>Feature sequence001 913 710 gene locus_tag LOCUS_00010 913 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 920 2239 gene locus_tag LOCUS_00020 920 2239 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_00020 2208 2987 gene locus_tag LOCUS_00030 2208 2987 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_00030 3053 4066 gene locus_tag LOCUS_00040 3053 4066 CDS product DUF1837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084977.1 protein_id gnl|my_center|LOCUS_00040 4056 6644 gene locus_tag LOCUS_00050 4056 6644 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388269.1 protein_id gnl|my_center|LOCUS_00050 7415 6966 gene locus_tag LOCUS_00060 7415 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7837 8736 gene locus_tag LOCUS_00070 7837 8736 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011313588.1 protein_id gnl|my_center|LOCUS_00070 8733 8954 gene locus_tag LOCUS_00080 8733 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9189 9010 gene locus_tag LOCUS_00090 9189 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10682 9363 gene locus_tag LOCUS_00100 10682 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11062 10679 gene locus_tag LOCUS_00110 11062 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12647 11262 gene locus_tag LOCUS_00120 12647 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12781 13224 gene locus_tag LOCUS_00130 12781 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14827 13382 gene locus_tag LOCUS_00140 14827 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15457 15687 gene locus_tag LOCUS_00150 15457 15687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15687 16292 gene locus_tag LOCUS_00160 15687 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16285 17157 gene locus_tag LOCUS_00170 16285 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17182 19254 gene locus_tag LOCUS_00180 17182 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19274 19738 gene locus_tag LOCUS_00190 19274 19738 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_00190 19743 21416 gene locus_tag LOCUS_00200 19743 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21409 21915 gene locus_tag LOCUS_00210 21409 21915 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_00210 21912 22739 gene locus_tag LOCUS_00220 21912 22739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22754 22918 gene locus_tag LOCUS_00230 22754 22918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22920 23972 gene locus_tag LOCUS_00240 22920 23972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00240 23975 24625 gene locus_tag LOCUS_00250 23975 24625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24630 26297 gene locus_tag LOCUS_00260 24630 26297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26297 26686 gene locus_tag LOCUS_00270 26297 26686 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_00270 26720 28927 gene locus_tag LOCUS_00280 26720 28927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28929 31307 gene locus_tag LOCUS_00290 28929 31307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31304 32185 gene locus_tag LOCUS_00300 31304 32185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32197 33903 gene locus_tag LOCUS_00310 32197 33903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33921 37499 gene locus_tag LOCUS_00320 33921 37499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37496 39121 gene locus_tag LOCUS_00330 37496 39121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39114 41072 gene locus_tag LOCUS_00340 39114 41072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41069 44851 gene locus_tag LOCUS_00350 41069 44851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 44848 45867 gene locus_tag LOCUS_00360 44848 45867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 47703 46330 gene locus_tag LOCUS_00370 47703 46330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 48189 48500 gene locus_tag LOCUS_00380 48189 48500 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966610.1 protein_id gnl|my_center|LOCUS_00380 48551 50056 gene locus_tag LOCUS_00390 48551 50056 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_00390 50912 51247 gene locus_tag LOCUS_00400 50912 51247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 51982 51479 gene locus_tag LOCUS_00410 51982 51479 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722912.1 protein_id gnl|my_center|LOCUS_00410 52112 54235 gene locus_tag LOCUS_00420 52112 54235 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_00420 54232 54969 gene locus_tag LOCUS_00430 54232 54969 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084297.1 protein_id gnl|my_center|LOCUS_00430 55085 56251 gene locus_tag LOCUS_00440 55085 56251 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_00440 56599 60228 gene locus_tag LOCUS_00450 56599 60228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 60360 61304 gene locus_tag LOCUS_00460 60360 61304 CDS product Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966848.1 protein_id gnl|my_center|LOCUS_00460 61333 61995 gene locus_tag LOCUS_00470 61333 61995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 63424 62084 gene locus_tag LOCUS_00480 63424 62084 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_00480 63686 64318 gene locus_tag LOCUS_00490 63686 64318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 64415 65728 gene locus_tag LOCUS_00500 64415 65728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 66384 65770 gene locus_tag LOCUS_00510 66384 65770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 69132 66937 gene locus_tag LOCUS_00520 69132 66937 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_00520 69595 69137 gene locus_tag LOCUS_00530 69595 69137 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398951.1 protein_id gnl|my_center|LOCUS_00530 70271 69684 gene locus_tag LOCUS_00540 70271 69684 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920714.1 protein_id gnl|my_center|LOCUS_00540 70436 71032 gene locus_tag LOCUS_00550 70436 71032 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237176.1 protein_id gnl|my_center|LOCUS_00550 71064 71702 gene locus_tag LOCUS_00560 71064 71702 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_00560 71918 73111 gene locus_tag LOCUS_00570 71918 73111 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 protein_id gnl|my_center|LOCUS_00570 73314 74186 gene locus_tag LOCUS_00580 73314 74186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 75008 75340 gene locus_tag LOCUS_00590 75008 75340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 76449 75454 gene locus_tag LOCUS_00600 gene galE 76449 75454 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173210.1 protein_id gnl|my_center|LOCUS_00600 76747 76442 gene locus_tag LOCUS_00610 76747 76442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 76631 77827 gene locus_tag LOCUS_00620 76631 77827 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_00620 77911 78582 gene locus_tag LOCUS_00630 77911 78582 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531177.1 protein_id gnl|my_center|LOCUS_00630 78636 79469 gene locus_tag LOCUS_00640 gene dapF 78636 79469 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_00640 79466 80704 gene locus_tag LOCUS_00650 gene mtaB 79466 80704 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921511.1 protein_id gnl|my_center|LOCUS_00650 80701 81651 gene locus_tag LOCUS_00660 80701 81651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 81866 82075 gene locus_tag LOCUS_00670 81866 82075 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312807.1 protein_id gnl|my_center|LOCUS_00670 82545 82177 gene locus_tag LOCUS_00680 82545 82177 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_00680 83225 82581 gene locus_tag LOCUS_00690 gene mobA 83225 82581 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_00690 83421 84170 gene locus_tag LOCUS_00700 83421 84170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_00700 84167 84940 gene locus_tag LOCUS_00710 84167 84940 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_00710 85015 85836 gene locus_tag LOCUS_00720 85015 85836 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_00720 85980 87296 gene locus_tag LOCUS_00730 85980 87296 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_00730 87323 89254 gene locus_tag LOCUS_00740 gene asnB 87323 89254 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_00740 89254 90459 gene locus_tag LOCUS_00750 89254 90459 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_00750 91468 90437 gene locus_tag LOCUS_00760 91468 90437 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_00760 92421 91486 gene locus_tag LOCUS_00770 92421 91486 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_00770 93461 92418 gene locus_tag LOCUS_00780 93461 92418 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_00780 94898 93471 gene locus_tag LOCUS_00790 94898 93471 CDS product TIGR03016 family PEP-CTERM system-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390864.1 protein_id gnl|my_center|LOCUS_00790 95711 95079 gene locus_tag LOCUS_00800 95711 95079 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_00800 96192 97829 gene locus_tag LOCUS_00810 96192 97829 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_00810 97890 98906 gene locus_tag LOCUS_00820 97890 98906 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_00820 99083 100684 gene locus_tag LOCUS_00830 gene xrtA 99083 100684 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_00830 100713 102665 gene locus_tag LOCUS_00840 100713 102665 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_00840 103359 102886 gene locus_tag LOCUS_00850 103359 102886 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_00850 103622 103918 gene locus_tag LOCUS_00860 gene lsrG 103622 103918 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181386.1 protein_id gnl|my_center|LOCUS_00860 103922 105127 gene locus_tag LOCUS_00870 103922 105127 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_00870 106072 105140 gene locus_tag LOCUS_00880 106072 105140 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639972.1 protein_id gnl|my_center|LOCUS_00880 107162 106083 gene locus_tag LOCUS_00890 gene gmd 107162 106083 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088213.1 protein_id gnl|my_center|LOCUS_00890 107418 107269 gene locus_tag LOCUS_00900 107418 107269 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_00900 107682 108968 gene locus_tag LOCUS_00910 gene pseC 107682 108968 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639919.1 protein_id gnl|my_center|LOCUS_00910 108984 110309 gene locus_tag LOCUS_00920 108984 110309 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222491.1 protein_id gnl|my_center|LOCUS_00920 110327 112189 gene locus_tag LOCUS_00930 110327 112189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_00930 112229 113209 gene locus_tag LOCUS_00940 gene pseB 112229 113209 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 protein_id gnl|my_center|LOCUS_00940 113366 114898 gene locus_tag LOCUS_00950 113366 114898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 114953 116500 gene locus_tag LOCUS_00960 114953 116500 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_00960 116466 117644 gene locus_tag LOCUS_00970 116466 117644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 117816 119321 gene locus_tag LOCUS_00980 117816 119321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 119576 120241 gene locus_tag LOCUS_00990 119576 120241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 120241 121545 gene locus_tag LOCUS_01000 120241 121545 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942610.1 protein_id gnl|my_center|LOCUS_01000 121545 122939 gene locus_tag LOCUS_01010 121545 122939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 122974 124008 gene locus_tag LOCUS_01020 122974 124008 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_01020 124001 125092 gene locus_tag LOCUS_01030 gene neuB 124001 125092 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066398080.1 protein_id gnl|my_center|LOCUS_01030 125092 125775 gene locus_tag LOCUS_01040 gene pseF 125092 125775 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707835.1 protein_id gnl|my_center|LOCUS_01040 125772 126812 gene locus_tag LOCUS_01050 125772 126812 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192249737.1 protein_id gnl|my_center|LOCUS_01050 127246 127824 gene locus_tag LOCUS_01060 127246 127824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 127821 129056 gene locus_tag LOCUS_01070 127821 129056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 129049 129771 gene locus_tag LOCUS_01080 129049 129771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 129964 129797 gene locus_tag LOCUS_01090 129964 129797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 129938 130477 gene locus_tag LOCUS_01100 129938 130477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 130470 131525 gene locus_tag LOCUS_01110 gene pseI 130470 131525 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707837.1 protein_id gnl|my_center|LOCUS_01110 131549 132748 gene locus_tag LOCUS_01120 131549 132748 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869425.1 protein_id gnl|my_center|LOCUS_01120 132762 133391 gene locus_tag LOCUS_01130 gene hisH 132762 133391 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333911.1 protein_id gnl|my_center|LOCUS_01130 133393 134145 gene locus_tag LOCUS_01140 gene hisF 133393 134145 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 protein_id gnl|my_center|LOCUS_01140 134203 134715 gene locus_tag LOCUS_01150 134203 134715 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925129.1 protein_id gnl|my_center|LOCUS_01150 134705 135793 gene locus_tag LOCUS_01160 134705 135793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 135774 137105 gene locus_tag LOCUS_01170 135774 137105 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187744700.1 protein_id gnl|my_center|LOCUS_01170 138350 137019 gene locus_tag LOCUS_01180 138350 137019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 138941 139498 gene locus_tag LOCUS_01190 138941 139498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 139629 140675 gene locus_tag LOCUS_01200 139629 140675 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909115.1 protein_id gnl|my_center|LOCUS_01200 140672 141718 gene locus_tag LOCUS_01210 140672 141718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 141777 142763 gene locus_tag LOCUS_01220 141777 142763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 142778 143761 gene locus_tag LOCUS_01230 142778 143761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 143770 144894 gene locus_tag LOCUS_01240 143770 144894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 144925 146706 gene locus_tag LOCUS_01250 144925 146706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 148093 146642 gene locus_tag LOCUS_01260 148093 146642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 148951 148127 gene locus_tag LOCUS_01270 148951 148127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 148991 149932 gene locus_tag LOCUS_01280 148991 149932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 149940 150671 gene locus_tag LOCUS_01290 149940 150671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 150668 151723 gene locus_tag LOCUS_01300 150668 151723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 151743 152387 gene locus_tag LOCUS_01310 151743 152387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 152723 153460 gene locus_tag LOCUS_01320 152723 153460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 154540 153464 gene locus_tag LOCUS_01330 154540 153464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 156050 154623 gene locus_tag LOCUS_01340 156050 154623 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257983.1 