center|LOCUS_04280 11846 12397 gene locus_tag LOCUS_04290 11846 12397 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_04290 12384 14702 gene locus_tag LOCUS_04300 gene pucD 12384 14702 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_04300 15095 14739 gene locus_tag LOCUS_04310 15095 14739 CDS product Rv2640c family ArsR-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086804.1 protein_id gnl|my_center|LOCUS_04310 15414 16037 gene locus_tag LOCUS_04320 15414 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 16501 16034 gene locus_tag LOCUS_04330 16501 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 16735 17277 gene locus_tag LOCUS_04340 gene infC 16735 17277 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_04340 17300 17494 gene locus_tag LOCUS_04350 gene rpmI 17300 17494 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858721.1 protein_id gnl|my_center|LOCUS_04350 17508 17870 gene locus_tag LOCUS_04360 gene rplT 17508 17870 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776197.1 protein_id gnl|my_center|LOCUS_04360 17948 18679 gene locus_tag LOCUS_04370 17948 18679 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_04370 18676 19728 gene locus_tag LOCUS_04380 gene pheS 18676 19728 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_04380 19739 22201 gene locus_tag LOCUS_04390 gene pheT 19739 22201 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_04390 22288 24045 gene locus_tag LOCUS_04400 22288 24045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_04400 24132 25142 gene locus_tag LOCUS_04410 gene argC 24132 25142 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_04410 25139 26317 gene locus_tag LOCUS_04420 gene argJ 25139 26317 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014333.1 protein_id gnl|my_center|LOCUS_04420 26314 27174 gene locus_tag LOCUS_04430 gene argB 26314 27174 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_04430 27171 28355 gene locus_tag LOCUS_04440 27171 28355 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_04440 28352 28867 gene locus_tag LOCUS_04450 28352 28867 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 protein_id gnl|my_center|LOCUS_04450 28855 30069 gene locus_tag LOCUS_04460 28855 30069 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079277.1 protein_id gnl|my_center|LOCUS_04460 30066 31526 gene locus_tag LOCUS_04470 gene argH 30066 31526 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110848.1 protein_id gnl|my_center|LOCUS_04470 31550 32134 gene locus_tag LOCUS_04480 31550 32134 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227827.1 protein_id gnl|my_center|LOCUS_04480 33285 32164 gene locus_tag LOCUS_04490 gene ald 33285 32164 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_04490 34821 33370 gene locus_tag LOCUS_04500 34821 33370 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence012 <1 1186 gene locus_tag LOCUS_04510 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162483898.1:precorrin-3B C(17)-methyltransferase 1183 1809 gene locus_tag LOCUS_04520 1183 1809 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392611.1 protein_id gnl|my_center|LOCUS_04520 1802 2773 gene locus_tag LOCUS_04530 1802 2773 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_04530 2878 3375 gene locus_tag LOCUS_04540 gene cobO 2878 3375 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_04540 3372 4754 gene locus_tag LOCUS_04550 3372 4754 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228815.1 protein_id gnl|my_center|LOCUS_04550 4751 6016 gene locus_tag LOCUS_04560 4751 6016 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868658.1 protein_id gnl|my_center|LOCUS_04560 6045 6794 gene locus_tag LOCUS_04570 gene cobF 6045 6794 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896950.1 protein_id gnl|my_center|LOCUS_04570 8425 6821 gene locus_tag LOCUS_04580 8425 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 10957 8600 gene locus_tag LOCUS_04590 10957 8600 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_04590 11841 11032 gene locus_tag LOCUS_04600 11841 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12109 11858 gene locus_tag LOCUS_04610 12109 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 13440 12211 gene locus_tag LOCUS_04620 13440 12211 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 protein_id gnl|my_center|LOCUS_04620 15632 13524 gene locus_tag LOCUS_04630 gene glgX 15632 13524 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_04630 16176 15694 gene locus_tag LOCUS_04640 16176 15694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 17425 16145 gene locus_tag LOCUS_04650 17425 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04650 17712 17491 gene locus_tag LOCUS_04660 17712 17491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 17693 19123 gene locus_tag LOCUS_04670 17693 19123 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 protein_id gnl|my_center|LOCUS_04670 20312 19143 gene locus_tag LOCUS_04680 20312 19143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 21299 20520 gene locus_tag LOCUS_04690 gene tam 21299 20520 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705336.1 protein_id gnl|my_center|LOCUS_04690 22402 21296 gene locus_tag LOCUS_04700 22402 21296 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_04700 22606 22427 gene locus_tag LOCUS_04710 22606 22427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 22596 24206 gene locus_tag LOCUS_04720 22596 24206 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026997.1 protein_id gnl|my_center|LOCUS_04720 25683 24667 gene locus_tag LOCUS_04730 25683 24667 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_04730 26585 25680 gene locus_tag LOCUS_04740 26585 25680 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_04740 27514 26582 gene locus_tag LOCUS_04750 27514 26582 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_04750 28707 27511 gene locus_tag LOCUS_04760 28707 27511 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039902.1 protein_id gnl|my_center|LOCUS_04760 29555 28704 gene locus_tag LOCUS_04770 29555 28704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 30409 29903 gene locus_tag LOCUS_04780 30409 29903 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228753.1 protein_id gnl|my_center|LOCUS_04780 30447 31478 gene locus_tag LOCUS_04790 30447 31478 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_04790 33027 31552 gene locus_tag LOCUS_04800 gene ahcY 33027 31552 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_04800 34293 34367 gene locus_tag LOCUS_t00060 34293 34367 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 303 1214 gene locus_tag LOCUS_04810 303 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1456 1818 gene locus_tag LOCUS_04820 1456 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1818 4190 gene locus_tag LOCUS_04830 1818 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 7026 4519 gene locus_tag LOCUS_04840 7026 4519 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545345.1 protein_id gnl|my_center|LOCUS_04840 9431 7023 gene locus_tag LOCUS_04850 9431 7023 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545530.1 protein_id gnl|my_center|LOCUS_04850 9660 10013 gene locus_tag LOCUS_04860 9660 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 10114 10692 gene locus_tag LOCUS_04870 10114 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 11836 10685 gene locus_tag LOCUS_04880 11836 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 11905 12234 gene locus_tag LOCUS_04890 11905 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 12215 13315 gene locus_tag LOCUS_04900 12215 13315 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_04900 14422 13511 gene locus_tag LOCUS_04910 14422 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 14519 15439 gene locus_tag LOCUS_04920 14519 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 15623 15841 gene locus_tag LOCUS_04930 15623 15841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 15899 20485 gene locus_tag LOCUS_04940 15899 20485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 21000 21914 gene locus_tag LOCUS_04950 21000 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 21907 22485 gene locus_tag LOCUS_04960 21907 22485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 22510 23796 gene locus_tag LOCUS_04970 22510 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 24525 25388 gene locus_tag LOCUS_04980 24525 25388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 26166 25429 gene locus_tag LOCUS_04990 26166 25429 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224827.1 protein_id gnl|my_center|LOCUS_04990 26988 27212 gene locus_tag LOCUS_05000 26988 27212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 27222 27806 gene locus_tag LOCUS_05010 27222 27806 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729581.1 protein_id gnl|my_center|LOCUS_05010 27948 28184 gene locus_tag LOCUS_05020 27948 28184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 28493 28272 gene locus_tag LOCUS_05030 28493 28272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 28610 28831 gene locus_tag LOCUS_05040 28610 28831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 29021 29248 gene locus_tag LOCUS_05050 29021 29248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 29248 30243 gene locus_tag LOCUS_05060 29248 30243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 30312 31286 gene locus_tag LOCUS_05070 30312 31286 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_05070 31283 31900 gene locus_tag LOCUS_05080 31283 31900 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence014 <1 623 gene locus_tag LOCUS_05090 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791450.1:branched-chain amino acid transaminase 651 1136 gene locus_tag LOCUS_05100 651 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1208 2359 gene locus_tag LOCUS_05110 1208 2359 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_05110 3444 2431 gene locus_tag LOCUS_05120 3444 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3956 3441 gene locus_tag LOCUS_05130 3956 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 5502 3949 gene locus_tag LOCUS_05140 gene nrfD 5502 3949 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_05140 6407 5499 gene locus_tag LOCUS_05150 6407 5499 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938583.1 protein_id gnl|my_center|LOCUS_05150 7136 6507 gene locus_tag LOCUS_05160 7136 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 7694 7137 gene locus_tag LOCUS_05170 7694 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 7793 8041 gene locus_tag LOCUS_05180 7793 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 8949 8224 gene locus_tag LOCUS_05190 8949 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 9523 9203 gene locus_tag LOCUS_05200 9523 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 9645 9920 gene locus_tag LOCUS_05210 9645 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 10103 11899 gene locus_tag LOCUS_05220 10103 11899 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_05220 13292 11943 gene locus_tag LOCUS_05230 13292 11943 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_05230 14569 13289 gene locus_tag LOCUS_05240 14569 13289 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_05240 15003 15497 gene locus_tag LOCUS_05250 15003 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 16664 16116 gene locus_tag LOCUS_05260 16664 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 17178 16795 gene locus_tag LOCUS_05270 17178 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05270 18628 18290 gene locus_tag LOCUS_05280 18628 18290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 18842 19642 gene locus_tag LOCUS_05290 18842 19642 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878408.1 protein_id gnl|my_center|LOCUS_05290 19675 20496 gene locus_tag LOCUS_05300 19675 20496 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_05300 20525 20866 gene locus_tag LOCUS_05310 20525 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 21747 20809 gene locus_tag LOCUS_05320 21747 20809 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_05320 22982 21744 gene locus_tag LOCUS_05330 22982 21744 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_05330 23029 24444 gene locus_tag LOCUS_05340 23029 24444 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_05340 24643 24413 gene locus_tag LOCUS_05350 24643 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 25434 24829 gene locus_tag LOCUS_05360 25434 24829 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_05360 26538 25549 gene locus_tag LOCUS_05370 26538 25549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 27803 26616 gene locus_tag LOCUS_05380 27803 26616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 28173 29036 gene locus_tag LOCUS_05390 28173 29036 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_05390 30656 29055 gene locus_tag LOCUS_05400 30656 29055 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_05400 31294 30653 gene locus_tag LOCUS_05410 31294 30653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 31345 31767 gene locus_tag LOCUS_05420 31345 31767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 31781 32344 gene locus_tag LOCUS_05430 31781 32344 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence015 2529 2047 gene locus_tag LOCUS_05440 2529 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 2720 2526 gene locus_tag LOCUS_05450 2720 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3559 2717 gene locus_tag LOCUS_05460 3559 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 4224 3556 gene locus_tag LOCUS_05470 4224 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 4933 4214 gene locus_tag LOCUS_05480 4933 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 6020 5079 gene locus_tag LOCUS_05490 6020 5079 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085573.1 protein_id gnl|my_center|LOCUS_05490 7005 6031 gene locus_tag LOCUS_05500 gene gmd 7005 6031 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_05500 7029 8189 gene locus_tag LOCUS_05510 7029 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 8199 8870 gene locus_tag LOCUS_05520 8199 8870 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416861.1 protein_id gnl|my_center|LOCUS_05520 8999 9502 gene locus_tag LOCUS_05530 8999 9502 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229486.1 protein_id gnl|my_center|LOCUS_05530 12992 9432 gene locus_tag LOCUS_05540 12992 9432 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730314.1 protein_id gnl|my_center|LOCUS_05540 14335 13163 gene locus_tag LOCUS_05550 14335 13163 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_05550 15410 14409 gene locus_tag LOCUS_05560 15410 14409 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223361.1 protein_id gnl|my_center|LOCUS_05560 17511 15412 gene locus_tag LOCUS_05570 17511 15412 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_05570 19163 17514 gene locus_tag LOCUS_05580 19163 17514 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_05580 19348 19818 gene locus_tag LOCUS_05590 19348 19818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 20548 19850 gene locus_tag LOCUS_05600 20548 19850 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412782.1 protein_id gnl|my_center|LOCUS_05600 21339 20545 gene locus_tag LOCUS_05610 21339 20545 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031119.1 protein_id gnl|my_center|LOCUS_05610 21556 22293 gene locus_tag LOCUS_05620 21556 22293 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 protein_id gnl|my_center|LOCUS_05620 22510 24408 gene locus_tag LOCUS_05630 22510 24408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_05630 24398 24889 gene locus_tag LOCUS_05640 24398 24889 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276566.1 protein_id gnl|my_center|LOCUS_05640 25673 24924 gene locus_tag LOCUS_05650 25673 24924 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_05650 26865 25741 gene locus_tag LOCUS_05660 26865 25741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969390.1 protein_id gnl|my_center|LOCUS_05660 28681 26858 gene locus_tag LOCUS_05670 28681 26858 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840173.1 protein_id gnl|my_center|LOCUS_05670 29786 28725 gene locus_tag LOCUS_05680 29786 28725 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626531.1 protein_id gnl|my_center|LOCUS_05680 30169 30951 gene locus_tag LOCUS_05690 30169 30951 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence016 356 2134 gene locus_tag LOCUS_05700 356 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2142 2981 gene locus_tag LOCUS_05710 2142 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3000 3452 gene locus_tag LOCUS_05720 3000 3452 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_05720 3449 3724 gene locus_tag LOCUS_05730 3449 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3733 4647 gene locus_tag LOCUS_05740 3733 4647 CDS product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189723.1 protein_id gnl|my_center|LOCUS_05740 4644 5921 gene locus_tag LOCUS_05750 4644 5921 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030918.1 protein_id gnl|my_center|LOCUS_05750 6552 7118 gene locus_tag LOCUS_05760 6552 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 8326 7172 gene locus_tag LOCUS_05770 8326 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 8558 10159 gene locus_tag LOCUS_05780 8558 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 10484 11971 gene locus_tag LOCUS_05790 10484 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 12071 13048 gene locus_tag LOCUS_05800 12071 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 13087 13995 gene locus_tag LOCUS_05810 13087 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 13992 15089 gene locus_tag LOCUS_05820 13992 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 15173 16186 gene locus_tag LOCUS_05830 15173 16186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05830 16325 17212 gene locus_tag LOCUS_05840 16325 17212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 18069 17209 gene locus_tag LOCUS_05850 18069 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 18272 19438 gene locus_tag LOCUS_05860 18272 19438 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_05860 20390 19389 gene locus_tag LOCUS_05870 20390 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 22708 20390 gene locus_tag LOCUS_05880 22708 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 23754 22705 gene locus_tag LOCUS_05890 23754 22705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 24904 23747 gene locus_tag LOCUS_05900 24904 23747 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021210.1 protein_id gnl|my_center|LOCUS_05900 25546 24941 gene locus_tag LOCUS_05910 25546 24941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 26724 25696 gene locus_tag LOCUS_05920 26724 25696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 27160 26888 gene locus_tag LOCUS_05930 27160 26888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 27182 27460 gene locus_tag LOCUS_05940 27182 27460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 28580 27690 gene locus_tag LOCUS_05950 28580 27690 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_05950 29583 30506 gene locus_tag LOCUS_05960 29583 30506 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681782.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence017 1392 601 gene locus_tag LOCUS_05970 1392 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1542 2243 gene locus_tag LOCUS_05980 1542 2243 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205383.1 protein_id gnl|my_center|LOCUS_05980 2243 4204 gene locus_tag LOCUS_05990 gene selB 2243 4204 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_05990 4201 5235 gene locus_tag LOCUS_06000 gene selD 4201 5235 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_06000 5355 6602 gene locus_tag LOCUS_06010 gene selA 5355 6602 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_06010 6776 6648 gene locus_tag LOCUS_06020 6776 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 6839 6848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7507 8136 gene locus_tag LOCUS_06030 7507 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 9051 8146 gene locus_tag LOCUS_06040 9051 8146 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230532.1 protein_id gnl|my_center|LOCUS_06040 10058 9051 gene locus_tag LOCUS_06050 10058 9051 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_06050 11139 10063 gene locus_tag LOCUS_06060 11139 10063 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_06060 12368 11136 gene locus_tag LOCUS_06070 12368 11136 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031767.1 protein_id gnl|my_center|LOCUS_06070 13288 12380 gene locus_tag LOCUS_06080 13288 12380 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537498.1 protein_id gnl|my_center|LOCUS_06080 14238 13285 gene locus_tag LOCUS_06090 14238 13285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383546.1 protein_id gnl|my_center|LOCUS_06090 15957 14350 gene locus_tag LOCUS_06100 15957 14350 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537499.1 protein_id gnl|my_center|LOCUS_06100 16258 17577 gene locus_tag LOCUS_06110 16258 17577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 17574 18755 gene locus_tag LOCUS_06120 17574 18755 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259040.1 protein_id gnl|my_center|LOCUS_06120 18766 19779 gene locus_tag LOCUS_06130 18766 19779 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_06130 19797 21149 gene locus_tag LOCUS_06140 gene nagA 19797 21149 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417418.1 protein_id gnl|my_center|LOCUS_06140 21570 21298 gene locus_tag LOCUS_06150 21570 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 21920 21582 gene locus_tag LOCUS_06160 21920 21582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 22022 22189 gene locus_tag LOCUS_06170 22022 22189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 22323 23318 gene locus_tag LOCUS_06180 22323 23318 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_06180 23495 24043 gene locus_tag LOCUS_06190 23495 24043 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530470.1 protein_id gnl|my_center|LOCUS_06190 24172 26019 gene locus_tag LOCUS_06200 24172 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 27126 26194 gene locus_tag LOCUS_06210 27126 26194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence018 2030 888 gene locus_tag LOCUS_06220 2030 888 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 protein_id gnl|my_center|LOCUS_06220 3410 2169 gene locus_tag LOCUS_06230 3410 2169 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 protein_id gnl|my_center|LOCUS_06230 3981 3460 gene locus_tag LOCUS_06240 3981 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4175 4005 gene locus_tag LOCUS_06250 4175 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 4612 4220 gene locus_tag LOCUS_06260 4612 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4838 4650 gene locus_tag LOCUS_06270 4838 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5494 4910 gene locus_tag LOCUS_06280 5494 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 5552 6031 gene locus_tag LOCUS_06290 5552 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 7724 6039 gene locus_tag LOCUS_06300 7724 6039 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197012475.1 protein_id gnl|my_center|LOCUS_06300 8284 7808 gene locus_tag LOCUS_06310 8284 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9287 8319 gene locus_tag LOCUS_06320 9287 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10355 9291 gene locus_tag LOCUS_06330 10355 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 11632 10469 gene locus_tag LOCUS_06340 11632 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 12186 11632 gene locus_tag LOCUS_06350 12186 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 13446 12223 gene locus_tag LOCUS_06360 13446 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 13989 13561 gene locus_tag LOCUS_06370 13989 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 14743 14009 gene locus_tag LOCUS_06380 14743 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 15142 14903 gene locus_tag LOCUS_06390 15142 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 15691 15443 gene locus_tag LOCUS_06400 15691 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 16188 15688 gene locus_tag LOCUS_06410 16188 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 18359 16185 gene locus_tag LOCUS_06420 18359 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 19678 18356 gene locus_tag LOCUS_06430 19678 18356 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838314.1 protein_id gnl|my_center|LOCUS_06430 21883 19772 gene locus_tag LOCUS_06440 21883 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 23275 21947 gene locus_tag LOCUS_06450 23275 21947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 23225 23947 gene locus_tag LOCUS_06460 23225 23947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 24243 24863 gene locus_tag LOCUS_06470 24243 24863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 25122 24913 gene locus_tag LOCUS_06480 25122 24913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 26109 25207 gene locus_tag LOCUS_06490 26109 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 26810 26094 gene locus_tag LOCUS_06500 26810 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 26923 27249 gene locus_tag LOCUS_06510 26923 27249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 28175 27246 gene locus_tag LOCUS_06520 28175 27246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence019 89 913 gene locus_tag LOCUS_06530 89 913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_06530 964 1752 gene locus_tag LOCUS_06540 964 1752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_06540 1828 2781 gene locus_tag LOCUS_06550 1828 2781 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_06550 4284 2851 gene locus_tag LOCUS_06560 4284 2851 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_06560 4365 5495 gene locus_tag LOCUS_06570 4365 5495 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035552.1 protein_id gnl|my_center|LOCUS_06570 5492 6124 gene locus_tag LOCUS_06580 gene upp 5492 6124 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858289.1 protein_id gnl|my_center|LOCUS_06580 8593 6314 gene locus_tag LOCUS_06590 8593 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 9392 8865 gene locus_tag LOCUS_06600 9392 8865 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224765.1 protein_id gnl|my_center|LOCUS_06600 9501 10541 gene locus_tag LOCUS_06610 9501 10541 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_06610 11240 10605 gene locus_tag LOCUS_06620 11240 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 11574 12593 gene locus_tag LOCUS_06630 11574 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 12645 13160 gene locus_tag LOCUS_06640 12645 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 15348 13120 gene locus_tag LOCUS_06650 gene katG 15348 13120 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_06650 15874 15341 gene locus_tag LOCUS_06660 gene furA3 15874 15341 CDS product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_06660 16000 16320 gene locus_tag LOCUS_06670 16000 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 16374 17030 gene locus_tag LOCUS_06680 16374 17030 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_06680 18014 17082 gene locus_tag LOCUS_06690 18014 17082 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527598.1 protein_id gnl|my_center|LOCUS_06690 19442 18117 gene locus_tag LOCUS_06700 19442 18117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 19521 20573 gene locus_tag LOCUS_06710 19521 20573 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793191.1 protein_id gnl|my_center|LOCUS_06710 23131 20597 gene locus_tag LOCUS_06720 23131 20597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 23393 26140 gene locus_tag LOCUS_06730 23393 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 26134 27825 gene locus_tag LOCUS_06740 26134 27825 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence020 1313 474 gene locus_tag LOCUS_06750 gene trpC 1313 474 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_06750 2370 1411 gene locus_tag LOCUS_06760 2370 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3956 2367 gene locus_tag LOCUS_06770 gene trpE 3956 2367 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826697.1 protein_id gnl|my_center|LOCUS_06770 4384 3956 gene locus_tag LOCUS_06780 4384 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4674 4381 gene locus_tag LOCUS_06790 4674 4381 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_06790 4679 4840 gene locus_tag LOCUS_06800 4679 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4938 5651 gene locus_tag LOCUS_06810 4938 5651 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_06810 6478 5711 gene locus_tag LOCUS_06820 gene hisF 6478 5711 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728898.1 protein_id gnl|my_center|LOCUS_06820 7221 6460 gene locus_tag LOCUS_06830 gene hisA 7221 6460 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337342.1 protein_id gnl|my_center|LOCUS_06830 7715 7221 gene locus_tag LOCUS_06840 gene hisH 7715 7221 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887071.1 protein_id gnl|my_center|LOCUS_06840 8482 7862 gene locus_tag LOCUS_06850 gene hisB 8482 7862 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_06850 9552 8479 gene locus_tag LOCUS_06860 9552 8479 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_06860 10856 9549 gene locus_tag LOCUS_06870 gene hisD 10856 9549 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402931.1 protein_id gnl|my_center|LOCUS_06870 11001 11204 gene locus_tag LOCUS_06880 11001 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 11670 11278 gene locus_tag LOCUS_06890 11670 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 12116 11667 gene locus_tag LOCUS_06900 12116 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 12801 12169 gene locus_tag LOCUS_06910 gene nth 12801 12169 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419724.1 protein_id gnl|my_center|LOCUS_06910 12971 13921 gene locus_tag LOCUS_06920 gene mshD 12971 13921 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_06920 14628 13885 gene locus_tag LOCUS_06930 14628 13885 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_06930 14682 15032 gene locus_tag LOCUS_06940 14682 15032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 15066 15524 gene locus_tag LOCUS_06950 15066 15524 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_06950 15521 16228 gene locus_tag LOCUS_06960 gene ubiE 15521 16228 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_06960 16240 17604 gene locus_tag LOCUS_06970 16240 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 19084 17549 gene locus_tag LOCUS_06980 19084 17549 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_06980 19786 19094 gene locus_tag LOCUS_06990 19786 19094 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_06990 20673 19783 gene locus_tag LOCUS_07000 20673 19783 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_07000 20672 21880 gene locus_tag LOCUS_07010 20672 21880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 24276 21895 gene locus_tag LOCUS_07020 24276 21895 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893757.1 protein_id gnl|my_center|LOCUS_07020 24362 25654 gene locus_tag LOCUS_07030 24362 25654 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 protein_id gnl|my_center|LOCUS_07030 26309 25671 gene locus_tag LOCUS_07040 26309 25671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 27442 26315 gene locus_tag LOCUS_07050 gene rodA 27442 26315 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_07050 <28037 27520 gene locus_tag LOCUS_07060 <28037 27520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143268.1:shikimate dehydrogenase >Feature sequence021 2433 883 gene locus_tag LOCUS_07070 2433 883 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 protein_id gnl|my_center|LOCUS_07070 2833 2435 gene locus_tag LOCUS_07080 2833 2435 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_07080 3603 2830 gene locus_tag LOCUS_07090 3603 2830 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233048.1 protein_id gnl|my_center|LOCUS_07090 4240 3617 gene locus_tag LOCUS_07100 4240 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5500 4343 gene locus_tag LOCUS_07110 gene moeB 5500 4343 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_07110 5576 6238 gene locus_tag LOCUS_07120 5576 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 7316 6342 gene locus_tag LOCUS_07130 7316 6342 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606051.1 protein_id gnl|my_center|LOCUS_07130 8335 7304 gene locus_tag LOCUS_07140 gene pdhA 8335 7304 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_07140 9547 8456 gene locus_tag LOCUS_07150 9547 8456 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_07150 9616 10683 gene locus_tag LOCUS_07160 9616 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 11522 10707 gene locus_tag LOCUS_07170 11522 10707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938017.1 protein_id gnl|my_center|LOCUS_07170 12315 11503 gene locus_tag LOCUS_07180 12315 11503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083875.1 protein_id gnl|my_center|LOCUS_07180 13430 12312 gene locus_tag LOCUS_07190 13430 12312 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_07190 14308 13427 gene locus_tag LOCUS_07200 14308 13427 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_07200 15612 14314 gene locus_tag LOCUS_07210 15612 14314 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_07210 16789 15692 gene locus_tag LOCUS_07220 16789 15692 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728195.1 protein_id gnl|my_center|LOCUS_07220 17970 16858 gene locus_tag LOCUS_07230 17970 16858 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_07230 19308 19991 gene locus_tag LOCUS_07240 19308 19991 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_07240 19988 21364 gene locus_tag LOCUS_07250 19988 21364 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_07250 21361 21960 gene locus_tag LOCUS_07260 21361 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 22898 22005 gene locus_tag LOCUS_07270 22898 22005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 23421 23206 gene locus_tag LOCUS_07280 23421 23206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 23842 24003 gene locus_tag LOCUS_07290 23842 24003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 24138 24437 gene locus_tag LOCUS_07300 24138 24437 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406322.1 protein_id gnl|my_center|LOCUS_07300 24434 24709 gene locus_tag LOCUS_07310 24434 24709 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_07310 25090 24839 gene locus_tag LOCUS_07320 25090 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 25914 25045 gene locus_tag LOCUS_07330 25914 25045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07330 26216 26527 gene locus_tag LOCUS_07340 26216 26527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 26524 26814 gene locus_tag LOCUS_07350 26524 26814 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_07350 27350 27021 gene locus_tag LOCUS_07360 27350 27021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence022 137 1555 gene locus_tag LOCUS_07370 137 1555 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257998.1 protein_id gnl|my_center|LOCUS_07370 1558 2487 gene locus_tag LOCUS_07380 1558 2487 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338663.1 protein_id gnl|my_center|LOCUS_07380 2516 3691 gene locus_tag LOCUS_07390 2516 3691 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_07390 3694 4191 gene locus_tag LOCUS_07400 3694 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 4253 4696 gene locus_tag LOCUS_07410 4253 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4707 5981 gene locus_tag LOCUS_07420 4707 5981 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429682.1 protein_id gnl|my_center|LOCUS_07420 6008 7069 gene locus_tag LOCUS_07430 6008 7069 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053875.1 protein_id gnl|my_center|LOCUS_07430 7743 7078 gene locus_tag LOCUS_07440 7743 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 8117 8413 gene locus_tag LOCUS_07450 8117 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 8470 8823 gene locus_tag LOCUS_07460 8470 8823 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898051.1 protein_id gnl|my_center|LOCUS_07460 11823 8914 gene locus_tag LOCUS_07470 11823 8914 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_07470 12121 15030 gene locus_tag LOCUS_07480 12121 15030 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224374.1 protein_id gnl|my_center|LOCUS_07480 15027 16424 gene locus_tag LOCUS_07490 15027 16424 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224375.1 protein_id gnl|my_center|LOCUS_07490 17273 16506 gene locus_tag LOCUS_07500 17273 16506 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_07500 17984 18295 gene locus_tag LOCUS_07510 17984 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 18292 19536 gene locus_tag LOCUS_07520 18292 19536 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_07520 19533 20261 gene locus_tag LOCUS_07530 19533 20261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 20266 20580 gene locus_tag LOCUS_07540 20266 20580 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_07540 20604 21113 gene locus_tag LOCUS_07550 20604 21113 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_07550 22010 21552 gene locus_tag LOCUS_07560 22010 21552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 22255 22578 gene locus_tag LOCUS_07570 22255 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 22618 22830 gene locus_tag LOCUS_07580 22618 22830 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_07580 22827 23072 gene locus_tag LOCUS_07590 22827 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 23771 23244 gene locus_tag LOCUS_07600 23771 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 23655 23921 gene locus_tag LOCUS_07610 23655 23921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 24279 24659 gene locus_tag LOCUS_07620 24279 24659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 24656 24868 gene locus_tag LOCUS_07630 24656 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 25407 25072 gene locus_tag LOCUS_07640 25407 25072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 25640 25404 gene locus_tag LOCUS_07650 25640 25404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence023 1487 6 gene locus_tag LOCUS_07660 1487 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4218 1501 gene locus_tag LOCUS_07670 4218 1501 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_07670 7903 4418 gene locus_tag LOCUS_07680 7903 4418 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_07680 9039 7951 gene locus_tag LOCUS_07690 9039 7951 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 protein_id gnl|my_center|LOCUS_07690 9710 9060 gene locus_tag LOCUS_07700 9710 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 9939 11192 gene locus_tag LOCUS_07710 9939 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 11202 12197 gene locus_tag LOCUS_07720 11202 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 12190 13725 gene locus_tag LOCUS_07730 12190 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 13709 14185 gene locus_tag LOCUS_07740 13709 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 14733 14455 gene locus_tag LOCUS_07750 14733 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 15065 14760 gene locus_tag LOCUS_07760 15065 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 16206 15079 gene locus_tag LOCUS_07770 16206 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 17148 16351 gene locus_tag LOCUS_07780 17148 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 18893 17139 gene locus_tag LOCUS_07790 18893 17139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 19966 18968 gene locus_tag LOCUS_07800 19966 18968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029465.1 protein_id gnl|my_center|LOCUS_07800 20865 19954 gene locus_tag LOCUS_07810 20865 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 21437 20862 gene locus_tag LOCUS_07820 21437 20862 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029464.1 protein_id gnl|my_center|LOCUS_07820 23257 21509 gene locus_tag LOCUS_07830 23257 21509 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088606.1 protein_id gnl|my_center|LOCUS_07830 23151 23885 gene locus_tag LOCUS_07840 23151 23885 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224827.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence024 1309 1497 gene locus_tag LOCUS_07850 1309 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1497 1844 gene locus_tag LOCUS_07860 1497 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1841 2158 gene locus_tag LOCUS_07870 1841 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2340 2600 gene locus_tag LOCUS_07880 2340 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929158.1 protein_id gnl|my_center|LOCUS_07880 3371 2649 gene locus_tag LOCUS_07890 3371 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3377 4807 gene locus_tag LOCUS_07900 3377 4807 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_07900 4930 5760 gene locus_tag LOCUS_07910 4930 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6139 6627 gene locus_tag LOCUS_07920 6139 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 7744 6725 gene locus_tag LOCUS_07930 7744 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7743 8420 gene locus_tag LOCUS_07940 7743 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 8423 9058 gene locus_tag LOCUS_07950 8423 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 10114 9218 gene locus_tag LOCUS_07960 10114 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 11697 10630 gene locus_tag LOCUS_07970 11697 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 11839 12897 gene locus_tag LOCUS_07980 gene recA 11839 12897 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938389.1 protein_id gnl|my_center|LOCUS_07980 13090 13410 gene locus_tag LOCUS_07990 13090 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 13488 15089 gene locus_tag LOCUS_08000 13488 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 15086 17884 gene locus_tag LOCUS_08010 15086 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 17881 18723 gene locus_tag LOCUS_08020 17881 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 18756 19553 gene locus_tag LOCUS_08030 18756 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 19627 21723 gene locus_tag LOCUS_08040 19627 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 21720 22124 gene locus_tag LOCUS_08050 21720 22124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 22220 23176 gene locus_tag LOCUS_08060 22220 23176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 23140 23619 gene locus_tag LOCUS_08070 23140 23619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence025 210 392 gene locus_tag LOCUS_08080 210 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1626 649 gene locus_tag LOCUS_08090 gene etfA 1626 649 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398999.1 protein_id gnl|my_center|LOCUS_08090 2408 1623 gene locus_tag LOCUS_08100 2408 1623 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728286.1 protein_id gnl|my_center|LOCUS_08100 4462 2408 gene locus_tag LOCUS_08110 gene dgcA 4462 2408 CDS product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 protein_id gnl|my_center|LOCUS_08110 5646 4459 gene locus_tag LOCUS_08120 5646 4459 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_08120 6617 5646 gene locus_tag LOCUS_08130 6617 5646 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_08130 7702 6674 gene locus_tag LOCUS_08140 7702 6674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_08140 9239 7695 gene locus_tag LOCUS_08150 9239 7695 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258152.1 protein_id gnl|my_center|LOCUS_08150 9828 9412 gene locus_tag LOCUS_08160 9828 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10890 9877 gene locus_tag LOCUS_08170 10890 9877 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_08170 10950 10855 gene locus_tag LOCUS_t00070 10950 10855 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11914 11042 gene locus_tag LOCUS_08180 11914 11042 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_08180 12754 11915 gene locus_tag LOCUS_08190 12754 11915 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_08190 14004 12880 gene locus_tag LOCUS_08200 gene rhaS 14004 12880 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978052.1 protein_id gnl|my_center|LOCUS_08200 15135 14092 gene locus_tag LOCUS_08210 15135 14092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 protein_id gnl|my_center|LOCUS_08210 16972 15596 gene locus_tag LOCUS_08220 16972 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 17056 17463 gene locus_tag LOCUS_08230 17056 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 18914 17580 gene locus_tag LOCUS_08240 18914 17580 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_08240 19172 21283 gene locus_tag LOCUS_08250 19172 21283 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_08250 21498 22076 gene locus_tag LOCUS_08260 21498 22076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 21971 22420 gene locus_tag LOCUS_08270 21971 22420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227620.1 protein_id gnl|my_center|LOCUS_08270 23447 22434 gene locus_tag LOCUS_08280 23447 22434 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence026 2228 1350 gene locus_tag LOCUS_08290 2228 1350 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_08290 3848 2343 gene locus_tag LOCUS_08300 3848 2343 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950337.1 protein_id gnl|my_center|LOCUS_08300 5305 3845 gene locus_tag LOCUS_08310 5305 3845 CDS product hydrogenase HycQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400662.1 protein_id gnl|my_center|LOCUS_08310 5964 5305 gene locus_tag LOCUS_08320 5964 5305 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_08320 6947 5961 gene locus_tag LOCUS_08330 6947 5961 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_08330 8962 6944 gene locus_tag LOCUS_08340 8962 6944 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_08340 9420 8959 gene locus_tag LOCUS_08350 9420 8959 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_08350 9998 9624 gene locus_tag LOCUS_08360 9998 9624 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_08360 11025 10162 gene locus_tag LOCUS_08370 gene fdhD 11025 10162 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_08370 11942 11022 gene locus_tag LOCUS_08380 gene nrfD 11942 11022 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459139.1 protein_id gnl|my_center|LOCUS_08380 12570 11962 gene locus_tag LOCUS_08390 12570 11962 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_08390 15176 12567 gene locus_tag LOCUS_08400 15176 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15784 15269 gene locus_tag LOCUS_08410 15784 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15994 15788 gene locus_tag LOCUS_08420 15994 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 16503 15994 gene locus_tag LOCUS_08430 16503 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08430 16734 16573 gene locus_tag LOCUS_08440 16734 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 16799 17173 gene locus_tag LOCUS_08450 16799 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 17747 17280 gene locus_tag LOCUS_08460 17747 17280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 18137 17793 gene locus_tag LOCUS_08470 18137 17793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 18460 18134 gene locus_tag LOCUS_08480 18460 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 19317 18436 gene locus_tag LOCUS_08490 19317 18436 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971751.1 protein_id gnl|my_center|LOCUS_08490 19713 20600 gene locus_tag LOCUS_08500 19713 20600 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526233.1 protein_id gnl|my_center|LOCUS_08500 20597 21589 gene locus_tag LOCUS_08510 20597 21589 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_08510 21586 22494 gene locus_tag LOCUS_08520 21586 22494 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_08520 22491 23390 gene locus_tag LOCUS_08530 22491 23390 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730998.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence027 1291 1923 gene locus_tag LOCUS_08540 1291 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2085 2768 gene locus_tag LOCUS_08550 2085 2768 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_08550 2872 4209 gene locus_tag LOCUS_08560 2872 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4512 5657 gene locus_tag LOCUS_08570 4512 5657 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_08570 6922 5666 gene locus_tag LOCUS_08580 6922 5666 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_08580 7506 6970 gene locus_tag LOCUS_08590 7506 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7527 9785 gene locus_tag LOCUS_08600 7527 9785 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_08600 10346 9822 gene locus_tag LOCUS_08610 10346 9822 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971468.1 protein_id gnl|my_center|LOCUS_08610 10969 10343 gene locus_tag LOCUS_08620 10969 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 11047 12018 gene locus_tag LOCUS_08630 11047 12018 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_08630 12299 12072 gene locus_tag LOCUS_08640 12299 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 12198 12539 gene locus_tag LOCUS_08650 12198 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 12536 13531 gene locus_tag LOCUS_08660 gene rsmI 12536 13531 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_08660 13521 15173 gene locus_tag LOCUS_08670 gene metG 13521 15173 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869940.1 protein_id gnl|my_center|LOCUS_08670 15178 16131 gene locus_tag LOCUS_08680 15178 16131 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_08680 16161 16943 gene locus_tag LOCUS_08690 gene rsmA 16161 16943 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 protein_id gnl|my_center|LOCUS_08690 16922 17791 gene locus_tag LOCUS_08700 16922 17791 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_08700 19685 18315 gene locus_tag LOCUS_08710 19685 18315 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 protein_id gnl|my_center|LOCUS_08710 20374 19703 gene locus_tag LOCUS_08720 20374 19703 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_08720 20588 20661 gene locus_tag LOCUS_t00080 20588 20661 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20929 21399 gene locus_tag LOCUS_08730 20929 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 23223 21334 gene locus_tag LOCUS_08740 23223 21334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence028 <1 658 gene locus_tag LOCUS_08750 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_092005623.1:transketolase 655 1731 gene locus_tag LOCUS_08760 gene tal 655 1731 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_08760 1766 3403 gene locus_tag LOCUS_08770 gene pgi 1766 3403 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_08770 3403 4434 gene locus_tag LOCUS_08780 gene gnd 3403 4434 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_08780 5180 4527 gene locus_tag LOCUS_08790 gene rpiA 5180 4527 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920162.1 protein_id gnl|my_center|LOCUS_08790 5403 6842 gene locus_tag LOCUS_08800 gene zwf 5403 6842 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_08800 6839 7702 gene locus_tag LOCUS_08810 6839 7702 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729831.1 protein_id gnl|my_center|LOCUS_08810 7699 9984 gene locus_tag LOCUS_08820 7699 9984 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_08820 11112 10012 gene locus_tag LOCUS_08830 11112 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 11623 11210 gene locus_tag LOCUS_08840 11623 11210 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877101.1 protein_id gnl|my_center|LOCUS_08840 11622 13037 gene locus_tag LOCUS_08850 11622 13037 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978673.1 protein_id gnl|my_center|LOCUS_08850 13577 13065 gene locus_tag LOCUS_08860 13577 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 14494 13766 gene locus_tag LOCUS_08870 14494 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 15054 14491 gene locus_tag LOCUS_08880 15054 14491 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224600.1 protein_id gnl|my_center|LOCUS_08880 15168 15785 gene locus_tag LOCUS_08890 15168 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 16032 15766 gene locus_tag LOCUS_08900 16032 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 17040 16630 gene locus_tag LOCUS_08910 17040 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 18090 17641 gene locus_tag LOCUS_08920 18090 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_08920 18327 19448 gene locus_tag LOCUS_08930 18327 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 19672 19454 gene locus_tag LOCUS_08940 19672 19454 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_08940 19878 19669 gene locus_tag LOCUS_08950 19878 19669 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_08950 20452 20057 gene locus_tag LOCUS_08960 20452 20057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 20661 20452 gene locus_tag LOCUS_08970 20661 20452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 20832 20758 gene locus_tag LOCUS_t00090 20832 20758 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 21935 20898 gene locus_tag LOCUS_08980 21935 20898 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_08980 22138 22698 gene locus_tag LOCUS_08990 22138 22698 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence029 146 484 gene locus_tag LOCUS_09000 146 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 494 763 gene locus_tag LOCUS_09010 494 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3437 1956 gene locus_tag LOCUS_09020 3437 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4233 3658 gene locus_tag LOCUS_09030 4233 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4586 4302 gene locus_tag LOCUS_09040 4586 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4482 5813 gene locus_tag LOCUS_09050 4482 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 7269 6262 gene locus_tag LOCUS_09060 7269 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 7391 7819 gene locus_tag LOCUS_09070 7391 7819 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_09070 7828 9303 gene locus_tag LOCUS_09080 7828 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 9309 10340 gene locus_tag LOCUS_09090 9309 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 10454 10795 gene locus_tag LOCUS_09100 10454 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 12168 10990 gene locus_tag LOCUS_09110 12168 10990 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826413.1 protein_id gnl|my_center|LOCUS_09110 15676 12305 gene locus_tag LOCUS_09120 15676 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 15798 16583 gene locus_tag LOCUS_09130 15798 16583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 16534 16836 gene locus_tag LOCUS_09140 16534 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 17310 16885 gene locus_tag LOCUS_09150 17310 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 17410 18222 gene locus_tag LOCUS_09160 17410 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 19111 18620 gene locus_tag LOCUS_09170 19111 18620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 19312 19133 gene locus_tag LOCUS_09180 19312 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 <22599 19744 gene locus_tag LOCUS_09190 <22599 19744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228224.1:DNA translocase FtsK >Feature sequence030 648 232 gene locus_tag LOCUS_09200 648 232 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_09200 835 1521 gene locus_tag LOCUS_09210 835 1521 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898328.1 protein_id gnl|my_center|LOCUS_09210 1558 2670 gene locus_tag LOCUS_09220 1558 2670 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_09220 4147 2675 gene locus_tag LOCUS_09230 4147 2675 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_09230 4249 6288 gene locus_tag LOCUS_09240 4249 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 6507 8429 gene locus_tag LOCUS_09250 6507 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 8504 9352 gene locus_tag LOCUS_09260 8504 9352 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_09260 9376 9777 gene locus_tag LOCUS_09270 9376 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 9785 10744 gene locus_tag LOCUS_09280 gene trxB 9785 10744 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_09280 10860 11222 gene locus_tag LOCUS_09290 gene trxA 10860 11222 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400164.1 protein_id gnl|my_center|LOCUS_09290 11228 12226 gene locus_tag LOCUS_09300 11228 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 13386 12391 gene locus_tag LOCUS_09310 13386 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 14479 13361 gene locus_tag LOCUS_09320 14479 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 15132 15617 gene locus_tag LOCUS_09330 15132 15617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 16543 15875 gene locus_tag LOCUS_09340 16543 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 17100 16624 gene locus_tag LOCUS_09350 17100 16624 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467902.1 protein_id gnl|my_center|LOCUS_09350 17420 17226 gene locus_tag LOCUS_09360 17420 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 18880 17663 gene locus_tag LOCUS_09370 18880 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 19203 18877 gene locus_tag LOCUS_09380 19203 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 19580 19203 gene locus_tag LOCUS_09390 19580 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 19803 19618 gene locus_tag LOCUS_09400 19803 19618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 19996 21465 gene locus_tag LOCUS_09410 gene dnaA 19996 21465 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950320.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence031 1032 382 gene locus_tag LOCUS_09420 1032 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1411 2583 gene locus_tag LOCUS_09430 1411 2583 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_09430 2580 3425 gene locus_tag LOCUS_09440 2580 3425 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284934.1 protein_id gnl|my_center|LOCUS_09440 5214 3496 gene locus_tag LOCUS_09450 5214 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10197 6256 gene locus_tag LOCUS_09460 10197 6256 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_09460 11483 10197 gene locus_tag LOCUS_09470 11483 10197 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_09470 13488 11608 gene locus_tag LOCUS_09480 13488 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 13733 15004 gene locus_tag LOCUS_09490 13733 15004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 15987 15064 gene locus_tag LOCUS_09500 15987 15064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_09500 16934 15984 gene locus_tag LOCUS_09510 16934 15984 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_09510 18451 16934 gene locus_tag LOCUS_09520 18451 16934 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_09520 19809 18457 gene locus_tag LOCUS_09530 gene lysA 19809 18457 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109975.1 protein_id gnl|my_center|LOCUS_09530 19873 21582 gene locus_tag LOCUS_09540 19873 21582 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence032 498 43 gene locus_tag LOCUS_09550 498 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1055 609 gene locus_tag LOCUS_09560 1055 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 4971 2761 gene locus_tag LOCUS_09570 4971 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 6287 4983 gene locus_tag LOCUS_09580 6287 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 9532 6335 gene locus_tag LOCUS_09590 9532 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 11050 9638 gene locus_tag LOCUS_09600 11050 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 11695 11081 gene locus_tag LOCUS_09610 11695 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 11936 15682 gene locus_tag LOCUS_09620 11936 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 15874 16077 gene locus_tag LOCUS_09630 15874 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 16191 19523 gene locus_tag LOCUS_09640 16191 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 19520 20098 gene locus_tag LOCUS_09650 19520 20098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence033 40 116 gene locus_tag LOCUS_t00100 40 116 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1752 73 gene locus_tag LOCUS_09660 1752 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2883 2047 gene locus_tag LOCUS_09670 2883 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3832 2873 gene locus_tag LOCUS_09680 3832 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4003 4554 gene locus_tag LOCUS_09690 4003 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4874 5776 gene locus_tag LOCUS_09700 4874 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5780 6271 gene locus_tag LOCUS_09710 5780 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 6271 7548 gene locus_tag LOCUS_09720 6271 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7578 8510 gene locus_tag LOCUS_09730 7578 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 8524 10296 gene locus_tag LOCUS_09740 8524 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 10385 12961 gene locus_tag LOCUS_09750 10385 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 13173 14048 gene locus_tag LOCUS_09760 13173 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 14045 15022 gene locus_tag LOCUS_09770 14045 15022 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_09770 16535 15072 gene locus_tag LOCUS_09780 16535 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 17487 16804 gene locus_tag LOCUS_09790 17487 16804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_09790 18961 17465 gene locus_tag LOCUS_09800 18961 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 19476 19078 gene locus_tag LOCUS_09810 19476 19078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 21131 19476 gene locus_tag LOCUS_09820 21131 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence034 <1 558 gene locus_tag LOCUS_09830 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003859220.1:ATP-dependent Clp protease proteolytic subunit 561 1547 gene locus_tag LOCUS_09840 561 1547 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776099.1 protein_id gnl|my_center|LOCUS_09840 1548 3005 gene locus_tag LOCUS_09850 1548 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3002 3994 gene locus_tag LOCUS_09860 3002 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 4004 5209 gene locus_tag LOCUS_09870 4004 5209 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695838.1 protein_id gnl|my_center|LOCUS_09870 5236 6393 gene locus_tag LOCUS_09880 5236 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6390 7685 gene locus_tag LOCUS_09890 6390 7685 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_09890 7766 8005 gene locus_tag LOCUS_09900 7766 8005 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879121.1 protein_id gnl|my_center|LOCUS_09900 8061 8612 gene locus_tag LOCUS_09910 8061 8612 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227068.1 protein_id gnl|my_center|LOCUS_09910 8609 11008 gene locus_tag LOCUS_09920 8609 11008 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_09920 11005 11832 gene locus_tag LOCUS_09930 11005 11832 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_09930 11912 12862 gene locus_tag LOCUS_09940 11912 12862 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388723.1 protein_id gnl|my_center|LOCUS_09940 12865 14085 gene locus_tag LOCUS_09950 12865 14085 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_09950 14082 15236 gene locus_tag LOCUS_09960 14082 15236 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401873.1 protein_id gnl|my_center|LOCUS_09960 15294 15944 gene locus_tag LOCUS_09970 15294 15944 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978539.1 protein_id gnl|my_center|LOCUS_09970 15935 16114 gene locus_tag LOCUS_09980 15935 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 16099 16494 gene locus_tag LOCUS_09990 16099 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 17625 16555 gene locus_tag LOCUS_10000 gene moaA 17625 16555 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_10000 18240 17773 gene locus_tag LOCUS_10010 gene mog 18240 17773 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_10010 18988 18359 gene locus_tag LOCUS_10020 18988 18359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 19172 19097 gene locus_tag LOCUS_t00110 19172 19097 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 19658 19344 gene locus_tag LOCUS_10030 19658 19344 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_10030 19866 19940 gene locus_tag LOCUS_t00120 19866 19940 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 1546 191 gene locus_tag LOCUS_10040 1546 191 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727859.1 protein_id gnl|my_center|LOCUS_10040 2074 1640 gene locus_tag LOCUS_10050 2074 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2763 2071 gene locus_tag LOCUS_10060 2763 2071 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 protein_id gnl|my_center|LOCUS_10060 3792 2995 gene locus_tag LOCUS_10070 gene larE 3792 2995 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_10070 4652 3846 gene locus_tag LOCUS_10080 4652 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 6387 4768 gene locus_tag LOCUS_10090 gene groL 6387 4768 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_10090 7039 6761 gene locus_tag LOCUS_10100 7039 6761 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_10100 8298 7030 gene locus_tag LOCUS_10110 gene thrC 8298 7030 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 protein_id gnl|my_center|LOCUS_10110 8598 9425 gene locus_tag LOCUS_10120 8598 9425 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908106.1 protein_id gnl|my_center|LOCUS_10120 9431 10837 gene locus_tag LOCUS_10130 9431 10837 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_10130 12050 10917 gene locus_tag LOCUS_10140 12050 10917 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_10140 13743 12055 gene locus_tag LOCUS_10150 13743 12055 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_10150 14626 13769 gene locus_tag LOCUS_10160 14626 13769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 14919 14644 gene locus_tag LOCUS_10170 14919 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 16242 15337 gene locus_tag LOCUS_10180 gene rlmB 16242 15337 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_10180 16718 16239 gene locus_tag LOCUS_10190 gene ispF 16718 16239 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393963.1 protein_id gnl|my_center|LOCUS_10190 17380 16712 gene locus_tag LOCUS_10200 gene ispD 17380 16712 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731019.1 protein_id gnl|my_center|LOCUS_10200 17886 17410 gene locus_tag LOCUS_10210 17886 17410 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_10210 19272 18013 gene locus_tag LOCUS_10220 gene disA 19272 18013 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_10220 <20636 19306 gene locus_tag LOCUS_10230 <20636 19306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975461.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence036 13 122 gene locus_tag LOCUS_r00010 13 122 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 903 214 gene locus_tag LOCUS_10240 903 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1067 2635 gene locus_tag LOCUS_10250 1067 2635 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 protein_id gnl|my_center|LOCUS_10250 3384 2632 gene locus_tag LOCUS_10260 3384 2632 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889268.1 protein_id gnl|my_center|LOCUS_10260 4406 3381 gene locus_tag LOCUS_10270 4406 3381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223406.1 protein_id gnl|my_center|LOCUS_10270 4939 5733 gene locus_tag LOCUS_10280 4939 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5760 6815 gene locus_tag LOCUS_10290 5760 6815 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_10290 6901 8799 gene locus_tag LOCUS_10300 6901 8799 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_10300 8796 9818 gene locus_tag LOCUS_10310 8796 9818 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_10310 11091 9865 gene locus_tag LOCUS_10320 11091 9865 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_10320 11134 11832 gene locus_tag LOCUS_10330 11134 11832 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_10330 11829 14315 gene locus_tag LOCUS_10340 11829 14315 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_10340 14419 14799 gene locus_tag LOCUS_10350 gene gcvH 14419 14799 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_10350 14866 15351 gene locus_tag LOCUS_10360 14866 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 15362 16684 gene locus_tag LOCUS_10370 15362 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 16730 17236 gene locus_tag LOCUS_10380 16730 17236 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_10380 18285 17290 gene locus_tag LOCUS_10390 18285 17290 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807763.1 protein_id gnl|my_center|LOCUS_10390 18403 19779 gene locus_tag LOCUS_10400 18403 19779 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224729.1 protein_id gnl|my_center|LOCUS_10400 20390 19755 gene locus_tag LOCUS_10410 20390 19755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence037 381 3083 gene locus_tag LOCUS_10420 381 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4186 3014 gene locus_tag LOCUS_10430 4186 3014 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_10430 5733 4183 gene locus_tag LOCUS_10440 5733 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 6494 5733 gene locus_tag LOCUS_10450 6494 5733 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_10450 6702 8456 gene locus_tag LOCUS_10460 6702 8456 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_10460 8461 9903 gene locus_tag LOCUS_10470 8461 9903 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229625.1 protein_id gnl|my_center|LOCUS_10470 9900 11444 gene locus_tag LOCUS_10480 9900 11444 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_10480 12278 11496 gene locus_tag LOCUS_10490 12278 11496 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 protein_id gnl|my_center|LOCUS_10490 12700 12281 gene locus_tag LOCUS_10500 gene fabZ 12700 12281 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_10500 14295 12742 gene locus_tag LOCUS_10510 14295 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 18339 14323 gene locus_tag LOCUS_10520 18339 14323 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_10520 19474 18509 gene locus_tag LOCUS_10530 19474 18509 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_10530 20360 19518 gene locus_tag LOCUS_10540 20360 19518 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence038 <1 1988 gene locus_tag LOCUS_10550 <1 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938574.1:ATP-dependent zinc metalloprotease FtsH 3257 2034 gene locus_tag LOCUS_10560 3257 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 6826 3509 gene locus_tag LOCUS_10570 6826 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 6993 7352 gene locus_tag LOCUS_10580 6993 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 8245 7328 gene locus_tag LOCUS_10590 8245 7328 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_10590 9403 8267 gene locus_tag LOCUS_10600 9403 8267 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_10600 10524 9400 gene locus_tag LOCUS_10610 10524 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 11645 10521 gene locus_tag LOCUS_10620 11645 10521 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_10620 11232 11141 gene locus_tag LOCUS_t00130 11232 11141 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12537 11638 gene locus_tag LOCUS_10630 12537 11638 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224592.1 protein_id gnl|my_center|LOCUS_10630 13798 12623 gene locus_tag LOCUS_10640 13798 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 14107 15648 gene locus_tag LOCUS_10650 gene glpK 14107 15648 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_10650 15893 17665 gene locus_tag LOCUS_10660 15893 17665 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_10660 17788 18747 gene locus_tag LOCUS_10670 17788 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 18800 19747 gene locus_tag LOCUS_10680 gene cofD 18800 19747 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence039 1436 609 gene locus_tag LOCUS_10690 1436 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_10690 1588 3102 gene locus_tag LOCUS_10700 1588 3102 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_10700 3104 5107 gene locus_tag LOCUS_10710 3104 5107 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_10710 5308 5589 gene locus_tag LOCUS_10720 5308 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6342 5599 gene locus_tag LOCUS_10730 6342 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10730 6822 6565 gene locus_tag LOCUS_10740 6822 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 6988 7269 gene locus_tag LOCUS_10750 6988 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 8489 7320 gene locus_tag LOCUS_10760 8489 7320 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230475.1 protein_id gnl|my_center|LOCUS_10760 9519 8500 gene locus_tag LOCUS_10770 9519 8500 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085506.1 protein_id gnl|my_center|LOCUS_10770 9707 10711 gene locus_tag LOCUS_10780 9707 10711 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_10780 11455 10781 gene locus_tag LOCUS_10790 11455 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 11465 12706 gene locus_tag LOCUS_10800 11465 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 12717 15035 gene locus_tag LOCUS_10810 12717 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 15063 18239 gene locus_tag LOCUS_10820 15063 18239 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_10820 18344 18682 gene locus_tag LOCUS_10830 18344 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 18737 18813 gene locus_tag LOCUS_t00140 18737 18813 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 20049 19084 gene locus_tag LOCUS_10840 20049 19084 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence040 248 1048 gene locus_tag LOCUS_10850 248 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2078 1578 gene locus_tag LOCUS_10860 2078 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2183 2695 gene locus_tag LOCUS_10870 2183 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2692 3168 gene locus_tag LOCUS_10880 2692 3168 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230086.1 protein_id gnl|my_center|LOCUS_10880 3944 3336 gene locus_tag LOCUS_10890 3944 3336 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_10890 4845 3955 gene locus_tag LOCUS_10900 4845 3955 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091312173.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 5904 5176 gene locus_tag LOCUS_10910 5904 5176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228377.1 protein_id gnl|my_center|LOCUS_10910 6857 5901 gene locus_tag LOCUS_10920 6857 5901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_10920 7403 8314 gene locus_tag LOCUS_10930 7403 8314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892221.1 protein_id gnl|my_center|LOCUS_10930 8311 8613 gene locus_tag LOCUS_10940 8311 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 10145 9597 gene locus_tag LOCUS_10950 10145 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 10775 10365 gene locus_tag LOCUS_10960 10775 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 10850 11275 gene locus_tag LOCUS_10970 10850 11275 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816949.1 protein_id gnl|my_center|LOCUS_10970 11674 11393 gene locus_tag LOCUS_10980 11674 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 11967 11674 gene locus_tag LOCUS_10990 11967 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 12285 13943 gene locus_tag LOCUS_11000 12285 13943 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 protein_id gnl|my_center|LOCUS_11000 14093 14881 gene locus_tag LOCUS_11010 14093 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 14941 15129 gene locus_tag LOCUS_11020 14941 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 15881 15039 gene locus_tag LOCUS_11030 15881 15039 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057901.1 protein_id gnl|my_center|LOCUS_11030 16503 17117 gene locus_tag LOCUS_11040 16503 17117 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225037.1 protein_id gnl|my_center|LOCUS_11040 17114 17593 gene locus_tag LOCUS_11050 17114 17593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 18244 17939 gene locus_tag LOCUS_11060 18244 17939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 18917 18408 gene locus_tag LOCUS_11070 18917 18408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 19340 18930 gene locus_tag LOCUS_11080 19340 18930 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 protein_id gnl|my_center|LOCUS_11080 19507 19983 gene locus_tag LOCUS_11090 19507 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence041 602 333 gene locus_tag LOCUS_11100 602 333 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_11100 795 1301 gene locus_tag LOCUS_11110 795 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1375 1671 gene locus_tag LOCUS_11120 1375 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1730 2443 gene locus_tag LOCUS_11130 1730 2443 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_11130 2826 4586 gene locus_tag LOCUS_11140 gene kdpA 2826 4586 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 protein_id gnl|my_center|LOCUS_11140 4583 6673 gene locus_tag LOCUS_11150 gene kdpB 4583 6673 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_11150 6682 7257 gene locus_tag LOCUS_11160 gene kdpC 6682 7257 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_11160 7254 7583 gene locus_tag LOCUS_11170 7254 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 8511 7597 gene locus_tag LOCUS_11180 8511 7597 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081119.1 protein_id gnl|my_center|LOCUS_11180 9674 8562 gene locus_tag LOCUS_11190 9674 8562 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_11190 9924 10769 gene locus_tag LOCUS_11200 9924 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 10769 11521 gene locus_tag LOCUS_11210 10769 11521 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257507.1 protein_id gnl|my_center|LOCUS_11210 11626 13332 gene locus_tag LOCUS_11220 11626 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 14750 13392 gene locus_tag LOCUS_11230 14750 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 15761 14898 gene locus_tag LOCUS_11240 15761 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 18802 15758 gene locus_tag LOCUS_11250 18802 15758 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_11250 <20110 18799 gene locus_tag LOCUS_11260 <20110 18799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259049.1:polysulfide reductase NrfD >Feature sequence042 1267 659 gene locus_tag LOCUS_11270 1267 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2506 1280 gene locus_tag LOCUS_11280 2506 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2574 2711 gene locus_tag LOCUS_11290 2574 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 5472 2917 gene locus_tag LOCUS_11300 5472 2917 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_11300 5899 5726 gene locus_tag LOCUS_11310 5899 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6120 6971 gene locus_tag LOCUS_11320 6120 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6968 10498 gene locus_tag LOCUS_11330 6968 10498 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_11330 10524 13241 gene locus_tag LOCUS_11340 10524 13241 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_11340 13238 13600 gene locus_tag LOCUS_11350 13238 13600 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_11350 13593 14009 gene locus_tag LOCUS_11360 13593 14009 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393083.1 protein_id gnl|my_center|LOCUS_11360 14127 14627 gene locus_tag LOCUS_11370 14127 14627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 14614 17967 gene locus_tag LOCUS_11380 14614 17967 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_11380 18891 18202 gene locus_tag LOCUS_11390 18891 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence043 1287 988 gene locus_tag LOCUS_11400 1287 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1237 1794 gene locus_tag LOCUS_11410 1237 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2529 3521 gene locus_tag LOCUS_11420 2529 3521 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_11420 3630 4451 gene locus_tag LOCUS_11430 3630 4451 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529194.1 protein_id gnl|my_center|LOCUS_11430 4550 5296 gene locus_tag LOCUS_11440 4550 5296 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_11440 5293 6432 gene locus_tag LOCUS_11450 5293 6432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_11450 6500 8155 gene locus_tag LOCUS_11460 6500 8155 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_11460 9060 8419 gene locus_tag LOCUS_11470 9060 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 9611 9057 gene locus_tag LOCUS_11480 9611 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 11277 9877 gene locus_tag LOCUS_11490 11277 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 12742 11735 gene locus_tag LOCUS_11500 12742 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 14115 13522 gene locus_tag LOCUS_11510 14115 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 14247 14492 gene locus_tag LOCUS_11520 14247 14492 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_11520 14489 14878 gene locus_tag LOCUS_11530 14489 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 15480 16019 gene locus_tag LOCUS_11540 15480 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 16029 16526 gene locus_tag LOCUS_11550 16029 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 17184 18581 gene locus_tag LOCUS_11560 17184 18581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 19442 18909 gene locus_tag LOCUS_11570 19442 18909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 19499 19660 gene locus_tag LOCUS_11580 19499 19660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence044 683 159 gene locus_tag LOCUS_11590 683 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2414 951 gene locus_tag LOCUS_11600 gene proS 2414 951 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_11600 3746 2484 gene locus_tag LOCUS_11610 gene ispG 3746 2484 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_11610 5081 3825 gene locus_tag LOCUS_11620 5081 3825 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_11620 6478 5186 gene locus_tag LOCUS_11630 gene dxr 6478 5186 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921880.1 protein_id gnl|my_center|LOCUS_11630 8376 6535 gene locus_tag LOCUS_11640 8376 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 8961 8392 gene locus_tag LOCUS_11650 gene frr 8961 8392 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081622.1 protein_id gnl|my_center|LOCUS_11650 9689 8961 gene locus_tag LOCUS_11660 gene pyrH 9689 8961 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_11660 10526 9732 gene locus_tag LOCUS_11670 gene tsf 10526 9732 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950794.1 protein_id gnl|my_center|LOCUS_11670 11465 10530 gene locus_tag LOCUS_11680 11465 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 12661 11642 gene locus_tag LOCUS_11690 12661 11642 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804632.1 protein_id gnl|my_center|LOCUS_11690 12701 13387 gene locus_tag LOCUS_11700 12701 13387 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_11700 13452 14885 gene locus_tag LOCUS_11710 13452 14885 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_11710 14882 15517 gene locus_tag LOCUS_11720 14882 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 15911 15552 gene locus_tag LOCUS_11730 gene rsfS 15911 15552 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052031.1 protein_id gnl|my_center|LOCUS_11730 16605 16084 gene locus_tag LOCUS_11740 16605 16084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 16814 18181 gene locus_tag LOCUS_11750 16814 18181 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028829.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence045 1172 2812 gene locus_tag LOCUS_11760 1172 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4491 3082 gene locus_tag LOCUS_11770 4491 3082 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211039795.1 protein_id gnl|my_center|LOCUS_11770 4840 4553 gene locus_tag LOCUS_11780 4840 4553 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067031882.1 protein_id gnl|my_center|LOCUS_11780 5397 4837 gene locus_tag LOCUS_11790 5397 4837 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236074025.1 protein_id gnl|my_center|LOCUS_11790 5469 5723 gene locus_tag LOCUS_11800 5469 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5901 6221 gene locus_tag LOCUS_11810 5901 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6194 6595 gene locus_tag LOCUS_11820 6194 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 8352 7072 gene locus_tag LOCUS_11830 8352 7072 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_11830 8766 8500 gene locus_tag LOCUS_11840 8766 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 9528 10004 gene locus_tag LOCUS_11850 9528 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 10480 10064 gene locus_tag LOCUS_11860 gene vapc11 10480 10064 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_11860 10689 10477 gene locus_tag LOCUS_11870 10689 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 10878 12071 gene locus_tag LOCUS_11880 10878 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 13182 12778 gene locus_tag LOCUS_11890 gene vapC26 13182 12778 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_11890 13869 14519 gene locus_tag LOCUS_11900 13869 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 14516 15238 gene locus_tag LOCUS_11910 14516 15238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 15462 15833 gene locus_tag LOCUS_11920 15462 15833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 16856 18274 gene locus_tag LOCUS_11930 16856 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 18335 18763 gene locus_tag LOCUS_11940 18335 18763 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_11940 <19696 18795 gene locus_tag LOCUS_11950 <19696 18795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013363235.1:phosphoglycerate dehydrogenase >Feature sequence046 1035 2705 gene locus_tag LOCUS_11960 1035 2705 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270376.1 protein_id gnl|my_center|LOCUS_11960 5061 2749 gene locus_tag LOCUS_11970 gene ligA 5061 2749 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813875.1 protein_id gnl|my_center|LOCUS_11970 6191 5058 gene locus_tag LOCUS_11980 gene mnmA 6191 5058 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093979.1 protein_id gnl|my_center|LOCUS_11980 7438 6242 gene locus_tag LOCUS_11990 7438 6242 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_11990 9004 7484 gene locus_tag LOCUS_12000 9004 7484 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027651.1 protein_id gnl|my_center|LOCUS_12000 12411 9199 gene locus_tag LOCUS_12010 gene ileS 12411 9199 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_12010 13760 12471 gene locus_tag LOCUS_12020 13760 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 14765 14037 gene locus_tag LOCUS_12030 gene hxpB 14765 14037 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106833.1 protein_id gnl|my_center|LOCUS_12030 14865 15812 gene locus_tag LOCUS_12040 14865 15812 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191243275.1 protein_id gnl|my_center|LOCUS_12040 15899 16291 gene locus_tag LOCUS_12050 15899 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 16412 16945 gene locus_tag LOCUS_12060 16412 16945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 17033 17641 gene locus_tag LOCUS_12070 17033 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 17557 18102 gene locus_tag LOCUS_12080 17557 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 18399 19193 gene locus_tag LOCUS_12090 18399 19193 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971512.1 protein_id gnl|my_center|LOCUS_12090 19395 19273 gene locus_tag LOCUS_12100 19395 19273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence047 367 1008 gene locus_tag LOCUS_12110 367 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1005 1757 gene locus_tag LOCUS_12120 gene narI 1005 1757 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026935.1 protein_id gnl|my_center|LOCUS_12120 1820 3001 gene locus_tag LOCUS_12130 1820 3001 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776255.1 protein_id gnl|my_center|LOCUS_12130 3166 4185 gene locus_tag LOCUS_12140 3166 4185 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_12140 4282 4743 gene locus_tag LOCUS_12150 4282 4743 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027346.1 protein_id gnl|my_center|LOCUS_12150 5602 4808 gene locus_tag LOCUS_12160 5602 4808 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 protein_id gnl|my_center|LOCUS_12160 5595 6092 gene locus_tag LOCUS_12170 5595 6092 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413574.1 protein_id gnl|my_center|LOCUS_12170 6315 6962 gene locus_tag LOCUS_12180 gene folE 6315 6962 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_12180 7055 7843 gene locus_tag LOCUS_12190 7055 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 7837 9141 gene locus_tag LOCUS_12200 7837 9141 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_12200 10359 9349 gene locus_tag LOCUS_12210 10359 9349 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727807.1 protein_id gnl|my_center|LOCUS_12210 11096 10410 gene locus_tag LOCUS_12220 11096 10410 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259317.1 protein_id gnl|my_center|LOCUS_12220 11636 11241 gene locus_tag LOCUS_12230 11636 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 12840 11761 gene locus_tag LOCUS_12240 gene tal 12840 11761 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_12240 13400 14380 gene locus_tag LOCUS_12250 13400 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 14377 15297 gene locus_tag LOCUS_12260 14377 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 15626 18295 gene locus_tag LOCUS_12270 gene aceE 15626 18295 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911788.1 protein_id gnl|my_center|LOCUS_12270 18928 18716 gene locus_tag LOCUS_12280 18928 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 19098 19020 gene locus_tag LOCUS_t00150 19098 19020 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 <1 1122 gene locus_tag LOCUS_12290 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029332.1:thiol reductant ABC exporter subunit CydD 1148 2380 gene locus_tag LOCUS_12300 1148 2380 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846808.1 protein_id gnl|my_center|LOCUS_12300 2976 2434 gene locus_tag LOCUS_12310 2976 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3761 3033 gene locus_tag LOCUS_12320 3761 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 7170 3784 gene locus_tag LOCUS_12330 7170 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8417 7173 gene locus_tag LOCUS_12340 gene nrfD 8417 7173 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_12340 9470 8481 gene locus_tag LOCUS_12350 9470 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 10866 9622 gene locus_tag LOCUS_12360 10866 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 11468 10863 gene locus_tag LOCUS_12370 11468 10863 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_12370 12781 11504 gene locus_tag LOCUS_12380 12781 11504 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_12380 12961 13092 gene locus_tag LOCUS_12390 12961 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 13216 14418 gene locus_tag LOCUS_12400 13216 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12400 15509 14460 gene locus_tag LOCUS_12410 15509 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 17998 15575 gene locus_tag LOCUS_12420 17998 15575 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_12420 18326 18138 gene locus_tag LOCUS_12430 18326 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 18738 18418 gene locus_tag LOCUS_12440 18738 18418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence049 173 9 gene locus_tag LOCUS_12450 gene rpmG 173 9 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393952.1 protein_id gnl|my_center|LOCUS_12450 296 222 gene locus_tag LOCUS_t00160 296 222 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 373 299 gene locus_tag LOCUS_t00170 373 299 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 400 936 gene locus_tag LOCUS_12460 400 936 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095190.1 protein_id gnl|my_center|LOCUS_12460 2536 983 gene locus_tag LOCUS_12470 2536 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3497 3102 gene locus_tag LOCUS_12480 3497 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 3438 4484 gene locus_tag LOCUS_12490 3438 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4598 6097 gene locus_tag LOCUS_12500 4598 6097 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_12500 6393 6803 gene locus_tag LOCUS_12510 6393 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 6896 8074 gene locus_tag LOCUS_12520 6896 8074 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_12520 7998 8381 gene locus_tag LOCUS_12530 7998 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 8415 8651 gene locus_tag LOCUS_12540 8415 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 8648 9082 gene locus_tag LOCUS_12550 8648 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 9277 9522 gene locus_tag LOCUS_12560 9277 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 9538 9903 gene locus_tag LOCUS_12570 9538 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 10082 9999 gene locus_tag LOCUS_t00180 10082 9999 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 10167 10655 gene locus_tag LOCUS_12580 10167 10655 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402987.1 protein_id gnl|my_center|LOCUS_12580 11267 10722 gene locus_tag LOCUS_12590 11267 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11365 12246 gene locus_tag LOCUS_12600 11365 12246 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_12600 13536 12250 gene locus_tag LOCUS_12610 13536 12250 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_12610 15070 13679 gene locus_tag LOCUS_12620 15070 13679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 16400 15186 gene locus_tag LOCUS_12630 16400 15186 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_12630 18985 16562 gene locus_tag LOCUS_12640 18985 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence050 719 348 gene locus_tag LOCUS_12650 719 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 904 716 gene locus_tag LOCUS_12660 904 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1197 901 gene locus_tag LOCUS_12670 1197 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1256 1537 gene locus_tag LOCUS_12680 1256 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1871 2146 gene locus_tag LOCUS_12690 1871 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2244 2441 gene locus_tag LOCUS_12700 2244 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2438 2707 gene locus_tag LOCUS_12710 2438 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2704 3006 gene locus_tag LOCUS_12720 2704 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3003 3305 gene locus_tag LOCUS_12730 3003 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3302 3541 gene locus_tag LOCUS_12740 3302 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3523 4368 gene locus_tag LOCUS_12750 3523 4368 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338319.1 protein_id gnl|my_center|LOCUS_12750 4365 4580 gene locus_tag LOCUS_12760 4365 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 4577 4885 gene locus_tag LOCUS_12770 4577 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4911 5357 gene locus_tag LOCUS_12780 4911 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5867 5361 gene locus_tag LOCUS_12790 5867 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 6984 5860 gene locus_tag LOCUS_12800 6984 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 7565 7299 gene locus_tag LOCUS_12810 7565 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 8391 7579 gene locus_tag LOCUS_12820 8391 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 8573 8388 gene locus_tag LOCUS_12830 8573 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 8905 8570 gene locus_tag LOCUS_12840 8905 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 9513 8902 gene locus_tag LOCUS_12850 9513 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 9806 9513 gene locus_tag LOCUS_12860 9806 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10672 9803 gene locus_tag LOCUS_12870 10672 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 10880 10713 gene locus_tag LOCUS_12880 10880 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11011 10880 gene locus_tag LOCUS_12890 11011 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 11181 11011 gene locus_tag LOCUS_12900 11181 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 12295 11192 gene locus_tag LOCUS_12910 12295 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 12506 12306 gene locus_tag LOCUS_12920 12506 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 12826 12530 gene locus_tag LOCUS_12930 12826 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13092 12817 gene locus_tag LOCUS_12940 13092 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 13816 13520 gene locus_tag LOCUS_12950 13816 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 14220 13828 gene locus_tag LOCUS_12960 14220 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 14934 14293 gene locus_tag LOCUS_12970 14934 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 15659 14931 gene locus_tag LOCUS_12980 15659 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 15945 15649 gene locus_tag LOCUS_12990 15945 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 16403 15945 gene locus_tag LOCUS_13000 16403 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 16627 16403 gene locus_tag LOCUS_13010 16627 16403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 17450 16617 gene locus_tag LOCUS_13020 17450 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 18054 17440 gene locus_tag LOCUS_13030 18054 17440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 18202 18516 gene locus_tag LOCUS_13040 18202 18516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence051 1596 439 gene locus_tag LOCUS_13050 1596 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2018 1593 gene locus_tag LOCUS_13060 2018 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3367 2015 gene locus_tag LOCUS_13070 gene fliI 3367 2015 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_13070 3987 3361 gene locus_tag LOCUS_13080 3987 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4978 3980 gene locus_tag LOCUS_13090 gene fliG 4978 3980 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_13090 6555 4975 gene locus_tag LOCUS_13100 gene fliF 6555 4975 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994427.1 protein_id gnl|my_center|LOCUS_13100 6866 6561 gene locus_tag LOCUS_13110 6866 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 7283 6870 gene locus_tag LOCUS_13120 gene flgC 7283 6870 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_13120 7615 7280 gene locus_tag LOCUS_13130 7615 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8113 7823 gene locus_tag LOCUS_13140 8113 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8501 8103 gene locus_tag LOCUS_13150 8501 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10966 8498 gene locus_tag LOCUS_13160 10966 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 12061 11234 gene locus_tag LOCUS_13170 12061 11234 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_13170 12214 16191 gene locus_tag LOCUS_13180 12214 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence052 308 1075 gene locus_tag LOCUS_13190 308 1075 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206437.1 protein_id gnl|my_center|LOCUS_13190 1714 1520 gene locus_tag LOCUS_13200 1714 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1980 1711 gene locus_tag LOCUS_13210 1980 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2763 2341 gene locus_tag LOCUS_13220 2763 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2996 2760 gene locus_tag LOCUS_13230 2996 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3499 2993 gene locus_tag LOCUS_13240 3499 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3822 3505 gene locus_tag LOCUS_13250 3822 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13250 4328 4564 gene locus_tag LOCUS_13260 4328 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 5292 4918 gene locus_tag LOCUS_13270 5292 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 5519 5289 gene locus_tag LOCUS_13280 5519 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6213 6593 gene locus_tag LOCUS_13290 6213 6593 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222672.1 protein_id gnl|my_center|LOCUS_13290 7172 6852 gene locus_tag LOCUS_13300 7172 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 7834 7169 gene locus_tag LOCUS_13310 7834 7169 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_13310 8029 8934 gene locus_tag LOCUS_13320 gene sigI 8029 8934 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406207.1 protein_id gnl|my_center|LOCUS_13320 9591 10067 gene locus_tag LOCUS_13330 9591 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 10282 10710 gene locus_tag LOCUS_13340 10282 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 10958 10614 gene locus_tag LOCUS_13350 10958 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 11121 11465 gene locus_tag LOCUS_13360 11121 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 11493 11840 gene locus_tag LOCUS_13370 11493 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 12262 11810 gene locus_tag LOCUS_13380 12262 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 12304 12888 gene locus_tag LOCUS_13390 12304 12888 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228137.1 protein_id gnl|my_center|LOCUS_13390 13864 12998 gene locus_tag LOCUS_13400 13864 12998 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_13400 15150 13861 gene locus_tag LOCUS_13410 15150 13861 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713000.1 protein_id gnl|my_center|LOCUS_13410 15480 16142 gene locus_tag LOCUS_13420 15480 16142 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084755.1 protein_id gnl|my_center|LOCUS_13420 16139 17191 gene locus_tag LOCUS_13430 16139 17191 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_13430 17188 17997 gene locus_tag LOCUS_13440 17188 17997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_13440 18342 18004 gene locus_tag LOCUS_13450 18342 18004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence053 1199 447 gene locus_tag LOCUS_13460 1199 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1277 1516 gene locus_tag LOCUS_13470 1277 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1513 1851 gene locus_tag LOCUS_13480 1513 1851 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_13480 2076 1759 gene locus_tag LOCUS_13490 2076 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2141 2368 gene locus_tag LOCUS_13500 2141 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2361 2780 gene locus_tag LOCUS_13510 2361 2780 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094558.1 protein_id gnl|my_center|LOCUS_13510 3103 4515 gene locus_tag LOCUS_13520 3103 4515 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 protein_id gnl|my_center|LOCUS_13520 4918 4526 gene locus_tag LOCUS_13530 4918 4526 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 protein_id gnl|my_center|LOCUS_13530 5099 6625 gene locus_tag LOCUS_13540 5099 6625 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978791.1 protein_id gnl|my_center|LOCUS_13540 6694 7224 gene locus_tag LOCUS_13550 6694 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 7221 9089 gene locus_tag LOCUS_13560 7221 9089 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_13560 9213 10457 gene locus_tag LOCUS_13570 9213 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 10577 10586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11693 10674 gene locus_tag LOCUS_13580 11693 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 11741 15394 gene locus_tag LOCUS_13590 11741 15394 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115449.1 protein_id gnl|my_center|LOCUS_13590 16478 15429 gene locus_tag LOCUS_13600 16478 15429 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400885.1 protein_id gnl|my_center|LOCUS_13600 16593 16853 gene locus_tag LOCUS_13610 16593 16853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 18013 16772 gene locus_tag LOCUS_13620 18013 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence054 554 949 gene locus_tag LOCUS_13630 554 949 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_13630 997 2691 gene locus_tag LOCUS_13640 gene ahpF 997 2691 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930514.1 protein_id gnl|my_center|LOCUS_13640 2894 4894 gene locus_tag LOCUS_13650 2894 4894 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775729.1 protein_id gnl|my_center|LOCUS_13650 5064 4855 gene locus_tag LOCUS_13660 5064 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 6380 5061 gene locus_tag LOCUS_13670 6380 5061 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_13670 6490 7428 gene locus_tag LOCUS_13680 6490 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 7493 9133 gene locus_tag LOCUS_13690 7493 9133 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_13690 10893 9208 gene locus_tag LOCUS_13700 10893 9208 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229303.1 protein_id gnl|my_center|LOCUS_13700 13592 11097 gene locus_tag LOCUS_13710 gene gyrA 13592 11097 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_13710 15529 13607 gene locus_tag LOCUS_13720 gene gyrB 15529 13607 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_13720 16165 15776 gene locus_tag LOCUS_13730 16165 15776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 17277 16162 gene locus_tag LOCUS_13740 gene recF 17277 16162 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_13740 <18257 17304 gene locus_tag LOCUS_13750 <18257 17304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726602.1:DNA polymerase III subunit beta >Feature sequence055 7 507 gene locus_tag LOCUS_13760 7 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 678 1604 gene locus_tag LOCUS_13770 678 1604 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 protein_id gnl|my_center|LOCUS_13770 1601 2707 gene locus_tag LOCUS_13780 1601 2707 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225157.1 protein_id gnl|my_center|LOCUS_13780 2736 4223 gene locus_tag LOCUS_13790 2736 4223 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844950.1 protein_id gnl|my_center|LOCUS_13790 4230 5036 gene locus_tag LOCUS_13800 4230 5036 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392770.1 protein_id gnl|my_center|LOCUS_13800 5017 6003 gene locus_tag LOCUS_13810 5017 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6159 7724 gene locus_tag LOCUS_13820 6159 7724 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385803.1 protein_id gnl|my_center|LOCUS_13820 7834 8805 gene locus_tag LOCUS_13830 7834 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8795 10099 gene locus_tag LOCUS_13840 8795 10099 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_13840 10124 11068 gene locus_tag LOCUS_13850 10124 11068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385804.1 protein_id gnl|my_center|LOCUS_13850 11075 13054 gene locus_tag LOCUS_13860 11075 13054 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385805.1 protein_id gnl|my_center|LOCUS_13860 13051 13902 gene locus_tag LOCUS_13870 13051 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 13941 15056 gene locus_tag LOCUS_13880 13941 15056 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_13880 15049 15933 gene locus_tag LOCUS_13890 15049 15933 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530304.1 protein_id gnl|my_center|LOCUS_13890 15920 17158 gene locus_tag LOCUS_13900 15920 17158 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189026.