protein_id gnl|my_center|LOCUS_01340 156103 156855 gene locus_tag LOCUS_01350 156103 156855 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_01350 156910 158436 gene locus_tag LOCUS_01360 156910 158436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 159167 158439 gene locus_tag LOCUS_01370 159167 158439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 160594 159167 gene locus_tag LOCUS_01380 160594 159167 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence002 1616 1269 gene locus_tag LOCUS_01390 1616 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 1786 2889 gene locus_tag LOCUS_01400 1786 2889 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_01400 3127 3522 gene locus_tag LOCUS_01410 3127 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 3545 4027 gene locus_tag LOCUS_01420 3545 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4047 4370 gene locus_tag LOCUS_01430 gene soxZ 4047 4370 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_01430 4622 4801 gene locus_tag LOCUS_01440 4622 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01440 4998 5741 gene locus_tag LOCUS_01450 4998 5741 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401893.1 protein_id gnl|my_center|LOCUS_01450 6041 6349 gene locus_tag LOCUS_01460 6041 6349 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_01460 6581 7501 gene locus_tag LOCUS_01470 6581 7501 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_01470 7513 8244 gene locus_tag LOCUS_01480 7513 8244 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440275.1 protein_id gnl|my_center|LOCUS_01480 8255 8749 gene locus_tag LOCUS_01490 8255 8749 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_01490 9765 8818 gene locus_tag LOCUS_01500 9765 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 11353 9809 gene locus_tag LOCUS_01510 11353 9809 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_01510 12217 11549 gene locus_tag LOCUS_01520 gene rpe 12217 11549 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532059.1 protein_id gnl|my_center|LOCUS_01520 14636 12276 gene locus_tag LOCUS_01530 14636 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 15486 14656 gene locus_tag LOCUS_01540 15486 14656 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_01540 15941 15582 gene locus_tag LOCUS_01550 15941 15582 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_01550 17432 16014 gene locus_tag LOCUS_01560 17432 16014 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_01560 18542 17478 gene locus_tag LOCUS_01570 gene fba 18542 17478 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388354.1 protein_id gnl|my_center|LOCUS_01570 20681 18642 gene locus_tag LOCUS_01580 gene tkt 20681 18642 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529250.1 protein_id gnl|my_center|LOCUS_01580 21540 20716 gene locus_tag LOCUS_01590 21540 20716 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_01590 22676 21678 gene locus_tag LOCUS_01600 gene glpX 22676 21678 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_01600 23527 22904 gene locus_tag LOCUS_01610 23527 22904 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329401.1 protein_id gnl|my_center|LOCUS_01610 24394 23663 gene locus_tag LOCUS_01620 24394 23663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 24813 25139 gene locus_tag LOCUS_01630 24813 25139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 25157 26449 gene locus_tag LOCUS_01640 25157 26449 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_01640 26583 27152 gene locus_tag LOCUS_01650 26583 27152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 27626 27213 gene locus_tag LOCUS_01660 27626 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 27967 27891 gene locus_tag LOCUS_t00010 27967 27891 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29200 28037 gene locus_tag LOCUS_01670 29200 28037 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389837.1 protein_id gnl|my_center|LOCUS_01670 29498 29836 gene locus_tag LOCUS_01680 29498 29836 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_01680 29916 31337 gene locus_tag LOCUS_01690 gene glnA 29916 31337 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_01690 31427 32266 gene locus_tag LOCUS_01700 31427 32266 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_01700 32323 32886 gene locus_tag LOCUS_01710 32323 32886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 33031 33972 gene locus_tag LOCUS_01720 33031 33972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 33998 34153 gene locus_tag LOCUS_01730 33998 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 34533 34171 gene locus_tag LOCUS_01740 34533 34171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 34620 35273 gene locus_tag LOCUS_01750 34620 35273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 35655 35284 gene locus_tag LOCUS_01760 35655 35284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 35858 36445 gene locus_tag LOCUS_01770 35858 36445 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_01770 36454 37500 gene locus_tag LOCUS_01780 gene trpD 36454 37500 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_01780 37505 38320 gene locus_tag LOCUS_01790 gene trpC 37505 38320 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337146.1 protein_id gnl|my_center|LOCUS_01790 38368 38802 gene locus_tag LOCUS_01800 gene moaC 38368 38802 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390440.1 protein_id gnl|my_center|LOCUS_01800 38817 40034 gene locus_tag LOCUS_01810 38817 40034 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_01810 40325 41053 gene locus_tag LOCUS_01820 gene lexA 40325 41053 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389651.1 protein_id gnl|my_center|LOCUS_01820 41109 42416 gene locus_tag LOCUS_01830 41109 42416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 44560 42413 gene locus_tag LOCUS_01840 44560 42413 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_01840 44657 46078 gene locus_tag LOCUS_01850 gene gltX 44657 46078 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_01850 46152 47471 gene locus_tag LOCUS_01860 gene gltA 46152 47471 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_01860 48479 47550 gene locus_tag LOCUS_01870 48479 47550 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_01870 48817 48506 gene locus_tag LOCUS_01880 48817 48506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 50105 48750 gene locus_tag LOCUS_01890 gene lpxB 50105 48750 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_01890 50932 50102 gene locus_tag LOCUS_01900 gene lpxI 50932 50102 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_01900 51722 50922 gene locus_tag LOCUS_01910 gene lpxA 51722 50922 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_01910 52190 51723 gene locus_tag LOCUS_01920 gene fabZ 52190 51723 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_01920 53219 52194 gene locus_tag LOCUS_01930 gene lpxD 53219 52194 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443878.1 protein_id gnl|my_center|LOCUS_01930 53789 53223 gene locus_tag LOCUS_01940 53789 53223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 56092 53804 gene locus_tag LOCUS_01950 gene bamA 56092 53804 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_01950 57240 56104 gene locus_tag LOCUS_01960 gene rseP 57240 56104 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389468.1 protein_id gnl|my_center|LOCUS_01960 58471 57275 gene locus_tag LOCUS_01970 58471 57275 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_01970 59157 58462 gene locus_tag LOCUS_01980 59157 58462 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389466.1 protein_id gnl|my_center|LOCUS_01980 59884 59150 gene locus_tag LOCUS_01990 59884 59150 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_01990 60458 59889 gene locus_tag LOCUS_02000 gene frr 60458 59889 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_02000 61188 60472 gene locus_tag LOCUS_02010 gene pyrH 61188 60472 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389463.1 protein_id gnl|my_center|LOCUS_02010 62225 61299 gene locus_tag LOCUS_02020 gene tsf 62225 61299 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_02020 63238 62294 gene locus_tag LOCUS_02030 gene rpsB 63238 62294 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 protein_id gnl|my_center|LOCUS_02030 63874 63404 gene locus_tag LOCUS_02040 63874 63404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 67442 63969 gene locus_tag LOCUS_02050 gene dnaE 67442 63969 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389457.1 protein_id gnl|my_center|LOCUS_02050 67622 68320 gene locus_tag LOCUS_02060 gene rpiA 67622 68320 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_02060 68343 69020 gene locus_tag LOCUS_02070 gene rpiA 68343 69020 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396641.1 protein_id gnl|my_center|LOCUS_02070 69189 69383 gene locus_tag LOCUS_02080 69189 69383 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546765.1 protein_id gnl|my_center|LOCUS_02080 69380 69601 gene locus_tag LOCUS_02090 69380 69601 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020810.1 protein_id gnl|my_center|LOCUS_02090 69763 70032 gene locus_tag LOCUS_02100 69763 70032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 70032 70475 gene locus_tag LOCUS_02110 70032 70475 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387852.1 protein_id gnl|my_center|LOCUS_02110 70908 70456 gene locus_tag LOCUS_02120 70908 70456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 71588 70905 gene locus_tag LOCUS_02130 71588 70905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216122.1 protein_id gnl|my_center|LOCUS_02130 72795 71581 gene locus_tag LOCUS_02140 72795 71581 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_02140 74144 72831 gene locus_tag LOCUS_02150 74144 72831 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389451.1 protein_id gnl|my_center|LOCUS_02150 74846 74514 gene locus_tag LOCUS_02160 74846 74514 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_02160 75014 75949 gene locus_tag LOCUS_02170 75014 75949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 77242 75944 gene locus_tag LOCUS_02180 77242 75944 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982178.1 protein_id gnl|my_center|LOCUS_02180 78255 77239 gene locus_tag LOCUS_02190 78255 77239 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_02190 79211 78252 gene locus_tag LOCUS_02200 79211 78252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_02200 79321 79506 gene locus_tag LOCUS_02210 79321 79506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 80746 81684 gene locus_tag LOCUS_02220 80746 81684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 81740 84478 gene locus_tag LOCUS_02230 gene polA 81740 84478 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_02230 84506 84850 gene locus_tag LOCUS_02240 84506 84850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 85467 84847 gene locus_tag LOCUS_02250 85467 84847 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_02250 86446 85496 gene locus_tag LOCUS_02260 gene msrP 86446 85496 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_02260 86712 86524 gene locus_tag LOCUS_02270 86712 86524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 86650 87318 gene locus_tag LOCUS_02280 86650 87318 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_02280 87832 87326 gene locus_tag LOCUS_02290 87832 87326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 88630 87878 gene locus_tag LOCUS_02300 88630 87878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 88699 89586 gene locus_tag LOCUS_02310 88699 89586 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626584.1 protein_id gnl|my_center|LOCUS_02310 89671 92352 gene locus_tag LOCUS_02320 gene acnA 89671 92352 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_02320 92433 93161 gene locus_tag LOCUS_02330 92433 93161 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537692.1 protein_id gnl|my_center|LOCUS_02330 93448 93726 gene locus_tag LOCUS_02340 93448 93726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 95720 93834 gene locus_tag LOCUS_02350 gene htpG 95720 93834 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387833.1 protein_id gnl|my_center|LOCUS_02350 96110 95847 gene locus_tag LOCUS_02360 96110 95847 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_02360 96243 96899 gene locus_tag LOCUS_02370 96243 96899 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 protein_id gnl|my_center|LOCUS_02370 96896 97261 gene locus_tag LOCUS_02380 96896 97261 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028143851.1 protein_id gnl|my_center|LOCUS_02380 97258 98100 gene locus_tag LOCUS_02390 97258 98100 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_02390 >Feature sequence003 <1 927 gene locus_tag LOCUS_02400 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974129.1:FAD-binding oxidoreductase 1943 900 gene locus_tag LOCUS_02410 1943 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3504 1945 gene locus_tag LOCUS_02420 3504 1945 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_02420 3823 3572 gene locus_tag LOCUS_02430 3823 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 4006 6138 gene locus_tag LOCUS_02440 4006 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6490 7470 gene locus_tag LOCUS_02450 gene bchI 6490 7470 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625950.1 protein_id gnl|my_center|LOCUS_02450 7467 9263 gene locus_tag LOCUS_02460 7467 9263 CDS product magnesium chelatase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388245.1 protein_id gnl|my_center|LOCUS_02460 9260 10150 gene locus_tag LOCUS_02470 9260 10150 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388246.1 protein_id gnl|my_center|LOCUS_02470 10228 11760 gene locus_tag LOCUS_02480 10228 11760 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388252.1 protein_id gnl|my_center|LOCUS_02480 11741 12865 gene locus_tag LOCUS_02490 11741 12865 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_02490 12947 13396 gene locus_tag LOCUS_02500 12947 13396 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227714.1 protein_id gnl|my_center|LOCUS_02500 13470 13604 gene locus_tag LOCUS_02510 13470 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 14449 13631 gene locus_tag LOCUS_02520 14449 13631 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_02520 16038 14497 gene locus_tag LOCUS_02530 gene crtI 16038 14497 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_02530 16159 17028 gene locus_tag LOCUS_02540 16159 17028 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390731.1 protein_id gnl|my_center|LOCUS_02540 17174 18205 gene locus_tag LOCUS_02550 17174 18205 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390730.1 protein_id gnl|my_center|LOCUS_02550 18467 19255 gene locus_tag LOCUS_02560 gene bchC 18467 19255 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_02560 19252 20271 gene locus_tag LOCUS_02570 19252 20271 CDS product chlorophyllide a reductase iron protein subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390728.1 protein_id gnl|my_center|LOCUS_02570 20297 21865 gene locus_tag LOCUS_02580 gene bchY 20297 21865 CDS product chlorophyllide a reductase subunit Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390727.1 protein_id gnl|my_center|LOCUS_02580 21865 23319 gene locus_tag LOCUS_02590 gene bchZ 21865 23319 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390726.1 protein_id gnl|my_center|LOCUS_02590 23423 23719 gene locus_tag LOCUS_02600 23423 23719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 23732 23947 gene locus_tag LOCUS_02610 23732 23947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 24066 24890 gene locus_tag LOCUS_02620 gene pufL 24066 24890 CDS product photosynthetic reaction center subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_02620 24906 