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence056 2775 1273 gene locus_tag LOCUS_13910 2775 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3481 4587 gene locus_tag LOCUS_13920 3481 4587 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_13920 5292 4915 gene locus_tag LOCUS_13930 5292 4915 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477789.1 protein_id gnl|my_center|LOCUS_13930 5853 6164 gene locus_tag LOCUS_13940 5853 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6514 6523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6565 6641 gene locus_tag LOCUS_t00190 6565 6641 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6774 7958 gene locus_tag LOCUS_13950 6774 7958 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_13950 8079 10106 gene locus_tag LOCUS_13960 8079 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 10109 12565 gene locus_tag LOCUS_13970 10109 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 12574 15189 gene locus_tag LOCUS_13980 12574 15189 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_13980 15605 15336 gene locus_tag LOCUS_13990 15605 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 16227 15841 gene locus_tag LOCUS_14000 16227 15841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 16883 16470 gene locus_tag LOCUS_14010 16883 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 17080 17661 gene locus_tag LOCUS_14020 17080 17661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence057 266 907 gene locus_tag LOCUS_14030 266 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1794 1126 gene locus_tag LOCUS_14040 1794 1126 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545742.1 protein_id gnl|my_center|LOCUS_14040 1865 2620 gene locus_tag LOCUS_14050 1865 2620 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_14050 2617 3777 gene locus_tag LOCUS_14060 2617 3777 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_14060 3806 4156 gene locus_tag LOCUS_14070 3806 4156 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_14070 4156 5373 gene locus_tag LOCUS_14080 4156 5373 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_14080 9431 5790 gene locus_tag LOCUS_14090 9431 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 9862 9434 gene locus_tag LOCUS_14100 9862 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 10199 9888 gene locus_tag LOCUS_14110 10199 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 10096 10374 gene locus_tag LOCUS_14120 10096 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 10571 11794 gene locus_tag LOCUS_14130 10571 11794 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826413.1 protein_id gnl|my_center|LOCUS_14130 12007 11840 gene locus_tag LOCUS_14140 12007 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 12450 12007 gene locus_tag LOCUS_14150 12450 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 13405 12443 gene locus_tag LOCUS_14160 13405 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 13539 14186 gene locus_tag LOCUS_14170 13539 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 14291 14767 gene locus_tag LOCUS_14180 14291 14767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 14761 15762 gene locus_tag LOCUS_14190 14761 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence058 642 427 gene locus_tag LOCUS_14200 642 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1542 646 gene locus_tag LOCUS_14210 gene hisG 1542 646 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_14210 2104 1547 gene locus_tag LOCUS_14220 gene ribE 2104 1547 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392435.1 protein_id gnl|my_center|LOCUS_14220 3336 2110 gene locus_tag LOCUS_14230 3336 2110 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_14230 4394 3333 gene locus_tag LOCUS_14240 gene ribD 4394 3333 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814865.1 protein_id gnl|my_center|LOCUS_14240 5125 4445 gene locus_tag LOCUS_14250 gene rpe 5125 4445 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_14250 5973 5137 gene locus_tag LOCUS_14260 gene fmt 5973 5137 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_14260 6515 6030 gene locus_tag LOCUS_14270 gene def 6515 6030 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_14270 8245 6527 gene locus_tag LOCUS_14280 8245 6527 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14280 9456 8266 gene locus_tag LOCUS_14290 gene metK 9456 8266 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_14290 10682 9456 gene locus_tag LOCUS_14300 gene coaBC 10682 9456 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_14300 11091 10735 gene locus_tag LOCUS_14310 11091 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 11485 11081 gene locus_tag LOCUS_14320 11485 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 11952 11632 gene locus_tag LOCUS_14330 gene mihF 11952 11632 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_14330 12783 11986 gene locus_tag LOCUS_14340 gene pyrF 12783 11986 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111363.1 protein_id gnl|my_center|LOCUS_14340 13762 12833 gene locus_tag LOCUS_14350 13762 12833 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_14350 17024 13743 gene locus_tag LOCUS_14360 gene carB 17024 13743 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence059 856 614 gene locus_tag LOCUS_14370 856 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 955 1326 gene locus_tag LOCUS_14380 955 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14380 1323 2990 gene locus_tag LOCUS_14390 1323 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 3285 3701 gene locus_tag LOCUS_14400 3285 3701 CDS product DUF6262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729601.1 protein_id gnl|my_center|LOCUS_14400 3786 4058 gene locus_tag LOCUS_14410 3786 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4939 4625 gene locus_tag LOCUS_14420 4939 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6164 5676 gene locus_tag LOCUS_14430 6164 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7668 6217 gene locus_tag LOCUS_14440 7668 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 10175 7662 gene locus_tag LOCUS_14450 10175 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 11182 10865 gene locus_tag LOCUS_14460 11182 10865 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_14460 11433 11179 gene locus_tag LOCUS_14470 11433 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 12639 11563 gene locus_tag LOCUS_14480 12639 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 13068 12643 gene locus_tag LOCUS_14490 13068 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 14308 13259 gene locus_tag LOCUS_14500 14308 13259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 14802 14416 gene locus_tag LOCUS_14510 14802 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 15121 15882 gene locus_tag LOCUS_14520 15121 15882 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_14520 16256 15963 gene locus_tag LOCUS_14530 16256 15963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 16319 16669 gene locus_tag LOCUS_14540 gene ychN 16319 16669 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169659.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence060 134 1144 gene locus_tag LOCUS_14550 134 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1131 1955 gene locus_tag LOCUS_14560 1131 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1952 4120 gene locus_tag LOCUS_14570 1952 4120 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_14570 4941 4507 gene locus_tag LOCUS_14580 4941 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 5387 4938 gene locus_tag LOCUS_14590 5387 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 5569 8088 gene locus_tag LOCUS_14600 5569 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 9373 8327 gene locus_tag LOCUS_14610 9373 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 11406 9562 gene locus_tag LOCUS_14620 11406 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 11763 12464 gene locus_tag LOCUS_14630 11763 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 12461 13702 gene locus_tag LOCUS_14640 12461 13702 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_14640 13699 14424 gene locus_tag LOCUS_14650 13699 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 14447 14761 gene locus_tag LOCUS_14660 14447 14761 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_14660 14784 15299 gene locus_tag LOCUS_14670 14784 15299 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890414.1 protein_id gnl|my_center|LOCUS_14670 16569 16165 gene locus_tag LOCUS_14680 gene tnpA 16569 16165 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435056.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence061 <1 2298 gene locus_tag LOCUS_14690 <1 2298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230385.1:peptidase S8 3218 2640 gene locus_tag LOCUS_14700 3218 2640 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729066.1 protein_id gnl|my_center|LOCUS_14700 3613 3215 gene locus_tag LOCUS_14710 3613 3215 CDS product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894879.1 protein_id gnl|my_center|LOCUS_14710 3959 3798 gene locus_tag LOCUS_14720 3959 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4450 4247 gene locus_tag LOCUS_14730 4450 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 5834 4464 gene locus_tag LOCUS_14740 gene der 5834 4464 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940452.1 protein_id gnl|my_center|LOCUS_14740 7342 5909 gene locus_tag LOCUS_14750 7342 5909 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_14750 7524 8741 gene locus_tag LOCUS_14760 7524 8741 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_14760 8734 10179 gene locus_tag LOCUS_14770 8734 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 10248 11309 gene locus_tag LOCUS_14780 gene ispH 10248 11309 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_14780 11405 12271 gene locus_tag LOCUS_14790 11405 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 12821 12213 gene locus_tag LOCUS_14800 12821 12213 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 protein_id gnl|my_center|LOCUS_14800 13741 13058 gene locus_tag LOCUS_14810 13741 13058 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530016.1 protein_id gnl|my_center|LOCUS_14810 15782 13752 gene locus_tag LOCUS_14820 15782 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 16912 15779 gene locus_tag LOCUS_14830 16912 15779 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_14830 17051 16896 gene locus_tag LOCUS_14840 17051 16896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence062 2538 1519 gene locus_tag LOCUS_14850 2538 1519 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_14850 3806 2607 gene locus_tag LOCUS_14860 3806 2607 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 protein_id gnl|my_center|LOCUS_14860 3867 4712 gene locus_tag LOCUS_14870 3867 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 4717 5268 gene locus_tag LOCUS_14880 4717 5268 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403256.1 protein_id gnl|my_center|LOCUS_14880 6025 5336 gene locus_tag LOCUS_14890 6025 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 6178 7005 gene locus_tag LOCUS_14900 6178 7005 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 protein_id gnl|my_center|LOCUS_14900 7002 8747 gene locus_tag LOCUS_14910 7002 8747 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_14910 8782 9633 gene locus_tag LOCUS_14920 8782 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 9649 11673 gene locus_tag LOCUS_14930 9649 11673 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_14930 12590 11652 gene locus_tag LOCUS_14940 12590 11652 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_14940 14444 12900 gene locus_tag LOCUS_14950 14444 12900 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_14950 14974 14468 gene locus_tag LOCUS_14960 gene mce 14974 14468 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_14960 16311 14971 gene locus_tag LOCUS_14970 gene ccrA 16311 14971 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence063 1083 853 gene locus_tag LOCUS_14980 1083 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1543 1157 gene locus_tag LOCUS_14990 1543 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1740 2435 gene locus_tag LOCUS_15000 1740 2435 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404711.1 protein_id gnl|my_center|LOCUS_15000 2428 3870 gene locus_tag LOCUS_15010 2428 3870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_15010 3867 4298 gene locus_tag LOCUS_15020 3867 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4372 5814 gene locus_tag LOCUS_15030 4372 5814 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_15030 5923 6192 gene locus_tag LOCUS_15040 5923 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6488 7723 gene locus_tag LOCUS_15050 6488 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 8100 9236 gene locus_tag LOCUS_15060 8100 9236 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_15060 9465 10361 gene locus_tag LOCUS_15070 9465 10361 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525137.1 protein_id gnl|my_center|LOCUS_15070 10512 12695 gene locus_tag LOCUS_15080 10512 12695 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_15080 13271 12861 gene locus_tag LOCUS_15090 13271 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 13153 13668 gene locus_tag LOCUS_15100 13153 13668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 13771 14067 gene locus_tag LOCUS_15110 13771 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 14852 14118 gene locus_tag LOCUS_15120 14852 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 14936 15571 gene locus_tag LOCUS_15130 14936 15571 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence064 342 1397 gene locus_tag LOCUS_15140 342 1397 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487216.1 protein_id gnl|my_center|LOCUS_15140 1394 2557 gene locus_tag LOCUS_15150 1394 2557 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_15150 3470 2565 gene locus_tag LOCUS_15160 3470 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4568 3483 gene locus_tag LOCUS_15170 4568 3483 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 protein_id gnl|my_center|LOCUS_15170 5623 4565 gene locus_tag LOCUS_15180 gene iolX 5623 4565 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_15180 6513 5674 gene locus_tag LOCUS_15190 6513 5674 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339533.1 protein_id gnl|my_center|LOCUS_15190 7603 6515 gene locus_tag LOCUS_15200 7603 6515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970637.1 protein_id gnl|my_center|LOCUS_15200 8880 7753 gene locus_tag LOCUS_15210 8880 7753 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967117.1 protein_id gnl|my_center|LOCUS_15210 9870 8920 gene locus_tag LOCUS_15220 9870 8920 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896035.1 protein_id gnl|my_center|LOCUS_15220 11096 10041 gene locus_tag LOCUS_15230 11096 10041 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031545.1 protein_id gnl|my_center|LOCUS_15230 13069 11183 gene locus_tag LOCUS_15240 gene iolD 13069 11183 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_15240 13977 13066 gene locus_tag LOCUS_15250 gene iolB 13977 13066 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729993.1 protein_id gnl|my_center|LOCUS_15250 14897 13974 gene locus_tag LOCUS_15260 14897 13974 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612349.1 protein_id gnl|my_center|LOCUS_15260 16116 14953 gene locus_tag LOCUS_15270 16116 14953 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037244312.1 protein_id gnl|my_center|LOCUS_15270 <16683 16171 gene locus_tag LOCUS_15280 <16683 16171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919175.1:5-dehydro-2-deoxygluconokinase >Feature sequence065 78 2372 gene locus_tag LOCUS_15290 78 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2369 3499 gene locus_tag LOCUS_15300 2369 3499 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_15300 3501 4727 gene locus_tag LOCUS_15310 3501 4727 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_15310 4932 6197 gene locus_tag LOCUS_15320 4932 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 6199 6687 gene locus_tag LOCUS_15330 6199 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 6739 8730 gene locus_tag LOCUS_15340 6739 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 8813 10276 gene locus_tag LOCUS_15350 8813 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 11825 10290 gene locus_tag LOCUS_15360 11825 10290 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230432.1 protein_id gnl|my_center|LOCUS_15360 12520 11861 gene locus_tag LOCUS_15370 12520 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 12626 13651 gene locus_tag LOCUS_15380 12626 13651 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_15380 16391 13674 gene locus_tag LOCUS_15390 16391 13674 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102268.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence066 <1 896 gene locus_tag LOCUS_15400 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039770.1:MBL fold metallo-hydrolase 1153 929 gene locus_tag LOCUS_15410 1153 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1578 1195 gene locus_tag LOCUS_15420 1578 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2210 1575 gene locus_tag LOCUS_15430 2210 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2907 2317 gene locus_tag LOCUS_15440 2907 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3134 3394 gene locus_tag LOCUS_15450 3134 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3391 3741 gene locus_tag LOCUS_15460 3391 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3969 5687 gene locus_tag LOCUS_15470 3969 5687 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_15470 7271 5853 gene locus_tag LOCUS_15480 7271 5853 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289203.1 protein_id gnl|my_center|LOCUS_15480 8811 7303 gene locus_tag LOCUS_15490 8811 7303 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_15490 10691 8817 gene locus_tag LOCUS_15500 10691 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 10999 10688 gene locus_tag LOCUS_15510 gene nuoK 10999 10688 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_15510 11529 10996 gene locus_tag LOCUS_15520 11529 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 12493 11561 gene locus_tag LOCUS_15530 gene nuoH 12493 11561 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_15530 13457 12486 gene locus_tag LOCUS_15540 13457 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 13963 13607 gene locus_tag LOCUS_15550 13963 13607 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_15550 14181 13960 gene locus_tag LOCUS_15560 14181 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 14420 14214 gene locus_tag LOCUS_15570 14420 14214 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730261.1 protein_id gnl|my_center|LOCUS_15570 <16535 14407 gene locus_tag LOCUS_15580 <16535 14407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404941.1:copper-translocating P-type ATPase >Feature sequence067 374 1168 gene locus_tag LOCUS_15590 374 1168 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974599.1 protein_id gnl|my_center|LOCUS_15590 1335 1526 gene locus_tag LOCUS_15600 1335 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1537 1785 gene locus_tag LOCUS_15610 1537 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1901 3847 gene locus_tag LOCUS_15620 1901 3847 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_15620 4837 3899 gene locus_tag LOCUS_15630 4837 3899 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_15630 4910 5461 gene locus_tag LOCUS_15640 4910 5461 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_15640 7419 5491 gene locus_tag LOCUS_15650 gene thiC 7419 5491 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220133538.1 protein_id gnl|my_center|LOCUS_15650 7683 7612 gene locus_tag LOCUS_t00200 7683 7612 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7868 8263 gene locus_tag LOCUS_15660 7868 8263 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256033.1 protein_id gnl|my_center|LOCUS_15660 9112 8306 gene locus_tag LOCUS_15670 9112 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 10103 9159 gene locus_tag LOCUS_15680 10103 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 10978 10103 gene locus_tag LOCUS_15690 10978 10103 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_15690 11385 10975 gene locus_tag LOCUS_15700 11385 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 11766 11536 gene locus_tag LOCUS_15710 11766 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 12284 13381 gene locus_tag LOCUS_15720 12284 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 13417 14160 gene locus_tag LOCUS_15730 13417 14160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062048.1 protein_id gnl|my_center|LOCUS_15730 14157 15338 gene locus_tag LOCUS_15740 14157 15338 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125903.1 protein_id gnl|my_center|LOCUS_15740 15391 15588 gene locus_tag LOCUS_15750 15391 15588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence068 <1 1084 gene locus_tag LOCUS_15760 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878709.1:5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase 1081 2076 gene locus_tag LOCUS_15770 1081 2076 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027388.1 protein_id gnl|my_center|LOCUS_15770 2073 2564 gene locus_tag LOCUS_15780 2073 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 3567 2566 gene locus_tag LOCUS_15790 3567 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3925 6564 gene locus_tag LOCUS_15800 3925 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 6729 6655 gene locus_tag LOCUS_t00210 6729 6655 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7629 6832 gene locus_tag LOCUS_15810 7629 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 9452 7626 gene locus_tag LOCUS_15820 9452 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10837 9449 gene locus_tag LOCUS_15830 10837 9449 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_15830 11094 11330 gene locus_tag LOCUS_15840 11094 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15840 11361 13076 gene locus_tag LOCUS_15850 11361 13076 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15850 13090 15141 gene locus_tag LOCUS_15860 13090 15141 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125263880.1 protein_id gnl|my_center|LOCUS_15860 15138 16094 gene locus_tag LOCUS_15870 15138 16094 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972421.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence069 3320 111 gene locus_tag LOCUS_15880 3320 111 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225383.1 protein_id gnl|my_center|LOCUS_15880 3957 3394 gene locus_tag LOCUS_15890 3957 3394 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_15890 4163 6007 gene locus_tag LOCUS_15900 4163 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6343 6618 gene locus_tag LOCUS_15910 6343 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 6729 7712 gene locus_tag LOCUS_15920 6729 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 7705 8706 gene locus_tag LOCUS_15930 7705 8706 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109982.1 protein_id gnl|my_center|LOCUS_15930 11084 8745 gene locus_tag LOCUS_15940 11084 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 11501 12676 gene locus_tag LOCUS_15950 11501 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 12673 15318 gene locus_tag LOCUS_15960 12673 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence070 228 626 gene locus_tag LOCUS_15970 228 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1440 676 gene locus_tag LOCUS_15980 1440 676 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401354.1 protein_id gnl|my_center|LOCUS_15980 2275 1508 gene locus_tag LOCUS_15990 2275 1508 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284930.1 protein_id gnl|my_center|LOCUS_15990 2425 2673 gene locus_tag LOCUS_16000 2425 2673 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402017.1 protein_id gnl|my_center|LOCUS_16000 2891 3877 gene locus_tag LOCUS_16010 2891 3877 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109784478.1 protein_id gnl|my_center|LOCUS_16010 3951 4652 gene locus_tag LOCUS_16020 3951 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4878 5906 gene locus_tag LOCUS_16030 4878 5906 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968134.1 protein_id gnl|my_center|LOCUS_16030 5965 6777 gene locus_tag LOCUS_16040 5965 6777 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_16040 6952 7944 gene locus_tag LOCUS_16050 6952 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 8385 9278 gene locus_tag LOCUS_16060 8385 9278 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228477.1 protein_id gnl|my_center|LOCUS_16060 9295 10077 gene locus_tag LOCUS_16070 9295 10077 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456023.1 protein_id gnl|my_center|LOCUS_16070 10155 11039 gene locus_tag LOCUS_16080 10155 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 11086 12582 gene locus_tag LOCUS_16090 11086 12582 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030798.1 protein_id gnl|my_center|LOCUS_16090 12575 13945 gene locus_tag LOCUS_16100 12575 13945 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266227.1 protein_id gnl|my_center|LOCUS_16100 13957 14889 gene locus_tag LOCUS_16110 13957 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 14886 15851 gene locus_tag LOCUS_16120 14886 15851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence071 3200 1272 gene locus_tag LOCUS_16130 gene nuoL 3200 1272 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_16130 3509 3204 gene locus_tag LOCUS_16140 gene nuoK 3509 3204 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_16140 4243 3506 gene locus_tag LOCUS_16150 4243 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 5103 4240 gene locus_tag LOCUS_16160 5103 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 6390 5104 gene locus_tag LOCUS_16170 gene nuoH 6390 5104 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_16170 9260 6387 gene locus_tag LOCUS_16180 9260 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 10557 9253 gene locus_tag LOCUS_16190 gene nuoF 10557 9253 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_16190 11222 10557 gene locus_tag LOCUS_16200 11222 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 12601 11219 gene locus_tag LOCUS_16210 gene nuoD 12601 11219 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_16210 13143 12598 gene locus_tag LOCUS_16220 13143 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 13697 13140 gene locus_tag LOCUS_16230 13697 13140 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_16230 14161 13709 gene locus_tag LOCUS_16240 14161 13709 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_16240 14283 15755 gene locus_tag LOCUS_16250 14283 15755 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence072 3887 2574 gene locus_tag LOCUS_16260 3887 2574 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_16260 4783 3884 gene locus_tag LOCUS_16270 4783 3884 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_16270 5750 4878 gene locus_tag LOCUS_16280 5750 4878 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528511.1 protein_id gnl|my_center|LOCUS_16280 5812 7371 gene locus_tag LOCUS_16290 5812 7371 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_16290 8223 7390 gene locus_tag LOCUS_16300 8223 7390 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977223.1 protein_id gnl|my_center|LOCUS_16300 9612 8356 gene locus_tag LOCUS_16310 gene nagA 9612 8356 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_16310 11297 9609 gene locus_tag LOCUS_16320 11297 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 12787 11390 gene locus_tag LOCUS_16330 12787 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 13437 12922 gene locus_tag LOCUS_16340 13437 12922 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_16340 13661 13996 gene locus_tag LOCUS_16350 13661 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 14480 14127 gene locus_tag LOCUS_16360 14480 14127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 <15841 14616 gene locus_tag LOCUS_16370 <15841 14616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957755.1:MFS transporter >Feature sequence073 1039 215 gene locus_tag LOCUS_16380 1039 215 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_16380 1334 2470 gene locus_tag LOCUS_16390 1334 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2482 3117 gene locus_tag LOCUS_16400 2482 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3264 4187 gene locus_tag LOCUS_16410 3264 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4520 4257 gene locus_tag LOCUS_16420 4520 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 4661 5662 gene locus_tag LOCUS_16430 4661 5662 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 protein_id gnl|my_center|LOCUS_16430 5677 6993 gene locus_tag LOCUS_16440 5677 6993 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 protein_id gnl|my_center|LOCUS_16440 6689 6698 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7003 7455 gene locus_tag LOCUS_16450 7003 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 7509 8666 gene locus_tag LOCUS_16460 7509 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 8699 8776 gene locus_tag LOCUS_t00220 8699 8776 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10578 8887 gene locus_tag LOCUS_16470 10578 8887 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_16470 11004 10618 gene locus_tag LOCUS_16480 11004 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 11128 12273 gene locus_tag LOCUS_16490 11128 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 12529 13989 gene locus_tag LOCUS_16500 gene yfmT 12529 13989 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244104.1 protein_id gnl|my_center|LOCUS_16500 14001 14741 gene locus_tag LOCUS_16510 14001 14741 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726819.1 protein_id gnl|my_center|LOCUS_16510 <15778 14807 gene locus_tag LOCUS_16520 <15778 14807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976053.1:substrate-binding domain-containing protein >Feature sequence074 382 789 gene locus_tag LOCUS_16530 382 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 786 1679 gene locus_tag LOCUS_16540 gene truB 786 1679 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 protein_id gnl|my_center|LOCUS_16540 1720 2691 gene locus_tag LOCUS_16550 1720 2691 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_16550 2826 3083 gene locus_tag LOCUS_16560 gene rpsO 2826 3083 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_16560 3238 5640 gene locus_tag LOCUS_16570 3238 5640 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728507.1 protein_id gnl|my_center|LOCUS_16570 5637 6923 gene locus_tag LOCUS_16580 5637 6923 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071997834.1 protein_id gnl|my_center|LOCUS_16580 7121 10150 gene locus_tag LOCUS_16590 7121 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 10152 10970 gene locus_tag LOCUS_16600 gene dapB 10152 10970 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228101.1 protein_id gnl|my_center|LOCUS_16600 11106 11537 gene locus_tag LOCUS_16610 11106 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 11554 12411 gene locus_tag LOCUS_16620 11554 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 12691 13599 gene locus_tag LOCUS_16630 gene dapA 12691 13599 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_16630 13620 15287 gene locus_tag LOCUS_16640 13620 15287 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence075 733 993 gene locus_tag LOCUS_16650 733 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 987 1397 gene locus_tag LOCUS_16660 gene vapC26 987 1397 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_16660 1499 1975 gene locus_tag LOCUS_16670 1499 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2150 2476 gene locus_tag LOCUS_16680 2150 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2729 2598 gene locus_tag LOCUS_16690 2729 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2909 3367 gene locus_tag LOCUS_16700 2909 3367 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_16700 3845 3657 gene locus_tag LOCUS_16710 3845 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3771 4058 gene locus_tag LOCUS_16720 3771 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 4169 4462 gene locus_tag LOCUS_16730 4169 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4499 4777 gene locus_tag LOCUS_16740 4499 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4777 5547 gene locus_tag LOCUS_16750 4777 5547 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730124.1 protein_id gnl|my_center|LOCUS_16750 5570 6307 gene locus_tag LOCUS_16760 gene fabG 5570 6307 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392772.1 protein_id gnl|my_center|LOCUS_16760 6337 7515 gene locus_tag LOCUS_16770 6337 7515 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460999.1 protein_id gnl|my_center|LOCUS_16770 8298 7588 gene locus_tag LOCUS_16780 8298 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 8814 8311 gene locus_tag LOCUS_16790 8814 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 8701 10137 gene locus_tag LOCUS_16800 8701 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 10134 12116 gene locus_tag LOCUS_16810 10134 12116 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064868.1 protein_id gnl|my_center|LOCUS_16810 12116 12913 gene locus_tag LOCUS_16820 12116 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 12933 14042 gene locus_tag LOCUS_16830 12933 14042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 14061 14828 gene locus_tag LOCUS_16840 14061 14828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537570.1 protein_id gnl|my_center|LOCUS_16840 14809 15669 gene locus_tag LOCUS_16850 14809 15669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence076 1876 872 gene locus_tag LOCUS_16860 gene hpnH 1876 872 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_16860 3435 1876 gene locus_tag LOCUS_16870 3435 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5332 3428 gene locus_tag LOCUS_16880 gene shc 5332 3428 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_16880 6300 5329 gene locus_tag LOCUS_16890 6300 5329 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 protein_id gnl|my_center|LOCUS_16890 7736 6342 gene locus_tag LOCUS_16900 gene hpnE 7736 6342 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_16900 8620 7733 gene locus_tag LOCUS_16910 gene hpnD 8620 7733 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_16910 9567 8617 gene locus_tag LOCUS_16920 gene hpnC 9567 8617 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_16920 10091 10582 gene locus_tag LOCUS_16930 10091 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 10654 11784 gene locus_tag LOCUS_16940 10654 11784 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_16940 11781 12122 gene locus_tag LOCUS_16950 11781 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 12122 13549 gene locus_tag LOCUS_16960 12122 13549 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_16960 13630 14151 gene locus_tag LOCUS_16970 13630 14151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence077 187 2004 gene locus_tag LOCUS_16980 gene lepA 187 2004 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729920.1 protein_id gnl|my_center|LOCUS_16980 2139 3224 gene locus_tag LOCUS_16990 gene hrcA 2139 3224 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123574708.1 protein_id gnl|my_center|LOCUS_16990 3211 4359 gene locus_tag LOCUS_17000 gene dnaJ 3211 4359 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_17000 4352 5080 gene locus_tag LOCUS_17010 4352 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5118 5357 gene locus_tag LOCUS_17020 5118 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 5387 5710 gene locus_tag LOCUS_17030 5387 5710 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122473.1 protein_id gnl|my_center|LOCUS_17030 5695 6744 gene locus_tag LOCUS_17040 5695 6744 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_17040 6734 7243 gene locus_tag LOCUS_17050 6734 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 7240 8559 gene locus_tag LOCUS_17060 7240 8559 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_17060 8567 9496 gene locus_tag LOCUS_17070 gene era 8567 9496 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895864.1 protein_id gnl|my_center|LOCUS_17070 9511 10461 gene locus_tag LOCUS_17080 9511 10461 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053875.1 protein_id gnl|my_center|LOCUS_17080 11532 10486 gene locus_tag LOCUS_17090 11532 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 14018 11874 gene locus_tag LOCUS_17100 14018 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 14083 14826 gene locus_tag LOCUS_17110 14083 14826 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_17110 <15514 14805 gene locus_tag LOCUS_17120 <15514 14805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941346.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence078 1719 256 gene locus_tag LOCUS_17130 gene tig 1719 256 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_17130 2003 2155 gene locus_tag LOCUS_17140 2003 2155 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_17140 2252 2328 gene locus_tag LOCUS_t00230 2252 2328 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3549 2737 gene locus_tag LOCUS_17150 3549 2737 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027518.1 protein_id gnl|my_center|LOCUS_17150 5168 3546 gene locus_tag LOCUS_17160 5168 3546 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_17160 6067 5162 gene locus_tag LOCUS_17170 6067 5162 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_17170 7200 6061 gene locus_tag LOCUS_17180 7200 6061 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_17180 7958 7200 gene locus_tag LOCUS_17190 7958 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 8659 7955 gene locus_tag LOCUS_17200 8659 7955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_17200 11640 8656 gene locus_tag LOCUS_17210 11640 8656 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_17210 12879 11644 gene locus_tag LOCUS_17220 12879 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 13993 13061 gene locus_tag LOCUS_17230 13993 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 14136 14357 gene locus_tag LOCUS_17240 14136 14357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 15119 14547 gene locus_tag LOCUS_17250 15119 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence079 100 357 gene locus_tag LOCUS_17260 100 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1985 519 gene locus_tag LOCUS_17270 1985 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3983 2250 gene locus_tag LOCUS_17280 3983 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 4257 4093 gene locus_tag LOCUS_17290 4257 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 5099 7771 gene locus_tag LOCUS_17300 5099 7771 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850600.1 protein_id gnl|my_center|LOCUS_17300 8883 8074 gene locus_tag LOCUS_17310 8883 8074 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020487310.1 protein_id gnl|my_center|LOCUS_17310 9974 8880 gene locus_tag LOCUS_17320 9974 8880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184768132.1 protein_id gnl|my_center|LOCUS_17320 11235 10120 gene locus_tag LOCUS_17330 11235 10120 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202597.1 protein_id gnl|my_center|LOCUS_17330 12641 11388 gene locus_tag LOCUS_17340 12641 11388 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893427.1 protein_id gnl|my_center|LOCUS_17340 13608 12634 gene locus_tag LOCUS_17350 13608 12634 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225279.1 protein_id gnl|my_center|LOCUS_17350 14746 13598 gene locus_tag LOCUS_17360 14746 13598 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225276.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence080 783 37 gene locus_tag LOCUS_17370 783 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1481 1912 gene locus_tag LOCUS_17380 1481 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1921 2382 gene locus_tag LOCUS_17390 1921 2382 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_17390 2504 5389 gene locus_tag LOCUS_17400 gene acnA 2504 5389 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805056.1 protein_id gnl|my_center|LOCUS_17400 5597 6226 gene locus_tag LOCUS_17410 5597 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 6253 7302 gene locus_tag LOCUS_17420 6253 7302 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974942.1 protein_id gnl|my_center|LOCUS_17420 8764 7382 gene locus_tag LOCUS_17430 8764 7382 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093271.1 protein_id gnl|my_center|LOCUS_17430 9255 8797 gene locus_tag LOCUS_17440 9255 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 10419 9307 gene locus_tag LOCUS_17450 10419 9307 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_17450 12022 10625 gene locus_tag LOCUS_17460 12022 10625 CDS product IS1380-like element ISMsm3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726768.1 protein_id gnl|my_center|LOCUS_17460 12198 12506 gene locus_tag LOCUS_17470 12198 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 13391 12576 gene locus_tag LOCUS_17480 13391 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 14202 13567 gene locus_tag LOCUS_17490 14202 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 14454 15311 gene locus_tag LOCUS_17500 14454 15311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence081 1972 605 gene locus_tag LOCUS_17510 1972 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2351 2091 gene locus_tag LOCUS_17520 gene yoeB 2351 2091 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_17520 2599 2348 gene locus_tag LOCUS_17530 2599 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 4712 2928 gene locus_tag LOCUS_17540 4712 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 5949 4774 gene locus_tag LOCUS_17550 5949 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 5971 6348 gene locus_tag LOCUS_17560 5971 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 7012 6365 gene locus_tag LOCUS_17570 7012 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 7988 7122 gene locus_tag LOCUS_17580 7988 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 8555 8052 gene locus_tag LOCUS_17590 8555 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 10354 8594 gene locus_tag LOCUS_17600 10354 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10403 10870 gene locus_tag LOCUS_17610 10403 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 10900 12192 gene locus_tag LOCUS_17620 10900 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 15089 12462 gene locus_tag LOCUS_17630 15089 12462 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence082 63 137 gene locus_tag LOCUS_t00240 63 137 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 360 953 gene locus_tag LOCUS_17640 360 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 968 1480 gene locus_tag LOCUS_17650 968 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17650 1598 6829 gene locus_tag LOCUS_17660 1598 6829 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_17660 6826 9684 gene locus_tag LOCUS_17670 6826 9684 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_17670 9681 13676 gene locus_tag LOCUS_17680 9681 13676 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_17680 13813 13953 gene locus_tag LOCUS_17690 13813 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 14087 14323 gene locus_tag LOCUS_17700 14087 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17700 14628 14338 gene locus_tag LOCUS_17710 14628 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence083 <1 774 gene locus_tag LOCUS_17720 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730889.1:acyl-CoA synthetase 771 2438 gene locus_tag LOCUS_17730 771 2438 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 protein_id gnl|my_center|LOCUS_17730 2483 2728 gene locus_tag LOCUS_17740 2483 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2848 3708 gene locus_tag LOCUS_17750 gene fdhD 2848 3708 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_17750 3705 4274 gene locus_tag LOCUS_17760 gene moaC 3705 4274 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804486.1 protein_id gnl|my_center|LOCUS_17760 5247 4300 gene locus_tag LOCUS_17770 5247 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 6329 5244 gene locus_tag LOCUS_17780 6329 5244 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_17780 6459 7664 gene locus_tag LOCUS_17790 6459 7664 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405724.1 protein_id gnl|my_center|LOCUS_17790 8401 7673 gene locus_tag LOCUS_17800 8401 7673 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_17800 9444 8389 gene locus_tag LOCUS_17810 9444 8389 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_17810 9761 9441 gene locus_tag LOCUS_17820 9761 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 11151 9790 gene locus_tag LOCUS_17830 11151 9790 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_17830 13498 11159 gene locus_tag LOCUS_17840 13498 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 14645 13716 gene locus_tag LOCUS_17850 14645 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence084 102 389 gene locus_tag LOCUS_17860 102 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1214 648 gene locus_tag LOCUS_17870 1214 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1376 2713 gene locus_tag LOCUS_17880 1376 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2820 3761 gene locus_tag LOCUS_17890 2820 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4183 3827 gene locus_tag LOCUS_17900 4183 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 4769 4984 gene locus_tag LOCUS_17910 4769 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 5833 5318 gene locus_tag LOCUS_17920 5833 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 6026 6520 gene locus_tag LOCUS_17930 6026 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 6520 7437 gene locus_tag LOCUS_17940 6520 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 7831 8178 gene locus_tag LOCUS_17950 7831 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17950 8153 8662 gene locus_tag LOCUS_17960 8153 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 8701 10521 gene locus_tag LOCUS_17970 8701 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 10565 10753 gene locus_tag LOCUS_17980 10565 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 10836 12938 gene locus_tag LOCUS_17990 10836 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence085 2023 1013 gene locus_tag LOCUS_18000 2023 1013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776186.1 protein_id gnl|my_center|LOCUS_18000 3074 2025 gene locus_tag LOCUS_18010 3074 2025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_18010 3904 3077 gene locus_tag LOCUS_18020 3904 3077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18020 4887 3901 gene locus_tag LOCUS_18030 4887 3901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_18030 6761 5040 gene locus_tag LOCUS_18040 6761 5040 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 protein_id gnl|my_center|LOCUS_18040 8368 7241 gene locus_tag LOCUS_18050 8368 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 8544 9728 gene locus_tag LOCUS_18060 8544 9728 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705629.1 protein_id gnl|my_center|LOCUS_18060 14445 9820 gene locus_tag LOCUS_18070 14445 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence086 239 706 gene locus_tag LOCUS_18080 239 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 706 1005 gene locus_tag LOCUS_18090 706 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1002 1703 gene locus_tag LOCUS_18100 1002 1703 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900903.1 protein_id gnl|my_center|LOCUS_18100 1865 2059 gene locus_tag LOCUS_18110 1865 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2393 2734 gene locus_tag LOCUS_18120 2393 2734 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296467.1 protein_id gnl|my_center|LOCUS_18120 2731 3012 gene locus_tag LOCUS_18130 2731 3012 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556002.1 protein_id gnl|my_center|LOCUS_18130 3520 3876 gene locus_tag LOCUS_18140 3520 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3941 3856 gene locus_tag LOCUS_t00250 3941 3856 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4221 4877 gene locus_tag LOCUS_18150 4221 4877 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_18150 4883 5395 gene locus_tag LOCUS_18160 gene fhaB 4883 5395 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_18160 5392 7107 gene locus_tag LOCUS_18170 5392 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 7223 9226 gene locus_tag LOCUS_18180 gene pknB 7223 9226 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112820.1 protein_id gnl|my_center|LOCUS_18180 9828 9223 gene locus_tag LOCUS_18190 9828 9223 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_18190 9733 10215 gene locus_tag LOCUS_18200 9733 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 10221 10841 gene locus_tag LOCUS_18210 10221 10841 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230583.1 protein_id gnl|my_center|LOCUS_18210 11288 10848 gene locus_tag LOCUS_18220 11288 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 11725 11285 gene locus_tag LOCUS_18230 11725 11285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 12968 11790 gene locus_tag LOCUS_18240 12968 11790 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081124.1 protein_id gnl|my_center|LOCUS_18240 13959 12994 gene locus_tag LOCUS_18250 13959 12994 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_18250 14385 14041 gene locus_tag LOCUS_18260 14385 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence087 614 405 gene locus_tag LOCUS_18270 gene rpmB 614 405 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_18270 742 2496 gene locus_tag LOCUS_18280 742 2496 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_18280 2499 4754 gene locus_tag LOCUS_18290 gene recG 2499 4754 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_18290 4925 5398 gene locus_tag LOCUS_18300 gene rsmD 4925 5398 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064430360.1 protein_id gnl|my_center|LOCUS_18300 5395 5916 gene locus_tag LOCUS_18310 gene coaD 5395 5916 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_18310 5913 6491 gene locus_tag LOCUS_18320 5913 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6573 7112 gene locus_tag LOCUS_18330 6573 7112 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 protein_id gnl|my_center|LOCUS_18330 7235 7414 gene locus_tag LOCUS_18340 gene rpmF 7235 7414 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_18340 7416 8540 gene locus_tag LOCUS_18350 gene plsX 7416 8540 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_18350 8530 8826 gene locus_tag LOCUS_18360 gene acpP 8530 8826 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699980.1 protein_id gnl|my_center|LOCUS_18360 8846 9532 gene locus_tag LOCUS_18370 gene rnc 8846 9532 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_18370 9525 10427 gene locus_tag LOCUS_18380 gene mutM 9525 10427 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355756.1 protein_id gnl|my_center|LOCUS_18380 10613 11416 gene locus_tag LOCUS_18390 10613 11416 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence088 152 2038 gene locus_tag LOCUS_18400 152 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2147 3889 gene locus_tag LOCUS_18410 2147 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3927 4952 gene locus_tag LOCUS_18420 3927 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6404 5067 gene locus_tag LOCUS_18430 6404 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 8163 6433 gene locus_tag LOCUS_18440 8163 6433 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_18440 8742 9356 gene locus_tag LOCUS_18450 8742 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 10395 9391 gene locus_tag LOCUS_18460 10395 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 10747 10400 gene locus_tag LOCUS_18470 10747 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 11779 10757 gene locus_tag LOCUS_18480 gene xerD 11779 10757 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_18480 12336 11776 gene locus_tag LOCUS_18490 12336 11776 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943966.1 protein_id gnl|my_center|LOCUS_18490 14034 12382 gene locus_tag LOCUS_18500 14034 12382 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_18500 14465 14130 gene locus_tag LOCUS_18510 14465 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence089 2032 1439 gene locus_tag LOCUS_18520 2032 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18520 2230 2054 gene locus_tag LOCUS_18530 2230 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18530 2259 2447 gene locus_tag LOCUS_18540 2259 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2717 2481 gene locus_tag LOCUS_18550 2717 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3155 2874 gene locus_tag LOCUS_18560 3155 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3399 3169 gene locus_tag LOCUS_18570 3399 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5011 4679 gene locus_tag LOCUS_18580 5011 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 5146 5436 gene locus_tag LOCUS_18590 5146 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 5653 5402 gene locus_tag LOCUS_18600 5653 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6518 6153 gene locus_tag LOCUS_18610 6518 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 6826 6539 gene locus_tag LOCUS_18620 6826 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 6920 7324 gene locus_tag LOCUS_18630 6920 7324 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228199.1 protein_id gnl|my_center|LOCUS_18630 7326 7712 gene locus_tag LOCUS_18640 7326 7712 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_18640 7709 8908 gene locus_tag LOCUS_18650 7709 8908 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214468507.1 protein_id gnl|my_center|LOCUS_18650 9216 9046 gene locus_tag LOCUS_18660 9216 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 9371 9982 gene locus_tag LOCUS_18670 9371 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 10455 10249 gene locus_tag LOCUS_18680 10455 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 10766 10452 gene locus_tag LOCUS_18690 10766 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 10885 11463 gene locus_tag LOCUS_18700 10885 11463 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975339.1 protein_id gnl|my_center|LOCUS_18700 11463 12761 gene locus_tag LOCUS_18710 11463 12761 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224589.1 protein_id gnl|my_center|LOCUS_18710 12758 12895 gene locus_tag LOCUS_18720 12758 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence090 1067 1909 gene locus_tag LOCUS_18730 1067 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1879 2448 gene locus_tag LOCUS_18740 1879 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2433 3428 gene locus_tag LOCUS_18750 2433 3428 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_18750 4353 3502 gene locus_tag LOCUS_18760 4353 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4621 5208 gene locus_tag LOCUS_18770 4621 5208 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 protein_id gnl|my_center|LOCUS_18770 5857 5213 gene locus_tag LOCUS_18780 5857 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 5856 7013 gene locus_tag LOCUS_18790 5856 7013 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894937.1 protein_id gnl|my_center|LOCUS_18790 7236 7688 gene locus_tag LOCUS_18800 7236 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 7781 8449 gene locus_tag LOCUS_18810 7781 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 9179 8487 gene locus_tag LOCUS_18820 9179 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 11610 9466 gene locus_tag LOCUS_18830 11610 9466 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_18830 11656 12423 gene locus_tag LOCUS_18840 11656 12423 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_18840 13633 12431 gene locus_tag LOCUS_18850 gene menE 13633 12431 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence091 <1 767 gene locus_tag LOCUS_18860 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731394.1:LLM class F420-dependent oxidoreductase 949 3282 gene locus_tag LOCUS_18870 949 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3663 3334 gene locus_tag LOCUS_18880 3663 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 5190 3943 gene locus_tag LOCUS_18890 5190 3943 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144955419.1 protein_id gnl|my_center|LOCUS_18890 5875 7038 gene locus_tag LOCUS_18900 5875 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 7038 8510 gene locus_tag LOCUS_18910 7038 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 8503 11256 gene locus_tag LOCUS_18920 8503 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 11307 12122 gene locus_tag LOCUS_18930 11307 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 12119 12736 gene locus_tag LOCUS_18940 gene cas4 12119 12736 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102934575.1 protein_id gnl|my_center|LOCUS_18940 12727 13749 gene locus_tag LOCUS_18950 gene cas1c 12727 13749 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 protein_id gnl|my_center|LOCUS_18950 13749 14012 gene locus_tag LOCUS_18960 13749 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence092 <1 500 gene locus_tag LOCUS_18970 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:response regulator 1242 562 gene locus_tag LOCUS_18980 1242 562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459344.1 protein_id gnl|my_center|LOCUS_18980 2598 1660 gene locus_tag LOCUS_18990 gene galE1 2598 1660 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 protein_id gnl|my_center|LOCUS_18990 3737 4165 gene locus_tag LOCUS_19000 3737 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 6024 4180 gene locus_tag LOCUS_19010 6024 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6408 7586 gene locus_tag LOCUS_19020 6408 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 7607 8623 gene locus_tag LOCUS_19030 7607 8623 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_19030 9592 8774 gene locus_tag LOCUS_19040 9592 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 9653 9838 gene locus_tag LOCUS_19050 9653 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 11177 10074 gene locus_tag LOCUS_19060 11177 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 12323 11628 gene locus_tag LOCUS_19070 12323 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 12619 12308 gene locus_tag LOCUS_19080 12619 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 13587 12937 gene locus_tag LOCUS_19090 13587 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence093 129 1112 gene locus_tag LOCUS_19100 129 1112 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_19100 2970 1093 gene locus_tag LOCUS_19110 2970 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 4580 2973 gene locus_tag LOCUS_19120 gene gcvPB 4580 2973 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250330.1 protein_id gnl|my_center|LOCUS_19120 6007 4577 gene locus_tag LOCUS_19130 gene gcvPA 6007 4577 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_19130 7343 6072 gene locus_tag LOCUS_19140 7343 6072 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_19140 8730 7360 gene locus_tag LOCUS_19150 8730 7360 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253525.1 protein_id gnl|my_center|LOCUS_19150 8807 10339 gene locus_tag LOCUS_19160 gene gabD 8807 10339 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_19160 10413 10907 gene locus_tag LOCUS_19170 10413 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 11865 10867 gene locus_tag LOCUS_19180 gene dapA 11865 10867 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172098.1 protein_id gnl|my_center|LOCUS_19180 11898 13178 gene locus_tag LOCUS_19190 11898 13178 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089925.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence094 2522 1521 gene locus_tag LOCUS_19200 gene speB 2522 1521 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_19200 3895 2606 gene locus_tag LOCUS_19210 3895 2606 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_19210 4117 7734 gene locus_tag LOCUS_19220 gene dnaE 4117 7734 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_19220 7868 8521 gene locus_tag LOCUS_19230 7868 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 9088 8567 gene locus_tag LOCUS_19240 9088 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 11898 9394 gene locus_tag LOCUS_19250 11898 9394 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_19250 12883 11912 gene locus_tag LOCUS_19260 12883 11912 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 protein_id gnl|my_center|LOCUS_19260 <13834 12912 gene locus_tag LOCUS_19270 <13834 12912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404785.1:DUF2309 domain-containing protein >Feature sequence095 1591 506 gene locus_tag LOCUS_19280 1591 506 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_19280 2055 1588 gene locus_tag LOCUS_19290 gene aroQ 2055 1588 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393049.1 protein_id gnl|my_center|LOCUS_19290 3140 2046 gene locus_tag LOCUS_19300 3140 2046 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_19300 3672 3151 gene locus_tag LOCUS_19310 3672 3151 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393065.1 protein_id gnl|my_center|LOCUS_19310 4913 3720 gene locus_tag LOCUS_19320 gene aroC 4913 3720 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_19320 5784 5014 gene locus_tag LOCUS_19330 5784 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 6430 5792 gene locus_tag LOCUS_19340 gene nfuA 6430 5792 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553665.1 protein_id gnl|my_center|LOCUS_19340 6461 7204 gene locus_tag LOCUS_19350 6461 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727299.1 protein_id gnl|my_center|LOCUS_19350 7526 7236 gene locus_tag LOCUS_19360 7526 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 7650 7862 gene locus_tag LOCUS_19370 7650 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 8404 7877 gene locus_tag LOCUS_19380 8404 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 8963 8445 gene locus_tag LOCUS_19390 8963 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 10251 8983 gene locus_tag LOCUS_19400 gene tyrS 10251 8983 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_19400 11997 10312 gene locus_tag LOCUS_19410 gene menD 11997 10312 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_19410 12051 12761 gene locus_tag LOCUS_19420 gene menH 12051 12761 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_19420 <13617 12823 gene locus_tag LOCUS_19430 <13617 12823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776415.1:1,4-dihydroxy-2-naphthoate polyprenyltransferase >Feature sequence096 1626 868 gene locus_tag LOCUS_19440 1626 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1774 2166 gene locus_tag LOCUS_19450 1774 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2170 2511 gene locus_tag LOCUS_19460 2170 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 3142 2531 gene locus_tag LOCUS_19470 3142 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4040 3576 gene locus_tag LOCUS_19480 4040 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 4594 4037 gene locus_tag LOCUS_19490 4594 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 4689 5444 gene locus_tag LOCUS_19500 4689 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5576 5651 gene locus_tag LOCUS_t00260 5576 5651 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6302 5895 gene locus_tag LOCUS_19510 6302 5895 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401566.1 protein_id gnl|my_center|LOCUS_19510 6520 6299 gene locus_tag LOCUS_19520 gene vapB2 6520 6299 CDS product type II toxin-antitoxin system antitoxin VapB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401563.1 protein_id gnl|my_center|LOCUS_19520 7217 6840 gene locus_tag LOCUS_19530 7217 6840 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_19530 7380 9119 gene locus_tag LOCUS_19540 7380 9119 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031418.1 protein_id gnl|my_center|LOCUS_19540 9363 9160 gene locus_tag LOCUS_19550 9363 9160 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_19550 9765 9475 gene locus_tag LOCUS_19560 9765 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 10166 9768 gene locus_tag LOCUS_19570 10166 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 11392 10457 gene locus_tag LOCUS_19580 11392 10457 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057210.1 protein_id gnl|my_center|LOCUS_19580 11493 12986 gene locus_tag LOCUS_19590 11493 12986 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence097 1110 691 gene locus_tag LOCUS_19600 1110 691 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721477.1 protein_id gnl|my_center|LOCUS_19600 1879 1307 gene locus_tag LOCUS_19610 1879 1307 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 protein_id gnl|my_center|LOCUS_19610 2405 3169 gene locus_tag LOCUS_19620 2405 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3374 3589 gene locus_tag LOCUS_19630 gene vapB26 3374 3589 CDS product type II toxin-antitoxin system antitoxin VapB26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403039.1 protein_id gnl|my_center|LOCUS_19630 3567 4016 gene locus_tag LOCUS_19640 gene vapC26 3567 4016 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_19640 4344 4532 gene locus_tag LOCUS_19650 4344 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 5668 4805 gene locus_tag LOCUS_19660 5668 4805 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_19660 6246 5665 gene locus_tag LOCUS_19670 6246 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 7353 6469 gene locus_tag LOCUS_19680 7353 6469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227235.1 protein_id gnl|my_center|LOCUS_19680 8305 7346 gene locus_tag LOCUS_19690 8305 7346 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_19690 8381 8872 gene locus_tag LOCUS_19700 8381 8872 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229400.1 protein_id gnl|my_center|LOCUS_19700 9090 9740 gene locus_tag LOCUS_19710 9090 9740 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730704.1 protein_id gnl|my_center|LOCUS_19710 9865 10662 gene locus_tag LOCUS_19720 gene tam 9865 10662 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705336.1 protein_id gnl|my_center|LOCUS_19720 10800 11045 gene locus_tag LOCUS_19730 10800 11045 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_19730 11042 11431 gene locus_tag LOCUS_19740 11042 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 12115 11780 gene locus_tag LOCUS_19750 12115 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 12334 12825 gene locus_tag LOCUS_19760 12334 12825 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence098 1739 1338 gene locus_tag LOCUS_19770 1739 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1915 1736 gene locus_tag LOCUS_19780 1915 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2829 1912 gene locus_tag LOCUS_19790 2829 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3730 2819 gene locus_tag LOCUS_19800 3730 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 3930 4466 gene locus_tag LOCUS_19810 3930 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 4877 5728 gene locus_tag LOCUS_19820 4877 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 5731 6285 gene locus_tag LOCUS_19830 5731 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 6664 6395 gene locus_tag LOCUS_19840 6664 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 6624 7550 gene locus_tag LOCUS_19850 6624 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 7547 8575 gene locus_tag LOCUS_19860 7547 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 8572 10383 gene locus_tag LOCUS_19870 8572 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence099 480 49 gene locus_tag LOCUS_19880 480 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742169.1 protein_id gnl|my_center|LOCUS_19880 645 1814 gene locus_tag LOCUS_19890 gene glmU 645 1814 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_19890 1825 2805 gene locus_tag LOCUS_19900 1825 2805 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032836384.1 protein_id gnl|my_center|LOCUS_19900 2834 3958 gene locus_tag LOCUS_19910 2834 3958 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_19910 4123 4773 gene locus_tag LOCUS_19920 4123 4773 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_19920 4936 5430 gene locus_tag LOCUS_19930 gene pth 4936 5430 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 protein_id gnl|my_center|LOCUS_19930 5438 9061 gene locus_tag LOCUS_19940 gene mfd 5438 9061 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068204100.1 protein_id gnl|my_center|LOCUS_19940 9117 10739 gene locus_tag LOCUS_19950 gene mazG 9117 10739 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142588.1 protein_id gnl|my_center|LOCUS_19950 10805 12349 gene locus_tag LOCUS_19960 10805 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence100 1166 1639 gene locus_tag LOCUS_19970 1166 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1716 2843 gene locus_tag LOCUS_19980 1716 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2923 4146 gene locus_tag LOCUS_19990 2923 4146 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_19990 4337 6466 gene locus_tag LOCUS_20000 gene nrdJ 4337 6466 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_20000 6497 7216 gene locus_tag LOCUS_20010 6497 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 7273 8013 gene locus_tag LOCUS_20020 7273 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 8010 9470 gene locus_tag LOCUS_20030 8010 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 9514 10257 gene locus_tag LOCUS_20040 9514 10257 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804305.1 protein_id gnl|my_center|LOCUS_20040 10257 11180 gene locus_tag LOCUS_20050 10257 11180 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056998.1 protein_id gnl|my_center|LOCUS_20050 11180 11890 gene locus_tag LOCUS_20060 11180 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 11887 12339 gene locus_tag LOCUS_20070 11887 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence101 670 879 gene locus_tag LOCUS_20080 gene rpmB 670 879 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_20080 985 2187 gene locus_tag LOCUS_20090 985 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3185 2223 gene locus_tag LOCUS_20100 3185 2223 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 protein_id gnl|my_center|LOCUS_20100 3348 5156 gene locus_tag LOCUS_20110 3348 5156 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_20110 5268 7013 gene locus_tag LOCUS_20120 5268 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 8241 7060 gene locus_tag LOCUS_20130 8241 7060 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931215.1 protein_id gnl|my_center|LOCUS_20130 8346 9227 gene locus_tag LOCUS_20140 8346 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 10327 9182 gene locus_tag LOCUS_20150 gene trpD 10327 9182 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_20150 12117 10327 gene locus_tag LOCUS_20160 12117 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 12515 12117 gene locus_tag LOCUS_20170 gene tnpA 12515 12117 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435056.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence102 2335 1475 gene locus_tag LOCUS_20180 2335 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 6217 2396 gene locus_tag LOCUS_20190 6217 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 6841 6257 gene locus_tag LOCUS_20200 6841 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 7081 6878 gene locus_tag LOCUS_20210 7081 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 8902 7106 gene locus_tag LOCUS_20220 8902 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 9918 8902 gene locus_tag LOCUS_20230 9918 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 10487 9915 gene locus_tag LOCUS_20240 10487 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 11146 10535 gene locus_tag LOCUS_20250 11146 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 11284 12534 gene locus_tag LOCUS_20260 11284 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence103 1124 342 gene locus_tag LOCUS_20270 1124 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2945 1164 gene locus_tag LOCUS_20280 gene cydC 2945 1164 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_20280 4765 2942 gene locus_tag LOCUS_20290 4765 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20290 5357 6787 gene locus_tag LOCUS_20300 gene xseA 5357 6787 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_20300 6787 7140 gene locus_tag LOCUS_20310 6787 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 7201 7932 gene locus_tag LOCUS_20320 7201 7932 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_20320 7974 9194 gene locus_tag LOCUS_20330 7974 9194 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_20330 11427 9118 gene locus_tag LOCUS_20340 11427 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 12380 11424 gene locus_tag LOCUS_20350 12380 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 12694 12416 gene locus_tag LOCUS_20360 12694 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence104 1602 208 gene locus_tag LOCUS_20370 1602 208 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099715.1 protein_id gnl|my_center|LOCUS_20370 2701 2387 gene locus_tag LOCUS_20380 2701 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2618 2818 gene locus_tag LOCUS_20390 2618 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2931 4952 gene locus_tag LOCUS_20400 2931 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4912 5526 gene locus_tag LOCUS_20410 4912 5526 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_20410 5554 6426 gene locus_tag LOCUS_20420 5554 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 6423 7550 gene locus_tag LOCUS_20430 6423 7550 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_20430 7711 11427 gene locus_tag LOCUS_20440 7711 11427 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026932.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence105 <1 613 gene locus_tag LOCUS_20450 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068236.1:DNA polymerase I 740 2281 gene locus_tag LOCUS_20460 gene rpsA 740 2281 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950568.1 protein_id gnl|my_center|LOCUS_20460 2328 3695 gene locus_tag LOCUS_20470 2328 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 5082 3682 gene locus_tag LOCUS_20480 5082 3682 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_20480 5162 6130 gene locus_tag LOCUS_20490 5162 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 6257 7570 gene locus_tag LOCUS_20500 6257 7570 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_20500 12132 7504 gene locus_tag LOCUS_20510 12132 7504 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence106 389 1570 gene locus_tag LOCUS_20520 389 1570 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919764.1 protein_id gnl|my_center|LOCUS_20520 1849 2178 gene locus_tag LOCUS_20530 1849 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2136 2738 gene locus_tag LOCUS_20540 2136 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3284 3126 gene locus_tag LOCUS_20550 3284 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 3562 3356 gene locus_tag LOCUS_20560 3562 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5125 3590 gene locus_tag LOCUS_20570 5125 3590 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 protein_id gnl|my_center|LOCUS_20570 5885 5238 gene locus_tag LOCUS_20580 5885 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 7132 5924 gene locus_tag LOCUS_20590 7132 5924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_20590 7875 7129 gene locus_tag LOCUS_20600 7875 7129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_20600 9263 7872 gene locus_tag LOCUS_20610 9263 7872 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222424.1 protein_id gnl|my_center|LOCUS_20610 11321 9624 gene locus_tag LOCUS_20620 11321 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 12043 11318 gene locus_tag LOCUS_20630 12043 11318 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence107 716 168 gene locus_tag LOCUS_20640 716 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1570 716 gene locus_tag LOCUS_20650 1570 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1954 2769 gene locus_tag LOCUS_20660 1954 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228707.1 protein_id gnl|my_center|LOCUS_20660 2850 3182 gene locus_tag LOCUS_20670 2850 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3130 3339 gene locus_tag LOCUS_20680 3130 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20680 4233 3601 gene locus_tag LOCUS_20690 4233 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4340 5119 gene locus_tag LOCUS_20700 gene fabG 4340 5119 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_20700 5895 5638 gene locus_tag LOCUS_20710 5895 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 5870 6172 gene locus_tag LOCUS_20720 5870 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20720 6449 6955 gene locus_tag LOCUS_20730 6449 6955 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_20730 7928 7254 gene locus_tag LOCUS_20740 7928 7254 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166534399.1 protein_id gnl|my_center|LOCUS_20740 8130 7984 gene locus_tag LOCUS_20750 8130 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 8565 8197 gene locus_tag LOCUS_20760 8565 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 8640 10064 gene locus_tag LOCUS_20770 8640 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 10391 11362 gene locus_tag LOCUS_20780 10391 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 11581 11889 gene locus_tag LOCUS_20790 11581 11889 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212552.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence108 568 191 gene locus_tag LOCUS_20800 568 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1846 653 gene locus_tag LOCUS_20810 1846 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2084 2177 gene locus_tag LOCUS_t00270 2084 2177 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2744 3109 gene locus_tag LOCUS_20820 2744 3109 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_20820 3156 4070 gene locus_tag LOCUS_20830 3156 4070 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_20830 4130 4540 gene locus_tag LOCUS_20840 4130 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4620 5879 gene locus_tag LOCUS_20850 4620 5879 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082252.1 protein_id gnl|my_center|LOCUS_20850 5267 5276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6081 7775 gene locus_tag LOCUS_20860 6081 7775 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_20860 7898 9337 gene locus_tag LOCUS_20870 7898 9337 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_20870 8969 9058 gene locus_tag LOCUS_t00280 8969 9058 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9331 10101 gene locus_tag LOCUS_20880 9331 10101 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_20880 10098 11258 gene locus_tag LOCUS_20890 10098 11258 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_20890 11999 11301 gene locus_tag LOCUS_20900 11999 11301 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence109 35 109 gene locus_tag LOCUS_t00290 35 109 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 645 235 gene locus_tag LOCUS_20910 645 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1233 2687 gene locus_tag LOCUS_20920 1233 2687 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727425.1 protein_id gnl|my_center|LOCUS_20920 2684 2842 gene locus_tag LOCUS_20930 2684 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3361 2882 gene locus_tag LOCUS_20940 3361 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 4569 6212 gene locus_tag LOCUS_20950 4569 6212 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550958.1 protein_id gnl|my_center|LOCUS_20950 8563 6704 gene locus_tag LOCUS_20960 8563 6704 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 protein_id gnl|my_center|LOCUS_20960 9148 9507 gene locus_tag LOCUS_20970 gene cmtR 9148 9507 CDS product Cd(II)/Pb(II)-sensing metalloregulatory transcriptional regulator CmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410018.1 protein_id gnl|my_center|LOCUS_20970 9540 10418 gene locus_tag LOCUS_20980 9540 10418 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_20980 10508 11044 gene locus_tag LOCUS_20990 10508 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 11902 11096 gene locus_tag LOCUS_21000 11902 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence110 2141 648 gene locus_tag LOCUS_21010 2141 648 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_21010 3990 2176 gene locus_tag LOCUS_21020 3990 2176 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597405.1 protein_id gnl|my_center|LOCUS_21020 4643 4179 gene locus_tag LOCUS_21030 4643 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 5719 4640 gene locus_tag LOCUS_21040 gene rsmH 5719 4640 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_21040 6213 5800 gene locus_tag LOCUS_21050 gene mraZ 6213 5800 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358778.1 protein_id gnl|my_center|LOCUS_21050 7222 6515 gene locus_tag LOCUS_21060 7222 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 7740 7192 gene locus_tag LOCUS_21070 7740 7192 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840499.1 protein_id gnl|my_center|LOCUS_21070 8914 7994 gene locus_tag LOCUS_21080 8914 7994 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_21080 9267 8878 gene locus_tag LOCUS_21090 9267 8878 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_21090 9756 9472 gene locus_tag LOCUS_21100 9756 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 10494 9826 gene locus_tag LOCUS_21110 gene msrA 10494 9826 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_21110 10667 11995 gene locus_tag LOCUS_21120 gene egtB 10667 11995 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence111 <1 939 gene locus_tag LOCUS_21130 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089481.1:FAD-dependent oxidoreductase 1000 2859 gene locus_tag LOCUS_21140 1000 2859 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_21140 2866 3918 gene locus_tag LOCUS_21150 2866 3918 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_21150 3955 5655 gene locus_tag LOCUS_21160 3955 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 6009 7724 gene locus_tag LOCUS_21170 6009 7724 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_21170 8796 7705 gene locus_tag LOCUS_21180 8796 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 9038 9772 gene locus_tag LOCUS_21190 9038 9772 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223072.1 protein_id gnl|my_center|LOCUS_21190 10586 9720 gene locus_tag LOCUS_21200 10586 9720 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_21200 10759 10935 gene locus_tag LOCUS_21210 10759 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 10944 11096 gene locus_tag LOCUS_21220 10944 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 12062 11154 gene locus_tag LOCUS_21230 12062 11154 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence112 542 471 gene locus_tag LOCUS_t00300 542 471 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 678 2852 gene locus_tag LOCUS_21240 678 2852 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_21240 3394 2909 gene locus_tag LOCUS_21250 3394 2909 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 protein_id gnl|my_center|LOCUS_21250 3578 5065 gene locus_tag LOCUS_21260 3578 5065 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_21260 5825 5070 gene locus_tag LOCUS_21270 gene gpmA 5825 5070 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940195.1 protein_id gnl|my_center|LOCUS_21270 6035 7885 gene locus_tag LOCUS_21280 gene dnaK 6035 7885 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_21280 7882 8577 gene locus_tag LOCUS_21290 7882 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 8581 9711 gene locus_tag LOCUS_21300 gene dnaJ 8581 9711 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_21300 9714 10178 gene locus_tag LOCUS_21310 9714 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence113 788 1114 gene locus_tag LOCUS_21320 788 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1114 1332 gene locus_tag LOCUS_21330 1114 1332 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407785.1 protein_id gnl|my_center|LOCUS_21330 2122 2712 gene locus_tag LOCUS_21340 2122 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21340 2700 3497 gene locus_tag LOCUS_21350 2700 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21350 3499 4392 gene locus_tag LOCUS_21360 3499 4392 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026878.1 protein_id gnl|my_center|LOCUS_21360 4389 4751 gene locus_tag LOCUS_21370 4389 4751 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 protein_id gnl|my_center|LOCUS_21370 4729 5976 gene locus_tag LOCUS_21380 4729 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 6089 6505 gene locus_tag LOCUS_21390 6089 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 6895 6701 gene locus_tag LOCUS_21400 6895 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 8108 7230 gene locus_tag LOCUS_21410 8108 7230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_21410 9033 8101 gene locus_tag LOCUS_21420 9033 8101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_21420 9218 9024 gene locus_tag LOCUS_21430 9218 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 9393 10613 gene locus_tag LOCUS_21440 9393 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 10610 11281 gene locus_tag LOCUS_21450 10610 11281 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_21450 11824 11585 gene locus_tag LOCUS_21460 11824 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence114 1042 461 gene locus_tag LOCUS_21470 gene kdpC 1042 461 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973321.1 protein_id gnl|my_center|LOCUS_21470 3224 1092 gene locus_tag LOCUS_21480 gene kdpB 3224 1092 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391516.1 protein_id gnl|my_center|LOCUS_21480 4988 3270 gene locus_tag LOCUS_21490 gene kdpA 4988 3270 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391515.1 protein_id gnl|my_center|LOCUS_21490 5434 8115 gene locus_tag LOCUS_21500 5434 8115 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223788.1 protein_id gnl|my_center|LOCUS_21500 8112 8798 gene locus_tag LOCUS_21510 8112 8798 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_21510 8921 9175 gene locus_tag LOCUS_21520 8921 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 9429 9211 gene locus_tag LOCUS_21530 9429 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 9310 9549 gene locus_tag LOCUS_21540 9310 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 10130 9699 gene locus_tag LOCUS_21550 10130 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 10354 10127 gene locus_tag LOCUS_21560 10354 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 10489 10878 gene locus_tag LOCUS_21570 10489 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 11770 11180 gene locus_tag LOCUS_21580 11770 11180 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031787.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence115 1237 86 gene locus_tag LOCUS_21590 1237 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 4316 1215 gene locus_tag LOCUS_21600 4316 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 5509 4313 gene locus_tag LOCUS_21610 5509 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 5718 5506 gene locus_tag LOCUS_21620 5718 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 7019 5718 gene locus_tag LOCUS_21630 gene dnaB 7019 5718 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_21630 7453 7016 gene locus_tag LOCUS_21640 7453 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 7758 7450 gene locus_tag LOCUS_21650 7758 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 8333 7755 gene locus_tag LOCUS_21660 8333 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 8735 8487 gene locus_tag LOCUS_21670 8735 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 8792 9514 gene locus_tag LOCUS_21680 8792 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 9772 10089 gene locus_tag LOCUS_21690 9772 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 10086 11891 gene locus_tag LOCUS_21700 10086 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence116 310 513 gene locus_tag LOCUS_21710 310 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1272 880 gene locus_tag LOCUS_21720 1272 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2588 1287 gene locus_tag LOCUS_21730 2588 1287 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 protein_id gnl|my_center|LOCUS_21730 3217 2843 gene locus_tag LOCUS_21740 3217 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3220 3678 gene locus_tag LOCUS_21750 3220 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5679 3850 gene locus_tag LOCUS_21760 5679 3850 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670186.1 protein_id gnl|my_center|LOCUS_21760 6920 5955 gene locus_tag LOCUS_21770 6920 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 7849 6917 gene locus_tag LOCUS_21780 7849 6917 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225097.1 protein_id gnl|my_center|LOCUS_21780 9093 7846 gene locus_tag LOCUS_21790 9093 7846 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103051.1 protein_id gnl|my_center|LOCUS_21790 10396 9170 gene locus_tag LOCUS_21800 10396 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 12047 10410 gene locus_tag LOCUS_21810 12047 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence117 652 2439 gene locus_tag LOCUS_21820 652 2439 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 protein_id gnl|my_center|LOCUS_21820 3141 2479 gene locus_tag LOCUS_21830 3141 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 3506 3180 gene locus_tag LOCUS_21840 3506 3180 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123088.1 protein_id gnl|my_center|LOCUS_21840 4064 4429 gene locus_tag LOCUS_21850 4064 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 7673 4467 gene locus_tag LOCUS_21860 gene dnaE2 7673 4467 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908228.1 protein_id gnl|my_center|LOCUS_21860 8946 7717 gene locus_tag LOCUS_21870 8946 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 9560 8943 gene locus_tag LOCUS_21880 9560 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229209.1 protein_id gnl|my_center|LOCUS_21880 9633 11633 gene locus_tag LOCUS_21890 9633 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence118 1174 1932 gene locus_tag LOCUS_21900 1174 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2222 2046 gene locus_tag LOCUS_21910 2222 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2807 2241 gene locus_tag LOCUS_21920 2807 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 3485 2985 gene locus_tag LOCUS_21930 3485 2985 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_21930 3767 3495 gene locus_tag LOCUS_21940 3767 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 4155 3769 gene locus_tag LOCUS_21950 4155 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 4408 4133 gene locus_tag LOCUS_21960 4408 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 5080 4463 gene locus_tag LOCUS_21970 5080 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 5712 5191 gene locus_tag LOCUS_21980 5712 5191 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104932.1 protein_id gnl|my_center|LOCUS_21980 6800 5775 gene locus_tag LOCUS_21990 6800 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227554.1 protein_id gnl|my_center|LOCUS_21990 7757 7128 gene locus_tag LOCUS_22000 gene merB 7757 7128 CDS product organomercurial lyase MerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790334.1 protein_id gnl|my_center|LOCUS_22000 8032 8418 gene locus_tag LOCUS_22010 8032 8418 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296233.1 protein_id gnl|my_center|LOCUS_22010 8415 8792 gene locus_tag LOCUS_22020 8415 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 9094 8774 gene locus_tag LOCUS_22030 9094 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 9741 9082 gene locus_tag LOCUS_22040 9741 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 10253 9843 gene locus_tag LOCUS_22050 10253 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 10207 10461 gene locus_tag LOCUS_22060 10207 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 10392 10625 gene locus_tag LOCUS_22070 10392 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 11224 10559 gene locus_tag LOCUS_22080 11224 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 11931 11221 gene locus_tag LOCUS_22090 11931 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence119 980 339 gene locus_tag LOCUS_22100 980 339 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226530.1 protein_id gnl|my_center|LOCUS_22100 1191 2207 gene locus_tag LOCUS_22110 1191 2207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_22110 2204 2938 gene locus_tag LOCUS_22120 2204 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 3815 3507 gene locus_tag LOCUS_22130 3815 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 5782 4970 gene locus_tag LOCUS_22140 5782 4970 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_22140 7469 5910 gene locus_tag LOCUS_22150 7469 5910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030563.1 protein_id gnl|my_center|LOCUS_22150 7593 8201 gene locus_tag LOCUS_22160 7593 8201 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730269.1 protein_id gnl|my_center|LOCUS_22160 9052 8504 gene locus_tag LOCUS_22170 9052 8504 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_22170 9054 9392 gene locus_tag LOCUS_22180 9054 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 10044 9520 gene locus_tag LOCUS_22190 10044 9520 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877376.1 protein_id gnl|my_center|LOCUS_22190 10090 10764 gene locus_tag LOCUS_22200 10090 10764 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728323.1 protein_id gnl|my_center|LOCUS_22200 11688 11443 gene locus_tag LOCUS_22210 11688 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940650.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence120 1594 578 gene locus_tag LOCUS_22220 gene speB 1594 578 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_22220 2322 1606 gene locus_tag LOCUS_22230 2322 1606 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228766.1 protein_id gnl|my_center|LOCUS_22230 3865 2402 gene locus_tag LOCUS_22240 3865 2402 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_22240 4071 4143 gene locus_tag LOCUS_t00310 4071 4143 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4296 5069 gene locus_tag LOCUS_22250 gene ddaH 4296 5069 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 protein_id gnl|my_center|LOCUS_22250 5266 5733 gene locus_tag LOCUS_22260 5266 5733 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079498.1 protein_id gnl|my_center|LOCUS_22260 6901 5801 gene locus_tag LOCUS_22270 6901 5801 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225984036.1 protein_id gnl|my_center|LOCUS_22270 7594 7073 gene locus_tag LOCUS_22280 7594 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 8168 7566 gene locus_tag LOCUS_22290 8168 7566 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_22290 8554 8309 gene locus_tag LOCUS_22300 8554 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 9983 8691 gene locus_tag LOCUS_22310 gene dinB 9983 8691 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_22310 10830 10093 gene locus_tag LOCUS_22320 10830 10093 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_22320 11297 10827 gene locus_tag LOCUS_22330 gene nrdR 11297 10827 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224266.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence121 518 1900 gene locus_tag LOCUS_22340 518 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2566 1937 gene locus_tag LOCUS_22350 2566 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3359 2616 gene locus_tag LOCUS_22360 3359 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3964 3404 gene locus_tag LOCUS_22370 3964 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 5129 4032 gene locus_tag LOCUS_22380 5129 4032 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_22380 5314 7767 gene locus_tag LOCUS_22390 5314 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 8446 7757 gene locus_tag LOCUS_22400 8446 7757 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640373.1 protein_id gnl|my_center|LOCUS_22400 8740 9375 gene locus_tag LOCUS_22410 8740 9375 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_22410 9930 9394 gene locus_tag LOCUS_22420 gene orn 9930 9394 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_22420 10020 10472 gene locus_tag LOCUS_22430 gene dut 10020 10472 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence122 455 174 gene locus_tag LOCUS_22440 455 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 512 428 gene locus_tag LOCUS_t00320 512 428 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2581 578 gene locus_tag LOCUS_22450 2581 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2847 2617 gene locus_tag LOCUS_22460 gene secG 2847 2617 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 protein_id gnl|my_center|LOCUS_22460 3784 2963 gene locus_tag LOCUS_22470 gene tpiA 3784 2963 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_22470 5009 3804 gene locus_tag LOCUS_22480 5009 3804 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_22480 6040 5006 gene locus_tag LOCUS_22490 gene gap 6040 5006 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_22490 7146 6037 gene locus_tag LOCUS_22500 7146 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 7347 8126 gene locus_tag LOCUS_22510 7347 8126 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404626.1 protein_id gnl|my_center|LOCUS_22510 8145 8831 gene locus_tag LOCUS_22520 8145 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 8860 9702 gene locus_tag LOCUS_22530 8860 9702 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_22530 9714 10631 gene locus_tag LOCUS_22540 9714 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence123 756 1022 gene locus_tag LOCUS_22550 756 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2764 1400 gene locus_tag LOCUS_22560 2764 1400 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031374.1 protein_id gnl|my_center|LOCUS_22560 4212 2761 gene locus_tag LOCUS_22570 4212 2761 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031373.1 protein_id gnl|my_center|LOCUS_22570 5693 4218 gene locus_tag LOCUS_22580 5693 4218 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031372.1 protein_id gnl|my_center|LOCUS_22580 7216 5690 gene locus_tag LOCUS_22590 7216 5690 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229315.1 protein_id gnl|my_center|LOCUS_22590 8115 7249 gene locus_tag LOCUS_22600 8115 7249 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877583.1 protein_id gnl|my_center|LOCUS_22600 8497 8168 gene locus_tag LOCUS_22610 8497 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 9592 9170 gene locus_tag LOCUS_22620 gene vapC26 9592 9170 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_22620 9811 9596 gene locus_tag LOCUS_22630 gene vapB26 9811 9596 CDS product type II toxin-antitoxin system antitoxin VapB26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403039.1 protein_id gnl|my_center|LOCUS_22630 10680 10261 gene locus_tag LOCUS_22640 10680 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence124 578 1948 gene locus_tag LOCUS_22650 578 1948 CDS product IS1380-like element ISMsm3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726768.1 protein_id gnl|my_center|LOCUS_22650 2577 2771 gene locus_tag LOCUS_22660 2577 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3288 2947 gene locus_tag LOCUS_22670 3288 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4102 3275 gene locus_tag LOCUS_22680 4102 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4858 4511 gene locus_tag LOCUS_22690 4858 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 5511 4855 gene locus_tag LOCUS_22700 5511 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 6010 5600 gene locus_tag LOCUS_22710 6010 5600 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_22710 6253 6011 gene locus_tag LOCUS_22720 6253 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 7350 8384 gene locus_tag LOCUS_22730 7350 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 9405 8878 gene locus_tag LOCUS_22740 9405 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence125 560 1225 gene locus_tag LOCUS_22750 560 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1269 2294 gene locus_tag LOCUS_22760 1269 2294 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_22760 2355 2969 gene locus_tag LOCUS_22770 2355 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 3041 4180 gene locus_tag LOCUS_22780 3041 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 4388 4203 gene locus_tag LOCUS_22790 4388 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 4661 4395 gene locus_tag LOCUS_22800 4661 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 5833 4712 gene locus_tag LOCUS_22810 5833 4712 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 protein_id gnl|my_center|LOCUS_22810 6420 5866 gene locus_tag LOCUS_22820 6420 5866 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_22820 6714 6427 gene locus_tag LOCUS_22830 6714 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 7200 6895 gene locus_tag LOCUS_22840 7200 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 7639 7391 gene locus_tag LOCUS_22850 7639 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 8096 7905 gene locus_tag LOCUS_22860 8096 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 8547 8143 gene locus_tag LOCUS_22870 8547 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 8778 8563 gene locus_tag LOCUS_22880 8778 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 9394 8825 gene locus_tag LOCUS_22890 9394 8825 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975272.1 protein_id gnl|my_center|LOCUS_22890 9544 9398 gene locus_tag LOCUS_22900 9544 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 10144 9590 gene locus_tag LOCUS_22910 10144 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 10908 10231 gene locus_tag LOCUS_22920 10908 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence126 603 166 gene locus_tag LOCUS_22930 603 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1133 2818 gene locus_tag LOCUS_22940 1133 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3836 2871 gene locus_tag LOCUS_22950 3836 2871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892061.1 protein_id gnl|my_center|LOCUS_22950 4862 3849 gene locus_tag LOCUS_22960 4862 3849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_22960 5944 4856 gene locus_tag LOCUS_22970 5944 4856 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 protein_id gnl|my_center|LOCUS_22970 6975 5941 gene locus_tag LOCUS_22980 6975 5941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727086.1 protein_id gnl|my_center|LOCUS_22980 9421 7169 gene locus_tag LOCUS_22990 9421 7169 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_22990 9644 10777 gene locus_tag LOCUS_23000 9644 10777 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030634.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence127 1062 217 gene locus_tag LOCUS_23010 1062 217 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 protein_id gnl|my_center|LOCUS_23010 1331 2848 gene locus_tag LOCUS_23020 1331 2848 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228807.1 protein_id gnl|my_center|LOCUS_23020 2845 3570 gene locus_tag LOCUS_23030 2845 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3567 7121 gene locus_tag LOCUS_23040 gene cobN 3567 7121 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028008.1 protein_id gnl|my_center|LOCUS_23040 7118 9025 gene locus_tag LOCUS_23050 7118 9025 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728474.1 protein_id gnl|my_center|LOCUS_23050 9025 9543 gene locus_tag LOCUS_23060 gene cobU 9025 9543 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198615.1 protein_id gnl|my_center|LOCUS_23060 9543 10259 gene locus_tag LOCUS_23070 gene cobS 9543 10259 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140155.