25868 gene locus_tag LOCUS_02630 gene pufM 24906 25868 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_02630 25880 26902 gene locus_tag LOCUS_02640 25880 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 26953 27678 gene locus_tag LOCUS_02650 26953 27678 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140413.1 protein_id gnl|my_center|LOCUS_02650 29815 27746 gene locus_tag LOCUS_02660 29815 27746 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039218.1 protein_id gnl|my_center|LOCUS_02660 31297 29942 gene locus_tag LOCUS_02670 gene ppsR 31297 29942 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_02670 32112 31594 gene locus_tag LOCUS_02680 32112 31594 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_02680 32780 32103 gene locus_tag LOCUS_02690 gene bchJ 32780 32103 CDS product bacteriochlorophyll 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388371.1 protein_id gnl|my_center|LOCUS_02690 34478 32790 gene locus_tag LOCUS_02700 gene bchE 34478 32790 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391295.1 protein_id gnl|my_center|LOCUS_02700 35759 34548 gene locus_tag LOCUS_02710 gene hemA 35759 34548 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844889.1 protein_id gnl|my_center|LOCUS_02710 36681 35764 gene locus_tag LOCUS_02720 gene puhE 36681 35764 CDS product putative photosynthetic complex assembly protein PuhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388372.1 protein_id gnl|my_center|LOCUS_02720 37184 36693 gene locus_tag LOCUS_02730 gene puhC 37184 36693 CDS product photosynthetic complex assembly protein PuhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388373.1 protein_id gnl|my_center|LOCUS_02730 37863 37192 gene locus_tag LOCUS_02740 gene puhB 37863 37192 CDS product photosynthetic complex putative assembly protein PuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388374.1 protein_id gnl|my_center|LOCUS_02740 38726 37860 gene locus_tag LOCUS_02750 gene puhA 38726 37860 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_02750 40198 38750 gene locus_tag LOCUS_02760 40198 38750 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_02760 40896 40186 gene locus_tag LOCUS_02770 gene bchM 40896 40186 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388377.1 protein_id gnl|my_center|LOCUS_02770 41810 40896 gene locus_tag LOCUS_02780 gene bchL 41810 40896 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388378.1 protein_id gnl|my_center|LOCUS_02780 45517 41807 gene locus_tag LOCUS_02790 45517 41807 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_02790 47069 45492 gene locus_tag LOCUS_02800 gene bchB 47069 45492 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388380.1 protein_id gnl|my_center|LOCUS_02800 48366 47074 gene locus_tag LOCUS_02810 48366 47074 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388381.1 protein_id gnl|my_center|LOCUS_02810 48983 48366 gene locus_tag LOCUS_02820 gene bchF 48983 48366 CDS product 2-vinyl bacteriochlorophyllide hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388382.1 protein_id gnl|my_center|LOCUS_02820 49359 50255 gene locus_tag LOCUS_02830 49359 50255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 50281 51687 gene locus_tag LOCUS_02840 gene ppsR 50281 51687 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_02840 52023 51763 gene locus_tag LOCUS_02850 52023 51763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 51944 52723 gene locus_tag LOCUS_02860 gene chlG 51944 52723 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02860 52720 54078 gene locus_tag LOCUS_02870 52720 54078 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388386.1 protein_id gnl|my_center|LOCUS_02870 54084 55289 gene locus_tag LOCUS_02880 54084 55289 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388387.1 protein_id gnl|my_center|LOCUS_02880 55286 55783 gene locus_tag LOCUS_02890 55286 55783 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_02890 55788 56069 gene locus_tag LOCUS_02900 55788 56069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 56863 56090 gene locus_tag LOCUS_02910 56863 56090 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066727.1 protein_id gnl|my_center|LOCUS_02910 57449 56880 gene locus_tag LOCUS_02920 57449 56880 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 protein_id gnl|my_center|LOCUS_02920 57360 57605 gene locus_tag LOCUS_02930 57360 57605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 57602 58408 gene locus_tag LOCUS_02940 57602 58408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 58415 59176 gene locus_tag LOCUS_02950 58415 59176 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_02950 59752 59180 gene locus_tag LOCUS_02960 59752 59180 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 protein_id gnl|my_center|LOCUS_02960 61104 59752 gene locus_tag LOCUS_02970 61104 59752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_02970 62259 61108 gene locus_tag LOCUS_02980 62259 61108 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_02980 63160 62372 gene locus_tag LOCUS_02990 63160 62372 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_02990 64449 63157 gene locus_tag LOCUS_03000 64449 63157 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_03000 64745 64527 gene locus_tag LOCUS_03010 64745 64527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 65151 65726 gene locus_tag LOCUS_03020 65151 65726 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_03020 65723 66385 gene locus_tag LOCUS_03030 65723 66385 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_03030 66801 66406 gene locus_tag LOCUS_03040 66801 66406 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_03040 67026 66817 gene locus_tag LOCUS_03050 67026 66817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 67156 66923 gene locus_tag LOCUS_03060 67156 66923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 67635 68486 gene locus_tag LOCUS_03070 67635 68486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 68530 69012 gene locus_tag LOCUS_03080 gene aprB 68530 69012 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_03080 69012 70880 gene locus_tag LOCUS_03090 gene aprA 69012 70880 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_03090 71012 71362 gene locus_tag LOCUS_03100 71012 71362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 71383 71892 gene locus_tag LOCUS_03110 71383 71892 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889089.1 protein_id gnl|my_center|LOCUS_03110 73376 71976 gene locus_tag LOCUS_03120 73376 71976 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_03120 74851 73376 gene locus_tag LOCUS_03130 74851 73376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 75741 74866 gene locus_tag LOCUS_03140 gene phnD 75741 74866 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_03140 76356 76952 gene locus_tag LOCUS_03150 76356 76952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 77185 78570 gene locus_tag LOCUS_03160 77185 78570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 78639 79514 gene locus_tag LOCUS_03170 78639 79514 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_03170 79546 82089 gene locus_tag LOCUS_03180 79546 82089 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_03180 82126 82797 gene locus_tag LOCUS_03190 82126 82797 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392892.1 protein_id gnl|my_center|LOCUS_03190 83708 84019 gene locus_tag LOCUS_03200 83708 84019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 84173 85609 gene locus_tag LOCUS_03210 84173 85609 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947330.1 protein_id gnl|my_center|LOCUS_03210 85638 86924 gene locus_tag LOCUS_03220 85638 86924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 87213 87842 gene locus_tag LOCUS_03230 87213 87842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 88879 88670 gene locus_tag LOCUS_03240 88879 88670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 89263 89060 gene locus_tag LOCUS_03250 89263 89060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 90359 91027 gene locus_tag LOCUS_03260 90359 91027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 91040 93925 gene locus_tag LOCUS_03270 91040 93925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 94129 95241 gene locus_tag LOCUS_03280 94129 95241 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence004 1930 395 gene locus_tag LOCUS_03290 1930 395 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_03290 2899 1967 gene locus_tag LOCUS_03300 2899 1967 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_03300 4071 2998 gene locus_tag LOCUS_03310 4071 2998 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165691202.1 protein_id gnl|my_center|LOCUS_03310 4280 4068 gene locus_tag LOCUS_03320 4280 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 5233 4274 gene locus_tag LOCUS_03330 5233 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 5935 7194 gene locus_tag LOCUS_03340 gene dsrA 5935 7194 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_03340 7280 8371 gene locus_tag LOCUS_03350 gene dsrB 7280 8371 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_03350 8414 8773 gene locus_tag LOCUS_03360 gene tusD 8414 8773 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_03360 8793 9191 gene locus_tag LOCUS_03370 gene tusC 8793 9191 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_03370 9208 9510 gene locus_tag LOCUS_03380 gene tusB 9208 9510 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_03380 9614 9946 gene locus_tag LOCUS_03390 9614 9946 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_03390 10008 10748 gene locus_tag LOCUS_03400 gene dsrM 10008 10748 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 protein_id gnl|my_center|LOCUS_03400 10777 12273 gene locus_tag LOCUS_03410 10777 12273 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_03410 12362 14338 gene locus_tag LOCUS_03420 12362 14338 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_03420 14531 16462 gene locus_tag LOCUS_03430 14531 16462 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933900.1 protein_id gnl|my_center|LOCUS_03430 16466 16864 gene locus_tag LOCUS_03440 16466 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 16861 17622 gene locus_tag LOCUS_03450 gene hmeA 16861 17622 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_03450 17661 18938 gene locus_tag LOCUS_03460 gene hmeB 17661 18938 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_03460 19003 20415 gene locus_tag LOCUS_03470 gene cobB 19003 20415 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_03470 20422 21231 gene locus_tag LOCUS_03480 20422 21231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 21224 22081 gene locus_tag LOCUS_03490 21224 22081 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_03490 22380 22634 gene locus_tag LOCUS_03500 22380 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 22904 22683 gene locus_tag LOCUS_03510 22904 22683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 24031 23018 gene locus_tag LOCUS_03520 24031 23018 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_03520 24195 24422 gene locus_tag LOCUS_03530 24195 24422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 26808 24439 gene locus_tag LOCUS_03540 26808 24439 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_03540 26976 28925 gene locus_tag LOCUS_03550 26976 28925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 28922 30256 gene locus_tag LOCUS_03560 28922 30256 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_03560 30437 31231 gene locus_tag LOCUS_03570 30437 31231 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389559.1 protein_id gnl|my_center|LOCUS_03570 31265 32059 gene locus_tag LOCUS_03580 31265 32059 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389560.1 protein_id gnl|my_center|LOCUS_03580 32974 32192 gene locus_tag LOCUS_03590 32974 32192 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_03590 33948 33214 gene locus_tag LOCUS_03600 33948 33214 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_03600 34887 34015 gene locus_tag LOCUS_03610 gene rpoH 34887 34015 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719564.1 protein_id gnl|my_center|LOCUS_03610 36227 35271 gene locus_tag LOCUS_03620 36227 35271 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387816.1 protein_id gnl|my_center|LOCUS_03620 36488 37102 gene locus_tag LOCUS_03630 36488 37102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 37152 37769 gene locus_tag LOCUS_03640 37152 37769 CDS product HpnM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387817.1 protein_id gnl|my_center|LOCUS_03640 38765 37776 gene locus_tag LOCUS_03650 38765 37776 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_03650 41382 38782 gene locus_tag LOCUS_03660 41382 38782 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_03660 41601 42305 gene locus_tag LOCUS_03670 41601 42305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 42328 42951 gene locus_tag LOCUS_03680 42328 42951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 42914 43600 gene locus_tag LOCUS_03690 42914 43600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 43659 44273 gene locus_tag LOCUS_03700 43659 44273 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188272.1 protein_id gnl|my_center|LOCUS_03700 44851 44225 gene locus_tag LOCUS_03710 44851 44225 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188272.1 protein_id gnl|my_center|LOCUS_03710 45996 44848 gene locus_tag LOCUS_03720 gene aepY 45996 44848 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_03720 47714 45993 gene locus_tag LOCUS_03730 gene aepX 47714 45993 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525540.1 protein_id gnl|my_center|LOCUS_03730 47795 48553 gene locus_tag LOCUS_03740 47795 48553 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899275.1 protein_id gnl|my_center|LOCUS_03740 48968 48579 gene locus_tag LOCUS_03750 48968 48579 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533691.1 protein_id gnl|my_center|LOCUS_03750 49231 48980 gene locus_tag LOCUS_03760 49231 48980 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143214.1 protein_id gnl|my_center|LOCUS_03760 49418 49720 gene locus_tag LOCUS_03770 49418 49720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 50062 50382 gene locus_tag LOCUS_03780 50062 50382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 51258 50443 gene locus_tag LOCUS_03790 51258 50443 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188389.1 protein_id gnl|my_center|LOCUS_03790 51596 51336 gene locus_tag LOCUS_03800 51596 51336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 52645 51659 gene locus_tag LOCUS_03810 52645 51659 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_03810 52795 53781 gene locus_tag LOCUS_03820 gene ispH 52795 53781 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470638.1 protein_id gnl|my_center|LOCUS_03820 53800 54933 gene locus_tag LOCUS_03830 gene hpnH 53800 54933 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_03830 55253 54930 gene locus_tag LOCUS_03840 55253 54930 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_03840 55488 55240 gene locus_tag LOCUS_03850 55488 55240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 56248 55559 gene locus_tag LOCUS_03860 56248 55559 CDS product purine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387822.1 protein_id gnl|my_center|LOCUS_03860 58216 56261 gene locus_tag LOCUS_03870 gene shc 58216 56261 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_03870 59080 58271 gene locus_tag LOCUS_03880 59080 58271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 59739 59077 gene locus_tag LOCUS_03890 59739 59077 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_03890 61044 59800 gene locus_tag LOCUS_03900 gene hpnE 61044 59800 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_03900 61925 61041 gene locus_tag LOCUS_03910 61925 