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence128 107 2005 gene locus_tag LOCUS_23080 107 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2097 3002 gene locus_tag LOCUS_23090 2097 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2999 4276 gene locus_tag LOCUS_23100 2999 4276 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968789.1 protein_id gnl|my_center|LOCUS_23100 4293 4739 gene locus_tag LOCUS_23110 4293 4739 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_23110 6147 5569 gene locus_tag LOCUS_23120 6147 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 6342 7064 gene locus_tag LOCUS_23130 6342 7064 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_23130 7103 7801 gene locus_tag LOCUS_23140 7103 7801 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052739315.1 protein_id gnl|my_center|LOCUS_23140 7805 8686 gene locus_tag LOCUS_23150 7805 8686 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970078.1 protein_id gnl|my_center|LOCUS_23150 8737 10644 gene locus_tag LOCUS_23160 8737 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence129 120 671 gene locus_tag LOCUS_23170 120 671 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966530.1 protein_id gnl|my_center|LOCUS_23170 668 3085 gene locus_tag LOCUS_23180 668 3085 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929962.1 protein_id gnl|my_center|LOCUS_23180 3106 3555 gene locus_tag LOCUS_23190 3106 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4236 3631 gene locus_tag LOCUS_23200 4236 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4348 5685 gene locus_tag LOCUS_23210 4348 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 5789 6679 gene locus_tag LOCUS_23220 5789 6679 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_23220 6693 7727 gene locus_tag LOCUS_23230 6693 7727 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894640.1 protein_id gnl|my_center|LOCUS_23230 7724 8560 gene locus_tag LOCUS_23240 7724 8560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_23240 8562 9353 gene locus_tag LOCUS_23250 8562 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23250 9355 10758 gene locus_tag LOCUS_23260 9355 10758 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727681.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence130 302 631 gene locus_tag LOCUS_23270 302 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 729 1853 gene locus_tag LOCUS_23280 729 1853 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_23280 1887 2270 gene locus_tag LOCUS_23290 1887 2270 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228341.1 protein_id gnl|my_center|LOCUS_23290 2971 2327 gene locus_tag LOCUS_23300 2971 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3141 4574 gene locus_tag LOCUS_23310 3141 4574 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223556.1 protein_id gnl|my_center|LOCUS_23310 5302 4619 gene locus_tag LOCUS_23320 5302 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 6640 5615 gene locus_tag LOCUS_23330 6640 5615 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_23330 7593 6637 gene locus_tag LOCUS_23340 7593 6637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_23340 9586 7658 gene locus_tag LOCUS_23350 9586 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence131 422 129 gene locus_tag LOCUS_23360 422 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 1021 419 gene locus_tag LOCUS_23370 gene parA 1021 419 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_23370 1858 2577 gene locus_tag LOCUS_23380 1858 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2816 4540 gene locus_tag LOCUS_23390 2816 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4595 5830 gene locus_tag LOCUS_23400 4595 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5899 6741 gene locus_tag LOCUS_23410 5899 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 7210 6782 gene locus_tag LOCUS_23420 7210 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 7506 7964 gene locus_tag LOCUS_23430 7506 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 8195 8007 gene locus_tag LOCUS_23440 8195 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 9316 8549 gene locus_tag LOCUS_23450 9316 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 10362 9313 gene locus_tag LOCUS_23460 10362 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence132 83 943 gene locus_tag LOCUS_23470 gene pgeF 83 943 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_23470 979 2406 gene locus_tag LOCUS_23480 gene murL 979 2406 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_23480 2403 3818 gene locus_tag LOCUS_23490 gene murD 2403 3818 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 protein_id gnl|my_center|LOCUS_23490 5184 3784 gene locus_tag LOCUS_23500 5184 3784 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219112755.1 protein_id gnl|my_center|LOCUS_23500 5261 5188 gene locus_tag LOCUS_t00330 5261 5188 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6653 5418 gene locus_tag LOCUS_23510 6653 5418 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419637.1 protein_id gnl|my_center|LOCUS_23510 7279 6644 gene locus_tag LOCUS_23520 gene tmk 7279 6644 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173647.1 protein_id gnl|my_center|LOCUS_23520 10194 7300 gene locus_tag LOCUS_23530 gene topA 10194 7300 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence133 1321 323 gene locus_tag LOCUS_23540 1321 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1707 1378 gene locus_tag LOCUS_23550 1707 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2447 1794 gene locus_tag LOCUS_23560 2447 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23560 2707 2417 gene locus_tag LOCUS_23570 2707 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2863 5004 gene locus_tag LOCUS_23580 2863 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 5964 5626 gene locus_tag LOCUS_23590 5964 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 6625 6143 gene locus_tag LOCUS_23600 6625 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 8601 6640 gene locus_tag LOCUS_23610 gene ftsH 8601 6640 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_23610 10295 9585 gene locus_tag LOCUS_23620 10295 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence134 3 1712 gene locus_tag LOCUS_23630 gene acs 3 1712 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_23630 1888 2382 gene locus_tag LOCUS_23640 1888 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 3814 2426 gene locus_tag LOCUS_23650 3814 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4321 3932 gene locus_tag LOCUS_23660 4321 3932 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_23660 4562 4329 gene locus_tag LOCUS_23670 4562 4329 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_23670 4853 4644 gene locus_tag LOCUS_23680 4853 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 6045 4873 gene locus_tag LOCUS_23690 gene thiO 6045 4873 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence135 1033 1107 gene locus_tag LOCUS_t00340 1033 1107 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1259 1615 gene locus_tag LOCUS_23700 1259 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1686 2327 gene locus_tag LOCUS_23710 1686 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23710 2324 2791 gene locus_tag LOCUS_23720 2324 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3038 2751 gene locus_tag LOCUS_23730 3038 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2920 3255 gene locus_tag LOCUS_23740 2920 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3363 3776 gene locus_tag LOCUS_23750 3363 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 5037 3811 gene locus_tag LOCUS_23760 5037 3811 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_23760 6052 5156 gene locus_tag LOCUS_23770 6052 5156 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_23770 6246 6052 gene locus_tag LOCUS_23780 6246 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 7937 6459 gene locus_tag LOCUS_23790 7937 6459 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674117.1 protein_id gnl|my_center|LOCUS_23790 9466 8810 gene locus_tag LOCUS_23800 9466 8810 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384239.1 protein_id gnl|my_center|LOCUS_23800 10085 9786 gene locus_tag LOCUS_23810 10085 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence136 42 419 gene locus_tag LOCUS_23820 gene rpsM 42 419 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105472.1 protein_id gnl|my_center|LOCUS_23820 420 827 gene locus_tag LOCUS_23830 gene rpsK 420 827 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 protein_id gnl|my_center|LOCUS_23830 838 1485 gene locus_tag LOCUS_23840 gene rpsD 838 1485 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_23840 1506 2444 gene locus_tag LOCUS_23850 1506 2444 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_23850 2449 2802 gene locus_tag LOCUS_23860 2449 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2949 3704 gene locus_tag LOCUS_23870 2949 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3825 4274 gene locus_tag LOCUS_23880 gene rplM 3825 4274 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_23880 4277 4669 gene locus_tag LOCUS_23890 gene rpsI 4277 4669 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_23890 4674 5993 gene locus_tag LOCUS_23900 gene glmM 4674 5993 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_23900 6004 7839 gene locus_tag LOCUS_23910 gene glmS 6004 7839 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_23910 7836 8204 gene locus_tag LOCUS_23920 7836 8204 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_23920 8207 9601 gene locus_tag LOCUS_23930 8207 9601 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727745.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence137 647 2644 gene locus_tag LOCUS_23940 647 2644 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_23940 4671 2698 gene locus_tag LOCUS_23950 4671 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4899 5516 gene locus_tag LOCUS_23960 4899 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5519 6040 gene locus_tag LOCUS_23970 5519 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6128 6568 gene locus_tag LOCUS_23980 6128 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 6587 10102 gene locus_tag LOCUS_23990 gene dnaE 6587 10102 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence138 149 1117 gene locus_tag LOCUS_24000 149 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1615 2487 gene locus_tag LOCUS_24010 gene hexR 1615 2487 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 protein_id gnl|my_center|LOCUS_24010 2474 3304 gene locus_tag LOCUS_24020 2474 3304 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_24020 3304 4266 gene locus_tag LOCUS_24030 3304 4266 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_24030 4444 5805 gene locus_tag LOCUS_24040 4444 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 5821 6786 gene locus_tag LOCUS_24050 5821 6786 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118115.1 protein_id gnl|my_center|LOCUS_24050 6783 7643 gene locus_tag LOCUS_24060 6783 7643 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969788.1 protein_id gnl|my_center|LOCUS_24060 7666 9105 gene locus_tag LOCUS_24070 gene xylB 7666 9105 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083938.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence139 542 1729 gene locus_tag LOCUS_24080 542 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1726 2871 gene locus_tag LOCUS_24090 gene murG 1726 2871 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_24090 2861 4276 gene locus_tag LOCUS_24100 gene murC 2861 4276 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_24100 4273 5328 gene locus_tag LOCUS_24110 gene murB 4273 5328 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_24110 5325 6134 gene locus_tag LOCUS_24120 5325 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 6346 7431 gene locus_tag LOCUS_24130 gene ftsZ 6346 7431 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_24130 7445 8140 gene locus_tag LOCUS_24140 7445 8140 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105285.1 protein_id gnl|my_center|LOCUS_24140 8202 8759 gene locus_tag LOCUS_24150 8202 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 8777 9043 gene locus_tag LOCUS_24160 8777 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 9129 10058 gene locus_tag LOCUS_24170 9129 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence140 2856 6338 gene locus_tag LOCUS_24180 2856 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 6468 7682 gene locus_tag LOCUS_24190 6468 7682 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_24190 7807 9198 gene locus_tag LOCUS_24200 7807 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 9387 9869 gene locus_tag LOCUS_24210 9387 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24210 9789 9798 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence141 674 117 gene locus_tag LOCUS_24220 674 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 764 1123 gene locus_tag LOCUS_24230 764 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1123 2352 gene locus_tag LOCUS_24240 1123 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2359 2880 gene locus_tag LOCUS_24250 2359 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3436 3088 gene locus_tag LOCUS_tm00010 3436 3088 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4084 3557 gene locus_tag LOCUS_24260 gene smpB 4084 3557 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_24260 4225 4629 gene locus_tag LOCUS_24270 4225 4629 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_24270 4762 5043 gene locus_tag LOCUS_24280 4762 5043 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730181.1 protein_id gnl|my_center|LOCUS_24280 5063 6028 gene locus_tag LOCUS_24290 5063 6028 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_24290 6154 6927 gene locus_tag LOCUS_24300 gene rph 6154 6927 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_24300 6924 7559 gene locus_tag LOCUS_24310 6924 7559 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_24310 8792 7935 gene locus_tag LOCUS_24320 8792 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 <10074 8930 gene locus_tag LOCUS_24330 <10074 8930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039137.1:glycerate kinase >Feature sequence142 1431 601 gene locus_tag LOCUS_24340 1431 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1333 1527 gene locus_tag LOCUS_24350 1333 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1755 2114 gene locus_tag LOCUS_24360 1755 2114 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229671.1 protein_id gnl|my_center|LOCUS_24360 2111 2587 gene locus_tag LOCUS_24370 2111 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2634 2828 gene locus_tag LOCUS_24380 2634 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2841 3071 gene locus_tag LOCUS_24390 2841 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3143 3427 gene locus_tag LOCUS_24400 3143 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3568 3894 gene locus_tag LOCUS_24410 3568 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 4194 4427 gene locus_tag LOCUS_24420 4194 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 4424 4690 gene locus_tag LOCUS_24430 4424 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 6056 4926 gene locus_tag LOCUS_24440 6056 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 7800 6151 gene locus_tag LOCUS_24450 7800 6151 CDS product IS200/IS605 family element transposase accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028271.1 protein_id gnl|my_center|LOCUS_24450 8433 7843 gene locus_tag LOCUS_24460 8433 7843 CDS product IS607-like element IS1535 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404760.1 protein_id gnl|my_center|LOCUS_24460 8510 8665 gene locus_tag LOCUS_24470 8510 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 8662 9117 gene locus_tag LOCUS_24480 8662 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 9146 9403 gene locus_tag LOCUS_24490 9146 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 9400 9765 gene locus_tag LOCUS_24500 9400 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 10043 9678 gene locus_tag LOCUS_24510 10043 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence143 230 323 gene locus_tag LOCUS_t00350 230 323 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 673 1197 gene locus_tag LOCUS_24520 gene mug 673 1197 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_24520 1268 1633 gene locus_tag LOCUS_24530 1268 1633 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_24530 1671 2585 gene locus_tag LOCUS_24540 1671 2585 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_24540 2645 3124 gene locus_tag LOCUS_24550 2645 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 3206 4480 gene locus_tag LOCUS_24560 3206 4480 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082252.1 protein_id gnl|my_center|LOCUS_24560 4682 6376 gene locus_tag LOCUS_24570 4682 6376 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_24570 6532 7938 gene locus_tag LOCUS_24580 6532 7938 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_24580 7932 8702 gene locus_tag LOCUS_24590 7932 8702 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_24590 8699 9868 gene locus_tag LOCUS_24600 8699 9868 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence144 1317 856 gene locus_tag LOCUS_24610 1317 856 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974727.1 protein_id gnl|my_center|LOCUS_24610 1537 1367 gene locus_tag LOCUS_24620 1537 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2113 1592 gene locus_tag LOCUS_24630 2113 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2609 2127 gene locus_tag LOCUS_24640 2609 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 4345 2765 gene locus_tag LOCUS_24650 4345 2765 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 protein_id gnl|my_center|LOCUS_24650 5011 4631 gene locus_tag LOCUS_24660 5011 4631 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_24660 7191 5071 gene locus_tag LOCUS_24670 7191 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 7339 7734 gene locus_tag LOCUS_24680 7339 7734 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_24680 7866 8288 gene locus_tag LOCUS_24690 7866 8288 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence145 3065 150 gene locus_tag LOCUS_24700 gene ppdK 3065 150 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_24700 4554 3187 gene locus_tag LOCUS_24710 4554 3187 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_24710 5702 4551 gene locus_tag LOCUS_24720 gene hemW 5702 4551 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729894.1 protein_id gnl|my_center|LOCUS_24720 6439 5699 gene locus_tag LOCUS_24730 gene recO 6439 5699 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_24730 6690 6436 gene locus_tag LOCUS_24740 6690 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 7205 6687 gene locus_tag LOCUS_24750 7205 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 7440 7844 gene locus_tag LOCUS_24760 gene msrB 7440 7844 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089781.1 protein_id gnl|my_center|LOCUS_24760 8131 7796 gene locus_tag LOCUS_24770 8131 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 8532 8128 gene locus_tag LOCUS_24780 8532 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 9581 8697 gene locus_tag LOCUS_24790 gene ftsX 9581 8697 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence146 3202 608 gene locus_tag LOCUS_24800 gene xdh 3202 608 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869184.1 protein_id gnl|my_center|LOCUS_24800 3331 3963 gene locus_tag LOCUS_24810 3331 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 5029 3995 gene locus_tag LOCUS_24820 5029 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 5131 6519 gene locus_tag LOCUS_24830 gene hydA 5131 6519 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_24830 6630 6908 gene locus_tag LOCUS_24840 6630 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 8487 6976 gene locus_tag LOCUS_24850 8487 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence147 669 295 gene locus_tag LOCUS_24860 669 295 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095430.1 protein_id gnl|my_center|LOCUS_24860 1115 669 gene locus_tag LOCUS_24870 1115 669 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 protein_id gnl|my_center|LOCUS_24870 1526 1146 gene locus_tag LOCUS_24880 1526 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1638 2051 gene locus_tag LOCUS_24890 1638 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2924 2337 gene locus_tag LOCUS_24900 2924 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 3716 3054 gene locus_tag LOCUS_24910 3716 3054 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_24910 4570 3710 gene locus_tag LOCUS_24920 4570 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 5432 4833 gene locus_tag LOCUS_24930 5432 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24930 6269 5682 gene locus_tag LOCUS_24940 6269 5682 CDS product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414146.1 protein_id gnl|my_center|LOCUS_24940 9073 6893 gene locus_tag LOCUS_24950 9073 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 <9656 9073 gene locus_tag LOCUS_24960 <9656 9073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027316.1:glycosyl hydrolase family 65 protein >Feature sequence148 2204 60 gene locus_tag LOCUS_24970 2204 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2761 2201 gene locus_tag LOCUS_24980 2761 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 3404 2754 gene locus_tag LOCUS_24990 3404 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 5461 3401 gene locus_tag LOCUS_25000 5461 3401 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_25000 7019 5556 gene locus_tag LOCUS_25010 7019 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 7835 7461 gene locus_tag LOCUS_25020 7835 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 9387 8257 gene locus_tag LOCUS_25030 9387 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence149 520 74 gene locus_tag LOCUS_25040 520 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 983 1366 gene locus_tag LOCUS_25050 983 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1605 2126 gene locus_tag LOCUS_25060 1605 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2687 2352 gene locus_tag LOCUS_25070 2687 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 2612 3100 gene locus_tag LOCUS_25080 2612 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3105 3353 gene locus_tag LOCUS_25090 3105 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 3350 3775 gene locus_tag LOCUS_25100 3350 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 4153 3716 gene locus_tag LOCUS_25110 4153 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 4671 4234 gene locus_tag LOCUS_25120 4671 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 4843 5346 gene locus_tag LOCUS_25130 4843 5346 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_25130 5343 5834 gene locus_tag LOCUS_25140 5343 5834 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930412.1 protein_id gnl|my_center|LOCUS_25140 6641 7360 gene locus_tag LOCUS_25150 6641 7360 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_25150 7682 8968 gene locus_tag LOCUS_25160 7682 8968 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084375.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence150 463 1347 gene locus_tag LOCUS_25170 463 1347 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528427.1 protein_id gnl|my_center|LOCUS_25170 1344 2489 gene locus_tag LOCUS_25180 1344 2489 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533159.1 protein_id gnl|my_center|LOCUS_25180 4184 2526 gene locus_tag LOCUS_25190 4184 2526 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_25190 4295 5365 gene locus_tag LOCUS_25200 4295 5365 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234306381.1 protein_id gnl|my_center|LOCUS_25200 5362 6633 gene locus_tag LOCUS_25210 5362 6633 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_25210 6630 7526 gene locus_tag LOCUS_25220 6630 7526 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728150.1 protein_id gnl|my_center|LOCUS_25220 7537 8709 gene locus_tag LOCUS_25230 7537 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence151 <1 5208 gene locus_tag LOCUS_25240 <1 5208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883981.1:DEAD/DEAH box helicase 5205 8072 gene locus_tag LOCUS_25250 5205 8072 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence152 168 830 gene locus_tag LOCUS_25260 168 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1864 890 gene locus_tag LOCUS_25270 1864 890 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606051.1 protein_id gnl|my_center|LOCUS_25270 2883 1852 gene locus_tag LOCUS_25280 gene pdhA 2883 1852 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_25280 3996 3001 gene locus_tag LOCUS_25290 3996 3001 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_25290 3934 4089 gene locus_tag LOCUS_25300 3934 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 4161 5255 gene locus_tag LOCUS_25310 4161 5255 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896739.1 protein_id gnl|my_center|LOCUS_25310 6067 5252 gene locus_tag LOCUS_25320 6067 5252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938017.1 protein_id gnl|my_center|LOCUS_25320 6860 6048 gene locus_tag LOCUS_25330 6860 6048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083875.1 protein_id gnl|my_center|LOCUS_25330 7975 6857 gene locus_tag LOCUS_25340 7975 6857 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_25340 8853 7972 gene locus_tag LOCUS_25350 8853 7972 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence153 1654 692 gene locus_tag LOCUS_25360 gene hemB 1654 692 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776657.1 protein_id gnl|my_center|LOCUS_25360 2596 1700 gene locus_tag LOCUS_25370 2596 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3528 2593 gene locus_tag LOCUS_25380 gene hemC 3528 2593 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260939.1 protein_id gnl|my_center|LOCUS_25380 4805 3525 gene locus_tag LOCUS_25390 4805 3525 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727309.1 protein_id gnl|my_center|LOCUS_25390 5705 4962 gene locus_tag LOCUS_25400 5705 4962 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_25400 6565 5768 gene locus_tag LOCUS_25410 6565 5768 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_25410 6821 6600 gene locus_tag LOCUS_25420 6821 6600 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 protein_id gnl|my_center|LOCUS_25420 7646 6876 gene locus_tag LOCUS_25430 gene proC 7646 6876 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_25430 8272 7772 gene locus_tag LOCUS_25440 8272 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 <9207 8288 gene locus_tag LOCUS_25450 <9207 8288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742053.1:D-inositol-3-phosphate glycosyltransferase >Feature sequence154 <1 920 gene locus_tag LOCUS_25460 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189749554.1:LysM peptidoglycan-binding domain-containing protein 953 1864 gene locus_tag LOCUS_25470 953 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1875 2957 gene locus_tag LOCUS_25480 1875 2957 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417097.1 protein_id gnl|my_center|LOCUS_25480 2987 3946 gene locus_tag LOCUS_25490 gene galE1 2987 3946 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 protein_id gnl|my_center|LOCUS_25490 4748 4017 gene locus_tag LOCUS_25500 gene cofE 4748 4017 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_25500 5682 4735 gene locus_tag LOCUS_25510 gene cofD 5682 4735 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_25510 7779 5767 gene locus_tag LOCUS_25520 7779 5767 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 protein_id gnl|my_center|LOCUS_25520 <9045 7986 gene locus_tag LOCUS_25530 <9045 7986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974200.1:glycerol-3-phosphate dehydrogenase/oxidase >Feature sequence155 1151 1795 gene locus_tag LOCUS_25540 1151 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2693 1719 gene locus_tag LOCUS_25550 2693 1719 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 protein_id gnl|my_center|LOCUS_25550 3166 2783 gene locus_tag LOCUS_25560 3166 2783 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228341.1 protein_id gnl|my_center|LOCUS_25560 4397 3186 gene locus_tag LOCUS_25570 4397 3186 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_25570 4737 4408 gene locus_tag LOCUS_25580 4737 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 5813 4734 gene locus_tag LOCUS_25590 5813 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 6602 5898 gene locus_tag LOCUS_25600 6602 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 6908 8635 gene locus_tag LOCUS_25610 6908 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence156 638 1402 gene locus_tag LOCUS_25620 638 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1914 2549 gene locus_tag LOCUS_25630 1914 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2565 3533 gene locus_tag LOCUS_25640 2565 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3533 4231 gene locus_tag LOCUS_25650 3533 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 4231 4635 gene locus_tag LOCUS_25660 4231 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 4632 4802 gene locus_tag LOCUS_25670 4632 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 7003 4838 gene locus_tag LOCUS_25680 7003 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 7858 7115 gene locus_tag LOCUS_25690 7858 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 7755 8138 gene locus_tag LOCUS_25700 7755 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 8157 8426 gene locus_tag LOCUS_25710 8157 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 8445 8570 gene locus_tag LOCUS_25720 8445 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 8589 8828 gene locus_tag LOCUS_25730 8589 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence157 203 2920 gene locus_tag LOCUS_25740 gene valS 203 2920 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_25740 3147 3500 gene locus_tag LOCUS_25750 3147 3500 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971571.1 protein_id gnl|my_center|LOCUS_25750 3497 3901 gene locus_tag LOCUS_25760 3497 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3909 4745 gene locus_tag LOCUS_25770 3909 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 4811 6487 gene locus_tag LOCUS_25780 gene pgi 4811 6487 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_25780 6567 7604 gene locus_tag LOCUS_25790 gene gnd 6567 7604 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_25790 7609 8280 gene locus_tag LOCUS_25800 gene pgl 7609 8280 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_25800 <8904 8294 gene locus_tag LOCUS_25810 <8904 8294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903689.1:ribose 5-phosphate isomerase A >Feature sequence158 793 2391 gene locus_tag LOCUS_25820 793 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2388 3311 gene locus_tag LOCUS_25830 2388 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3313 4263 gene locus_tag LOCUS_25840 3313 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4619 5809 gene locus_tag LOCUS_25850 4619 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 6775 6119 gene locus_tag LOCUS_25860 6775 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 6902 8104 gene locus_tag LOCUS_25870 6902 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 8112 8495 gene locus_tag LOCUS_25880 8112 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence159 3238 1595 gene locus_tag LOCUS_25890 3238 1595 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_25890 4116 3235 gene locus_tag LOCUS_25900 4116 3235 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_25900 5261 4113 gene locus_tag LOCUS_25910 5261 4113 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227132.1 protein_id gnl|my_center|LOCUS_25910 5543 6727 gene locus_tag LOCUS_25920 5543 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 6729 7520 gene locus_tag LOCUS_25930 6729 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence160 <1 539 gene locus_tag LOCUS_25940 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976613.1:zinc metalloprotease HtpX 603 1268 gene locus_tag LOCUS_25950 603 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_25950 1282 2121 gene locus_tag LOCUS_25960 1282 2121 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086938.1 protein_id gnl|my_center|LOCUS_25960 2356 2060 gene locus_tag LOCUS_25970 2356 2060 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_25970 3741 2353 gene locus_tag LOCUS_25980 gene fumC 3741 2353 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948622.1 protein_id gnl|my_center|LOCUS_25980 5290 4238 gene locus_tag LOCUS_25990 5290 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 6597 5323 gene locus_tag LOCUS_26000 gene dprA 6597 5323 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337288.1 protein_id gnl|my_center|LOCUS_26000 6673 8106 gene locus_tag LOCUS_26010 6673 8106 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226072.1 protein_id gnl|my_center|LOCUS_26010 8429 8250 gene locus_tag LOCUS_26020 8429 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence161 62 637 gene locus_tag LOCUS_26030 gene sigR 62 637 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_26030 761 1003 gene locus_tag LOCUS_26040 761 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 1000 2181 gene locus_tag LOCUS_26050 1000 2181 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_26050 2178 3179 gene locus_tag LOCUS_26060 2178 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 3160 3804 gene locus_tag LOCUS_26070 gene hpt 3160 3804 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_26070 3811 4383 gene locus_tag LOCUS_26080 gene folE 3811 4383 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_26080 4461 5309 gene locus_tag LOCUS_26090 gene folP 4461 5309 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_26090 5306 5827 gene locus_tag LOCUS_26100 5306 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 5824 6192 gene locus_tag LOCUS_26110 gene folB 5824 6192 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113138.1 protein_id gnl|my_center|LOCUS_26110 6176 6667 gene locus_tag LOCUS_26120 6176 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 6784 8556 gene locus_tag LOCUS_26130 6784 8556 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence162 709 26 gene locus_tag LOCUS_26140 709 26 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_26140 1302 706 gene locus_tag LOCUS_26150 1302 706 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_26150 3970 1334 gene locus_tag LOCUS_26160 3970 1334 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_26160 3969 5102 gene locus_tag LOCUS_26170 3969 5102 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083626.1 protein_id gnl|my_center|LOCUS_26170 5103 6188 gene locus_tag LOCUS_26180 gene ychF 5103 6188 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_26180 7228 6266 gene locus_tag LOCUS_26190 7228 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 <8671 7324 gene locus_tag LOCUS_26200 <8671 7324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143598693.1:NADPH-dependent glutamate synthase >Feature sequence163 1798 1511 gene locus_tag LOCUS_26210 1798 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2960 1809 gene locus_tag LOCUS_26220 gene thrC 2960 1809 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_26220 4607 2964 gene locus_tag LOCUS_26230 4607 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 6898 4808 gene locus_tag LOCUS_26240 gene uvrB 6898 4808 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322763.1 protein_id gnl|my_center|LOCUS_26240 7573 6917 gene locus_tag LOCUS_26250 7573 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 8471 7620 gene locus_tag LOCUS_26260 8471 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence164 231 707 gene locus_tag LOCUS_26270 231 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 742 1473 gene locus_tag LOCUS_26280 742 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2206 1601 gene locus_tag LOCUS_26290 2206 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2837 2331 gene locus_tag LOCUS_26300 2837 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2778 2984 gene locus_tag LOCUS_26310 2778 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2988 3122 gene locus_tag LOCUS_26320 2988 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3753 3370 gene locus_tag LOCUS_26330 3753 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3948 3781 gene locus_tag LOCUS_26340 3948 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 4253 4492 gene locus_tag LOCUS_26350 4253 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 4674 5981 gene locus_tag LOCUS_26360 4674 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 5978 6301 gene locus_tag LOCUS_26370 5978 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 6412 7665 gene locus_tag LOCUS_26380 6412 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 8511 7906 gene locus_tag LOCUS_26390 8511 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence165 1013 2353 gene locus_tag LOCUS_26400 1013 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2365 2823 gene locus_tag LOCUS_26410 2365 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2823 5201 gene locus_tag LOCUS_26420 2823 5201 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_26420 5246 6970 gene locus_tag LOCUS_26430 5246 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 8370 7087 gene locus_tag LOCUS_26440 8370 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence166 <1 661 gene locus_tag LOCUS_26450 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880523.1:peroxiredoxin 642 854 gene locus_tag LOCUS_26460 642 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1142 2920 gene locus_tag LOCUS_26470 gene kdpA 1142 2920 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 protein_id gnl|my_center|LOCUS_26470 2917 4998 gene locus_tag LOCUS_26480 gene kdpB 2917 4998 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_26480 5007 5582 gene locus_tag LOCUS_26490 gene kdpC 5007 5582 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_26490 5579 5968 gene locus_tag LOCUS_26500 5579 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 6833 5919 gene locus_tag LOCUS_26510 6833 5919 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_26510 7996 6884 gene locus_tag LOCUS_26520 7996 6884 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence167 56 823 gene locus_tag LOCUS_26530 56 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3690 883 gene locus_tag LOCUS_26540 gene aceE 3690 883 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223999.1 protein_id gnl|my_center|LOCUS_26540 3696 4151 gene locus_tag LOCUS_26550 gene rnhA 3696 4151 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_26550 4266 5027 gene locus_tag LOCUS_26560 4266 5027 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_26560 5103 6104 gene locus_tag LOCUS_26570 5103 6104 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_26570 6163 7569 gene locus_tag LOCUS_26580 gene lpdA 6163 7569 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_26580 7919 7782 gene locus_tag LOCUS_26590 7919 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 8354 8133 gene locus_tag LOCUS_26600 8354 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence168 1975 449 gene locus_tag LOCUS_26610 1975 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2259 4049 gene locus_tag LOCUS_26620 gene glgP 2259 4049 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_26620 4077 6197 gene locus_tag LOCUS_26630 gene glgX 4077 6197 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224925.1 protein_id gnl|my_center|LOCUS_26630 6256 6927 gene locus_tag LOCUS_26640 gene rpiA 6256 6927 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920162.1 protein_id gnl|my_center|LOCUS_26640 7604 6933 gene locus_tag LOCUS_26650 gene pgl 7604 6933 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_26650 <8396 7613 gene locus_tag LOCUS_26660 <8396 7613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405880.1:decarboxylating 6-phosphogluconate dehydrogenase >Feature sequence169 1418 606 gene locus_tag LOCUS_26670 1418 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3043 1649 gene locus_tag LOCUS_26680 3043 1649 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257421.1 protein_id gnl|my_center|LOCUS_26680 4317 3040 gene locus_tag LOCUS_26690 4317 3040 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140281.1 protein_id gnl|my_center|LOCUS_26690 5096 4314 gene locus_tag LOCUS_26700 5096 4314 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_26700 6254 5133 gene locus_tag LOCUS_26710 gene xylF 6254 5133 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_26710 7466 6627 gene locus_tag LOCUS_26720 7466 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 7350 7721 gene locus_tag LOCUS_26730 7350 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence170 526 2361 gene locus_tag LOCUS_26740 526 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2514 3464 gene locus_tag LOCUS_26750 2514 3464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_26750 3461 4387 gene locus_tag LOCUS_26760 3461 4387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_26760 4409 5068 gene locus_tag LOCUS_26770 4409 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 5065 6120 gene locus_tag LOCUS_26780 5065 6120 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_26780 6934 6173 gene locus_tag LOCUS_26790 6934 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 7863 6931 gene locus_tag LOCUS_26800 gene cobD 7863 6931 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence171 1418 417 gene locus_tag LOCUS_26810 1418 417 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_26810 2365 1415 gene locus_tag LOCUS_26820 2365 1415 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_26820 2706 2362 gene locus_tag LOCUS_26830 2706 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2769 3995 gene locus_tag LOCUS_26840 2769 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 4604 4035 gene locus_tag LOCUS_26850 4604 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 5231 6148 gene locus_tag LOCUS_26860 5231 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 6151 6477 gene locus_tag LOCUS_26870 6151 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 6474 7940 gene locus_tag LOCUS_26880 6474 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 7937 8146 gene locus_tag LOCUS_26890 7937 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence172 662 141 gene locus_tag LOCUS_26900 662 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1372 695 gene locus_tag LOCUS_26910 1372 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26910 1770 1405 gene locus_tag LOCUS_26920 1770 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 2790 2377 gene locus_tag LOCUS_26930 2790 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3231 2914 gene locus_tag LOCUS_26940 3231 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3928 3386 gene locus_tag LOCUS_26950 3928 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 4508 4002 gene locus_tag LOCUS_26960 4508 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 4507 5223 gene locus_tag LOCUS_26970 4507 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 5685 5395 gene locus_tag LOCUS_26980 5685 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 6460 5729 gene locus_tag LOCUS_26990 6460 5729 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183783.1 protein_id gnl|my_center|LOCUS_26990 6732 6565 gene locus_tag LOCUS_27000 6732 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 7316 6891 gene locus_tag LOCUS_27010 7316 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 8069 7842 gene locus_tag LOCUS_27020 8069 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence173 1 639 gene locus_tag LOCUS_27030 1 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 1392 724 gene locus_tag LOCUS_27040 1392 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2075 1485 gene locus_tag LOCUS_27050 2075 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 3267 2110 gene locus_tag LOCUS_27060 3267 2110 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_27060 3390 3887 gene locus_tag LOCUS_27070 3390 3887 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_27070 4485 3892 gene locus_tag LOCUS_27080 4485 3892 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 protein_id gnl|my_center|LOCUS_27080 4767 5618 gene locus_tag LOCUS_27090 4767 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 6647 5643 gene locus_tag LOCUS_27100 6647 5643 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_27100 7213 6632 gene locus_tag LOCUS_27110 7213 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 8073 7183 gene locus_tag LOCUS_27120 8073 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence174 750 1403 gene locus_tag LOCUS_27130 750 1403 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_27130 1403 3181 gene locus_tag LOCUS_27140 1403 3181 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_27140 3178 3684 gene locus_tag LOCUS_27150 3178 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 3684 5636 gene locus_tag LOCUS_27160 3684 5636 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 protein_id gnl|my_center|LOCUS_27160 5633 6226 gene locus_tag LOCUS_27170 5633 6226 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_27170 6223 6672 gene locus_tag LOCUS_27180 6223 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 <8126 6724 gene locus_tag LOCUS_27190 <8126 6724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence175 1183 62 gene locus_tag LOCUS_27200 gene proB 1183 62 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228477.1 protein_id gnl|my_center|LOCUS_27200 2601 1180 gene locus_tag LOCUS_27210 gene obgE 2601 1180 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_27210 3964 2663 gene locus_tag LOCUS_27220 3964 2663 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_27220 4716 4036 gene locus_tag LOCUS_27230 4716 4036 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081890.1 protein_id gnl|my_center|LOCUS_27230 4882 5694 gene locus_tag LOCUS_27240 4882 5694 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 protein_id gnl|my_center|LOCUS_27240 5979 5728 gene locus_tag LOCUS_27250 gene rpmA 5979 5728 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060213.1 protein_id gnl|my_center|LOCUS_27250 6319 6005 gene locus_tag LOCUS_27260 gene rplU 6319 6005 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 protein_id gnl|my_center|LOCUS_27260 8043 6346 gene locus_tag LOCUS_27270 8043 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence176 419 1204 gene locus_tag LOCUS_27280 gene prcA 419 1204 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_27280 1265 2632 gene locus_tag LOCUS_27290 gene pafA 1265 2632 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_27290 2691 3410 gene locus_tag LOCUS_27300 2691 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3504 4004 gene locus_tag LOCUS_27310 3504 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 4008 4772 gene locus_tag LOCUS_27320 gene tatC 4008 4772 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410764.1 protein_id gnl|my_center|LOCUS_27320 4841 7033 gene locus_tag LOCUS_27330 4841 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence177 2287 1817 gene locus_tag LOCUS_27340 gene rpsG 2287 1817 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908590.1 protein_id gnl|my_center|LOCUS_27340 2660 2289 gene locus_tag LOCUS_27350 gene rpsL 2660 2289 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_27350 6930 2806 gene locus_tag LOCUS_27360 6930 2806 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403413.1 protein_id gnl|my_center|LOCUS_27360 <7929 6930 gene locus_tag LOCUS_27370 <7929 6930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029792.1:DNA-directed RNA polymerase subunit beta >Feature sequence178 185 586 gene locus_tag LOCUS_27380 185 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1472 624 gene locus_tag LOCUS_27390 1472 624 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_27390 1533 3173 gene locus_tag LOCUS_27400 gene purF 1533 3173 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_27400 3184 4248 gene locus_tag LOCUS_27410 gene purM 3184 4248 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 protein_id gnl|my_center|LOCUS_27410 4245 4871 gene locus_tag LOCUS_27420 gene pyrE 4245 4871 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_27420 4942 5739 gene locus_tag LOCUS_27430 4942 5739 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_27430 7413 5767 gene locus_tag LOCUS_27440 7413 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence179 2399 462 gene locus_tag LOCUS_27450 gene malQ 2399 462 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542051.1 protein_id gnl|my_center|LOCUS_27450 5722 2396 gene locus_tag LOCUS_27460 gene treS 5722 2396 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_27460 7803 5719 gene locus_tag LOCUS_27470 7803 5719 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence180 219 1019 gene locus_tag LOCUS_27480 gene folP 219 1019 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_27480 1040 1528 gene locus_tag LOCUS_27490 1040 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1535 1903 gene locus_tag LOCUS_27500 1535 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1887 2378 gene locus_tag LOCUS_27510 gene folK 1887 2378 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_27510 2445 4220 gene locus_tag LOCUS_27520 2445 4220 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_27520 4224 5084 gene locus_tag LOCUS_27530 4224 5084 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_27530 5081 6529 gene locus_tag LOCUS_27540 gene lysS 5081 6529 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_27540 7640 6666 gene locus_tag LOCUS_27550 7640 6666 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013676.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence181 509 2425 gene locus_tag LOCUS_27560 gene treZ 509 2425 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_27560 2433 5009 gene locus_tag LOCUS_27570 gene treY 2433 5009 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035665.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence182 2172 1342 gene locus_tag LOCUS_27580 2172 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 2104 2367 gene locus_tag LOCUS_27590 2104 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 4625 2772 gene locus_tag LOCUS_27600 4625 2772 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 protein_id gnl|my_center|LOCUS_27600 4807 5196 gene locus_tag LOCUS_27610 4807 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 5792 5223 gene locus_tag LOCUS_27620 5792 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 6919 5789 gene locus_tag LOCUS_27630 6919 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 7523 6897 gene locus_tag LOCUS_27640 7523 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence183 1121 1657 gene locus_tag LOCUS_27650 1121 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3409 2672 gene locus_tag LOCUS_27660 3409 2672 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804305.1 protein_id gnl|my_center|LOCUS_27660 3862 3653 gene locus_tag LOCUS_27670 3862 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 4536 3859 gene locus_tag LOCUS_27680 4536 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 5116 6426 gene locus_tag LOCUS_27690 5116 6426 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_27690 6464 7330 gene locus_tag LOCUS_27700 6464 7330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971601.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence184 1291 380 gene locus_tag LOCUS_27710 1291 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 1343 2680 gene locus_tag LOCUS_27720 1343 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3078 4094 gene locus_tag LOCUS_27730 3078 4094 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_27730 4249 4860 gene locus_tag LOCUS_27740 4249 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5217 5065 gene locus_tag LOCUS_27750 5217 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 5699 5244 gene locus_tag LOCUS_27760 5699 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 6614 6114 gene locus_tag LOCUS_27770 6614 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 6787 7557 gene locus_tag LOCUS_27780 6787 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence185 182 1114 gene locus_tag LOCUS_27790 182 1114 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_27790 2568 1135 gene locus_tag LOCUS_27800 2568 1135 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_27800 2742 3779 gene locus_tag LOCUS_27810 2742 3779 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035552.1 protein_id gnl|my_center|LOCUS_27810 3776 4408 gene locus_tag LOCUS_27820 gene upp 3776 4408 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858289.1 protein_id gnl|my_center|LOCUS_27820 6902 4611 gene locus_tag LOCUS_27830 6902 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 7652 7146 gene locus_tag LOCUS_27840 7652 7146 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048393.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence186 520 1557 gene locus_tag LOCUS_27850 520 1557 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_27850 1559 3082 gene locus_tag LOCUS_27860 gene atpA 1559 3082 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_27860 3086 4090 gene locus_tag LOCUS_27870 3086 4090 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814331.1 protein_id gnl|my_center|LOCUS_27870 4097 5554 gene locus_tag LOCUS_27880 gene atpD 4097 5554 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406701.1 protein_id gnl|my_center|LOCUS_27880 5554 6090 gene locus_tag LOCUS_27890 5554 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 7243 6110 gene locus_tag LOCUS_27900 7243 6110 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence187 386 709 gene locus_tag LOCUS_27910 386 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 883 1170 gene locus_tag LOCUS_27920 883 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 1211 1444 gene locus_tag LOCUS_27930 1211 1444 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_27930 1593 1429 gene locus_tag LOCUS_27940 1593 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3422 2178 gene locus_tag LOCUS_27950 3422 2178 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_27950 3491 3667 gene locus_tag LOCUS_27960 3491 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 4283 4798 gene locus_tag LOCUS_27970 4283 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 6171 5638 gene locus_tag LOCUS_27980 6171 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 <7673 6663 gene locus_tag LOCUS_27990 <7673 6663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164689163.1:IS3 family transposase >Feature sequence188 114 1313 gene locus_tag LOCUS_28000 114 1313 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530301.1 protein_id gnl|my_center|LOCUS_28000 1389 2405 gene locus_tag LOCUS_28010 1389 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 2449 3426 gene locus_tag LOCUS_28020 2449 3426 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812590.1 protein_id gnl|my_center|LOCUS_28020 3444 4472 gene locus_tag LOCUS_28030 3444 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 4778 5812 gene locus_tag LOCUS_28040 4778 5812 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095094.1 protein_id gnl|my_center|LOCUS_28040 5846 7396 gene locus_tag LOCUS_28050 gene araG 5846 7396 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267630.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence189 89 1459 gene locus_tag LOCUS_28060 89 1459 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877134.1 protein_id gnl|my_center|LOCUS_28060 1474 2655 gene locus_tag LOCUS_28070 1474 2655 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_28070 2690 4102 gene locus_tag LOCUS_28080 gene gcvPA 2690 4102 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_28080 4099 5706 gene locus_tag LOCUS_28090 gene gcvPB 4099 5706 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_28090 5715 7565 gene locus_tag LOCUS_28100 5715 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence190 <1 836 gene locus_tag LOCUS_28110 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258793.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 890 1183 gene locus_tag LOCUS_28120 gene groES 890 1183 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_28120 1271 2923 gene locus_tag LOCUS_28130 gene groL 1271 2923 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_28130 3024 3626 gene locus_tag LOCUS_28140 3024 3626 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258068.1 protein_id gnl|my_center|LOCUS_28140 3722 4885 gene locus_tag LOCUS_28150 3722 4885 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_28150 4936 7107 gene locus_tag LOCUS_28160 gene pcrA 4936 7107 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence191 933 445 gene locus_tag LOCUS_28170 933 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1101 2858 gene locus_tag LOCUS_28180 1101 2858 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_28180 3685 2894 gene locus_tag LOCUS_28190 3685 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 4567 3839 gene locus_tag LOCUS_28200 4567 3839 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_28200 4919 5172 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttcaacgtgggcggccccccgggggtcgctgcaac 6671 5535 gene locus_tag LOCUS_28210 6671 5535 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_28210 7535 6855 gene locus_tag LOCUS_28220 7535 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence192 272 78 gene locus_tag LOCUS_28230 272 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 286 1920 gene locus_tag LOCUS_28240 286 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 2203 3150 gene locus_tag LOCUS_28250 2203 3150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_28250 3165 4091 gene locus_tag LOCUS_28260 3165 4091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_28260 6369 4333 gene locus_tag LOCUS_28270 6369 4333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_28270 6503 7354 gene locus_tag LOCUS_28280 gene rapZ 6503 7354 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence193 <1 697 gene locus_tag LOCUS_28290 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681927.1:DNA adenine methylase 2772 691 gene locus_tag LOCUS_28300 2772 691 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224133.1 protein_id gnl|my_center|LOCUS_28300 3110 3280 gene locus_tag LOCUS_28310 3110 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 3277 4680 gene locus_tag LOCUS_28320 3277 4680 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_28320 6287 4692 gene locus_tag LOCUS_28330 6287 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 6399 6908 gene locus_tag LOCUS_28340 gene ribC 6399 6908 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence194 1353 250 gene locus_tag LOCUS_28350 1353 250 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_28350 2499 1831 gene locus_tag LOCUS_28360 2499 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3085 2792 gene locus_tag LOCUS_28370 3085 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3306 3082 gene locus_tag LOCUS_28380 3306 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3905 4993 gene locus_tag LOCUS_28390 3905 4993 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887158.1 protein_id gnl|my_center|LOCUS_28390 6420 6857 gene locus_tag LOCUS_28400 6420 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence195 1646 1377 gene locus_tag LOCUS_28410 1646 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 2866 1643 gene locus_tag LOCUS_28420 2866 1643 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_28420 3061 3369 gene locus_tag LOCUS_28430 3061 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 6296 3570 gene locus_tag LOCUS_28440 6296 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 7018 6305 gene locus_tag LOCUS_28450 7018 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence196 840 226 gene locus_tag LOCUS_28460 840 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1320 1583 gene locus_tag LOCUS_28470 1320 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 1869 2063 gene locus_tag LOCUS_28480 1869 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3335 2142 gene locus_tag LOCUS_28490 3335 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3933 3373 gene locus_tag LOCUS_28500 3933 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 <7468 3974 gene locus_tag LOCUS_28510 <7468 3974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256730.1:N-6 DNA methylase 5591 5600 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence197 3211 1325 gene locus_tag LOCUS_28520 3211 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 4603 3272 gene locus_tag LOCUS_28530 4603 3272 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_28530 6321 4600 gene locus_tag LOCUS_28540 gene aspS 6321 4600 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_28540 <7458 6384 gene locus_tag LOCUS_28550 <7458 6384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894356.1:histidine--tRNA ligase >Feature sequence198 621 1010 gene locus_tag LOCUS_28560 621 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 957 966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1010 1684 gene locus_tag LOCUS_28570 1010 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2498 5119 gene locus_tag LOCUS_28580 2498 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 5113 6543 gene locus_tag LOCUS_28590 5113 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 6443 7147 gene locus_tag LOCUS_28600 6443 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence199 <1 1089 gene locus_tag LOCUS_28610 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727745.1:NAD(P)H-hydrate dehydratase 1082 2236 gene locus_tag LOCUS_28620 gene alr 1082 2236 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143807.1 protein_id gnl|my_center|LOCUS_28620 2233 3177 gene locus_tag LOCUS_28630 2233 3177 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 protein_id gnl|my_center|LOCUS_28630 3239 4924 gene locus_tag LOCUS_28640 3239 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 4947 5435 gene locus_tag LOCUS_28650 gene tsaE 4947 5435 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_28650 5435 6109 gene locus_tag LOCUS_28660 gene tsaB 5435 6109 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_28660 6106 6609 gene locus_tag LOCUS_28670 gene rimI 6106 6609 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence200 983 543 gene locus_tag LOCUS_28680 983 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1253 2245 gene locus_tag LOCUS_28690 1253 2245 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_28690 3036 2281 gene locus_tag LOCUS_28700 3036 2281 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530617.1 protein_id gnl|my_center|LOCUS_28700 3423 5888 gene locus_tag LOCUS_28710 3423 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 7251 5938 gene locus_tag LOCUS_28720 7251 5938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence201 1399 95 gene locus_tag LOCUS_28730 1399 95 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_28730 1374 1568 gene locus_tag LOCUS_28740 1374 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2189 1557 gene locus_tag LOCUS_28750 2189 1557 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084624.1 protein_id gnl|my_center|LOCUS_28750 3070 2186 gene locus_tag LOCUS_28760 gene prmC 3070 2186 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927443.1 protein_id gnl|my_center|LOCUS_28760 4173 3067 gene locus_tag LOCUS_28770 gene prfA 4173 3067 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807618.1 protein_id gnl|my_center|LOCUS_28770 4434 4207 gene locus_tag LOCUS_28780 gene rpmE 4434 4207 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406668.1 protein_id gnl|my_center|LOCUS_28780 6354 4516 gene locus_tag LOCUS_28790 6354 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 <7364 6723 gene locus_tag LOCUS_28800 <7364 6723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546273.1:threonine synthase >Feature sequence202 349 876 gene locus_tag LOCUS_28810 349 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 870 1301 gene locus_tag LOCUS_28820 870 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 2256 1903 gene locus_tag LOCUS_28830 2256 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 2364 3572 gene locus_tag LOCUS_28840 2364 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3734 5194 gene locus_tag LOCUS_28850 gene yfmT 3734 5194 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244104.1 protein_id gnl|my_center|LOCUS_28850 5212 5946 gene locus_tag LOCUS_28860 5212 5946 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970569.1 protein_id gnl|my_center|LOCUS_28860 7125 5998 gene locus_tag LOCUS_28870 7125 5998 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729614.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence203 198 590 gene locus_tag LOCUS_28880 198 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1179 613 gene locus_tag LOCUS_28890 1179 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 2606 1176 gene locus_tag LOCUS_28900 2606 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 4082 2613 gene locus_tag LOCUS_28910 4082 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 4461 4084 gene locus_tag LOCUS_28920 4461 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 4991 4500 gene locus_tag LOCUS_28930 4991 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 5326 4988 gene locus_tag LOCUS_28940 5326 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 5705 5502 gene locus_tag LOCUS_28950 5705 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 6656 5751 gene locus_tag LOCUS_28960 6656 5751 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 protein_id gnl|my_center|LOCUS_28960 <7333 6653 gene locus_tag LOCUS_28970 <7333 6653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228858.1:type II secretion system protein >Feature sequence204 1332 367 gene locus_tag LOCUS_28980 1332 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 1592 1942 gene locus_tag LOCUS_28990 1592 1942 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_28990 2137 3612 gene locus_tag LOCUS_29000 gene ahcY 2137 3612 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_29000 4638 3688 gene locus_tag LOCUS_29010 4638 3688 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_29010 4772 5263 gene locus_tag LOCUS_29020 4772 5263 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405444.1 protein_id gnl|my_center|LOCUS_29020 5396 6463 gene locus_tag LOCUS_29030 5396 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence205 1722 46 gene locus_tag LOCUS_29040 gene malS 1722 46 CDS product oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822354.1 protein_id gnl|my_center|LOCUS_29040 2176 1784 gene locus_tag LOCUS_29050 2176 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978746.1 protein_id gnl|my_center|LOCUS_29050 2914 2345 gene locus_tag LOCUS_29060 2914 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 3232 3636 gene locus_tag LOCUS_29070 3232 3636 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083982.1 protein_id gnl|my_center|LOCUS_29070 4154 4444 gene locus_tag LOCUS_29080 4154 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 4512 4715 gene locus_tag LOCUS_29090 4512 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 4789 5034 gene locus_tag LOCUS_29100 4789 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 5031 5444 gene locus_tag LOCUS_29110 5031 5444 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_29110 6111 5689 gene locus_tag LOCUS_29120 6111 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 6473 6264 gene locus_tag LOCUS_29130 6473 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 6393 6602 gene locus_tag LOCUS_29140 6393 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence206 3192 109 gene locus_tag LOCUS_29150 3192 109 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_29150 5933 3192 gene locus_tag LOCUS_29160 5933 3192 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_29160 <7237 5930 gene locus_tag LOCUS_29170 <7237 5930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258557.1:helicase-related protein >Feature sequence207 501 34 gene locus_tag LOCUS_29180 501 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 1012 2373 gene locus_tag LOCUS_29190 1012 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2708 3241 gene locus_tag LOCUS_29200 2708 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 3615 5006 gene locus_tag LOCUS_29210 3615 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 6564 5203 gene locus_tag LOCUS_29220 6564 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence208 533 757 gene locus_tag LOCUS_29230 533 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 936 1586 gene locus_tag LOCUS_29240 936 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 1811 2845 gene locus_tag LOCUS_29250 1811 2845 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 protein_id gnl|my_center|LOCUS_29250 2847 3725 gene locus_tag LOCUS_29260 2847 3725 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_29260 4518 3715 gene locus_tag LOCUS_29270 4518 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 4831 4601 gene locus_tag LOCUS_29280 4831 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29280 5930 4884 gene locus_tag LOCUS_29290 5930 4884 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_29290 6975 5941 gene locus_tag LOCUS_29300 gene pdhA 6975 5941 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence209 1658 738 gene locus_tag LOCUS_29310 1658 738 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083532.1 protein_id gnl|my_center|LOCUS_29310 2111 1665 gene locus_tag LOCUS_29320 2111 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 2367 2939 gene locus_tag LOCUS_29330 2367 2939 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729205.1 protein_id gnl|my_center|LOCUS_29330 3250 3999 gene locus_tag LOCUS_29340 3250 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 4207 4896 gene locus_tag LOCUS_29350 4207 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 4997 5980 gene locus_tag LOCUS_29360 4997 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 6057 7067 gene locus_tag LOCUS_29370 6057 7067 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880940.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence210 <1 835 gene locus_tag LOCUS_29380 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728310.1:3-isopropylmalate dehydratase large subunit 832 1434 gene locus_tag LOCUS_29390 gene leuD 832 1434 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_29390 1612 2373 gene locus_tag LOCUS_29400 1612 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3159 3233 gene locus_tag LOCUS_t00360 3159 3233 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3922 4275 gene locus_tag LOCUS_29410 3922 4275 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730827.1 protein_id gnl|my_center|LOCUS_29410 4572 4411 gene locus_tag LOCUS_29420 4572 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 5305 4739 gene locus_tag LOCUS_29430 5305 4739 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777073.1 protein_id gnl|my_center|LOCUS_29430 5982 5329 gene locus_tag LOCUS_29440 5982 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 6143 6460 gene locus_tag LOCUS_29450 6143 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence211 164 394 gene locus_tag LOCUS_29460 164 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 484 1287 gene locus_tag LOCUS_29470 484 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2155 1256 gene locus_tag LOCUS_29480 2155 1256 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_29480 3188 2157 gene locus_tag LOCUS_29490 3188 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 4168 3431 gene locus_tag LOCUS_29500 4168 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 4584 4108 gene locus_tag LOCUS_29510 4584 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 5156 4932 gene locus_tag LOCUS_29520 5156 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 5281 6999 gene locus_tag LOCUS_29530 5281 6999 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_29530 >Feature sequence212 841 239 gene locus_tag LOCUS_29540 841 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1026 1340 gene locus_tag LOCUS_29550 1026 1340 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173915017.1 protein_id gnl|my_center|LOCUS_29550 1337 2101 gene locus_tag LOCUS_29560 1337 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2182 3393 gene locus_tag LOCUS_29570 2182 3393 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053137.1 protein_id gnl|my_center|LOCUS_29570 3390 4346 gene locus_tag LOCUS_29580 3390 4346 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_29580 4343 5380 gene locus_tag LOCUS_29590 4343 5380 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054866.1 protein_id gnl|my_center|LOCUS_29590 5493 5795 gene locus_tag LOCUS_29600 5493 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 6266 6066 gene locus_tag LOCUS_29610 6266 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 6849 6241 gene locus_tag LOCUS_29620 6849 6241 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence213 373 1620 gene locus_tag LOCUS_29630 373 1620 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 protein_id gnl|my_center|LOCUS_29630 1724 2293 gene locus_tag LOCUS_29640 1724 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2312 3331 gene locus_tag LOCUS_29650 2312 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3346 4809 gene locus_tag LOCUS_29660 3346 4809 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_29660 5294 5761 gene locus_tag LOCUS_29670 5294 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 5768 6739 gene locus_tag LOCUS_29680 5768 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence214 15 458 gene locus_tag LOCUS_29690 15 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 623 2212 gene locus_tag LOCUS_29700 623 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 2294 2920 gene locus_tag LOCUS_29710 2294 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3865 2963 gene locus_tag LOCUS_29720 3865 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 4730 4263 gene locus_tag LOCUS_29730 4730 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 5458 4727 gene locus_tag LOCUS_29740 5458 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 5901 5458 gene locus_tag LOCUS_29750 5901 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 6833 5901 gene locus_tag LOCUS_29760 6833 5901 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056998.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence215 101 29 gene locus_tag LOCUS_t00370 101 29 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 119 892 gene locus_tag LOCUS_29770 119 892 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484635.1 protein_id gnl|my_center|LOCUS_29770 1055 2386 gene locus_tag LOCUS_29780 1055 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 2403 4370 gene locus_tag LOCUS_29790 2403 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29790 4367 5128 gene locus_tag LOCUS_29800 4367 5128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_29800 5125 5871 gene locus_tag LOCUS_29810 5125 5871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225676.1 protein_id gnl|my_center|LOCUS_29810 6610 5876 gene locus_tag LOCUS_29820 6610 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 6868 6620 gene locus_tag LOCUS_29830 6868 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence216 3355 2957 gene locus_tag LOCUS_29840 gene rplL 3355 2957 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112006.1 protein_id gnl|my_center|LOCUS_29840 4068 3427 gene locus_tag LOCUS_29850 gene rplJ 4068 3427 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_29850 4985 4260 gene locus_tag LOCUS_29860 gene rplA 4985 4260 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_29860 5442 5011 gene locus_tag LOCUS_29870 gene rplK 5442 5011 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_29870 6006 5911 gene locus_tag LOCUS_t00380 6006 5911 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6588 6268 gene locus_tag LOCUS_29880 6588 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 6717 6644 gene locus_tag LOCUS_t00390 6717 6644 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence217 2188 149 gene locus_tag LOCUS_29890 gene dxs 2188 149 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140198.1 protein_id gnl|my_center|LOCUS_29890 2719 2261 gene locus_tag LOCUS_29900 2719 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 2907 4232 gene locus_tag LOCUS_29910 2907 4232 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_29910 4229 5590 gene locus_tag LOCUS_29920 4229 5590 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_29920 5981 5613 gene locus_tag LOCUS_29930 5981 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 6119 6622 gene locus_tag LOCUS_29940 gene moaC 6119 6622 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417293.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence218 936 244 gene locus_tag LOCUS_29950 936 244 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026959.1 protein_id gnl|my_center|LOCUS_29950 1143 2507 gene locus_tag LOCUS_29960 1143 2507 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_29960 2521 2820 gene locus_tag LOCUS_29970 2521 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 2896 4062 gene locus_tag LOCUS_29980 2896 4062 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_29980 5121 4198 gene locus_tag LOCUS_29990 5121 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 6697 5198 gene locus_tag LOCUS_30000 6697 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence219 <1 550 gene locus_tag LOCUS_30010 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727024.1:FMN-binding negative transcriptional regulator 970 1917 gene locus_tag LOCUS_30020 970 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 2823 3335 gene locus_tag LOCUS_30030 2823 3335 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225758.1 protein_id gnl|my_center|LOCUS_30030 3519 5258 gene locus_tag LOCUS_30040 3519 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence220 52 126 gene locus_tag LOCUS_t00400 52 126 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 293 1381 gene locus_tag LOCUS_30050 293 1381 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887158.1 protein_id gnl|my_center|LOCUS_30050 1904 1452 gene locus_tag LOCUS_30060 1904 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2693 2025 gene locus_tag LOCUS_30070 2693 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 3245 2697 gene locus_tag LOCUS_30080 3245 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 3927 4448 gene locus_tag LOCUS_30090 3927 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 4978 5340 gene locus_tag LOCUS_30100 4978 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 6500 5466 gene locus_tag LOCUS_30110 6500 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence221 566 1870 gene locus_tag LOCUS_30120 gene serS 566 1870 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937547.1 protein_id gnl|my_center|LOCUS_30120 2657 1902 gene locus_tag LOCUS_30130 gene regX 2657 1902 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402393.1 protein_id gnl|my_center|LOCUS_30130 4509 2752 gene locus_tag LOCUS_30140 4509 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 4701 5099 gene locus_tag LOCUS_30150 4701 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 5107 6702 gene locus_tag LOCUS_30160 5107 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence222 248 325 gene locus_tag LOCUS_t00410 248 325 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2121 514 gene locus_tag LOCUS_30170 2121 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 2783 2118 gene locus_tag LOCUS_30180 2783 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3246 3049 gene locus_tag LOCUS_30190 3246 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3371 4429 gene locus_tag LOCUS_30200 3371 4429 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869770.1 protein_id gnl|my_center|LOCUS_30200 4426 4734 gene locus_tag LOCUS_30210 4426 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 4731 6347 gene locus_tag LOCUS_30220 4731 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence223 1775 1074 gene locus_tag LOCUS_30230 1775 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 3159 1765 gene locus_tag LOCUS_30240 3159 1765 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_30240 4855 3455 gene locus_tag LOCUS_30250 4855 3455 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809081.1 protein_id gnl|my_center|LOCUS_30250 6186 4852 gene locus_tag LOCUS_30260 6186 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 6405 6235 gene locus_tag LOCUS_30270 6405 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 6674 6402 gene locus_tag LOCUS_30280 6674 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence224 243 440 gene locus_tag LOCUS_30290 243 440 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_30290 448 1929 gene locus_tag LOCUS_30300 gene gltX 448 1929 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_30300 1978 2793 gene locus_tag LOCUS_30310 1978 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 2804 2876 gene locus_tag LOCUS_t00420 2804 2876 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2908 2983 gene locus_tag LOCUS_t00430 2908 2983 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3401 3075 gene locus_tag LOCUS_30320 3401 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 4226 3864 gene locus_tag LOCUS_30330 4226 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 5476 4967 gene locus_tag LOCUS_30340 5476 4967 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_30340 5818 5504 gene locus_tag LOCUS_30350 5818 5504 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_30350 6551 5823 gene locus_tag LOCUS_30360 6551 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence225 1640 747 gene locus_tag LOCUS_30370 1640 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 2671 1640 gene locus_tag LOCUS_30380 2671 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3966 2716 gene locus_tag LOCUS_30390 3966 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 4518 4015 gene locus_tag LOCUS_30400 4518 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 4710 5372 gene locus_tag LOCUS_30410 4710 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 6367 5441 gene locus_tag LOCUS_30420 6367 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 6742 6578 gene locus_tag LOCUS_30430 6742 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 >Feature sequence226 706 1521 gene locus_tag LOCUS_30440 706 1521 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971512.1 protein_id gnl|my_center|LOCUS_30440 1910 4960 gene locus_tag LOCUS_30450 1910 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 5906 4932 gene locus_tag LOCUS_30460 5906 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence227 <1 1484 gene locus_tag LOCUS_30470 <1 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031630.1:NAD(P)/FAD-dependent oxidoreductase 1529 1774 gene locus_tag LOCUS_30480 1529 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 1894 2754 gene locus_tag LOCUS_30490 gene fdhD 1894 2754 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_30490 2751 3317 gene locus_tag LOCUS_30500 gene moaC 2751 3317 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804486.1 protein_id gnl|my_center|LOCUS_30500 4311 3352 gene locus_tag LOCUS_30510 4311 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 5282 4308 gene locus_tag LOCUS_30520 5282 4308 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence228 128 727 gene locus_tag LOCUS_30530 128 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 1153 2607 gene locus_tag LOCUS_30540 1153 2607 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_30540 3374 4663 gene locus_tag LOCUS_30550 3374 4663 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166233908.1 protein_id gnl|my_center|LOCUS_30550 >Feature sequence229 <1 1161 gene locus_tag LOCUS_30560 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727837.1:M20 family metallopeptidase 1198 1287 gene locus_tag LOCUS_t00440 1198 1287 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2883 1291 gene locus_tag LOCUS_30570 2883 1291 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_30570 2976 3866 gene locus_tag LOCUS_30580 2976 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 5020 3803 gene locus_tag LOCUS_30590 5020 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 6246 5017 gene locus_tag LOCUS_30600 6246 5017 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596134.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence230 1204 968 gene locus_tag LOCUS_30610 1204 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 1999 1373 gene locus_tag LOCUS_30620 1999 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 2424 2005 gene locus_tag LOCUS_30630 2424 2005 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_30630 2979 2554 gene locus_tag LOCUS_30640 2979 2554 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_30640 3087 3251 gene locus_tag LOCUS_30650 3087 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3248 4858 gene locus_tag LOCUS_30660 3248 4858 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_30660 4855 6360 gene locus_tag LOCUS_30670 gene glpK 4855 6360 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_30670 >Feature sequence231 207 503 gene locus_tag LOCUS_30680 207 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1486 524 gene locus_tag LOCUS_30690 1486 524 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113809.1 protein_id gnl|my_center|LOCUS_30690 1585 2388 gene locus_tag LOCUS_30700 1585 2388 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083971.1 protein_id gnl|my_center|LOCUS_30700 3457 3038 gene locus_tag LOCUS_30710 3457 3038 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926524.1 protein_id gnl|my_center|LOCUS_30710 3843 3454 gene locus_tag LOCUS_30720 3843 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3995 4213 gene locus_tag LOCUS_30730 3995 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 5420 6547 gene locus_tag LOCUS_30740 5420 6547 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence232 289 873 gene locus_tag LOCUS_30750 289 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414195.1 protein_id gnl|my_center|LOCUS_30750 912 2249 gene locus_tag LOCUS_30760 912 2249 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_30760 2253 3065 gene locus_tag LOCUS_30770 2253 3065 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 protein_id gnl|my_center|LOCUS_30770 3062 3418 gene locus_tag LOCUS_30780 3062 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3712 4011 gene locus_tag LOCUS_30790 3712 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 4447 3950 gene locus_tag LOCUS_30800 4447 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 4701 4441 gene locus_tag LOCUS_30810 4701 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 4900 5859 gene locus_tag LOCUS_30820 4900 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 6425 5937 gene locus_tag LOCUS_30830 6425 5937 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence233 1005 91 gene locus_tag LOCUS_30840 1005 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 1898 1002 gene locus_tag LOCUS_30850 gene rfbD 1898 1002 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_30850 2896 1901 gene locus_tag LOCUS_30860 gene rfbB 2896 1901 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_30860 3541 2909 gene locus_tag LOCUS_30870 3541 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 3715 5511 gene locus_tag LOCUS_30880 gene accC 3715 5511 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence234 353 1432 gene locus_tag LOCUS_30890 353 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30890 1429 4416 gene locus_tag LOCUS_30900 1429 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 4446 5054 gene locus_tag LOCUS_30910 gene phoU 4446 5054 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804558.1 protein_id gnl|my_center|LOCUS_30910 5547 5083 gene locus_tag LOCUS_30920 5547 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence235 81 932 gene locus_tag LOCUS_30930 gene mreC 81 932 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461822.1 protein_id gnl|my_center|LOCUS_30930 949 1467 gene locus_tag LOCUS_30940 949 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1584 3974 gene locus_tag LOCUS_30950 gene mrdA 1584 3974 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945987.1 protein_id gnl|my_center|LOCUS_30950 3987 5987 gene locus_tag LOCUS_30960 3987 5987 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence236 3540 2497 gene locus_tag LOCUS_30970 3540 2497 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793191.1 protein_id gnl|my_center|LOCUS_30970 3619 4944 gene locus_tag LOCUS_30980 3619 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 5048 5974 gene locus_tag LOCUS_30990 5048 5974 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527598.1 protein_id gnl|my_center|LOCUS_30990 >Feature sequence237 <1 662 gene locus_tag LOCUS_31000 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391556.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 677 3178 gene locus_tag LOCUS_31010 gene gyrA 677 3178 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_31010 3370 5040 gene locus_tag LOCUS_31020 3370 5040 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229303.1 protein_id gnl|my_center|LOCUS_31020 <6367 5128 gene locus_tag LOCUS_31030 <6367 5128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838678.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence238 942 1610 gene locus_tag LOCUS_31040 942 1610 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_31040 1780 1574 gene locus_tag LOCUS_31050 1780 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1752 2171 gene locus_tag LOCUS_31060 1752 2171 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_31060 2238 2756 gene locus_tag LOCUS_31070 2238 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3006 2812 gene locus_tag LOCUS_31080 3006 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3632 3003 gene locus_tag LOCUS_31090 3632 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 4323 3643 gene locus_tag LOCUS_31100 4323 3643 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338834.1 protein_id gnl|my_center|LOCUS_31100 5811 4330 gene locus_tag LOCUS_31110 5811 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence239 792 2480 gene locus_tag LOCUS_31120 792 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3956 2940 gene locus_tag LOCUS_31130 gene czcD 3956 2940 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 protein_id gnl|my_center|LOCUS_31130 4858 3953 gene locus_tag LOCUS_31140 4858 3953 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681782.1 protein_id gnl|my_center|LOCUS_31140 5787 4855 gene locus_tag LOCUS_31150 5787 4855 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_31150 <6310 5784 gene locus_tag LOCUS_31160 <6310 5784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039902.1:thiolase family protein >Feature sequence240 3774 259 gene locus_tag LOCUS_31170 gene metH 3774 259 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_31170 3820 4419 gene locus_tag LOCUS_31180 3820 4419 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918615.1 protein_id gnl|my_center|LOCUS_31180 4514 6061 gene locus_tag LOCUS_31190 4514 6061 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_31190 6100 6177 gene locus_tag LOCUS_t00450 6100 6177 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence241 <1 827 gene locus_tag LOCUS_31200 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918807.1:MBL fold metallo-hydrolase 1987 785 gene locus_tag LOCUS_31210 1987 785 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_31210 2142 2528 gene locus_tag LOCUS_31220 2142 2528 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_31220 2551 4344 gene locus_tag LOCUS_31230 2551 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 4341 4748 gene locus_tag LOCUS_31240 4341 4748 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811198.1 protein_id gnl|my_center|LOCUS_31240 5449 4730 gene locus_tag LOCUS_31250 5449 4730 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898599.1 protein_id gnl|my_center|LOCUS_31250 <6197 5464 gene locus_tag LOCUS_31260 <6197 5464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223124.1:type I glutamate--ammonia ligase >Feature sequence242 418 1824 gene locus_tag LOCUS_31270 418 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 2089 3096 gene locus_tag LOCUS_31280 2089 3096 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_31280 3093 3899 gene locus_tag LOCUS_31290 3093 3899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_31290 5963 4713 gene locus_tag LOCUS_31300 5963 4713 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence243 <1 1371 gene locus_tag LOCUS_31310 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227656.1:indolepyruvate ferredoxin oxidoreductase family protein 1377 2093 gene locus_tag LOCUS_31320 gene hpaI 1377 2093 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_31320 2090 3079 gene locus_tag LOCUS_31330 2090 3079 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_31330 3076 4074 gene locus_tag LOCUS_31340 3076 4074 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_31340 4120 5673 gene locus_tag LOCUS_31350 4120 5673 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence244 1259 426 gene locus_tag LOCUS_31360 1259 426 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730656.1 protein_id gnl|my_center|LOCUS_31360 2061 1306 gene locus_tag LOCUS_31370 2061 1306 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525160.1 protein_id gnl|my_center|LOCUS_31370 2849 2070 gene locus_tag LOCUS_31380 2849 2070 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_31380 4855 2924 gene locus_tag LOCUS_31390 4855 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 <6123 4873 gene locus_tag LOCUS_31400 <6123 4873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125903.1:alpha-hydroxy acid oxidase >Feature sequence245 3081 2425 gene locus_tag LOCUS_31410 3081 2425 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_31410 3524 3234 gene locus_tag LOCUS_31420 3524 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 4788 3604 gene locus_tag LOCUS_31430 gene menC 4788 3604 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_31430 4942 5026 gene locus_tag LOCUS_t00460 4942 5026 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5949 5065 gene locus_tag LOCUS_31440 5949 5065 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence246 579 1016 gene locus_tag LOCUS_31450 579 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 2916 1108 gene locus_tag LOCUS_31460 2916 1108 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_31460 3528 2920 gene locus_tag LOCUS_31470 3528 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 3916 3467 gene locus_tag LOCUS_31480 3916 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 4185 3928 gene locus_tag LOCUS_31490 4185 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 5891 4236 gene locus_tag LOCUS_31500 gene merA 5891 4236 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence247 2327 207 gene locus_tag LOCUS_31510 2327 207 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_31510 3862 2330 gene locus_tag LOCUS_31520 3862 2330 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_31520 4033 4638 gene locus_tag LOCUS_31530 4033 4638 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_31530 5368 4670 gene locus_tag LOCUS_31540 5368 4670 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412782.1 protein_id gnl|my_center|LOCUS_31540 <6063 5365 gene locus_tag LOCUS_31550 <6063 5365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031119.1:CoA transferase subunit A >Feature sequence248 1098 742 gene locus_tag LOCUS_31560 1098 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 1367 2560 gene locus_tag LOCUS_31570 1367 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 2547 3959 gene locus_tag LOCUS_31580 2547 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3944 4786 gene locus_tag LOCUS_31590 3944 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence249 114 1004 gene locus_tag LOCUS_31600 114 1004 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_31600 1007 1891 gene locus_tag LOCUS_31610 1007 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2473 1949 gene locus_tag LOCUS_31620 2473 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 2503 4842 gene locus_tag LOCUS_31630 2503 4842 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104130.1 protein_id gnl|my_center|LOCUS_31630 4906 5967 gene locus_tag LOCUS_31640 gene ribD 4906 5967 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_31640 >Feature sequence250 1192 425 gene locus_tag LOCUS_31650 1192 425 CDS product IS607-like element IS1535 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404760.1 protein_id gnl|my_center|LOCUS_31650 1372 2715 gene locus_tag LOCUS_31660 1372 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 2718 5396 gene locus_tag LOCUS_31670 2718 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence251 461 877 gene locus_tag LOCUS_31680 461 877 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_31680 939 2138 gene locus_tag LOCUS_31690 gene sucC 939 2138 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 protein_id gnl|my_center|LOCUS_31690 2135 3025 gene locus_tag LOCUS_31700 gene sucD 2135 3025 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110253.1 protein_id gnl|my_center|LOCUS_31700 3043 3660 gene locus_tag LOCUS_31710 gene purN 3043 3660 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919571.1 protein_id gnl|my_center|LOCUS_31710 3657 5159 gene locus_tag LOCUS_31720 gene purH 3657 5159 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence252 665 204 gene locus_tag LOCUS_31730 665 204 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413614.1 protein_id gnl|my_center|LOCUS_31730 920 2734 gene locus_tag LOCUS_31740 gene acsA 920 2734 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_31740 2731 4500 gene locus_tag LOCUS_31750 2731 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 4497 4760 gene locus_tag LOCUS_31760 4497 4760 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence253 1366 26 gene locus_tag LOCUS_31770 1366 26 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 protein_id gnl|my_center|LOCUS_31770 1641 2576 gene locus_tag LOCUS_31780 1641 2576 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057210.1 protein_id gnl|my_center|LOCUS_31780 2909 3283 gene locus_tag LOCUS_31790 2909 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3280 3576 gene locus_tag LOCUS_31800 3280 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3685 3888 gene locus_tag LOCUS_31810 3685 3888 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_31810 5638 3944 gene locus_tag LOCUS_31820 5638 3944 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028402.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence254 <1 1171 gene locus_tag LOCUS_31830 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460998.1:IS1634 family transposase 1272 2327 gene locus_tag LOCUS_31840 1272 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2359 2670 gene locus_tag LOCUS_31850 2359 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3372 4574 gene locus_tag LOCUS_31860 3372 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 4540 4911 gene locus_tag LOCUS_31870 4540 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 5267 5013 gene locus_tag LOCUS_31880 5267 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 5603 5343 gene locus_tag LOCUS_31890 5603 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence255 1225 119 gene locus_tag LOCUS_31900 1225 119 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890422.1 protein_id gnl|my_center|LOCUS_31900 1992 1261 gene locus_tag LOCUS_31910 1992 1261 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886075.1 protein_id gnl|my_center|LOCUS_31910 2419 2045 gene locus_tag LOCUS_31920 gene trxA 2419 2045 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_31920 3896 2565 gene locus_tag LOCUS_31930 3896 2565 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_31930 4230 5087 gene locus_tag LOCUS_31940 4230 5087 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173595.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence256 831 61 gene locus_tag LOCUS_31950 831 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 2274 868 gene locus_tag LOCUS_31960 2274 868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226903.1 protein_id gnl|my_center|LOCUS_31960 3030 2275 gene locus_tag LOCUS_31970 gene tcrA 3030 2275 CDS product two-component system response regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403148.1 protein_id gnl|my_center|LOCUS_31970 4205 3030 gene locus_tag LOCUS_31980 4205 3030 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_31980 4090 4326 gene locus_tag LOCUS_31990 4090 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 5350 4526 gene locus_tag LOCUS_32000 5350 4526 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346349.1 protein_id gnl|my_center|LOCUS_32000 >Feature sequence257 <1 2646 gene locus_tag LOCUS_32010 <1 2646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459216.1:TIGR02680 family protein 2655 4259 gene locus_tag LOCUS_32020 2655 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 4249 5550 gene locus_tag LOCUS_32030 4249 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence258 2473 1073 gene locus_tag LOCUS_32040 2473 1073 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_32040 2640 3629 gene locus_tag LOCUS_32050 2640 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 3691 5058 gene locus_tag LOCUS_32060 3691 5058 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_32060 5085 5453 gene locus_tag LOCUS_32070 5085 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 >Feature sequence259 973 233 gene locus_tag LOCUS_32080 gene map 973 233 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_32080 1672 992 gene locus_tag LOCUS_32090 1672 992 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_32090 2966 1680 gene locus_tag LOCUS_32100 gene secY 2966 1680 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_32100 3460 2972 gene locus_tag LOCUS_32110 gene rplO 3460 2972 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_32110 3642 3457 gene locus_tag LOCUS_32120 gene rpmD 3642 3457 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_32120 4193 3645 gene locus_tag LOCUS_32130 gene rpsE 4193 3645 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403680.1 protein_id gnl|my_center|LOCUS_32130 4567 4193 gene locus_tag LOCUS_32140 gene rplR 4567 4193 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_32140 5106 4567 gene locus_tag LOCUS_32150 gene rplF 5106 4567 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_32150 5566 5162 gene locus_tag LOCUS_32160 gene rpsH 5566 5162 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence260 1354 509 gene locus_tag LOCUS_32170 1354 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 2203 1469 gene locus_tag LOCUS_32180 2203 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 2589 2296 gene locus_tag LOCUS_32190 2589 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 2969 2586 gene locus_tag LOCUS_32200 2969 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 4202 3033 gene locus_tag LOCUS_32210 4202 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 5353 4286 gene locus_tag LOCUS_32220 5353 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence261 1348 1043 gene locus_tag LOCUS_32230 1348 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 2217 1453 gene locus_tag LOCUS_32240 2217 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 3848 2547 gene locus_tag LOCUS_32250 3848 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 3987 5420 gene locus_tag LOCUS_32260 3987 5420 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226072.1 protein_id gnl|my_center|LOCUS_32260 >Feature sequence262 1710 1285 gene locus_tag LOCUS_32270 1710 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 4010 2169 gene locus_tag LOCUS_32280 4010 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 4570 4049 gene locus_tag LOCUS_32290 4570 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 4914 5474 gene locus_tag LOCUS_32300 4914 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence263 919 233 gene locus_tag LOCUS_32310 919 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 2306 972 gene locus_tag LOCUS_32320 gene glnA 2306 972 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582594.1 protein_id gnl|my_center|LOCUS_32320 2631 4055 gene locus_tag LOCUS_32330 gene glnA 2631 4055 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087603.1 protein_id gnl|my_center|LOCUS_32330 4131 5543 gene locus_tag LOCUS_32340 4131 5543 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence264 156 2138 gene locus_tag LOCUS_32350 156 2138 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_32350 2140 2646 gene locus_tag LOCUS_32360 2140 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 2639 3460 gene locus_tag LOCUS_32370 2639 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 3558 3941 gene locus_tag LOCUS_32380 3558 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence265 459 76 gene locus_tag LOCUS_32390 459 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 824 480 gene locus_tag LOCUS_32400 824 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 1359 1006 gene locus_tag LOCUS_32410 1359 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32410 1374 1661 gene locus_tag LOCUS_32420 1374 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 1658 2737 gene locus_tag LOCUS_32430 1658 2737 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_32430 3594 2734 gene locus_tag LOCUS_32440 3594 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 5075 3660 gene locus_tag LOCUS_32450 5075 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 5308 5072 gene locus_tag LOCUS_32460 5308 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32460 >Feature sequence266 808 1044 gene locus_tag LOCUS_32470 808 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 1947 4652 gene locus_tag LOCUS_32480 1947 4652 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_32480 4642 5352 gene locus_tag LOCUS_32490 4642 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 >Feature sequence267 1813 1010 gene locus_tag LOCUS_32500 1813 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 2174 1818 gene locus_tag LOCUS_32510 2174 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 4030 2255 gene locus_tag LOCUS_32520 gene arsA 4030 2255 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122358.1 protein_id gnl|my_center|LOCUS_32520 4808 4110 gene locus_tag LOCUS_32530 4808 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence268 643 371 gene locus_tag LOCUS_32540 643 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 1323 955 gene locus_tag LOCUS_32550 1323 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 1415 2686 gene locus_tag LOCUS_32560 1415 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3430 2816 gene locus_tag LOCUS_32570 3430 2816 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777029.1 protein_id gnl|my_center|LOCUS_32570 5246 3504 gene locus_tag LOCUS_32580 5246 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence269 451 1353 gene locus_tag LOCUS_32590 gene mutM 451 1353 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355756.1 protein_id gnl|my_center|LOCUS_32590 1455 4967 gene locus_tag LOCUS_32600 1455 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 5316 5101 gene locus_tag LOCUS_32610 5316 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence270 1347 868 gene locus_tag LOCUS_32620 1347 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 1650 2816 gene locus_tag LOCUS_32630 1650 2816 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_32630 5286 3163 gene locus_tag LOCUS_32640 5286 3163 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064833.1 protein_id gnl|my_center|LOCUS_32640 >Feature sequence271 535 299 gene locus_tag LOCUS_32650 535 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 1409 3178 gene locus_tag LOCUS_32660 gene arc 1409 3178 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_32660 3200 4690 gene locus_tag LOCUS_32670 gene dop 3200 4690 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_32670 4784 4981 gene locus_tag LOCUS_32680 4784 4981 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411026.