61041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03910 63098 61950 gene locus_tag LOCUS_03920 63098 61950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03920 63951 63100 gene locus_tag LOCUS_03930 gene hpnC 63951 63100 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_03930 64598 63972 gene locus_tag LOCUS_03940 64598 63972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 65515 64751 gene locus_tag LOCUS_03950 65515 64751 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971049.1 protein_id gnl|my_center|LOCUS_03950 66379 67461 gene locus_tag LOCUS_03960 66379 67461 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970762.1 protein_id gnl|my_center|LOCUS_03960 67644 68249 gene locus_tag LOCUS_03970 67644 68249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 68256 69611 gene locus_tag LOCUS_03980 68256 69611 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_03980 69622 70860 gene locus_tag LOCUS_03990 69622 70860 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388321.1 protein_id gnl|my_center|LOCUS_03990 70983 71255 gene locus_tag LOCUS_04000 70983 71255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 71636 71277 gene locus_tag LOCUS_04010 gene tusE 71636 71277 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 protein_id gnl|my_center|LOCUS_04010 72123 71731 gene locus_tag LOCUS_04020 72123 71731 CDS product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919719.1 protein_id gnl|my_center|LOCUS_04020 72994 72188 gene locus_tag LOCUS_04030 72994 72188 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_04030 73721 74326 gene locus_tag LOCUS_04040 73721 74326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 74434 75078 gene locus_tag LOCUS_04050 74434 75078 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863343.1 protein_id gnl|my_center|LOCUS_04050 75075 75353 gene locus_tag LOCUS_04060 75075 75353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 75519 76430 gene locus_tag LOCUS_04070 75519 76430 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_04070 76576 77001 gene locus_tag LOCUS_04080 gene arfB 76576 77001 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_04080 78015 77137 gene locus_tag LOCUS_04090 78015 77137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 79982 78114 gene locus_tag LOCUS_04100 gene ilvD 79982 78114 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626247.1 protein_id gnl|my_center|LOCUS_04100 80158 80415 gene locus_tag LOCUS_04110 80158 80415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 80420 80827 gene locus_tag LOCUS_04120 80420 80827 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 protein_id gnl|my_center|LOCUS_04120 81581 80985 gene locus_tag LOCUS_04130 81581 80985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 81882 81685 gene locus_tag LOCUS_04140 81882 81685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 82733 81954 gene locus_tag LOCUS_04150 82733 81954 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705555.1 protein_id gnl|my_center|LOCUS_04150 82810 83736 gene locus_tag LOCUS_04160 82810 83736 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331465.1 protein_id gnl|my_center|LOCUS_04160 83783 84496 gene locus_tag LOCUS_04170 83783 84496 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_04170 84876 84493 gene locus_tag LOCUS_04180 84876 84493 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_04180 86072 84942 gene locus_tag LOCUS_04190 86072 84942 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932765.1 protein_id gnl|my_center|LOCUS_04190 86240 86968 gene locus_tag LOCUS_04200 86240 86968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 87957 86965 gene locus_tag LOCUS_04210 87957 86965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 88248 88529 gene locus_tag LOCUS_04220 88248 88529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 89035 88556 gene locus_tag LOCUS_04230 gene msrA 89035 88556 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943782.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence005 186 611 gene locus_tag LOCUS_04240 186 611 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220683.1 protein_id gnl|my_center|LOCUS_04240 1371 2207 gene locus_tag LOCUS_04250 1371 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2799 2365 gene locus_tag LOCUS_04260 2799 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3143 2796 gene locus_tag LOCUS_04270 3143 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 3926 3213 gene locus_tag LOCUS_04280 3926 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4649 3957 gene locus_tag LOCUS_04290 4649 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 7878 4675 gene locus_tag LOCUS_04300 7878 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 9383 7875 gene locus_tag LOCUS_04310 9383 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 9822 9580 gene locus_tag LOCUS_04320 9822 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 12570 10579 gene locus_tag LOCUS_04330 12570 10579 CDS product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948071.1 protein_id gnl|my_center|LOCUS_04330 12836 12621 gene locus_tag LOCUS_04340 12836 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 14025 12937 gene locus_tag LOCUS_04350 14025 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 15496 14156 gene locus_tag LOCUS_04360 15496 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 16172 16459 gene locus_tag LOCUS_04370 16172 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 17752 16799 gene locus_tag LOCUS_04380 gene pfkB 17752 16799 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256696.1 protein_id gnl|my_center|LOCUS_04380 18122 17853 gene locus_tag LOCUS_04390 18122 17853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 18626 18198 gene locus_tag LOCUS_04400 18626 18198 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_04400 18714 19325 gene locus_tag LOCUS_04410 18714 19325 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_04410 20022 19270 gene locus_tag LOCUS_04420 20022 19270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 21830 20019 gene locus_tag LOCUS_04430 gene recQ 21830 20019 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_04430 22069 23820 gene locus_tag LOCUS_04440 gene frdA 22069 23820 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706984.1 protein_id gnl|my_center|LOCUS_04440 23817 24557 gene locus_tag LOCUS_04450 23817 24557 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706985.1 protein_id gnl|my_center|LOCUS_04450 24557 24949 gene locus_tag LOCUS_04460 24557 24949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 24953 25297 gene locus_tag LOCUS_04470 gene frdD 24953 25297 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407771.1 protein_id gnl|my_center|LOCUS_04470 25715 25431 gene locus_tag LOCUS_04480 25715 25431 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 protein_id gnl|my_center|LOCUS_04480 25981 25712 gene locus_tag LOCUS_04490 25981 25712 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740683.1 protein_id gnl|my_center|LOCUS_04490 26078 26413 gene locus_tag LOCUS_04500 26078 26413 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_04500 26753 26433 gene locus_tag LOCUS_04510 26753 26433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 28658 26847 gene locus_tag LOCUS_04520 28658 26847 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_04520 29289 28696 gene locus_tag LOCUS_04530 29289 28696 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_04530 30960 29296 gene locus_tag LOCUS_04540 30960 29296 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_04540 31198 32082 gene locus_tag LOCUS_04550 31198 32082 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948447.1 protein_id gnl|my_center|LOCUS_04550 32782 32066 gene locus_tag LOCUS_04560 32782 32066 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_04560 33492 32779 gene locus_tag LOCUS_04570 33492 32779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 33730 35847 gene locus_tag LOCUS_04580 33730 35847 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_04580 35844 38054 gene locus_tag LOCUS_04590 gene scpA 35844 38054 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390232.1 protein_id gnl|my_center|LOCUS_04590 38058 39119 gene locus_tag LOCUS_04600 gene meaB 38058 39119 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_04600 40715 39150 gene locus_tag LOCUS_04610 40715 39150 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_04610 40856 40932 gene locus_tag LOCUS_t00020 40856 40932 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41005 42132 gene locus_tag LOCUS_04620 41005 42132 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808111.1 protein_id gnl|my_center|LOCUS_04620 42274 42684 gene locus_tag LOCUS_04630 42274 42684 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388775.1 protein_id gnl|my_center|LOCUS_04630 43205 42777 gene locus_tag LOCUS_04640 43205 42777 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388367.1 protein_id gnl|my_center|LOCUS_04640 45808 43220 gene locus_tag LOCUS_04650 45808 43220 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195227.1 protein_id gnl|my_center|LOCUS_04650 46839 45874 gene locus_tag LOCUS_04660 46839 45874 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_04660 47920 46940 gene locus_tag LOCUS_04670 47920 46940 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_04670 49795 48335 gene locus_tag LOCUS_04680 49795 48335 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_04680 50721 49837 gene locus_tag LOCUS_04690 50721 49837 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194709.1 protein_id gnl|my_center|LOCUS_04690 50856 51503 gene locus_tag LOCUS_04700 50856 51503 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388365.1 protein_id gnl|my_center|LOCUS_04700 53075 51648 gene locus_tag LOCUS_04710 53075 51648 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_04710 53494 53072 gene locus_tag LOCUS_04720 53494 53072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 54687 53632 gene locus_tag LOCUS_04730 gene mutY 54687 53632 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_04730 54736 55263 gene locus_tag LOCUS_04740 54736 55263 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390998.1 protein_id gnl|my_center|LOCUS_04740 55456 56043 gene locus_tag LOCUS_04750 55456 56043 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470666.1 protein_id gnl|my_center|LOCUS_04750 56074 59541 gene locus_tag LOCUS_04760 gene smc 56074 59541 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390996.1 protein_id gnl|my_center|LOCUS_04760 59704 60087 gene locus_tag LOCUS_04770 59704 60087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 60119 60844 gene locus_tag LOCUS_04780 60119 60844 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_04780 60907 61131 gene locus_tag LOCUS_04790 60907 61131 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596668.1 protein_id gnl|my_center|LOCUS_04790 61153 61722 gene locus_tag LOCUS_04800 61153 61722 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563084.1 protein_id gnl|my_center|LOCUS_04800 61722 62249 gene locus_tag LOCUS_04810 61722 62249 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390991.1 protein_id gnl|my_center|LOCUS_04810 64361 62268 gene locus_tag LOCUS_04820 gene ligA 64361 62268 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_04820 64119 64206 gene locus_tag LOCUS_t00030 64119 64206 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 66028 64358 gene locus_tag LOCUS_04830 gene recN 66028 64358 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388695.1 protein_id gnl|my_center|LOCUS_04830 66857 66042 gene locus_tag LOCUS_04840 66857 66042 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_04840 67917 66952 gene locus_tag LOCUS_04850 gene lpxC 67917 66952 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388698.1 protein_id gnl|my_center|LOCUS_04850 69739 68162 gene locus_tag LOCUS_04860 69739 68162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 71043 69778 gene locus_tag LOCUS_04870 gene ftsA 71043 69778 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_04870 71932 71078 gene locus_tag LOCUS_04880 71932 71078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 72834 71929 gene locus_tag LOCUS_04890 72834 71929 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388702.1 protein_id gnl|my_center|LOCUS_04890 73775 72831 gene locus_tag LOCUS_04900 gene murB 73775 72831 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 protein_id gnl|my_center|LOCUS_04900 75199 73775 gene locus_tag LOCUS_04910 gene murC 75199 73775 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_04910 76344 75211 gene locus_tag LOCUS_04920 gene murG 76344 75211 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_04920 77462 76344 gene locus_tag LOCUS_04930 77462 76344 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_04930 78832 77459 gene locus_tag LOCUS_04940 gene murD 78832 77459 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388707.1 protein_id gnl|my_center|LOCUS_04940 79929 78841 gene locus_tag LOCUS_04950 gene mraY 79929 78841 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_04950 81367 79940 gene locus_tag LOCUS_04960 gene murF 81367 79940 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_04960 82827 81364 gene locus_tag LOCUS_04970 82827 81364 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388710.1 protein_id gnl|my_center|LOCUS_04970 84556 82814 gene locus_tag LOCUS_04980 84556 82814 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_04980 84888 84553 gene locus_tag LOCUS_04990 84888 84553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 85865 84885 gene locus_tag LOCUS_05000 gene rsmH 85865 84885 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_05000 86341 85862 gene locus_tag LOCUS_05010 gene mraZ 86341 85862 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969752.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence006 25 99 gene locus_tag LOCUS_t00040 25 99 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 145 885 gene locus_tag LOCUS_05020 gene pyrF 145 885 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_05020 1277 882 gene locus_tag LOCUS_05030 1277 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1463 6307 gene locus_tag LOCUS_05040 1463 6307 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_05040 6316 7611 gene locus_tag LOCUS_05050 6316 7611 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_05050 7678 8298 gene locus_tag LOCUS_05060 7678 8298 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_05060 8396 9133 gene locus_tag LOCUS_05070 8396 9133 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968582.1 protein_id gnl|my_center|LOCUS_05070 10717 9146 gene locus_tag LOCUS_05080 gene purH 10717 9146 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391402.1 protein_id gnl|my_center|LOCUS_05080 12750 10798 gene locus_tag LOCUS_05090 12750 10798 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_05090 13730 12768 gene locus_tag LOCUS_05100 13730 12768 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 protein_id gnl|my_center|LOCUS_05100 14983 13727 gene locus_tag LOCUS_05110 14983 13727 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_05110 15999 14980 gene locus_tag LOCUS_05120 15999 14980 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_05120 17071 16097 gene locus_tag LOCUS_05130 17071 16097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 18141 17080 gene locus_tag LOCUS_05140 18141 17080 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975131.1 protein_id gnl|my_center|LOCUS_05140 19326 18145 gene locus_tag LOCUS_05150 19326 18145 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088166.1 protein_id gnl|my_center|LOCUS_05150 19822 19397 gene locus_tag LOCUS_05160 19822 19397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 20711 19893 gene locus_tag LOCUS_05170 20711 19893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 21507 20725 gene locus_tag LOCUS_05180 21507 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 22787 21510 gene locus_tag LOCUS_05190 22787 21510 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_05190 24304 22784 gene locus_tag LOCUS_05200 24304 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 25301 24312 gene locus_tag LOCUS_05210 25301 24312 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403376.1 protein_id gnl|my_center|LOCUS_05210 26612 25911 gene locus_tag LOCUS_05220 26612 25911 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_05220 27468 26749 gene locus_tag LOCUS_05230 27468 26749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 29373 27475 gene locus_tag LOCUS_05240 29373 27475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 29492 29370 gene locus_tag LOCUS_05250 29492 29370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 31398 29506 gene locus_tag LOCUS_05260 gene asnB 31398 29506 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194643.1 protein_id gnl|my_center|LOCUS_05260 32522 31413 gene locus_tag LOCUS_05270 32522 31413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 34287 32551 gene locus_tag LOCUS_05280 34287 32551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 36009 34288 gene locus_tag LOCUS_05290 36009 34288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 36042 36941 gene locus_tag LOCUS_05300 36042 36941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 37900 36947 gene locus_tag LOCUS_05310 37900 36947 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_05310 38577 37897 gene locus_tag LOCUS_05320 38577 37897 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920164.1 protein_id gnl|my_center|LOCUS_05320 39500 38574 gene locus_tag LOCUS_05330 39500 38574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 40273 39509 gene locus_tag LOCUS_05340 gene kdsB 40273 39509 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848238.1 protein_id gnl|my_center|LOCUS_05340 41322 40270 gene locus_tag LOCUS_05350 41322 40270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 42328 41315 gene locus_tag LOCUS_05360 42328 41315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 44115 42328 gene locus_tag LOCUS_05370 44115 42328 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_05370 44278 44126 gene locus_tag LOCUS_05380 44278 44126 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_05380 44684 44295 gene locus_tag LOCUS_05390 44684 44295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 45751 44681 gene locus_tag LOCUS_05400 45751 44681 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_05400 46851 45748 gene locus_tag LOCUS_05410 46851 45748 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_05410 48446 46848 gene locus_tag LOCUS_05420 48446 46848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 48525 49499 gene locus_tag LOCUS_05430 48525 49499 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929375.1 protein_id gnl|my_center|LOCUS_05430 51670 49496 gene locus_tag LOCUS_05440 51670 49496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 51633 51845 gene locus_tag LOCUS_05450 51633 51845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 52388 51774 gene locus_tag LOCUS_05460 52388 51774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 53481 52453 gene locus_tag LOCUS_05470 53481 52453 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_05470 54635 53478 gene locus_tag LOCUS_05480 54635 53478 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 protein_id gnl|my_center|LOCUS_05480 55632 54628 gene locus_tag LOCUS_05490 55632 54628 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_05490 56397 55633 gene locus_tag LOCUS_05500 56397 55633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 57527 56394 gene locus_tag LOCUS_05510 57527 56394 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_05510 58543 57524 gene locus_tag LOCUS_05520 58543 57524 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_05520 59025 58540 gene locus_tag LOCUS_05530 59025 58540 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_05530 59862 59077 gene locus_tag LOCUS_05540 59862 59077 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020539.1 protein_id gnl|my_center|LOCUS_05540 61373 59859 gene locus_tag LOCUS_05550 61373 59859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 62236 61370 gene locus_tag LOCUS_05560 gene rfbD 62236 61370 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_05560 63089 62247 gene locus_tag LOCUS_05570 63089 62247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 64825 63086 gene locus_tag LOCUS_05580 64825 63086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_05580 65667 64909 gene locus_tag LOCUS_05590 65667 64909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 66533 65820 gene locus_tag LOCUS_05600 66533 65820 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871129.1 protein_id gnl|my_center|LOCUS_05600 67439 66537 gene locus_tag LOCUS_05610 67439 66537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 69181 67442 gene locus_tag LOCUS_05620 69181 67442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 71124 69178 gene locus_tag LOCUS_05630 71124 69178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 72078 71137 gene locus_tag LOCUS_05640 72078 71137 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_05640 72839 72090 gene locus_tag LOCUS_05650 72839 72090 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_05650 73500 72850 gene locus_tag LOCUS_05660 73500 72850 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_05660 74474 73497 gene locus_tag LOCUS_05670 gene galE 74474 73497 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_05670 76401 74515 gene locus_tag LOCUS_05680 76401 74515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 77051 76470 gene locus_tag LOCUS_05690 77051 76470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 77701 77063 gene locus_tag LOCUS_05700 gene hisH 77701 77063 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946487.1 protein_id gnl|my_center|LOCUS_05700 78459 77698 gene locus_tag LOCUS_05710 gene wbuZ 78459 77698 CDS product glycosyl amidation-associated protein WbuZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213307.1 protein_id gnl|my_center|LOCUS_05710 79719 78481 gene locus_tag LOCUS_05720 79719 78481 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841181.1 protein_id gnl|my_center|LOCUS_05720 80557 79745 gene locus_tag LOCUS_05730 80557 79745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_05730 81261 80554 gene locus_tag LOCUS_05740 81261 80554 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence007 1825 2034 gene locus_tag LOCUS_05750 1825 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3150 1921 gene locus_tag LOCUS_05760 3150 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3625 3368 gene locus_tag LOCUS_05770 3625 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4330 3713 gene locus_tag LOCUS_05780 4330 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 4693 4618 gene locus_tag LOCUS_t00050 4693 4618 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5918 4770 gene locus_tag LOCUS_05790 gene rodA 5918 4770 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_05790 7802 5928 gene locus_tag LOCUS_05800 gene mrdA 7802 5928 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_05800 8319 7804 gene locus_tag LOCUS_05810 8319 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 9215 8316 gene locus_tag LOCUS_05820 gene mreC 9215 8316 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_05820 10365 9325 gene locus_tag LOCUS_05830 10365 9325 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_05830 12043 10490 gene locus_tag LOCUS_05840 12043 10490 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_05840 14831 12432 gene locus_tag LOCUS_05850 14831 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_05850 15604 14828 gene locus_tag LOCUS_05860 15604 14828 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_05860 16818 15640 gene locus_tag LOCUS_05870 16818 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 17105 17599 gene locus_tag LOCUS_05880 17105 17599 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_05880 17691 18209 gene locus_tag LOCUS_05890 17691 18209 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_05890 18247 18480 gene locus_tag LOCUS_05900 gene tusA 18247 18480 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_05900 18612 18935 gene locus_tag LOCUS_05910 18612 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086291.1 protein_id gnl|my_center|LOCUS_05910 19045 21645 gene locus_tag LOCUS_05920 19045 21645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 22695 21676 gene locus_tag LOCUS_05930 gene fliG 22695 21676 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388302.1 protein_id gnl|my_center|LOCUS_05930 23277 22753 gene locus_tag LOCUS_05940 23277 22753 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389313.1 protein_id gnl|my_center|LOCUS_05940 23395 24468 gene locus_tag LOCUS_05950 23395 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 24910 24452 gene locus_tag LOCUS_05960 24910 24452 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_05960 25027 25425 gene locus_tag LOCUS_05970 25027 25425 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388255.1 protein_id gnl|my_center|LOCUS_05970 25422 26330 gene locus_tag LOCUS_05980 25422 26330 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_05980 26459 27253 gene locus_tag LOCUS_05990 26459 27253 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_05990 27280 28047 gene locus_tag LOCUS_06000 27280 28047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 28594 28118 gene locus_tag LOCUS_06010 28594 28118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 30836 28752 gene locus_tag LOCUS_06020 gene recG 30836 28752 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_06020 30907 31170 gene locus_tag LOCUS_06030 30907 31170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 31175 34660 gene locus_tag LOCUS_06040 gene mfd 31175 34660 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 protein_id gnl|my_center|LOCUS_06040 34657 35127 gene locus_tag LOCUS_06050 34657 35127 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_06050 35746 35108 gene locus_tag LOCUS_06060 35746 35108 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_06060 37099 35768 gene locus_tag LOCUS_06070 37099 35768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 37799 37128 gene locus_tag LOCUS_06080 37799 37128 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819982.1 protein_id gnl|my_center|LOCUS_06080 37969 38778 gene locus_tag LOCUS_06090 37969 38778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 41136 39286 gene locus_tag LOCUS_06100 41136 39286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 41401 41709 gene locus_tag LOCUS_06110 41401 41709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 41880 43661 gene locus_tag LOCUS_06120 41880 43661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 43683 46226 gene locus_tag LOCUS_06130 43683 46226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 46852 46223 gene locus_tag LOCUS_06140 46852 46223 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_06140 46981 47658 gene locus_tag LOCUS_06150 46981 47658 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 protein_id gnl|my_center|LOCUS_06150 47851 48720 gene locus_tag LOCUS_06160 gene phnC 47851 48720 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104080.1 protein_id gnl|my_center|LOCUS_06160 48768 49775 gene locus_tag LOCUS_06170 gene phnD 48768 49775 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095112.1 protein_id gnl|my_center|LOCUS_06170 49866 50705 gene locus_tag LOCUS_06180 gene phnE 49866 50705 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_06180 50708 51172 gene locus_tag LOCUS_06190 50708 51172 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 protein_id gnl|my_center|LOCUS_06190 52307 51165 gene locus_tag LOCUS_06200 52307 51165 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194422.1 protein_id gnl|my_center|LOCUS_06200 52879 52304 gene locus_tag LOCUS_06210 52879 52304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 54016 54381 gene locus_tag LOCUS_06220 54016 54381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 55250 54519 gene locus_tag LOCUS_06230 gene phnF 55250 54519 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173106.1 protein_id gnl|my_center|LOCUS_06230 55402 55818 gene locus_tag LOCUS_06240 gene phnG 55402 55818 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529524.1 protein_id gnl|my_center|LOCUS_06240 55821 56417 gene locus_tag LOCUS_06250 gene phnH 55821 56417 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965300.1 protein_id gnl|my_center|LOCUS_06250 56422 57513 gene locus_tag LOCUS_06260 56422 57513 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084041.1 protein_id gnl|my_center|LOCUS_06260 57516 58394 gene locus_tag LOCUS_06270 57516 58394 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113123.1 protein_id gnl|my_center|LOCUS_06270 58404 59186 gene locus_tag LOCUS_06280 gene phnK 58404 59186 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 protein_id gnl|my_center|LOCUS_06280 59212 59901 gene locus_tag LOCUS_06290 gene phnL 59212 59901 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611411.1 protein_id gnl|my_center|LOCUS_06290 59898 60731 gene locus_tag LOCUS_06300 59898 60731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 60742 61881 gene locus_tag LOCUS_06310 60742 61881 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 protein_id gnl|my_center|LOCUS_06310 61967 62926 gene locus_tag LOCUS_06320 61967 62926 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087563.1 protein_id gnl|my_center|LOCUS_06320 63262 62939 gene locus_tag LOCUS_06330 63262 62939 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895797.1 protein_id gnl|my_center|LOCUS_06330 63486 63259 gene locus_tag LOCUS_06340 63486 63259 CDS product antitoxin MazE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729843.1 protein_id gnl|my_center|LOCUS_06340 64684 63665 gene locus_tag LOCUS_06350 64684 63665 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_06350 64953 65882 gene locus_tag LOCUS_06360 64953 65882 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_06360 66272 66183 gene locus_tag LOCUS_t00060 66272 66183 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 66424 67086 gene locus_tag LOCUS_06370 66424 67086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 68026 67220 gene locus_tag LOCUS_06380 68026 67220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 68412 68792 gene locus_tag LOCUS_06390 68412 68792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 68846 69646 gene locus_tag LOCUS_06400 68846 69646 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 protein_id gnl|my_center|LOCUS_06400 69711 70919 gene locus_tag LOCUS_06410 69711 70919 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626230.1 protein_id gnl|my_center|LOCUS_06410 71009 71989 gene locus_tag LOCUS_06420 71009 71989 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 protein_id gnl|my_center|LOCUS_06420 71989 73140 gene locus_tag LOCUS_06430 71989 73140 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_06430 73137 73772 gene locus_tag LOCUS_06440 gene tmk 73137 73772 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_06440 73847 74866 gene locus_tag LOCUS_06450 73847 74866 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence008 <1 1199 gene locus_tag LOCUS_06460 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein 3379 1232 gene locus_tag LOCUS_06470 3379 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3567 4265 gene locus_tag LOCUS_06480 3567 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 5625 4285 gene locus_tag LOCUS_06490 5625 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 