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence272 1123 59 gene locus_tag LOCUS_32690 gene pdhA 1123 59 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_32690 1335 1961 gene locus_tag LOCUS_32700 1335 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3963 1882 gene locus_tag LOCUS_32710 3963 1882 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887105.1 protein_id gnl|my_center|LOCUS_32710 2059 2148 gene locus_tag LOCUS_t00470 2059 2148 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4033 4869 gene locus_tag LOCUS_32720 4033 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence273 <1 2122 gene locus_tag LOCUS_32730 <1 2122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_049748465.1:acetate--CoA ligase family protein 2119 3810 gene locus_tag LOCUS_32740 2119 3810 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 protein_id gnl|my_center|LOCUS_32740 4149 3823 gene locus_tag LOCUS_32750 4149 3823 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403376.1 protein_id gnl|my_center|LOCUS_32750 4409 4146 gene locus_tag LOCUS_32760 4409 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence274 1024 1953 gene locus_tag LOCUS_32770 1024 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2368 4056 gene locus_tag LOCUS_32780 2368 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32780 4093 4650 gene locus_tag LOCUS_32790 4093 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32790 4999 5223 gene locus_tag LOCUS_32800 4999 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence275 3855 1615 gene locus_tag LOCUS_32810 3855 1615 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730185.1 protein_id gnl|my_center|LOCUS_32810 3906 5234 gene locus_tag LOCUS_32820 3906 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence276 1346 981 gene locus_tag LOCUS_32830 1346 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 2156 1632 gene locus_tag LOCUS_32840 2156 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 3022 2249 gene locus_tag LOCUS_32850 3022 2249 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899491.1 protein_id gnl|my_center|LOCUS_32850 4407 3058 gene locus_tag LOCUS_32860 4407 3058 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_32860 4855 4460 gene locus_tag LOCUS_32870 4855 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence277 53 127 gene locus_tag LOCUS_t00480 53 127 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1005 1931 gene locus_tag LOCUS_32880 1005 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 2969 1977 gene locus_tag LOCUS_32890 2969 1977 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_32890 3889 2966 gene locus_tag LOCUS_32900 3889 2966 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_32900 5109 3886 gene locus_tag LOCUS_32910 5109 3886 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence278 1297 8 gene locus_tag LOCUS_32920 gene gatA 1297 8 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_32920 1602 1294 gene locus_tag LOCUS_32930 gene gatC 1602 1294 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_32930 2357 1599 gene locus_tag LOCUS_32940 2357 1599 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_32940 2472 2876 gene locus_tag LOCUS_32950 2472 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 3853 2915 gene locus_tag LOCUS_32960 3853 2915 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083569.1 protein_id gnl|my_center|LOCUS_32960 4155 5195 gene locus_tag LOCUS_32970 4155 5195 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_32970 >Feature sequence279 335 3238 gene locus_tag LOCUS_32980 gene secA 335 3238 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727975.1 protein_id gnl|my_center|LOCUS_32980 3225 4352 gene locus_tag LOCUS_32990 gene prfB 3225 4352 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_32990 >Feature sequence280 478 23 gene locus_tag LOCUS_33000 gene arfB 478 23 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_33000 554 1552 gene locus_tag LOCUS_33010 554 1552 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_33010 3301 1571 gene locus_tag LOCUS_33020 3301 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 4453 4462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence281 885 571 gene locus_tag LOCUS_33030 885 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 1053 1667 gene locus_tag LOCUS_33040 1053 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 1657 2478 gene locus_tag LOCUS_33050 1657 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 2468 2695 gene locus_tag LOCUS_33060 2468 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 2695 3150 gene locus_tag LOCUS_33070 2695 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 3158 3442 gene locus_tag LOCUS_33080 3158 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 3432 4178 gene locus_tag LOCUS_33090 3432 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 4178 4807 gene locus_tag LOCUS_33100 4178 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence282 470 554 gene locus_tag LOCUS_t00490 470 554 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1423 593 gene locus_tag LOCUS_33110 1423 593 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_33110 1462 2721 gene locus_tag LOCUS_33120 1462 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 2718 3518 gene locus_tag LOCUS_33130 gene fabG 2718 3518 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_33130 3606 3875 gene locus_tag LOCUS_33140 gene acpP 3606 3875 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_33140 3875 5077 gene locus_tag LOCUS_33150 gene fabF 3875 5077 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_33150 >Feature sequence283 382 1920 gene locus_tag LOCUS_33160 382 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 2214 2474 gene locus_tag LOCUS_33170 2214 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 2743 2582 gene locus_tag LOCUS_33180 2743 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 3887 2748 gene locus_tag LOCUS_33190 3887 2748 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804855.1 protein_id gnl|my_center|LOCUS_33190 >Feature sequence284 204 128 gene locus_tag LOCUS_t00500 204 128 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 588 259 gene locus_tag LOCUS_33200 588 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3911 729 gene locus_tag LOCUS_33210 3911 729 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence285 713 306 gene locus_tag LOCUS_33220 713 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 1357 1094 gene locus_tag LOCUS_33230 1357 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 2809 1451 gene locus_tag LOCUS_33240 2809 1451 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026898.1 protein_id gnl|my_center|LOCUS_33240 2932 3753 gene locus_tag LOCUS_33250 2932 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 4784 3639 gene locus_tag LOCUS_33260 4784 3639 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_33260 >Feature sequence286 1081 716 gene locus_tag LOCUS_33270 1081 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 1626 1204 gene locus_tag LOCUS_33280 1626 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 1778 1632 gene locus_tag LOCUS_33290 1778 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 2768 1854 gene locus_tag LOCUS_33300 2768 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 3763 2765 gene locus_tag LOCUS_33310 3763 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 4398 3760 gene locus_tag LOCUS_33320 4398 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 >Feature sequence287 110 1429 gene locus_tag LOCUS_33330 110 1429 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_33330 1502 1834 gene locus_tag LOCUS_33340 1502 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 1898 2995 gene locus_tag LOCUS_33350 1898 2995 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_33350 3982 3077 gene locus_tag LOCUS_33360 3982 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 4346 3879 gene locus_tag LOCUS_33370 4346 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 4967 4737 gene locus_tag LOCUS_33380 4967 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence288 2507 1530 gene locus_tag LOCUS_33390 gene trpS 2507 1530 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_33390 2613 3413 gene locus_tag LOCUS_33400 2613 3413 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408432.1 protein_id gnl|my_center|LOCUS_33400 3459 4064 gene locus_tag LOCUS_33410 3459 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 4048 4881 gene locus_tag LOCUS_33420 4048 4881 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence289 1479 718 gene locus_tag LOCUS_33430 1479 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 1631 2023 gene locus_tag LOCUS_33440 1631 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 2027 2368 gene locus_tag LOCUS_33450 2027 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 2990 2376 gene locus_tag LOCUS_33460 2990 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3903 3439 gene locus_tag LOCUS_33470 3903 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 4457 3900 gene locus_tag LOCUS_33480 4457 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence290 1 273 gene locus_tag LOCUS_33490 1 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 478 2313 gene locus_tag LOCUS_33500 478 2313 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093506.1 protein_id gnl|my_center|LOCUS_33500 2842 2384 gene locus_tag LOCUS_33510 2842 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 <5071 2987 gene locus_tag LOCUS_33520 <5071 2987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549289.1:ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent >Feature sequence291 374 1210 gene locus_tag LOCUS_33530 374 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 1210 1764 gene locus_tag LOCUS_33540 1210 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 1775 2545 gene locus_tag LOCUS_33550 1775 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 2631 3017 gene locus_tag LOCUS_33560 2631 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 3109 4503 gene locus_tag LOCUS_33570 3109 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 4500 4997 gene locus_tag LOCUS_33580 4500 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence292 2631 1117 gene locus_tag LOCUS_33590 2631 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 3524 2628 gene locus_tag LOCUS_33600 3524 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 3569 3928 gene locus_tag LOCUS_33610 3569 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 4684 3968 gene locus_tag LOCUS_33620 4684 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 >Feature sequence293 244 561 gene locus_tag LOCUS_33630 244 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 630 1535 gene locus_tag LOCUS_33640 630 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1538 4180 gene locus_tag LOCUS_33650 1538 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence294 1091 57 gene locus_tag LOCUS_33660 1091 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 1449 2066 gene locus_tag LOCUS_33670 1449 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 2310 2615 gene locus_tag LOCUS_33680 2310 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3165 2581 gene locus_tag LOCUS_33690 3165 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 4838 3162 gene locus_tag LOCUS_33700 4838 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence295 1009 236 gene locus_tag LOCUS_33710 1009 236 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484635.1 protein_id gnl|my_center|LOCUS_33710 1027 1099 gene locus_tag LOCUS_t00510 1027 1099 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1686 1141 gene locus_tag LOCUS_33720 1686 1141 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838224.1 protein_id gnl|my_center|LOCUS_33720 2199 1741 gene locus_tag LOCUS_33730 2199 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 2516 2196 gene locus_tag LOCUS_33740 gene clpS 2516 2196 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776026.1 protein_id gnl|my_center|LOCUS_33740 2589 3317 gene locus_tag LOCUS_33750 2589 3317 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804965.1 protein_id gnl|my_center|LOCUS_33750 3299 4048 gene locus_tag LOCUS_33760 3299 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 4143 4601 gene locus_tag LOCUS_33770 4143 4601 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_33770 >Feature sequence296 1187 1588 gene locus_tag LOCUS_33780 1187 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 1802 3934 gene locus_tag LOCUS_33790 1802 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 3943 4827 gene locus_tag LOCUS_33800 3943 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence297 2293 1343 gene locus_tag LOCUS_33810 2293 1343 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148616319.1 protein_id gnl|my_center|LOCUS_33810 3299 2295 gene locus_tag LOCUS_33820 gene argF 3299 2295 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_33820 4561 3335 gene locus_tag LOCUS_33830 4561 3335 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_33830 >Feature sequence298 133 2127 gene locus_tag LOCUS_33840 133 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2445 2062 gene locus_tag LOCUS_33850 2445 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 2879 2806 gene locus_tag LOCUS_t00520 2879 2806 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3093 3764 gene locus_tag LOCUS_33860 3093 3764 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence299 582 367 gene locus_tag LOCUS_33870 582 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 839 657 gene locus_tag LOCUS_33880 839 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 2636 918 gene locus_tag LOCUS_33890 2636 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 >Feature sequence300 745 987 gene locus_tag LOCUS_33900 745 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 984 1316 gene locus_tag LOCUS_33910 gene whcE 984 1316 CDS product WhiB family transcriptional regulator WhcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858159.1 protein_id gnl|my_center|LOCUS_33910 1399 2565 gene locus_tag LOCUS_33920 1399 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 2495 3994 gene locus_tag LOCUS_33930 gene hpnJ 2495 3994 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_33930 <4876 4090 gene locus_tag LOCUS_33940 <4876 4090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941161.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence301 3128 774 gene locus_tag LOCUS_33950 3128 774 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_33950 3205 3798 gene locus_tag LOCUS_33960 3205 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 4613 3834 gene locus_tag LOCUS_33970 4613 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 4792 4867 gene locus_tag LOCUS_t00530 4792 4867 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence302 292 86 gene locus_tag LOCUS_33980 292 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 1887 544 gene locus_tag LOCUS_33990 1887 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 1859 2308 gene locus_tag LOCUS_34000 1859 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3140 2361 gene locus_tag LOCUS_34010 3140 2361 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113379.1 protein_id gnl|my_center|LOCUS_34010 3374 3168 gene locus_tag LOCUS_34020 3374 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 >Feature sequence303 <1 1055 gene locus_tag LOCUS_34030 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224513.1:protoporphyrinogen oxidase 1052 2269 gene locus_tag LOCUS_34040 gene pcaD 1052 2269 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_34040 2347 3819 gene locus_tag LOCUS_34050 gene lnt 2347 3819 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226566.1 protein_id gnl|my_center|LOCUS_34050 4301 3810 gene locus_tag LOCUS_34060 4301 3810 CDS product NIF family HAD-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816113.1 protein_id gnl|my_center|LOCUS_34060 >Feature sequence304 497 664 gene locus_tag LOCUS_34070 497 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 841 1485 gene locus_tag LOCUS_34080 841 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34080 2000 1845 gene locus_tag LOCUS_34090 2000 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 2659 3762 gene locus_tag LOCUS_34100 2659 3762 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289328.1 protein_id gnl|my_center|LOCUS_34100 4072 4386 gene locus_tag LOCUS_34110 4072 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 4688 4479 gene locus_tag LOCUS_34120 4688 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 >Feature sequence305 2059 908 gene locus_tag LOCUS_34130 2059 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 4782 2206 gene locus_tag LOCUS_34140 4782 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 >Feature sequence306 338 1249 gene locus_tag LOCUS_34150 338 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 1239 2111 gene locus_tag LOCUS_34160 1239 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3863 2313 gene locus_tag LOCUS_34170 3863 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence307 <1 1882 gene locus_tag LOCUS_34180 <1 1882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467407.1:DNA polymerase I 2048 3568 gene locus_tag LOCUS_34190 gene rpsA 2048 3568 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950568.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence308 2564 582 gene locus_tag LOCUS_34200 2564 582 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031418.1 protein_id gnl|my_center|LOCUS_34200 3330 4256 gene locus_tag LOCUS_34210 3330 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 >Feature sequence309 140 1183 gene locus_tag LOCUS_34220 140 1183 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_34220 1880 1245 gene locus_tag LOCUS_34230 1880 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 1997 2206 gene locus_tag LOCUS_34240 1997 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 2239 3285 gene locus_tag LOCUS_34250 2239 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 3337 3852 gene locus_tag LOCUS_34260 3337 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 <4760 3812 gene locus_tag LOCUS_34270 <4760 3812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942744.1:catalase/peroxidase HPI >Feature sequence310 346 1002 gene locus_tag LOCUS_34280 346 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34280 1083 2294 gene locus_tag LOCUS_34290 1083 2294 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053137.1 protein_id gnl|my_center|LOCUS_34290 2291 3247 gene locus_tag LOCUS_34300 2291 3247 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_34300 3244 4281 gene locus_tag LOCUS_34310 3244 4281 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054866.1 protein_id gnl|my_center|LOCUS_34310 >Feature sequence311 1117 209 gene locus_tag LOCUS_34320 1117 209 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_34320 3689 1362 gene locus_tag LOCUS_34330 3689 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 4503 3700 gene locus_tag LOCUS_34340 4503 3700 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_34340 >Feature sequence312 1028 1330 gene locus_tag LOCUS_34350 1028 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 1327 1707 gene locus_tag LOCUS_34360 1327 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 2749 2267 gene locus_tag LOCUS_34370 gene ribE 2749 2267 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_34370 3980 2739 gene locus_tag LOCUS_34380 3980 2739 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_34380 4588 3977 gene locus_tag LOCUS_34390 4588 3977 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_34390 >Feature sequence313 2820 1003 gene locus_tag LOCUS_34400 2820 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 2896 3306 gene locus_tag LOCUS_34410 2896 3306 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_34410 3349 3564 gene locus_tag LOCUS_34420 3349 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence314 2059 332 gene locus_tag LOCUS_34430 2059 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 2500 2333 gene locus_tag LOCUS_34440 2500 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 3231 3022 gene locus_tag LOCUS_34450 3231 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 3457 3275 gene locus_tag LOCUS_34460 3457 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 4122 3781 gene locus_tag LOCUS_34470 gene mazF6 4122 3781 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_34470 4394 4119 gene locus_tag LOCUS_34480 4394 4119 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410014.1 protein_id gnl|my_center|LOCUS_34480 >Feature sequence315 908 72 gene locus_tag LOCUS_34490 gene rplB 908 72 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_34490 1205 915 gene locus_tag LOCUS_34500 1205 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34500 2068 1205 gene locus_tag LOCUS_34510 2068 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 2727 2065 gene locus_tag LOCUS_34520 gene rplC 2727 2065 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403579.1 protein_id gnl|my_center|LOCUS_34520 3310 2984 gene locus_tag LOCUS_34530 gene rpsJ 3310 2984 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_34530 4540 3353 gene locus_tag LOCUS_34540 gene tuf 4540 3353 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_34540 >Feature sequence316 1620 280 gene locus_tag LOCUS_34550 1620 280 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_34550 3072 1738 gene locus_tag LOCUS_34560 3072 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3737 3069 gene locus_tag LOCUS_34570 3737 3069 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820363.1 protein_id gnl|my_center|LOCUS_34570 3851 4381 gene locus_tag LOCUS_34580 3851 4381 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_34580 >Feature sequence317 <1 770 gene locus_tag LOCUS_34590 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966697.1:NAD/NADP-dependent octopine/nopaline dehydrogenase family protein 767 1768 gene locus_tag LOCUS_34600 gene mer 767 1768 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_34600 1999 3081 gene locus_tag LOCUS_34610 gene pdhA 1999 3081 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_34610 3078 4082 gene locus_tag LOCUS_34620 3078 4082 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_34620 >Feature sequence318 161 349 gene locus_tag LOCUS_34630 161 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 473 1219 gene locus_tag LOCUS_34640 gene cobI 473 1219 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028010.1 protein_id gnl|my_center|LOCUS_34640 1216 2004 gene locus_tag LOCUS_34650 gene cobM 1216 2004 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976965.1 protein_id gnl|my_center|LOCUS_34650 2049 3767 gene locus_tag LOCUS_34660 gene cobJ 2049 3767 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483898.1 protein_id gnl|my_center|LOCUS_34660 3817 4440 gene locus_tag LOCUS_34670 3817 4440 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392611.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence319 315 1820 gene locus_tag LOCUS_34680 gene glpK 315 1820 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_34680 1830 2939 gene locus_tag LOCUS_34690 1830 2939 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_34690 2975 3883 gene locus_tag LOCUS_34700 2975 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence320 <1 2641 gene locus_tag LOCUS_34710 <1 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258561.1:Swt1 family HEPN domain-containing protein 1979 1988 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence321 1643 612 gene locus_tag LOCUS_34720 gene speB 1643 612 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_34720 2356 1640 gene locus_tag LOCUS_34730 2356 1640 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228766.1 protein_id gnl|my_center|LOCUS_34730 3911 2436 gene locus_tag LOCUS_34740 3911 2436 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_34740 4127 4199 gene locus_tag LOCUS_t00540 4127 4199 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence322 412 810 gene locus_tag LOCUS_34750 412 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 859 2247 gene locus_tag LOCUS_34760 859 2247 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_34760 2244 3059 gene locus_tag LOCUS_34770 2244 3059 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 protein_id gnl|my_center|LOCUS_34770 3052 4275 gene locus_tag LOCUS_34780 3052 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence323 2218 1424 gene locus_tag LOCUS_34790 2218 1424 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230125.1 protein_id gnl|my_center|LOCUS_34790 2865 2215 gene locus_tag LOCUS_34800 2865 2215 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103336743.1 protein_id gnl|my_center|LOCUS_34800 4090 2978 gene locus_tag LOCUS_34810 4090 2978 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727711.1 protein_id gnl|my_center|LOCUS_34810 >Feature sequence324 <1 556 gene locus_tag LOCUS_34820 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003424529.1:isoprenyl transferase 549 2420 gene locus_tag LOCUS_34830 549 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 4284 2542 gene locus_tag LOCUS_34840 4284 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence325 1310 483 gene locus_tag LOCUS_34850 1310 483 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 protein_id gnl|my_center|LOCUS_34850 1413 2114 gene locus_tag LOCUS_34860 1413 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 2670 2119 gene locus_tag LOCUS_34870 2670 2119 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403256.1 protein_id gnl|my_center|LOCUS_34870 3511 2675 gene locus_tag LOCUS_34880 3511 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 >Feature sequence326 1771 926 gene locus_tag LOCUS_34890 1771 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 1810 2958 gene locus_tag LOCUS_34900 1810 2958 CDS product galactosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484813.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence327 232 531 gene locus_tag LOCUS_34910 232 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 531 1652 gene locus_tag LOCUS_34920 531 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 1900 2400 gene locus_tag LOCUS_34930 1900 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34930 2430 3167 gene locus_tag LOCUS_34940 2430 3167 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 protein_id gnl|my_center|LOCUS_34940 3164 4030 gene locus_tag LOCUS_34950 3164 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 >Feature sequence328 <1 759 gene locus_tag LOCUS_34960 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390023.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 756 1616 gene locus_tag LOCUS_34970 gene argB 756 1616 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_34970 1613 2794 gene locus_tag LOCUS_34980 1613 2794 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110845.1 protein_id gnl|my_center|LOCUS_34980 2791 3306 gene locus_tag LOCUS_34990 2791 3306 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence329 1221 310 gene locus_tag LOCUS_35000 1221 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 1112 2518 gene locus_tag LOCUS_35010 1112 2518 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_35010 2564 3028 gene locus_tag LOCUS_35020 2564 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence330 437 814 gene locus_tag LOCUS_35030 437 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 2582 864 gene locus_tag LOCUS_35040 2582 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 2992 2840 gene locus_tag LOCUS_35050 2992 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 4185 2989 gene locus_tag LOCUS_35060 4185 2989 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_35060 >Feature sequence331 392 401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 429 791 gene locus_tag LOCUS_35070 429 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35070 842 1420 gene locus_tag LOCUS_35080 gene ruvC 842 1420 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_35080 1417 1998 gene locus_tag LOCUS_35090 gene ruvA 1417 1998 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772102.1 protein_id gnl|my_center|LOCUS_35090 2432 2441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2446 3138 gene locus_tag LOCUS_35100 2446 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35100 3287 3835 gene locus_tag LOCUS_35110 3287 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 >Feature sequence332 567 2639 gene locus_tag LOCUS_35120 567 2639 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402998.1 protein_id gnl|my_center|LOCUS_35120 2809 2600 gene locus_tag LOCUS_35130 2809 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 4080 2806 gene locus_tag LOCUS_35140 4080 2806 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence333 69 962 gene locus_tag LOCUS_35150 69 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228860.1 protein_id gnl|my_center|LOCUS_35150 959 2347 gene locus_tag LOCUS_35160 959 2347 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_35160 2344 3213 gene locus_tag LOCUS_35170 2344 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 3210 4115 gene locus_tag LOCUS_35180 3210 4115 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 protein_id gnl|my_center|LOCUS_35180 4158 4361 gene locus_tag LOCUS_35190 4158 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence334 794 1906 gene locus_tag LOCUS_35200 794 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 2101 3108 gene locus_tag LOCUS_35210 2101 3108 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_35210 3105 3707 gene locus_tag LOCUS_35220 3105 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35220 3668 3991 gene locus_tag LOCUS_35230 3668 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 4111 4038 gene locus_tag LOCUS_t00550 4111 4038 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence335 <1 852 gene locus_tag LOCUS_35240 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530465.1:FAD-binding oxidoreductase 2205 838 gene locus_tag LOCUS_35250 2205 838 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence336 3178 1139 gene locus_tag LOCUS_35260 3178 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 3528 3175 gene locus_tag LOCUS_35270 3528 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 4355 3525 gene locus_tag LOCUS_35280 4355 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence337 1600 707 gene locus_tag LOCUS_35290 1600 707 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876861.1 protein_id gnl|my_center|LOCUS_35290 3990 1597 gene locus_tag LOCUS_35300 3990 1597 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence338 438 2816 gene locus_tag LOCUS_35310 438 2816 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927044.1 protein_id gnl|my_center|LOCUS_35310 2954 3961 gene locus_tag LOCUS_35320 2954 3961 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_35320 >Feature sequence339 2293 1352 gene locus_tag LOCUS_35330 2293 1352 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748902.1 protein_id gnl|my_center|LOCUS_35330 2614 3858 gene locus_tag LOCUS_35340 2614 3858 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742179.1 protein_id gnl|my_center|LOCUS_35340 >Feature sequence340 841 356 gene locus_tag LOCUS_35350 gene def 841 356 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_35350 2523 853 gene locus_tag LOCUS_35360 2523 853 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_35360 1094 1103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3749 2559 gene locus_tag LOCUS_35370 gene metK 3749 2559 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_35370 4036 3749 gene locus_tag LOCUS_35380 4036 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35380 >Feature sequence341 2198 147 gene locus_tag LOCUS_35390 2198 147 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_35390 2253 3020 gene locus_tag LOCUS_35400 2253 3020 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_35400 <4337 3086 gene locus_tag LOCUS_35410 <4337 3086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223496096.1:o-succinylbenzoate--CoA ligase >Feature sequence342 388 1578 gene locus_tag LOCUS_35420 388 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 1581 3332 gene locus_tag LOCUS_35430 1581 3332 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812769.1 protein_id gnl|my_center|LOCUS_35430 >Feature sequence343 2308 1574 gene locus_tag LOCUS_35440 2308 1574 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640373.1 protein_id gnl|my_center|LOCUS_35440 2554 3189 gene locus_tag LOCUS_35450 2554 3189 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_35450 3744 3208 gene locus_tag LOCUS_35460 gene orn 3744 3208 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_35460 3862 4314 gene locus_tag LOCUS_35470 gene dut 3862 4314 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_35470 >Feature sequence344 <1 665 gene locus_tag LOCUS_35480 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888809.1:adenylosuccinate lyase 662 1567 gene locus_tag LOCUS_35490 662 1567 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230768.1 protein_id gnl|my_center|LOCUS_35490 1582 1836 gene locus_tag LOCUS_35500 gene purS 1582 1836 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_35500 1833 2513 gene locus_tag LOCUS_35510 gene purQ 1833 2513 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 protein_id gnl|my_center|LOCUS_35510 >Feature sequence345 218 1198 gene locus_tag LOCUS_35520 218 1198 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728195.1 protein_id gnl|my_center|LOCUS_35520 1307 2134 gene locus_tag LOCUS_35530 1307 2134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970045.1 protein_id gnl|my_center|LOCUS_35530 2131 3018 gene locus_tag LOCUS_35540 2131 3018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395917.1 protein_id gnl|my_center|LOCUS_35540 3093 4124 gene locus_tag LOCUS_35550 3093 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence346 518 225 gene locus_tag LOCUS_35560 518 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 1065 589 gene locus_tag LOCUS_35570 1065 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 1340 1143 gene locus_tag LOCUS_35580 1340 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 1577 2503 gene locus_tag LOCUS_35590 1577 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 2475 2651 gene locus_tag LOCUS_35600 2475 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 2731 3234 gene locus_tag LOCUS_35610 2731 3234 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227619.1 protein_id gnl|my_center|LOCUS_35610 3281 3775 gene locus_tag LOCUS_35620 3281 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence347 719 93 gene locus_tag LOCUS_35630 719 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 1144 725 gene locus_tag LOCUS_35640 1144 725 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_35640 1711 1286 gene locus_tag LOCUS_35650 1711 1286 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_35650 1819 3510 gene locus_tag LOCUS_35660 gene glpD 1819 3510 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence348 242 1201 gene locus_tag LOCUS_35670 242 1201 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080538.1 protein_id gnl|my_center|LOCUS_35670 1134 2639 gene locus_tag LOCUS_35680 1134 2639 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_35680 2703 4103 gene locus_tag LOCUS_35690 2703 4103 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence349 2009 138 gene locus_tag LOCUS_35700 2009 138 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_35700 3825 2071 gene locus_tag LOCUS_35710 3825 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence350 294 16 gene locus_tag LOCUS_35720 294 16 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_35720 1553 285 gene locus_tag LOCUS_35730 gene thrC 1553 285 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 protein_id gnl|my_center|LOCUS_35730 1799 2731 gene locus_tag LOCUS_35740 1799 2731 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908106.1 protein_id gnl|my_center|LOCUS_35740 2788 4188 gene locus_tag LOCUS_35750 2788 4188 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence351 <1 786 gene locus_tag LOCUS_35760 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027999.1:glycoside hydrolase family 15 protein 783 1832 gene locus_tag LOCUS_35770 783 1832 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_35770 1829 2878 gene locus_tag LOCUS_35780 1829 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 3140 2883 gene locus_tag LOCUS_35790 3140 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 3414 3214 gene locus_tag LOCUS_35800 3414 3214 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966272.1 protein_id gnl|my_center|LOCUS_35800 3897 3811 gene locus_tag LOCUS_t00560 3897 3811 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence352 388 2040 gene locus_tag LOCUS_35810 388 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence353 84 1073 gene locus_tag LOCUS_35820 84 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 1083 1817 gene locus_tag LOCUS_35830 1083 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 2595 1849 gene locus_tag LOCUS_35840 2595 1849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225676.1 protein_id gnl|my_center|LOCUS_35840 3353 2592 gene locus_tag LOCUS_35850 3353 2592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_35850 >Feature sequence354 <1 525 gene locus_tag LOCUS_35860 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004559569.1:bifunctional nuclease family protein 1598 603 gene locus_tag LOCUS_35870 1598 603 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807763.1 protein_id gnl|my_center|LOCUS_35870 1786 3093 gene locus_tag LOCUS_35880 1786 3093 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224729.1 protein_id gnl|my_center|LOCUS_35880 3620 3069 gene locus_tag LOCUS_35890 3620 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence355 552 139 gene locus_tag LOCUS_35900 552 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 660 2147 gene locus_tag LOCUS_35910 660 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 2477 3268 gene locus_tag LOCUS_35920 2477 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 >Feature sequence356 371 1276 gene locus_tag LOCUS_35930 371 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 2401 1349 gene locus_tag LOCUS_35940 2401 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 4025 2610 gene locus_tag LOCUS_35950 gene niaP 4025 2610 CDS product niacin permease NiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246397.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence357 1602 112 gene locus_tag LOCUS_35960 gene ltrA 1602 112 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145832239.1 protein_id gnl|my_center|LOCUS_35960 3273 1981 gene locus_tag LOCUS_35970 3273 1981 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078903565.1 protein_id gnl|my_center|LOCUS_35970 3452 4012 gene locus_tag LOCUS_35980 3452 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence358 <1 1308 gene locus_tag LOCUS_35990 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208974886.1:thiol reductant ABC exporter subunit CydC 1348 2124 gene locus_tag LOCUS_36000 1348 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 3068 2139 gene locus_tag LOCUS_36010 3068 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 3661 3065 gene locus_tag LOCUS_36020 3661 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 4107 3730 gene locus_tag LOCUS_36030 4107 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence359 2025 934 gene locus_tag LOCUS_36040 2025 934 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 protein_id gnl|my_center|LOCUS_36040 3162 2101 gene locus_tag LOCUS_36050 3162 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence360 65 598 gene locus_tag LOCUS_36060 65 598 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_36060 747 1817 gene locus_tag LOCUS_36070 gene moaA 747 1817 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_36070 2445 1762 gene locus_tag LOCUS_36080 2445 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 3645 2506 gene locus_tag LOCUS_36090 3645 2506 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_36090 <4143 3642 gene locus_tag LOCUS_36100 <4143 3642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256669.1:VWA domain-containing protein >Feature sequence361 1474 119 gene locus_tag LOCUS_36110 1474 119 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727859.1 protein_id gnl|my_center|LOCUS_36110 2124 1687 gene locus_tag LOCUS_36120 2124 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 2813 2121 gene locus_tag LOCUS_36130 2813 2121 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 protein_id gnl|my_center|LOCUS_36130 3842 3045 gene locus_tag LOCUS_36140 gene larE 3842 3045 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence362 <1 1061 gene locus_tag LOCUS_36150 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486225.1:glycosyltransferase family 4 protein 1101 1544 gene locus_tag LOCUS_36160 1101 1544 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_36160 1552 2643 gene locus_tag LOCUS_36170 1552 2643 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_36170 2665 3345 gene locus_tag LOCUS_36180 2665 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 >Feature sequence363 961 389 gene locus_tag LOCUS_36190 961 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 1408 1097 gene locus_tag LOCUS_36200 1408 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 1983 1738 gene locus_tag LOCUS_36210 1983 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 2185 1991 gene locus_tag LOCUS_36220 2185 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 2448 2182 gene locus_tag LOCUS_36230 2448 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 3080 2499 gene locus_tag LOCUS_36240 3080 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 3573 3208 gene locus_tag LOCUS_36250 3573 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence364 880 608 gene locus_tag LOCUS_36260 880 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 1610 963 gene locus_tag LOCUS_36270 1610 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36270 2021 1629 gene locus_tag LOCUS_36280 2021 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227620.1 protein_id gnl|my_center|LOCUS_36280 2232 2056 gene locus_tag LOCUS_36290 2232 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 2513 2857 gene locus_tag LOCUS_36300 2513 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 3446 3177 gene locus_tag LOCUS_36310 3446 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36310 >Feature sequence365 114 974 gene locus_tag LOCUS_36320 gene ftsE 114 974 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_36320 974 1858 gene locus_tag LOCUS_36330 gene ftsX 974 1858 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_36330 1975 2379 gene locus_tag LOCUS_36340 1975 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 2502 2711 gene locus_tag LOCUS_36350 2502 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 3067 2663 gene locus_tag LOCUS_36360 gene msrB 3067 2663 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971244.1 protein_id gnl|my_center|LOCUS_36360 3254 3820 gene locus_tag LOCUS_36370 3254 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 3817 4071 gene locus_tag LOCUS_36380 3817 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence366 1201 803 gene locus_tag LOCUS_36390 1201 803 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_36390 1971 1198 gene locus_tag LOCUS_36400 1971 1198 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233048.1 protein_id gnl|my_center|LOCUS_36400 2542 1985 gene locus_tag LOCUS_36410 2542 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3878 2721 gene locus_tag LOCUS_36420 gene moeB 3878 2721 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence367 <1 848 gene locus_tag LOCUS_36430 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531566.1:HAD family hydrolase 912 3020 gene locus_tag LOCUS_36440 gene glgX 912 3020 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_36440 3210 3461 gene locus_tag LOCUS_36450 3210 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence368 2434 734 gene locus_tag LOCUS_36460 2434 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 3444 2581 gene locus_tag LOCUS_36470 3444 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 2594 2603 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3529 4017 gene locus_tag LOCUS_36480 gene greA 3529 4017 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_36480 >Feature sequence369 1671 1447 gene locus_tag LOCUS_36490 1671 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 2498 1668 gene locus_tag LOCUS_36500 2498 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 3916 2495 gene locus_tag LOCUS_36510 3916 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 >Feature sequence370 1189 731 gene locus_tag LOCUS_36520 1189 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 1739 2944 gene locus_tag LOCUS_36530 1739 2944 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229302.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36530 2982 3188 gene locus_tag LOCUS_36540 2982 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3278 3724 gene locus_tag LOCUS_36550 3278 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 3721 3960 gene locus_tag LOCUS_36560 3721 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence371 377 1135 gene locus_tag LOCUS_36570 377 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 1571 1095 gene locus_tag LOCUS_36580 1571 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 2351 1596 gene locus_tag LOCUS_36590 2351 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 2817 2338 gene locus_tag LOCUS_36600 2817 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 <4044 3175 gene locus_tag LOCUS_36610 <4044 3175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256261.1:FAD-dependent thymidylate synthase >Feature sequence372 1821 436 gene locus_tag LOCUS_36620 gene gcvPA 1821 436 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_36620 2903 1821 gene locus_tag LOCUS_36630 gene gcvT 2903 1821 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899219.1 protein_id gnl|my_center|LOCUS_36630 3398 2964 gene locus_tag LOCUS_36640 3398 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 3955 3395 gene locus_tag LOCUS_36650 3955 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 >Feature sequence373 806 240 gene locus_tag LOCUS_36660 806 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36660 1617 724 gene locus_tag LOCUS_36670 1617 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36670 2591 1614 gene locus_tag LOCUS_36680 2591 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_36680 3175 2594 gene locus_tag LOCUS_36690 3175 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 3944 3300 gene locus_tag LOCUS_36700 3944 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence374 253 501 gene locus_tag LOCUS_36710 253 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 1747 530 gene locus_tag LOCUS_36720 1747 530 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031800.1 protein_id gnl|my_center|LOCUS_36720 2498 1824 gene locus_tag LOCUS_36730 2498 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 2791 3036 gene locus_tag LOCUS_36740 2791 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 3390 3211 gene locus_tag LOCUS_36750 3390 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 >Feature sequence375 184 1017 gene locus_tag LOCUS_36760 184 1017 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_36760 1312 1953 gene locus_tag LOCUS_36770 1312 1953 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730225.1 protein_id gnl|my_center|LOCUS_36770 1966 3156 gene locus_tag LOCUS_36780 1966 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 >Feature sequence376 1112 90 gene locus_tag LOCUS_36790 1112 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 2881 1496 gene locus_tag LOCUS_36800 2881 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 3657 2875 gene locus_tag LOCUS_36810 3657 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 3625 3774 gene locus_tag LOCUS_36820 3625 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 >Feature sequence377 947 780 gene locus_tag LOCUS_36830 947 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 1245 1078 gene locus_tag LOCUS_36840 1245 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 2356 1256 gene locus_tag LOCUS_36850 2356 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 2890 2591 gene locus_tag LOCUS_36860 2890 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3159 2881 gene locus_tag LOCUS_36870 3159 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 3571 3407 gene locus_tag LOCUS_36880 3571 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 3875 3591 gene locus_tag LOCUS_36890 3875 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence378 1643 24 gene locus_tag LOCUS_36900 1643 24 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_36900 1754 2425 gene locus_tag LOCUS_36910 1754 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 2975 2439 gene locus_tag LOCUS_36920 2975 2439 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_36920 <3921 3206 gene locus_tag LOCUS_36930 <3921 3206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230733.1:3-hydroxybutyryl-CoA dehydrogenase >Feature sequence379 2201 1209 gene locus_tag LOCUS_36940 gene meaB 2201 1209 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_36940 3577 2198 gene locus_tag LOCUS_36950 gene murA 3577 2198 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence380 1964 213 gene locus_tag LOCUS_36960 1964 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 3538 2057 gene locus_tag LOCUS_36970 3538 2057 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_36970 3896 3531 gene locus_tag LOCUS_36980 3896 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 >Feature sequence381 1376 1014 gene locus_tag LOCUS_36990 1376 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 2611 1481 gene locus_tag LOCUS_37000 gene dnaJ 2611 1481 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_37000 3340 2615 gene locus_tag LOCUS_37010 gene grpE 3340 2615 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 protein_id gnl|my_center|LOCUS_37010 <3895 3337 gene locus_tag LOCUS_37020 <3895 3337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230874.1:molecular chaperone DnaK >Feature sequence382 359 2470 gene locus_tag LOCUS_37030 359 2470 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089963.1 protein_id gnl|my_center|LOCUS_37030 2812 3867 gene locus_tag LOCUS_37040 2812 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 >Feature sequence383 1222 287 gene locus_tag LOCUS_37050 1222 287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_37050 1745 1506 gene locus_tag LOCUS_37060 1745 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 3052 1742 gene locus_tag LOCUS_37070 3052 1742 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_37070 >Feature sequence384 1289 144 gene locus_tag LOCUS_37080 1289 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 2742 1303 gene locus_tag LOCUS_37090 2742 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 >Feature sequence385 36 2114 gene locus_tag LOCUS_37100 gene fusA 36 2114 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_37100 2696 2178 gene locus_tag LOCUS_37110 2696 2178 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403826.1 protein_id gnl|my_center|LOCUS_37110 <3850 2699 gene locus_tag LOCUS_37120 <3850 2699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977296.1:threonine--tRNA ligase >Feature sequence386 1201 203 gene locus_tag LOCUS_37130 1201 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 1569 1207 gene locus_tag LOCUS_37140 gene trxA 1569 1207 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_37140 2644 1685 gene locus_tag LOCUS_37150 gene trxB 2644 1685 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_37150 3053 2652 gene locus_tag LOCUS_37160 3053 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 <3845 3050 gene locus_tag LOCUS_37170 <3845 3050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976234.1:DegV family protein >Feature sequence387 859 299 gene locus_tag LOCUS_37180 859 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 1656 859 gene locus_tag LOCUS_37190 1656 859 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970566.1 protein_id gnl|my_center|LOCUS_37190 1767 2474 gene locus_tag LOCUS_37200 1767 2474 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 protein_id gnl|my_center|LOCUS_37200 3038 3469 gene locus_tag LOCUS_37210 3038 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 3529 3789 gene locus_tag LOCUS_37220 3529 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence388 1556 711 gene locus_tag LOCUS_37230 1556 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 2425 1553 gene locus_tag LOCUS_37240 2425 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 2953 2576 gene locus_tag LOCUS_37250 2953 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence389 279 112 gene locus_tag LOCUS_37260 279 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 798 493 gene locus_tag LOCUS_37270 798 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 1680 994 gene locus_tag LOCUS_37280 1680 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 1615 1827 gene locus_tag LOCUS_37290 1615 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1909 2439 gene locus_tag LOCUS_37300 1909 2439 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552515.