5910 6305 gene locus_tag LOCUS_06500 5910 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6309 7439 gene locus_tag LOCUS_06510 6309 7439 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083132.1 protein_id gnl|my_center|LOCUS_06510 7488 11738 gene locus_tag LOCUS_06520 7488 11738 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_06520 11738 12454 gene locus_tag LOCUS_06530 11738 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 12475 13482 gene locus_tag LOCUS_06540 12475 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 13591 13944 gene locus_tag LOCUS_06550 13591 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 14145 14477 gene locus_tag LOCUS_06560 14145 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 14655 15533 gene locus_tag LOCUS_06570 14655 15533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 15533 16171 gene locus_tag LOCUS_06580 15533 16171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 16189 17091 gene locus_tag LOCUS_06590 16189 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 17139 17735 gene locus_tag LOCUS_06600 17139 17735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 17809 19347 gene locus_tag LOCUS_06610 17809 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 19814 19374 gene locus_tag LOCUS_06620 19814 19374 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388367.1 protein_id gnl|my_center|LOCUS_06620 21248 19848 gene locus_tag LOCUS_06630 21248 19848 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_06630 22392 21406 gene locus_tag LOCUS_06640 gene dctP 22392 21406 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 protein_id gnl|my_center|LOCUS_06640 23845 22445 gene locus_tag LOCUS_06650 23845 22445 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_06650 24402 23842 gene locus_tag LOCUS_06660 24402 23842 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 protein_id gnl|my_center|LOCUS_06660 25427 24435 gene locus_tag LOCUS_06670 25427 24435 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 protein_id gnl|my_center|LOCUS_06670 25707 26654 gene locus_tag LOCUS_06680 gene ppk2 25707 26654 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_06680 27278 26667 gene locus_tag LOCUS_06690 27278 26667 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_06690 28237 27278 gene locus_tag LOCUS_06700 gene ppk2 28237 27278 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_06700 28418 30010 gene locus_tag LOCUS_06710 28418 30010 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 protein_id gnl|my_center|LOCUS_06710 30024 30749 gene locus_tag LOCUS_06720 30024 30749 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400587.1 protein_id gnl|my_center|LOCUS_06720 30910 31140 gene locus_tag LOCUS_06730 gene secE2 30910 31140 CDS product calcium dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401885.1 protein_id gnl|my_center|LOCUS_06730 31292 31597 gene locus_tag LOCUS_06740 31292 31597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 31667 33421 gene locus_tag LOCUS_06750 31667 33421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 33418 34242 gene locus_tag LOCUS_06760 33418 34242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 34239 35912 gene locus_tag LOCUS_06770 34239 35912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 35914 36516 gene locus_tag LOCUS_06780 35914 36516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 36541 37023 gene locus_tag LOCUS_06790 36541 37023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 37086 38324 gene locus_tag LOCUS_06800 37086 38324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 38389 39858 gene locus_tag LOCUS_06810 38389 39858 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_06810 40068 39880 gene locus_tag LOCUS_06820 40068 39880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 40248 40937 gene locus_tag LOCUS_06830 40248 40937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 41006 41551 gene locus_tag LOCUS_06840 41006 41551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 41589 42404 gene locus_tag LOCUS_06850 41589 42404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 42549 42932 gene locus_tag LOCUS_06860 42549 42932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 43069 43314 gene locus_tag LOCUS_06870 43069 43314 CDS product DUF1902 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228375.1 protein_id gnl|my_center|LOCUS_06870 44855 43512 gene locus_tag LOCUS_06880 44855 43512 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_06880 45044 46018 gene locus_tag LOCUS_06890 45044 46018 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_06890 46436 47041 gene locus_tag LOCUS_06900 46436 47041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 47201 47536 gene locus_tag LOCUS_06910 47201 47536 CDS product DUF2173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022242.1 protein_id gnl|my_center|LOCUS_06910 48712 47558 gene locus_tag LOCUS_06920 gene tssA 48712 47558 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_06920 52907 48720 gene locus_tag LOCUS_06930 52907 48720 CDS product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114521.1 protein_id gnl|my_center|LOCUS_06930 53697 52933 gene locus_tag LOCUS_06940 53697 52933 CDS product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104706.1 protein_id gnl|my_center|LOCUS_06940 55043 53697 gene locus_tag LOCUS_06950 gene tssK 55043 53697 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 protein_id gnl|my_center|LOCUS_06950 55728 55213 gene locus_tag LOCUS_06960 55728 55213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104701.1 protein_id gnl|my_center|LOCUS_06960 56009 56863 gene locus_tag LOCUS_06970 56009 56863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 57033 57233 gene locus_tag LOCUS_06980 57033 57233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 57309 59471 gene locus_tag LOCUS_06990 57309 59471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 60132 60671 gene locus_tag LOCUS_07000 gene tssB 60132 60671 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089493.1 protein_id gnl|my_center|LOCUS_07000 60796 62271 gene locus_tag LOCUS_07010 gene tssC 60796 62271 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_07010 62325 62828 gene locus_tag LOCUS_07020 62325 62828 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089495.1 protein_id gnl|my_center|LOCUS_07020 62836 63345 gene locus_tag LOCUS_07030 gene tssE 62836 63345 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318239.1 protein_id gnl|my_center|LOCUS_07030 63335 65146 gene locus_tag LOCUS_07040 gene tssF 63335 65146 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 protein_id gnl|my_center|LOCUS_07040 65110 66156 gene locus_tag LOCUS_07050 gene tssG 65110 66156 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114517.1 protein_id gnl|my_center|LOCUS_07050 66153 68786 gene locus_tag LOCUS_07060 gene tssH 66153 68786 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_07060 69128 68853 gene locus_tag LOCUS_07070 69128 68853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 70506 69178 gene locus_tag LOCUS_07080 70506 69178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 70822 72966 gene locus_tag LOCUS_07090 70822 72966 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_07090 72971 73993 gene locus_tag LOCUS_07100 72971 73993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 73990 74394 gene locus_tag LOCUS_07110 73990 74394 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_07110 74419 75312 gene locus_tag LOCUS_07120 74419 75312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence009 343 119 gene locus_tag LOCUS_07130 343 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2744 348 gene locus_tag LOCUS_07140 gene feoB 2744 348 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_07140 3073 2741 gene locus_tag LOCUS_07150 3073 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 4460 3258 gene locus_tag LOCUS_07160 4460 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 5537 5304 gene locus_tag LOCUS_07170 5537 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5801 5541 gene locus_tag LOCUS_07180 5801 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6083 6652 gene locus_tag LOCUS_07190 6083 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 7198 6989 gene locus_tag LOCUS_07200 7198 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 9535 7352 gene locus_tag LOCUS_07210 gene uvrB 9535 7352 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470604.1 protein_id gnl|my_center|LOCUS_07210 9781 9945 gene locus_tag LOCUS_07220 9781 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 10068 10748 gene locus_tag LOCUS_07230 10068 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 10745 11749 gene locus_tag LOCUS_07240 10745 11749 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338244.1 protein_id gnl|my_center|LOCUS_07240 11746 12672 gene locus_tag LOCUS_07250 11746 12672 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080579555.1 protein_id gnl|my_center|LOCUS_07250 13383 12688 gene locus_tag LOCUS_07260 13383 12688 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_07260 13628 13715 gene locus_tag LOCUS_t00070 13628 13715 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13853 14197 gene locus_tag LOCUS_07270 13853 14197 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265541.1 protein_id gnl|my_center|LOCUS_07270 14960 14112 gene locus_tag LOCUS_07280 14960 14112 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067651.1 protein_id gnl|my_center|LOCUS_07280 15298 15053 gene locus_tag LOCUS_07290 15298 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 15557 15772 gene locus_tag LOCUS_07300 15557 15772 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389863.1 protein_id gnl|my_center|LOCUS_07300 18760 15827 gene locus_tag LOCUS_07310 18760 15827 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389864.1 protein_id gnl|my_center|LOCUS_07310 18972 20402 gene locus_tag LOCUS_07320 gene atpD 18972 20402 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045606127.1 protein_id gnl|my_center|LOCUS_07320 20399 20854 gene locus_tag LOCUS_07330 20399 20854 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836235.1 protein_id gnl|my_center|LOCUS_07330 20847 21134 gene locus_tag LOCUS_07340 20847 21134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07340 21131 21406 gene locus_tag LOCUS_07350 21131 21406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 21454 22074 gene locus_tag LOCUS_07360 21454 22074 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724766.1 protein_id gnl|my_center|LOCUS_07360 22104 22355 gene locus_tag LOCUS_07370 22104 22355 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187193.1 protein_id gnl|my_center|LOCUS_07370 22352 23104 gene locus_tag LOCUS_07380 22352 23104 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_07380 23088 24608 gene locus_tag LOCUS_07390 23088 24608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 24620 25489 gene locus_tag LOCUS_07400 24620 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 28164 25483 gene locus_tag LOCUS_07410 28164 25483 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169981.1 protein_id gnl|my_center|LOCUS_07410 28533 29684 gene locus_tag LOCUS_07420 28533 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 31315 29756 gene locus_tag LOCUS_07430 31315 29756 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625965.1 protein_id gnl|my_center|LOCUS_07430 31551 32666 gene locus_tag LOCUS_07440 31551 32666 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_07440 32698 33759 gene locus_tag LOCUS_07450 32698 33759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 35326 33722 gene locus_tag LOCUS_07460 35326 33722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 37403 35457 gene locus_tag LOCUS_07470 37403 35457 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819987.1 protein_id gnl|my_center|LOCUS_07470 37595 38416 gene locus_tag LOCUS_07480 37595 38416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 40384 38438 gene locus_tag LOCUS_07490 40384 38438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 40971 40480 gene locus_tag LOCUS_07500 40971 40480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 42995 41157 gene locus_tag LOCUS_07510 42995 41157 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390480.1 protein_id gnl|my_center|LOCUS_07510 45189 43009 gene locus_tag LOCUS_07520 gene flgK 45189 43009 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390479.1 protein_id gnl|my_center|LOCUS_07520 45657 45211 gene locus_tag LOCUS_07530 45657 45211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 45971 45654 gene locus_tag LOCUS_07540 45971 45654 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 protein_id gnl|my_center|LOCUS_07540 47125 45971 gene locus_tag LOCUS_07550 47125 45971 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390476.1 protein_id gnl|my_center|LOCUS_07550 47591 48349 gene locus_tag LOCUS_07560 47591 48349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 50523 48604 gene locus_tag LOCUS_07570 50523 48604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 50825 51574 gene locus_tag LOCUS_07580 50825 51574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 52638 51583 gene locus_tag LOCUS_07590 52638 51583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_07590 54356 52635 gene locus_tag LOCUS_07600 54356 52635 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_07600 55436 54399 gene locus_tag LOCUS_07610 55436 54399 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388527.1 protein_id gnl|my_center|LOCUS_07610 55731 56159 gene locus_tag LOCUS_07620 55731 56159 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390475.1 protein_id gnl|my_center|LOCUS_07620 56328 56744 gene locus_tag LOCUS_07630 gene dksA 56328 56744 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 protein_id gnl|my_center|LOCUS_07630 56911 58941 gene locus_tag LOCUS_07640 56911 58941 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140130.1 protein_id gnl|my_center|LOCUS_07640 62876 59205 gene locus_tag LOCUS_07650 62876 59205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 64264 63374 gene locus_tag LOCUS_07660 64264 63374 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_07660 65282 64320 gene locus_tag LOCUS_07670 gene trxB 65282 64320 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_07670 65502 66530 gene locus_tag LOCUS_07680 65502 66530 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388951.1 protein_id gnl|my_center|LOCUS_07680 67571 67966 gene locus_tag LOCUS_07690 gene sdhC 67571 67966 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_07690 67966 68349 gene locus_tag LOCUS_07700 gene sdhD 67966 68349 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_07700 68366 70159 gene locus_tag LOCUS_07710 gene sdhA 68366 70159 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_07710 70180 70956 gene locus_tag LOCUS_07720 70180 70956 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388960.1 protein_id gnl|my_center|LOCUS_07720 71133 72662 gene locus_tag LOCUS_07730 71133 72662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 72751 73866 gene locus_tag LOCUS_07740 gene zapE 72751 73866 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388963.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence010 200 1966 gene locus_tag LOCUS_07750 200 1966 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458059.1 protein_id gnl|my_center|LOCUS_07750 4044 3403 gene locus_tag LOCUS_07760 4044 3403 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_07760 4731 4126 gene locus_tag LOCUS_07770 gene def 4731 4126 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_07770 4885 5088 gene locus_tag LOCUS_07780 4885 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 5124 5396 gene locus_tag LOCUS_07790 5124 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5675 5511 gene locus_tag LOCUS_07800 5675 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5679 6326 gene locus_tag LOCUS_07810 5679 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 6929 6429 gene locus_tag LOCUS_07820 6929 6429 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126823873.1 protein_id gnl|my_center|LOCUS_07820 7216 6926 gene locus_tag LOCUS_07830 7216 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7763 7329 gene locus_tag LOCUS_07840 7763 7329 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194624.1 protein_id gnl|my_center|LOCUS_07840 8837 7794 gene locus_tag LOCUS_07850 8837 7794 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256084.1 protein_id gnl|my_center|LOCUS_07850 9268 8957 gene locus_tag LOCUS_07860 9268 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 10187 10648 gene locus_tag LOCUS_07870 10187 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 12743 11244 gene locus_tag LOCUS_07880 12743 11244 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034312.1 protein_id gnl|my_center|LOCUS_07880 14049 12733 gene locus_tag LOCUS_07890 14049 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 14165 15121 gene locus_tag LOCUS_07900 14165 15121 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625895.1 protein_id gnl|my_center|LOCUS_07900 15451 15149 gene locus_tag LOCUS_07910 15451 15149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 18800 15666 gene locus_tag LOCUS_07920 18800 15666 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_07920 20173 18797 gene locus_tag LOCUS_07930 20173 18797 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 protein_id gnl|my_center|LOCUS_07930 22498 20300 gene locus_tag LOCUS_07940 22498 20300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 25577 22773 gene locus_tag LOCUS_07950 gene secA 25577 22773 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_07950 25751 26602 gene locus_tag LOCUS_07960 25751 26602 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388154.1 protein_id gnl|my_center|LOCUS_07960 26741 27973 gene locus_tag LOCUS_07970 gene argJ 26741 27973 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_07970 27977 28552 gene locus_tag LOCUS_07980 27977 28552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 28552 29544 gene locus_tag LOCUS_07990 28552 29544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 29851 29528 gene locus_tag LOCUS_08000 29851 29528 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967577.1 protein_id gnl|my_center|LOCUS_08000 30144 30902 gene locus_tag LOCUS_08010 30144 30902 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_08010 30941 31183 gene locus_tag LOCUS_08020 30941 31183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 31839 31201 gene locus_tag LOCUS_08030 gene bluB 31839 31201 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 protein_id gnl|my_center|LOCUS_08030 32996 31896 gene locus_tag LOCUS_08040 32996 31896 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403058.1 protein_id gnl|my_center|LOCUS_08040 33691 32993 gene locus_tag LOCUS_08050 33691 32993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 34011 33742 gene locus_tag LOCUS_08060 34011 33742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 35409 34027 gene locus_tag LOCUS_08070 35409 34027 CDS product arylsulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404073.1 protein_id gnl|my_center|LOCUS_08070 35561 35647 gene locus_tag LOCUS_t00080 35561 35647 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35940 38579 gene locus_tag LOCUS_08080 35940 38579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 38590 41412 gene locus_tag LOCUS_08090 38590 41412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 42074 41409 gene locus_tag LOCUS_08100 42074 41409 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_08100 42220 43089 gene locus_tag LOCUS_08110 42220 43089 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629595.1 protein_id gnl|my_center|LOCUS_08110 43771 43112 gene locus_tag LOCUS_08120 43771 43112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 45065 43911 gene locus_tag LOCUS_08130 45065 43911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061528.1 protein_id gnl|my_center|LOCUS_08130 46060 45062 gene locus_tag LOCUS_08140 46060 45062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531312.1 protein_id gnl|my_center|LOCUS_08140 48017 46071 gene locus_tag LOCUS_08150 48017 46071 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975625.1 protein_id gnl|my_center|LOCUS_08150 49954 48014 gene locus_tag LOCUS_08160 49954 48014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975624.1 protein_id gnl|my_center|LOCUS_08160 50517 49951 gene locus_tag LOCUS_08170 50517 49951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 51266 50514 gene locus_tag LOCUS_08180 51266 50514 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061519.1 protein_id gnl|my_center|LOCUS_08180 52443 51295 gene locus_tag LOCUS_08190 52443 51295 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 protein_id gnl|my_center|LOCUS_08190 53042 52440 gene locus_tag LOCUS_08200 53042 52440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 54163 53039 gene locus_tag LOCUS_08210 54163 53039 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625896.1 protein_id gnl|my_center|LOCUS_08210 55404 54163 gene locus_tag LOCUS_08220 55404 54163 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975627.1 protein_id gnl|my_center|LOCUS_08220 56643 55420 gene locus_tag LOCUS_08230 56643 55420 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 protein_id gnl|my_center|LOCUS_08230 56744 59407 gene locus_tag LOCUS_08240 56744 59407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 protein_id gnl|my_center|LOCUS_08240 59426 59923 gene locus_tag LOCUS_08250 59426 59923 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531302.1 protein_id gnl|my_center|LOCUS_08250 60022 61881 gene locus_tag LOCUS_08260 60022 61881 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_08260 63304 61892 gene locus_tag LOCUS_08270 63304 61892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 63725 63330 gene locus_tag LOCUS_08280 63725 63330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 63845 64306 gene locus_tag LOCUS_08290 gene ssb 63845 64306 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919343.1 protein_id gnl|my_center|LOCUS_08290 64441 67203 gene locus_tag LOCUS_08300 gene gyrA 64441 67203 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389497.1 protein_id gnl|my_center|LOCUS_08300 67200 67766 gene locus_tag LOCUS_08310 gene coaD 67200 67766 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389496.1 protein_id gnl|my_center|LOCUS_08310 68293 68712 gene locus_tag LOCUS_08320 68293 68712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 69096 68812 gene locus_tag LOCUS_08330 69096 68812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 69835 69164 gene locus_tag LOCUS_08340 69835 69164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389536.1 protein_id gnl|my_center|LOCUS_08340 70364 71014 gene locus_tag LOCUS_08350 70364 71014 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 protein_id gnl|my_center|LOCUS_08350 71320 71027 gene locus_tag LOCUS_08360 71320 71027 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378049.1 protein_id gnl|my_center|LOCUS_08360 71757 71389 gene locus_tag LOCUS_08370 71757 71389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 73091 71877 gene locus_tag LOCUS_08380 gene nhaA 73091 71877 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387889.1 protein_id gnl|my_center|LOCUS_08380 73450 73375 gene locus_tag LOCUS_t00090 73450 73375 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 73530 73457 gene locus_tag LOCUS_t00100 73530 73457 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 433 978 gene locus_tag LOCUS_08390 433 978 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_08390 1845 1543 gene locus_tag LOCUS_08400 1845 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1891 2640 gene locus_tag LOCUS_08410 1891 2640 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390825.1 protein_id gnl|my_center|LOCUS_08410 2640 3569 gene locus_tag LOCUS_08420 2640 3569 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_08420 3611 4486 gene locus_tag LOCUS_08430 3611 4486 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_08430 4646 4572 gene locus_tag LOCUS_t00110 4646 4572 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4759 4920 gene locus_tag LOCUS_08440 4759 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5093 6355 gene locus_tag LOCUS_08450 gene murA 5093 6355 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390681.1 protein_id gnl|my_center|LOCUS_08450 6573 8720 gene locus_tag LOCUS_08460 gene katG 6573 8720 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444101.1 protein_id gnl|my_center|LOCUS_08460 9246 10313 gene locus_tag LOCUS_08470 9246 10313 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389542.1 protein_id gnl|my_center|LOCUS_08470 10477 10779 gene locus_tag LOCUS_08480 10477 10779 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_08480 10763 11029 gene locus_tag LOCUS_08490 10763 11029 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041364541.1 protein_id gnl|my_center|LOCUS_08490 11203 12507 gene locus_tag LOCUS_08500 gene hisD 11203 12507 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390581.1 protein_id gnl|my_center|LOCUS_08500 12512 12985 gene locus_tag LOCUS_08510 12512 12985 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390580.1 protein_id gnl|my_center|LOCUS_08510 12993 13436 gene locus_tag LOCUS_08520 12993 13436 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_08520 14216 13443 gene locus_tag LOCUS_08530 14216 13443 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_08530 14351 15226 gene locus_tag LOCUS_08540 14351 15226 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_08540 15219 15872 gene locus_tag LOCUS_08550 gene gmk 15219 15872 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086862.1 protein_id gnl|my_center|LOCUS_08550 16007 16630 gene locus_tag LOCUS_08560 16007 16630 CDS product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 protein_id gnl|my_center|LOCUS_08560 16630 18174 gene locus_tag LOCUS_08570 16630 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 18171 18956 gene locus_tag LOCUS_08580 18171 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 19085 19663 gene locus_tag LOCUS_08590 19085 19663 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_08590 19682 20245 gene locus_tag LOCUS_08600 19682 20245 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_08600 20266 20799 gene locus_tag LOCUS_08610 20266 20799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08610 20942 21154 gene locus_tag LOCUS_08620 20942 21154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 21138 21413 gene locus_tag LOCUS_08630 21138 21413 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_08630 22338 21493 gene locus_tag LOCUS_08640 gene rsmA 22338 21493 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388190.1 protein_id gnl|my_center|LOCUS_08640 23342 22335 gene locus_tag LOCUS_08650 gene pdxA 23342 22335 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388191.1 protein_id gnl|my_center|LOCUS_08650 24580 23357 gene locus_tag LOCUS_08660 24580 23357 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625938.1 protein_id gnl|my_center|LOCUS_08660 26973 24823 gene locus_tag LOCUS_08670 gene lptD 26973 24823 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_08670 28076 26976 gene locus_tag LOCUS_08680 gene lptG 28076 26976 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_08680 29223 28099 gene locus_tag LOCUS_08690 gene lptF 29223 28099 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 protein_id gnl|my_center|LOCUS_08690 31101 29308 gene locus_tag LOCUS_08700 31101 29308 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_08700 32602 31190 gene locus_tag LOCUS_08710 32602 31190 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_08710 32985 32602 gene locus_tag LOCUS_08720 32985 32602 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_08720 33226 32978 gene locus_tag LOCUS_08730 33226 32978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 33874 33293 gene locus_tag LOCUS_08740 33874 33293 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973484.1 protein_id gnl|my_center|LOCUS_08740 34908 33871 gene locus_tag LOCUS_08750 34908 33871 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_08750 35696 34905 gene locus_tag LOCUS_08760 gene cysQ 35696 34905 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_08760 38017 35693 gene locus_tag LOCUS_08770 38017 35693 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_08770 39075 38014 gene locus_tag LOCUS_08780 39075 38014 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974996.1 protein_id gnl|my_center|LOCUS_08780 40546 39089 gene locus_tag LOCUS_08790 gene amrB 40546 39089 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_08790 40734 41837 gene locus_tag LOCUS_08800 gene amrS 40734 41837 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_08800 41996 42988 gene locus_tag LOCUS_08810 41996 42988 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_08810 43095 44630 gene locus_tag LOCUS_08820 43095 44630 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_08820 44635 45084 gene locus_tag LOCUS_08830 44635 45084 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_08830 45251 45844 gene locus_tag LOCUS_08840 45251 45844 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103233.1 protein_id gnl|my_center|LOCUS_08840 45874 46581 gene locus_tag LOCUS_08850 45874 46581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_08850 46590 47849 gene locus_tag LOCUS_08860 46590 47849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_08860 47870 48358 gene locus_tag LOCUS_08870 47870 48358 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105266.1 protein_id gnl|my_center|LOCUS_08870 49241 49011 gene locus_tag LOCUS_08880 49241 49011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 50845 49658 gene locus_tag LOCUS_08890 50845 49658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_08890 50960 51823 gene locus_tag LOCUS_08900 50960 51823 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704257.1 protein_id gnl|my_center|LOCUS_08900 51952 53010 gene locus_tag LOCUS_08910 51952 53010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 53257 53544 gene locus_tag LOCUS_08920 53257 53544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 53993 54313 gene locus_tag LOCUS_08930 53993 54313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 54325 54708 gene locus_tag LOCUS_08940 54325 54708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 55572 54766 gene locus_tag LOCUS_08950 55572 54766 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_08950 57451 55586 gene locus_tag LOCUS_08960 57451 55586 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_08960 57652 58074 gene locus_tag LOCUS_08970 gene ndk 57652 58074 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720049.1 protein_id gnl|my_center|LOCUS_08970 58879 58232 gene locus_tag LOCUS_08980 gene purN 58879 58232 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390017.1 protein_id gnl|my_center|LOCUS_08980 59988 58876 gene locus_tag LOCUS_08990 gene purM 59988 58876 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532445.1 protein_id gnl|my_center|LOCUS_08990 60577 60050 gene locus_tag LOCUS_09000 60577 60050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence012 338 895 gene locus_tag LOCUS_09010 338 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 892 1965 gene locus_tag LOCUS_09020 gene vexE 892 1965 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_09020 1962 5222 gene locus_tag LOCUS_09030 gene vmeK 1962 5222 CDS product multidrug efflux RND transporter permease subunit VmeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 protein_id gnl|my_center|LOCUS_09030 5318 5704 gene locus_tag LOCUS_09040 5318 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7430 5712 gene locus_tag LOCUS_09050 7430 5712 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944569.1 protein_id gnl|my_center|LOCUS_09050 8722 7427 gene locus_tag LOCUS_09060 8722 7427 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 protein_id gnl|my_center|LOCUS_09060 9387 8719 gene locus_tag LOCUS_09070 9387 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546704.1 protein_id gnl|my_center|LOCUS_09070 10532 9384 gene locus_tag LOCUS_09080 10532 9384 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 protein_id gnl|my_center|LOCUS_09080 11137 10622 gene locus_tag LOCUS_09090 11137 10622 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_09090 12017 11151 gene locus_tag LOCUS_09100 12017 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 12479 12024 gene locus_tag LOCUS_09110 12479 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12881 12537 gene locus_tag LOCUS_09120 12881 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 13498 12884 gene locus_tag LOCUS_09130 gene scpB 13498 12884 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389527.