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37300 2452 3270 gene locus_tag LOCUS_37310 2452 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37310 3741 3295 gene locus_tag LOCUS_37320 3741 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence390 507 884 gene locus_tag LOCUS_37330 507 884 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_37330 881 2899 gene locus_tag LOCUS_37340 881 2899 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_37340 >Feature sequence391 528 2312 gene locus_tag LOCUS_37350 gene lepA 528 2312 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900516.1 protein_id gnl|my_center|LOCUS_37350 2447 3532 gene locus_tag LOCUS_37360 gene hrcA 2447 3532 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123574708.1 protein_id gnl|my_center|LOCUS_37360 >Feature sequence392 3 713 gene locus_tag LOCUS_37370 3 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 796 1983 gene locus_tag LOCUS_37380 gene ftsW 796 1983 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_37380 1980 3125 gene locus_tag LOCUS_37390 gene murG 1980 3125 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_37390 >Feature sequence393 666 1406 gene locus_tag LOCUS_37400 666 1406 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_37400 1676 1407 gene locus_tag LOCUS_37410 1676 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 1692 2486 gene locus_tag LOCUS_37420 1692 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 2549 2624 gene locus_tag LOCUS_t00570 2549 2624 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3103 2873 gene locus_tag LOCUS_37430 3103 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 >Feature sequence394 694 305 gene locus_tag LOCUS_37440 694 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 1512 697 gene locus_tag LOCUS_37450 1512 697 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 protein_id gnl|my_center|LOCUS_37450 2879 1509 gene locus_tag LOCUS_37460 2879 1509 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_37460 3541 2909 gene locus_tag LOCUS_37470 3541 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence395 342 1598 gene locus_tag LOCUS_37480 gene nagA 342 1598 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417418.1 protein_id gnl|my_center|LOCUS_37480 2468 1821 gene locus_tag LOCUS_37490 2468 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 >Feature sequence396 528 2018 gene locus_tag LOCUS_37500 gene mmsA 528 2018 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_37500 >Feature sequence397 1344 70 gene locus_tag LOCUS_37510 gene larC 1344 70 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122655.1 protein_id gnl|my_center|LOCUS_37510 2102 1341 gene locus_tag LOCUS_37520 gene larB 2102 1341 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_37520 2127 3116 gene locus_tag LOCUS_37530 gene pheA 2127 3116 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_37530 >Feature sequence398 468 1325 gene locus_tag LOCUS_37540 468 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 1526 1804 gene locus_tag LOCUS_37550 1526 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 1804 3078 gene locus_tag LOCUS_37560 1804 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 >Feature sequence399 383 2209 gene locus_tag LOCUS_37570 gene ftsH 383 2209 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173542.1 protein_id gnl|my_center|LOCUS_37570 2284 2958 gene locus_tag LOCUS_37580 2284 2958 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_37580 3314 2934 gene locus_tag LOCUS_37590 3314 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 >Feature sequence400 1607 2965 gene locus_tag LOCUS_37600 1607 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 3185 3445 gene locus_tag LOCUS_37610 3185 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 >Feature sequence401 583 3465 gene locus_tag LOCUS_37620 583 3465 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence402 430 29 gene locus_tag LOCUS_37630 430 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 591 427 gene locus_tag LOCUS_37640 591 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 2080 1091 gene locus_tag LOCUS_37650 2080 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 3093 2077 gene locus_tag LOCUS_37660 3093 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 <3677 3097 gene locus_tag LOCUS_37670 <3677 3097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173990.1:type IV pilus twitching motility protein PilT >Feature sequence403 458 81 gene locus_tag LOCUS_37680 458 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 711 1352 gene locus_tag LOCUS_37690 711 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 1489 1322 gene locus_tag LOCUS_37700 1489 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 1917 2576 gene locus_tag LOCUS_37710 1917 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 2573 2821 gene locus_tag LOCUS_37720 2573 2821 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410014.1 protein_id gnl|my_center|LOCUS_37720 2818 3159 gene locus_tag LOCUS_37730 gene mazF6 2818 3159 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_37730 >Feature sequence404 3057 346 gene locus_tag LOCUS_37740 3057 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 3128 3616 gene locus_tag LOCUS_37750 gene greA 3128 3616 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence405 1472 180 gene locus_tag LOCUS_37760 1472 180 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_37760 2092 1544 gene locus_tag LOCUS_37770 2092 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 3254 2103 gene locus_tag LOCUS_37780 3254 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 2352 2361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence406 35 1090 gene locus_tag LOCUS_37790 35 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 1572 1081 gene locus_tag LOCUS_37800 1572 1081 CDS product NIF family HAD-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816113.1 protein_id gnl|my_center|LOCUS_37800 3454 1577 gene locus_tag LOCUS_37810 3454 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 >Feature sequence407 2920 1802 gene locus_tag LOCUS_37820 2920 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 3210 2959 gene locus_tag LOCUS_37830 3210 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 3416 3341 gene locus_tag LOCUS_t00580 3416 3341 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence408 637 1791 gene locus_tag LOCUS_37840 637 1791 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_37840 1918 3066 gene locus_tag LOCUS_37850 1918 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 >Feature sequence409 371 2497 gene locus_tag LOCUS_37860 371 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 2762 3223 gene locus_tag LOCUS_37870 2762 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 >Feature sequence410 2591 1299 gene locus_tag LOCUS_37880 2591 1299 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039861.1 protein_id gnl|my_center|LOCUS_37880 <3599 2648 gene locus_tag LOCUS_37890 <3599 2648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908417.1:phosphatidate cytidylyltransferase >Feature sequence411 67 1455 gene locus_tag LOCUS_37900 gene miaB 67 1455 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296630.1 protein_id gnl|my_center|LOCUS_37900 1545 2384 gene locus_tag LOCUS_37910 gene miaA 1545 2384 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_37910 2389 3345 gene locus_tag LOCUS_37920 gene dapF 2389 3345 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_37920 >Feature sequence412 219 419 gene locus_tag LOCUS_37930 219 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 454 897 gene locus_tag LOCUS_37940 454 897 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_37940 >Feature sequence413 469 2868 gene locus_tag LOCUS_37950 469 2868 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_37950 >Feature sequence414 2928 1312 gene locus_tag LOCUS_37960 2928 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 <3558 2925 gene locus_tag LOCUS_37970 <3558 2925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919615.1:nucleoside triphosphate pyrophosphohydrolase >Feature sequence415 1604 720 gene locus_tag LOCUS_37980 1604 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 3190 1601 gene locus_tag LOCUS_37990 3190 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 >Feature sequence416 1640 3010 gene locus_tag LOCUS_38000 1640 3010 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_38000 >Feature sequence417 384 1919 gene locus_tag LOCUS_38010 384 1919 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_38010 3123 1864 gene locus_tag LOCUS_38020 3123 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence418 798 103 gene locus_tag LOCUS_38030 798 103 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029663.1 protein_id gnl|my_center|LOCUS_38030 1049 2431 gene locus_tag LOCUS_38040 1049 2431 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723717.1 protein_id gnl|my_center|LOCUS_38040 2883 2638 gene locus_tag LOCUS_38050 2883 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence419 <1 621 gene locus_tag LOCUS_38060 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728310.1:3-isopropylmalate dehydratase large subunit 618 1283 gene locus_tag LOCUS_38070 gene leuD 618 1283 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_38070 3069 1201 gene locus_tag LOCUS_38080 gene leuA 3069 1201 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_38080 >Feature sequence420 674 174 gene locus_tag LOCUS_38090 674 174 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 protein_id gnl|my_center|LOCUS_38090 1555 677 gene locus_tag LOCUS_38100 1555 677 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_38100 1827 1630 gene locus_tag LOCUS_38110 1827 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 1888 1897 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2384 2211 gene locus_tag LOCUS_38120 2384 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38120 3304 2444 gene locus_tag LOCUS_38130 3304 2444 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731497.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence421 3 380 gene locus_tag LOCUS_38140 3 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1472 579 gene locus_tag LOCUS_38150 1472 579 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_38150 2239 1574 gene locus_tag LOCUS_38160 2239 1574 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_38160 2928 2236 gene locus_tag LOCUS_38170 2928 2236 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_38170 >Feature sequence422 2159 258 gene locus_tag LOCUS_38180 2159 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 3241 2159 gene locus_tag LOCUS_38190 gene xerD 3241 2159 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565337.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence423 1193 201 gene locus_tag LOCUS_38200 1193 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 1570 1190 gene locus_tag LOCUS_38210 1570 1190 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_38210 3353 1698 gene locus_tag LOCUS_38220 gene merA 3353 1698 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_38220 >Feature sequence424 695 393 gene locus_tag LOCUS_38230 695 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 832 1824 gene locus_tag LOCUS_38240 832 1824 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081632.1 protein_id gnl|my_center|LOCUS_38240 1824 2732 gene locus_tag LOCUS_38250 1824 2732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_38250 2849 3109 gene locus_tag LOCUS_38260 2849 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence425 1531 824 gene locus_tag LOCUS_38270 1531 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 3356 1524 gene locus_tag LOCUS_38280 3356 1524 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_38280 >Feature sequence426 1133 2230 gene locus_tag LOCUS_38290 1133 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 2324 2884 gene locus_tag LOCUS_38300 2324 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence427 >Feature sequence428 513 124 gene locus_tag LOCUS_38310 513 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 840 595 gene locus_tag LOCUS_38320 840 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 1123 1671 gene locus_tag LOCUS_38330 1123 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 1756 2259 gene locus_tag LOCUS_38340 1756 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 2352 2756 gene locus_tag LOCUS_38350 2352 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 <3477 2767 gene locus_tag LOCUS_38360 <3477 2767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122200.1:NAD(P)H-hydrate epimerase >Feature sequence429 1896 679 gene locus_tag LOCUS_38370 1896 679 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_38370 <3470 1893 gene locus_tag LOCUS_38380 <3470 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583238.1:type II secretion system ATPase GspE >Feature sequence430 120 650 gene locus_tag LOCUS_38390 120 650 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410001.1 protein_id gnl|my_center|LOCUS_38390 1924 2490 gene locus_tag LOCUS_38400 1924 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 >Feature sequence431 2021 825 gene locus_tag LOCUS_38410 gene cysS 2021 825 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_38410 2676 2023 gene locus_tag LOCUS_38420 gene npdG 2676 2023 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_38420 >Feature sequence432 257 1030 gene locus_tag LOCUS_38430 257 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 1179 1595 gene locus_tag LOCUS_38440 1179 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 1893 3263 gene locus_tag LOCUS_38450 1893 3263 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110107303.1 protein_id gnl|my_center|LOCUS_38450 >Feature sequence433 217 2565 gene locus_tag LOCUS_38460 217 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 2762 3400 gene locus_tag LOCUS_38470 gene satP 2762 3400 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_38470 >Feature sequence434 625 1827 gene locus_tag LOCUS_38480 625 1827 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405909.1 protein_id gnl|my_center|LOCUS_38480 3219 2263 gene locus_tag LOCUS_38490 3219 2263 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027748.1 protein_id gnl|my_center|LOCUS_38490 >Feature sequence435 264 578 gene locus_tag LOCUS_38500 264 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 584 946 gene locus_tag LOCUS_38510 584 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 1062 1361 gene locus_tag LOCUS_38520 1062 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 1358 2059 gene locus_tag LOCUS_38530 1358 2059 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064970.1 protein_id gnl|my_center|LOCUS_38530 2985 2677 gene locus_tag LOCUS_38540 2985 2677 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_38540 >Feature sequence436 1056 58 gene locus_tag LOCUS_38550 1056 58 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145764452.1 protein_id gnl|my_center|LOCUS_38550 1376 1053 gene locus_tag LOCUS_38560 1376 1053 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229481.1 protein_id gnl|my_center|LOCUS_38560 1409 1567 gene locus_tag LOCUS_38570 1409 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 1816 1619 gene locus_tag LOCUS_38580 1816 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3380 1965 gene locus_tag LOCUS_38590 3380 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 >Feature sequence437 <1 990 gene locus_tag LOCUS_38600 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258793.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 1044 1337 gene locus_tag LOCUS_38610 gene groES 1044 1337 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_38610 1425 3077 gene locus_tag LOCUS_38620 gene groL 1425 3077 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_38620 >Feature sequence438 458 1210 gene locus_tag LOCUS_38630 458 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 1549 1202 gene locus_tag LOCUS_38640 1549 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 1618 3336 gene locus_tag LOCUS_38650 1618 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 >Feature sequence439 1637 462 gene locus_tag LOCUS_38660 1637 462 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_38660 2637 1708 gene locus_tag LOCUS_38670 2637 1708 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338663.1 protein_id gnl|my_center|LOCUS_38670 <3393 2640 gene locus_tag LOCUS_38680 <3393 2640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009208278.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence440 1517 495 gene locus_tag LOCUS_38690 1517 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 1903 1514 gene locus_tag LOCUS_38700 1903 1514 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895085.1 protein_id gnl|my_center|LOCUS_38700 2369 2118 gene locus_tag LOCUS_38710 2369 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 >Feature sequence441 1641 1859 gene locus_tag LOCUS_38720 1641 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 >Feature sequence442 62 619 gene locus_tag LOCUS_38730 gene ribE 62 619 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392435.1 protein_id gnl|my_center|LOCUS_38730 623 1519 gene locus_tag LOCUS_38740 gene hisG 623 1519 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_38740 1523 1735 gene locus_tag LOCUS_38750 1523 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 2982 1765 gene locus_tag LOCUS_38760 gene dpaL 2982 1765 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706020.1 protein_id gnl|my_center|LOCUS_38760 >Feature sequence443 388 3222 gene locus_tag LOCUS_38770 388 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence444 1886 1272 gene locus_tag LOCUS_38780 1886 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978012.1 protein_id gnl|my_center|LOCUS_38780 2921 1968 gene locus_tag LOCUS_38790 2921 1968 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972421.1 protein_id gnl|my_center|LOCUS_38790 >Feature sequence445 2478 2756 gene locus_tag LOCUS_38800 2478 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 2753 3133 gene locus_tag LOCUS_38810 2753 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 >Feature sequence446 846 391 gene locus_tag LOCUS_38820 846 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 1005 1187 gene locus_tag LOCUS_38830 1005 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 1184 1405 gene locus_tag LOCUS_38840 1184 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 2063 1728 gene locus_tag LOCUS_38850 2063 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 1956 2525 gene locus_tag LOCUS_38860 1956 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 2599 2757 gene locus_tag LOCUS_38870 2599 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence447 202 2301 gene locus_tag LOCUS_38880 gene pknB 202 2301 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776674.1 protein_id gnl|my_center|LOCUS_38880 <3366 2298 gene locus_tag LOCUS_38890 <3366 2298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530454.1:NAD(P)-binding protein >Feature sequence448 159 398 gene locus_tag LOCUS_38900 159 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 633 545 gene locus_tag LOCUS_t00590 633 545 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 945 1349 gene locus_tag LOCUS_38910 945 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 2557 1400 gene locus_tag LOCUS_38920 2557 1400 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214468507.1 protein_id gnl|my_center|LOCUS_38920 2978 2607 gene locus_tag LOCUS_38930 2978 2607 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence449 135 872 gene locus_tag LOCUS_38940 135 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 >Feature sequence450 372 878 gene locus_tag LOCUS_38950 372 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 959 1297 gene locus_tag LOCUS_38960 959 1297 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_38960 1294 2040 gene locus_tag LOCUS_38970 1294 2040 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417119.1 protein_id gnl|my_center|LOCUS_38970 >Feature sequence451 974 399 gene locus_tag LOCUS_38980 974 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 2312 1554 gene locus_tag LOCUS_38990 2312 1554 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_38990 <3333 2320 gene locus_tag LOCUS_39000 <3333 2320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974129.1:FAD-binding oxidoreductase >Feature sequence452 561 788 gene locus_tag LOCUS_39010 561 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 789 959 gene locus_tag LOCUS_39020 789 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 2791 1238 gene locus_tag LOCUS_39030 2791 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence453 710 2368 gene locus_tag LOCUS_39040 710 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 3223 2441 gene locus_tag LOCUS_39050 3223 2441 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_39050 >Feature sequence454 1641 850 gene locus_tag LOCUS_39060 1641 850 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_39060 1845 2177 gene locus_tag LOCUS_39070 1845 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 2389 2757 gene locus_tag LOCUS_39080 2389 2757 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_39080 2811 3284 gene locus_tag LOCUS_39090 2811 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39090 >Feature sequence455 1369 1815 gene locus_tag LOCUS_39100 1369 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 2571 1825 gene locus_tag LOCUS_39110 2571 1825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_39110 <3278 2568 gene locus_tag LOCUS_39120 <3278 2568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005093526.1:ABC transporter ATP-binding protein >Feature sequence456 334 882 gene locus_tag LOCUS_39130 334 882 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_39130 <3269 812 gene locus_tag LOCUS_39140 <3269 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005115449.1:indolepyruvate ferredoxin oxidoreductase family protein >Feature sequence457 880 311 gene locus_tag LOCUS_39150 880 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 <3252 966 gene locus_tag LOCUS_39160 <3252 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_131337810.1:LuxR family transcriptional regulator >Feature sequence458 394 155 gene locus_tag LOCUS_39170 394 155 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879121.1 protein_id gnl|my_center|LOCUS_39170 1755 460 gene locus_tag LOCUS_39180 1755 460 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_39180 2777 1752 gene locus_tag LOCUS_39190 2777 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 <3251 2747 gene locus_tag LOCUS_39200 <3251 2747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695838.1:glycosyltransferase family 4 protein >Feature sequence459 <1 518 gene locus_tag LOCUS_39210 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031161.1:squalene synthase HpnC 515 1402 gene locus_tag LOCUS_39220 gene hpnD 515 1402 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_39220 1420 2793 gene locus_tag LOCUS_39230 gene hpnE 1420 2793 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence460 <3235 640 gene locus_tag LOCUS_39240 <3235 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459216.1:TIGR02680 family protein >Feature sequence461 53 1552 gene locus_tag LOCUS_39250 53 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 1553 1936 gene locus_tag LOCUS_39260 1553 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 1937 2359 gene locus_tag LOCUS_39270 1937 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence462 1486 539 gene locus_tag LOCUS_39280 1486 539 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191243275.1 protein_id gnl|my_center|LOCUS_39280 1586 2314 gene locus_tag LOCUS_39290 gene hxpB 1586 2314 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106833.1 protein_id gnl|my_center|LOCUS_39290 >Feature sequence463 1802 1206 gene locus_tag LOCUS_39300 gene pgsA 1802 1206 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_39300 3157 1799 gene locus_tag LOCUS_39310 gene rimO 3157 1799 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392588.1 protein_id gnl|my_center|LOCUS_39310 >Feature sequence464 619 1164 gene locus_tag LOCUS_39320 619 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 1834 1280 gene locus_tag LOCUS_39330 1834 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 2160 1831 gene locus_tag LOCUS_39340 2160 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 2511 2437 gene locus_tag LOCUS_t00600 2511 2437 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2646 2571 gene locus_tag LOCUS_t00610 2646 2571 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2916 2842 gene locus_tag LOCUS_t00620 2916 2842 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence465 <1 956 gene locus_tag LOCUS_39350 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142395.1:M48 family metallopeptidase 2978 1002 gene locus_tag LOCUS_39360 2978 1002 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980561.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence466 103 603 gene locus_tag LOCUS_39370 103 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 638 2140 gene locus_tag LOCUS_39380 638 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 2197 2784 gene locus_tag LOCUS_39390 2197 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 >Feature sequence467 472 1881 gene locus_tag LOCUS_39400 472 1881 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_39400 <3149 1912 gene locus_tag LOCUS_39410 <3149 1912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528942.1:glycosyltransferase >Feature sequence468 1654 2352 gene locus_tag LOCUS_39420 1654 2352 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 protein_id gnl|my_center|LOCUS_39420 >Feature sequence469 <1 510 gene locus_tag LOCUS_39430 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933494.1:citrate synthase 1371 514 gene locus_tag LOCUS_39440 1371 514 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_39440 1468 2013 gene locus_tag LOCUS_39450 1468 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 2552 2064 gene locus_tag LOCUS_39460 2552 2064 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402987.1 protein_id gnl|my_center|LOCUS_39460 2671 2756 gene locus_tag LOCUS_t00630 2671 2756 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2835 3020 gene locus_tag LOCUS_39470 2835 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 >Feature sequence470 59 304 gene locus_tag LOCUS_39480 59 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 662 1189 gene locus_tag LOCUS_39490 662 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 1507 2487 gene locus_tag LOCUS_39500 1507 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence471 307 870 gene locus_tag LOCUS_39510 307 870 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_39510 854 1897 gene locus_tag LOCUS_39520 854 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 2417 2115 gene locus_tag LOCUS_39530 2417 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 2458 3006 gene locus_tag LOCUS_39540 gene rfbC 2458 3006 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_39540 >Feature sequence472 2412 508 gene locus_tag LOCUS_39550 gene shc 2412 508 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_39550 <3128 2426 gene locus_tag LOCUS_39560 <3128 2426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_107420324.1:polyprenyl synthetase family protein >Feature sequence473 175 756 gene locus_tag LOCUS_39570 175 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 1837 797 gene locus_tag LOCUS_39580 1837 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 2052 1834 gene locus_tag LOCUS_39590 2052 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 2406 2065 gene locus_tag LOCUS_39600 2406 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 2865 2560 gene locus_tag LOCUS_39610 2865 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 >Feature sequence474 <1 845 gene locus_tag LOCUS_39620 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036268.1:site-specific DNA-methyltransferase 1225 935 gene locus_tag LOCUS_39630 1225 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 1353 3065 gene locus_tag LOCUS_39640 1353 3065 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_39640 >Feature sequence475 564 1631 gene locus_tag LOCUS_39650 564 1631 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095094.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence476 1039 50 gene locus_tag LOCUS_39660 1039 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 1497 1153 gene locus_tag LOCUS_39670 1497 1153 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777081.1 protein_id gnl|my_center|LOCUS_39670 1664 2098 gene locus_tag LOCUS_39680 1664 2098 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_39680 2095 2721 gene locus_tag LOCUS_39690 2095 2721 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777116.1 protein_id gnl|my_center|LOCUS_39690 >Feature sequence477 1126 1587 gene locus_tag LOCUS_39700 1126 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 1660 2790 gene locus_tag LOCUS_39710 1660 2790 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_39710 >Feature sequence478 1144 650 gene locus_tag LOCUS_39720 1144 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 1227 2564 gene locus_tag LOCUS_39730 1227 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 >Feature sequence479 1334 786 gene locus_tag LOCUS_39740 1334 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 1945 1343 gene locus_tag LOCUS_39750 1945 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 2465 2142 gene locus_tag LOCUS_39760 2465 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39760 2732 2532 gene locus_tag LOCUS_39770 2732 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 >Feature sequence480 19 363 gene locus_tag LOCUS_39780 19 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 356 1204 gene locus_tag LOCUS_39790 356 1204 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_39790 1319 1813 gene locus_tag LOCUS_39800 1319 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 2426 1872 gene locus_tag LOCUS_39810 2426 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 2516 2761 gene locus_tag LOCUS_39820 2516 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 >Feature sequence481 2408 1416 gene locus_tag LOCUS_39830 2408 1416 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145764452.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39830 2707 2405 gene locus_tag LOCUS_39840 2707 2405 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173915017.1 protein_id gnl|my_center|LOCUS_39840 >Feature sequence482 <1 504 gene locus_tag LOCUS_39850 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977923.1:universal stress protein 667 3045 gene locus_tag LOCUS_39860 gene lon 667 3045 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 protein_id gnl|my_center|LOCUS_39860 >Feature sequence483 486 1160 gene locus_tag LOCUS_39870 486 1160 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898328.1 protein_id gnl|my_center|LOCUS_39870 1208 2320 gene locus_tag LOCUS_39880 1208 2320 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_39880 <3063 2325 gene locus_tag LOCUS_39890 <3063 2325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975035.1:CCA tRNA nucleotidyltransferase >Feature sequence484 194 1738 gene locus_tag LOCUS_39900 gene istA 194 1738 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_39900 1735 2520 gene locus_tag LOCUS_39910 gene istB 1735 2520 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_39910 >Feature sequence485 1271 222 gene locus_tag LOCUS_39920 1271 222 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_39920 2577 1318 gene locus_tag LOCUS_39930 2577 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 3044 2574 gene locus_tag LOCUS_39940 3044 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 >Feature sequence486 636 280 gene locus_tag LOCUS_39950 636 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 677 2410 gene locus_tag LOCUS_39960 677 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 3046 2465 gene locus_tag LOCUS_39970 3046 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 2498 2507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence487 231 46 gene locus_tag LOCUS_39980 231 46 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_39980 962 237 gene locus_tag LOCUS_39990 962 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 1267 959 gene locus_tag LOCUS_40000 gene rplX 1267 959 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_40000 1635 1267 gene locus_tag LOCUS_40010 gene rplN 1635 1267 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_40010 1922 1632 gene locus_tag LOCUS_40020 gene rpsQ 1922 1632 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_40020 2191 1922 gene locus_tag LOCUS_40030 2191 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 2625 2188 gene locus_tag LOCUS_40040 gene rplP 2625 2188 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_40040 >Feature sequence488 1775 63 gene locus_tag LOCUS_40050 1775 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 2403 1936 gene locus_tag LOCUS_40060 2403 1936 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_40060 2963 2568 gene locus_tag LOCUS_40070 2963 2568 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975235.1 protein_id gnl|my_center|LOCUS_40070 >Feature sequence489 1067 522 gene locus_tag LOCUS_40080 1067 522 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225197.1 protein_id gnl|my_center|LOCUS_40080 1109 2365 gene locus_tag LOCUS_40090 1109 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 >Feature sequence490 2074 467 gene locus_tag LOCUS_40100 gene gcvPB 2074 467 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_40100 <3009 2071 gene locus_tag LOCUS_40110 <3009 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460675.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA >Feature sequence491 1 321 gene locus_tag LOCUS_40120 1 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 2081 570 gene locus_tag LOCUS_40130 2081 570 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727774.1 protein_id gnl|my_center|LOCUS_40130 2757 2398 gene locus_tag LOCUS_40140 2757 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 >Feature sequence492 <1 703 gene locus_tag LOCUS_40150 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011174155.1:protein phosphatase 2C domain-containing protein 700 1698 gene locus_tag LOCUS_40160 700 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 2802 1837 gene locus_tag LOCUS_40170 2802 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 >Feature sequence493 107 201 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccccgccatctccccccgc 1079 243 gene locus_tag LOCUS_40180 1079 243 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_40180 1632 1084 gene locus_tag LOCUS_40190 gene purE 1632 1084 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417123.1 protein_id gnl|my_center|LOCUS_40190 2837 1629 gene locus_tag LOCUS_40200 2837 1629 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_40200 >Feature sequence494 <1 962 gene locus_tag LOCUS_40210 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031263.1:ATP-binding protein 1199 2746 gene locus_tag LOCUS_40220 1199 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 >Feature sequence495 483 1925 gene locus_tag LOCUS_40230 gene xseA 483 1925 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_40230 1925 2293 gene locus_tag LOCUS_40240 1925 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence496 1602 1042 gene locus_tag LOCUS_40250 1602 1042 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943966.1 protein_id gnl|my_center|LOCUS_40250 <2950 1655 gene locus_tag LOCUS_40260 <2950 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393886.1:CTP synthase >Feature sequence497 1788 340 gene locus_tag LOCUS_40270 1788 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 <2950 1915 gene locus_tag LOCUS_40280 <2950 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226714.1:WYL domain-containing protein >Feature sequence498 611 1069 gene locus_tag LOCUS_40290 611 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 1296 1592 gene locus_tag LOCUS_40300 1296 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 1648 2658 gene locus_tag LOCUS_40310 1648 2658 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027388.1 protein_id gnl|my_center|LOCUS_40310 >Feature sequence499 1431 739 gene locus_tag LOCUS_40320 1431 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 1486 1719 gene locus_tag LOCUS_40330 1486 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 2029 2883 gene locus_tag LOCUS_40340 2029 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 >Feature sequence500 2360 1191 gene locus_tag LOCUS_40350 2360 1191 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_40350 >Feature sequence501 856 113 gene locus_tag LOCUS_40360 856 113 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068149.1 protein_id gnl|my_center|LOCUS_40360 1138 956 gene locus_tag LOCUS_40370 1138 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 2256 1138 gene locus_tag LOCUS_40380 2256 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 2558 2295 gene locus_tag LOCUS_40390 2558 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 2761 2688 gene locus_tag LOCUS_t00640 2761 2688 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence502 1917 250 gene locus_tag LOCUS_40400 1917 250 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823075.1 protein_id gnl|my_center|LOCUS_40400 2846 1938 gene locus_tag LOCUS_40410 gene dapA 2846 1938 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_40410 >Feature sequence503 187 843 gene locus_tag LOCUS_40420 187 843 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_40420 849 1361 gene locus_tag LOCUS_40430 gene fhaB 849 1361 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_40430 >Feature sequence504 <2907 937 gene locus_tag LOCUS_40440 <2907 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839231.1:PD-(D/E)XK nuclease family protein >Feature sequence505 1181 120 gene locus_tag LOCUS_40450 1181 120 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_40450 2541 1351 gene locus_tag LOCUS_40460 2541 1351 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_40460 >Feature sequence506 1989 352 gene locus_tag LOCUS_40470 1989 352 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_40470 2095 2727 gene locus_tag LOCUS_40480 2095 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 >Feature sequence507 <1 2587 gene locus_tag LOCUS_40490 <1 2587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224374.1:DEAD/DEAH box helicase >Feature sequence508 1934 768 gene locus_tag LOCUS_40500 1934 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 >Feature sequence509 770 1951 gene locus_tag LOCUS_40510 770 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 >Feature sequence510 539 1345 gene locus_tag LOCUS_40520 539 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40520 <2880 1690 gene locus_tag LOCUS_40530 <2880 1690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000228115.1:FAD-dependent oxidoreductase >Feature sequence511 <1 1767 gene locus_tag LOCUS_40540 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542538.1:DNA helicase PcrA 2307 2510 gene locus_tag LOCUS_40550 2307 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 >Feature sequence512 >Feature sequence513 <2837 2272 gene locus_tag LOCUS_40560 <2837 2272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404923.1:D-alanine--D-alanine ligase family protein >Feature sequence514 137 1075 gene locus_tag LOCUS_40570 137 1075 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_40570 1161 2801 gene locus_tag LOCUS_40580 1161 2801 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_40580 >Feature sequence515 <1 1088 gene locus_tag LOCUS_40590 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878272.1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1088 2092 gene locus_tag LOCUS_40600 gene hpnH 1088 2092 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_40600 >Feature sequence516 2353 2150 gene locus_tag LOCUS_40610 2353 2150 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256480.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence517 126 713 gene locus_tag LOCUS_40620 126 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 747 1976 gene locus_tag LOCUS_40630 747 1976 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110107.1 protein_id gnl|my_center|LOCUS_40630 >Feature sequence518 2086 956 gene locus_tag LOCUS_40640 2086 956 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726879.1 protein_id gnl|my_center|LOCUS_40640 2667 2152 gene locus_tag LOCUS_40650 2667 2152 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_40650 >Feature sequence519 1744 581 gene locus_tag LOCUS_40660 1744 581 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_40660 2787 1741 gene locus_tag LOCUS_40670 2787 1741 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487216.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence520 118 867 gene locus_tag LOCUS_40680 118 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 1515 1084 gene locus_tag LOCUS_40690 1515 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 <2800 1536 gene locus_tag LOCUS_40700 <2800 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164993978.1:IS66 family transposase >Feature sequence521 902 2242 gene locus_tag LOCUS_40710 gene ccrA 902 2242 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_40710 2239 2733 gene locus_tag LOCUS_40720 gene mce 2239 2733 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_40720 >Feature sequence522 290 742 gene locus_tag LOCUS_40730 290 742 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545588.1 protein_id gnl|my_center|LOCUS_40730 2595 793 gene locus_tag LOCUS_40740 2595 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 >Feature sequence523 2204 2563 gene locus_tag LOCUS_40750 2204 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 >Feature sequence524 >Feature sequence525 <1 1099 gene locus_tag LOCUS_40760 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062389568.1:glycosyltransferase 1599 1096 gene locus_tag LOCUS_40770 1599 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 2039 1596 gene locus_tag LOCUS_40780 2039 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 <2793 2164 gene locus_tag LOCUS_40790 <2793 2164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259639.1:phosphopyruvate hydratase >Feature sequence526 1307 402 gene locus_tag LOCUS_40800 1307 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 1627 1304 gene locus_tag LOCUS_40810 1627 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 >Feature sequence527 <2785 180 gene locus_tag LOCUS_40820 <2785 180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256730.1:N-6 DNA methylase >Feature sequence528 743 2023 gene locus_tag LOCUS_40830 743 2023 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_40830 >Feature sequence529 3 230 gene locus_tag LOCUS_40840 3 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 251 1672 gene locus_tag LOCUS_40850 251 1672 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_40850 1705 1965 gene locus_tag LOCUS_40860 1705 1965 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_40860 2685 2536 gene locus_tag LOCUS_40870 2685 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 >Feature sequence530 1768 908 gene locus_tag LOCUS_40880 1768 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 2450 1770 gene locus_tag LOCUS_40890 2450 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence531 1725 289 gene locus_tag LOCUS_40900 1725 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 >Feature sequence532 63 1370 gene locus_tag LOCUS_40910 gene hisD 63 1370 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_40910 1367 2440 gene locus_tag LOCUS_40920 1367 2440 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_40920 >Feature sequence533 >Feature sequence534 2743 2546 gene locus_tag LOCUS_40930 2743 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 >Feature sequence535 1943 1698 gene locus_tag LOCUS_40940 1943 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_40940 2193 1924 gene locus_tag LOCUS_40950 2193 1924 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_40950 >Feature sequence536 155 1726 gene locus_tag LOCUS_40960 155 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 >Feature sequence537 363 82 gene locus_tag LOCUS_40970 363 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 1439 1600 gene locus_tag LOCUS_40980 1439 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 <2722 1580 gene locus_tag LOCUS_40990 <2722 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051509115.1:recombinase family protein >Feature sequence538 67 2331 gene locus_tag LOCUS_41000 67 2331 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_41000 >Feature sequence539 <1 1574 gene locus_tag LOCUS_41010 <1 1574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582471.1:transglutaminaseTgpA domain-containing protein 2091 1498 gene locus_tag LOCUS_41020 2091 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41020 >Feature sequence540 608 366 gene locus_tag LOCUS_41030 608 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 1156 716 gene locus_tag LOCUS_41040 1156 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 1587 1156 gene locus_tag LOCUS_41050 1587 1156 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224888.1 protein_id gnl|my_center|LOCUS_41050 1881 1636 gene locus_tag LOCUS_41060 1881 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 2589 2161 gene locus_tag LOCUS_41070 2589 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 >Feature sequence541 235 1527 gene locus_tag LOCUS_41080 235 1527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971436.1 protein_id gnl|my_center|LOCUS_41080 1577 2677 gene locus_tag LOCUS_41090 1577 2677 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225984036.1 protein_id gnl|my_center|LOCUS_41090 >Feature sequence542 328 2172 gene locus_tag LOCUS_41100 gene typA 328 2172 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_41100 2248 2333 gene locus_tag LOCUS_t00650 2248 2333 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence543 488 33 gene locus_tag LOCUS_41110 488 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 853 485 gene locus_tag LOCUS_41120 853 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41120 1377 850 gene locus_tag LOCUS_41130 1377 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41130 869 878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2549 1374 gene locus_tag LOCUS_41140 2549 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 >Feature sequence544 1707 472 gene locus_tag LOCUS_41150 1707 472 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846808.1 protein_id gnl|my_center|LOCUS_41150 <2676 1733 gene locus_tag LOCUS_41160 <2676 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029332.1:thiol reductant ABC exporter subunit CydD >Feature sequence545 103 1143 gene locus_tag LOCUS_41170 103 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 1140 2174 gene locus_tag LOCUS_41180 gene gap 1140 2174 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_41180 >Feature sequence546 1390 389 gene locus_tag LOCUS_41190 1390 389 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 protein_id gnl|my_center|LOCUS_41190 1520 1783 gene locus_tag LOCUS_41200 gene whiB3 1520 1783 CDS product redox-responsive transcriptional regulator WhiB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418017.1 protein_id gnl|my_center|LOCUS_41200 <2663 1820 gene locus_tag LOCUS_41210 <2663 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979644.1:DUF929 domain-containing protein >Feature sequence547 1094 768 gene locus_tag LOCUS_41220 1094 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 1942 1091 gene locus_tag LOCUS_41230 1942 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 >Feature sequence548 1 276 gene locus_tag LOCUS_41240 1 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 323 541 gene locus_tag LOCUS_41250 323 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 538 720 gene locus_tag LOCUS_41260 538 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 713 994 gene locus_tag LOCUS_41270 713 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 987 1241 gene locus_tag LOCUS_41280 987 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 1238 1429 gene locus_tag LOCUS_41290 1238 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 1426 1650 gene locus_tag LOCUS_41300 1426 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 1647 1835 gene locus_tag LOCUS_41310 1647 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 >Feature sequence549 <1 1179 gene locus_tag LOCUS_41320 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226667.1:VgrG-related protein 1185 1691 gene locus_tag LOCUS_41330 1185 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence550 9 734 gene locus_tag LOCUS_41340 9 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 802 1521 gene locus_tag LOCUS_41350 802 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 1910 1503 gene locus_tag LOCUS_41360 1910 1503 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811198.1 protein_id gnl|my_center|LOCUS_41360 >Feature sequence551 <1 2193 gene locus_tag LOCUS_41370 <1 2193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141767.1:carbamoyl-phosphate synthase large subunit >Feature sequence552 1261 425 gene locus_tag LOCUS_41380 1261 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 protein_id gnl|my_center|LOCUS_41380 1611 1258 gene locus_tag LOCUS_41390 1611 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 1948 1703 gene locus_tag LOCUS_41400 1948 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 2296 2607 gene locus_tag LOCUS_41410 2296 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 >Feature sequence553 <2630 765 gene locus_tag LOCUS_41420 <2630 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104130.1:bifunctional FO biosynthesis protein CofGH >Feature sequence554 130 1338 gene locus_tag LOCUS_41430 130 1338 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226293.1 protein_id gnl|my_center|LOCUS_41430 1508 1966 gene locus_tag LOCUS_41440 1508 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 >Feature sequence555 <1 1033 gene locus_tag LOCUS_41450 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222554.1:3-dehydroquinate synthase family protein 1024 1491 gene locus_tag LOCUS_41460 1024 1491 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222584.1 protein_id gnl|my_center|LOCUS_41460 1488 2573 gene locus_tag LOCUS_41470 1488 2573 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_41470 >Feature sequence556 88 429 gene locus_tag LOCUS_41480 88 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 520 1158 gene locus_tag LOCUS_41490 520 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 1234 1671 gene locus_tag LOCUS_41500 1234 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 1718 2272 gene locus_tag LOCUS_41510 1718 2272 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252838.1 protein_id gnl|my_center|LOCUS_41510 >Feature sequence557 <2590 1453 gene locus_tag LOCUS_41520 <2590 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151633682.1:substrate-binding domain-containing protein >Feature sequence558 1581 358 gene locus_tag LOCUS_41530 1581 358 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_41530 2206 1583 gene locus_tag LOCUS_41540 2206 1583 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_41540 >Feature sequence559 567 824 gene locus_tag LOCUS_41550 567 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 2039 1002 gene locus_tag LOCUS_41560 2039 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 >Feature sequence560 1644 256 gene locus_tag LOCUS_41570 1644 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 2087 1701 gene locus_tag LOCUS_41580 2087 1701 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_41580 2323 2084 gene locus_tag LOCUS_41590 2323 2084 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_41590 >Feature sequence561 54 1259 gene locus_tag LOCUS_41600 54 1259 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064857.1 protein_id gnl|my_center|LOCUS_41600 1270 2415 gene locus_tag LOCUS_41610 gene trpD 1270 2415 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_41610 >Feature sequence562 46 1542 gene locus_tag LOCUS_41620 46 1542 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_41620 2432 1650 gene locus_tag LOCUS_41630 2432 1650 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296290.1 protein_id gnl|my_center|LOCUS_41630 2316 2525 gene locus_tag LOCUS_41640 2316 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 >Feature sequence563 <1 913 gene locus_tag LOCUS_41650 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975310.1:adenylosuccinate synthase 910 2199 gene locus_tag LOCUS_41660 gene purD 910 2199 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_41660 >Feature sequence564 >Feature sequence565 2526 25 gene locus_tag LOCUS_41670 gene uvrA 2526 25 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_41670 >Feature sequence566 >Feature sequence567 <1 767 gene locus_tag LOCUS_41680 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030202.1:diaminopimelate decarboxylase 776 2371 gene locus_tag LOCUS_41690 776 2371 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_41690 >Feature sequence568 <1 2507 gene locus_tag LOCUS_41700 <1 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976739.1:isoleucine--tRNA ligase >Feature sequence569 1007 1345 gene locus_tag LOCUS_41710 1007 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 1783 2160 gene locus_tag LOCUS_41720 1783 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 >Feature sequence570 1113 961 gene locus_tag LOCUS_41730 1113 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 >Feature sequence571 75 572 gene locus_tag LOCUS_41740 gene nrdR 75 572 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 protein_id gnl|my_center|LOCUS_41740 1883 675 gene locus_tag LOCUS_41750 1883 675 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405724.1 protein_id gnl|my_center|LOCUS_41750 >Feature sequence572 760 2361 gene locus_tag LOCUS_41760 760 2361 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_41760 >Feature sequence573 1144 230 gene locus_tag LOCUS_41770 1144 230 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_41770 1698 1141 gene locus_tag LOCUS_41780 gene pyrR 1698 1141 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_41780 2153 1755 gene locus_tag LOCUS_41790 gene nusB 2153 1755 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728771.1 protein_id gnl|my_center|LOCUS_41790