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09130 14292 13495 gene locus_tag LOCUS_09140 14292 13495 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_09140 14989 14300 gene locus_tag LOCUS_09150 14989 14300 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_09150 15999 14986 gene locus_tag LOCUS_09160 gene nagZ 15999 14986 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_09160 16900 16001 gene locus_tag LOCUS_09170 16900 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 18675 16900 gene locus_tag LOCUS_09180 gene argS 18675 16900 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389532.1 protein_id gnl|my_center|LOCUS_09180 19847 18672 gene locus_tag LOCUS_09190 19847 18672 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 protein_id gnl|my_center|LOCUS_09190 19999 20355 gene locus_tag LOCUS_09200 gene erpA 19999 20355 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_09200 22084 20372 gene locus_tag LOCUS_09210 22084 20372 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_09210 22248 23273 gene locus_tag LOCUS_09220 gene cobD 22248 23273 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_09220 23270 24637 gene locus_tag LOCUS_09230 23270 24637 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_09230 24654 26045 gene locus_tag LOCUS_09240 24654 26045 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_09240 26054 26677 gene locus_tag LOCUS_09250 26054 26677 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 protein_id gnl|my_center|LOCUS_09250 26687 27850 gene locus_tag LOCUS_09260 26687 27850 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_09260 27869 28495 gene locus_tag LOCUS_09270 27869 28495 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_09270 28521 28967 gene locus_tag LOCUS_09280 28521 28967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 31949 29262 gene locus_tag LOCUS_09290 31949 29262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 32437 34311 gene locus_tag LOCUS_09300 32437 34311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 35115 35321 gene locus_tag LOCUS_09310 35115 35321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 36091 35504 gene locus_tag LOCUS_09320 36091 35504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391022.1 protein_id gnl|my_center|LOCUS_09320 37101 36157 gene locus_tag LOCUS_09330 37101 36157 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391023.1 protein_id gnl|my_center|LOCUS_09330 38050 37103 gene locus_tag LOCUS_09340 gene argF 38050 37103 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470667.1 protein_id gnl|my_center|LOCUS_09340 39234 38047 gene locus_tag LOCUS_09350 39234 38047 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391025.1 protein_id gnl|my_center|LOCUS_09350 39388 40983 gene locus_tag LOCUS_09360 gene guaA 39388 40983 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388108.1 protein_id gnl|my_center|LOCUS_09360 41436 41008 gene locus_tag LOCUS_09370 41436 41008 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_09370 41669 41433 gene locus_tag LOCUS_09380 41669 41433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967281.1 protein_id gnl|my_center|LOCUS_09380 41833 41908 gene locus_tag LOCUS_t00120 41833 41908 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 42213 43007 gene locus_tag LOCUS_09390 42213 43007 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_09390 43102 43368 gene locus_tag LOCUS_09400 43102 43368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 44312 43407 gene locus_tag LOCUS_09410 44312 43407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 46795 44309 gene locus_tag LOCUS_09420 46795 44309 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_09420 47190 46792 gene locus_tag LOCUS_09430 47190 46792 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391329.1 protein_id gnl|my_center|LOCUS_09430 47265 47588 gene locus_tag LOCUS_09440 47265 47588 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_09440 48767 47790 gene locus_tag LOCUS_09450 48767 47790 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_09450 48655 48927 gene locus_tag LOCUS_09460 48655 48927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 49583 48876 gene locus_tag LOCUS_09470 49583 48876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 49881 49630 gene locus_tag LOCUS_09480 49881 49630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 51713 49878 gene locus_tag LOCUS_09490 51713 49878 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_09490 53350 51710 gene locus_tag LOCUS_09500 53350 51710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 53796 53347 gene locus_tag LOCUS_09510 53796 53347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 54913 53981 gene locus_tag LOCUS_09520 54913 53981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 56513 54888 gene locus_tag LOCUS_09530 56513 54888 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336811.1 protein_id gnl|my_center|LOCUS_09530 58011 56581 gene locus_tag LOCUS_09540 58011 56581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 59693 58011 gene locus_tag LOCUS_09550 59693 58011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 61399 59690 gene locus_tag LOCUS_09560 61399 59690 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence013 102 1259 gene locus_tag LOCUS_09570 gene hemW 102 1259 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338802.1 protein_id gnl|my_center|LOCUS_09570 1515 1243 gene locus_tag LOCUS_09580 1515 1243 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391512.1 protein_id gnl|my_center|LOCUS_09580 1617 2012 gene locus_tag LOCUS_09590 1617 2012 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_09590 2118 2555 gene locus_tag LOCUS_09600 2118 2555 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_09600 2708 4069 gene locus_tag LOCUS_09610 gene miaB 2708 4069 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_09610 4066 5130 gene locus_tag LOCUS_09620 4066 5130 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527906.1 protein_id gnl|my_center|LOCUS_09620 5096 5644 gene locus_tag LOCUS_09630 gene ybeY 5096 5644 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391519.1 protein_id gnl|my_center|LOCUS_09630 5641 6564 gene locus_tag LOCUS_09640 5641 6564 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_09640 6828 8456 gene locus_tag LOCUS_09650 gene lnt 6828 8456 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_09650 8641 9135 gene locus_tag LOCUS_09660 8641 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 9317 10492 gene locus_tag LOCUS_09670 gene metK 9317 10492 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_09670 10489 11208 gene locus_tag LOCUS_09680 gene trmB 10489 11208 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_09680 11304 11849 gene locus_tag LOCUS_09690 11304 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 11846 13432 gene locus_tag LOCUS_09700 gene nusA 11846 13432 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_09700 13440 14099 gene locus_tag LOCUS_09710 13440 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 14121 16715 gene locus_tag LOCUS_09720 gene infB 14121 16715 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626661.1 protein_id gnl|my_center|LOCUS_09720 16786 17178 gene locus_tag LOCUS_09730 16786 17178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 17168 18094 gene locus_tag LOCUS_09740 gene truB 17168 18094 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391530.1 protein_id gnl|my_center|LOCUS_09740 18111 18380 gene locus_tag LOCUS_09750 gene rpsO 18111 18380 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202929.1 protein_id gnl|my_center|LOCUS_09750 18554 20701 gene locus_tag LOCUS_09760 gene pnp 18554 20701 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391532.1 protein_id gnl|my_center|LOCUS_09760 20874 22271 gene locus_tag LOCUS_09770 20874 22271 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_09770 22421 22834 gene locus_tag LOCUS_09780 22421 22834 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_09780 23004 23423 gene locus_tag LOCUS_09790 23004 23423 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_09790 23548 24891 gene locus_tag LOCUS_09800 23548 24891 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_09800 24906 25493 gene locus_tag LOCUS_09810 24906 25493 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_09810 26004 25501 gene locus_tag LOCUS_09820 26004 25501 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391536.1 protein_id gnl|my_center|LOCUS_09820 26133 27125 gene locus_tag LOCUS_09830 26133 27125 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_09830 27559 27128 gene locus_tag LOCUS_09840 27559 27128 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 protein_id gnl|my_center|LOCUS_09840 28189 27740 gene locus_tag LOCUS_09850 28189 27740 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391539.1 protein_id gnl|my_center|LOCUS_09850 28985 28179 gene locus_tag LOCUS_09860 gene moeB 28985 28179 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_09860 30043 29042 gene locus_tag LOCUS_09870 gene cysK 30043 29042 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626663.1 protein_id gnl|my_center|LOCUS_09870 30581 30126 gene locus_tag LOCUS_09880 30581 30126 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_09880 31049 30588 gene locus_tag LOCUS_09890 gene dut 31049 30588 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_09890 32272 31046 gene locus_tag LOCUS_09900 gene coaBC 32272 31046 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391543.1 protein_id gnl|my_center|LOCUS_09900 33994 32462 gene locus_tag LOCUS_09910 gene ubiB 33994 32462 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391544.1 protein_id gnl|my_center|LOCUS_09910 34832 34038 gene locus_tag LOCUS_09920 gene ubiE 34832 34038 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626664.1 protein_id gnl|my_center|LOCUS_09920 34867 35706 gene locus_tag LOCUS_09930 gene mutM 34867 35706 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391546.1 protein_id gnl|my_center|LOCUS_09930 35722 36120 gene locus_tag LOCUS_09940 35722 36120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626665.1 protein_id gnl|my_center|LOCUS_09940 36143 36919 gene locus_tag LOCUS_09950 36143 36919 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_09950 37002 37268 gene locus_tag LOCUS_09960 gene rpsT 37002 37268 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391549.1 protein_id gnl|my_center|LOCUS_09960 37913 39331 gene locus_tag LOCUS_09970 gene dnaA 37913 39331 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_09970 39548 40663 gene locus_tag LOCUS_09980 gene dnaN 39548 40663 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_09980 40695 41936 gene locus_tag LOCUS_09990 gene recF 40695 41936 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387764.1 protein_id gnl|my_center|LOCUS_09990 41941 44427 gene locus_tag LOCUS_10000 gene gyrB 41941 44427 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387765.1 protein_id gnl|my_center|LOCUS_10000 44589 46526 gene locus_tag LOCUS_10010 44589 46526 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_10010 47268 46633 gene locus_tag LOCUS_10020 47268 46633 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173676.1 protein_id gnl|my_center|LOCUS_10020 48737 47265 gene locus_tag LOCUS_10030 gene rfaE1 48737 47265 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_10030 49312 48734 gene locus_tag LOCUS_10040 49312 48734 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_10040 51483 49333 gene locus_tag LOCUS_10050 51483 49333 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862490.1 protein_id gnl|my_center|LOCUS_10050 51581 53362 gene locus_tag LOCUS_10060 51581 53362 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_10060 53758 53366 gene locus_tag LOCUS_10070 53758 53366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 54877 53936 gene locus_tag LOCUS_10080 54877 53936 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391000.1 protein_id gnl|my_center|LOCUS_10080 55839 55084 gene locus_tag LOCUS_10090 55839 55084 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_10090 55926 57182 gene locus_tag LOCUS_10100 55926 57182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 57224 58498 gene locus_tag LOCUS_10110 57224 58498 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387885.1 protein_id gnl|my_center|LOCUS_10110 58524 59294 gene locus_tag LOCUS_10120 58524 59294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_10120 59291 60118 gene locus_tag LOCUS_10130 59291 60118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_10130 61407 60211 gene locus_tag LOCUS_10140 61407 60211 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence014 2003 567 gene locus_tag LOCUS_10150 2003 567 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667839.1 protein_id gnl|my_center|LOCUS_10150 2218 2790 gene locus_tag LOCUS_10160 2218 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2844 3044 gene locus_tag LOCUS_10170 2844 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3665 3054 gene locus_tag LOCUS_10180 3665 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3913 3662 gene locus_tag LOCUS_10190 3913 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 6000 4021 gene locus_tag LOCUS_10200 6000 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 6681 8144 gene locus_tag LOCUS_10210 6681 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 8282 8815 gene locus_tag LOCUS_10220 gene rpsF 8282 8815 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314574.1 protein_id gnl|my_center|LOCUS_10220 8812 9054 gene locus_tag LOCUS_10230 gene rpsR 8812 9054 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_10230 9103 10050 gene locus_tag LOCUS_10240 9103 10050 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086853.1 protein_id gnl|my_center|LOCUS_10240 10062 10748 gene locus_tag LOCUS_10250 10062 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 10866 12104 gene locus_tag LOCUS_10260 10866 12104 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_10260 12228 13721 gene locus_tag LOCUS_10270 12228 13721 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_10270 13902 14420 gene locus_tag LOCUS_10280 13902 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 14478 15623 gene locus_tag LOCUS_10290 gene alr 14478 15623 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388168.1 protein_id gnl|my_center|LOCUS_10290 15620 16393 gene locus_tag LOCUS_10300 15620 16393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_10300 16390 17166 gene locus_tag LOCUS_10310 16390 17166 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_10310 17203 17442 gene locus_tag LOCUS_10320 17203 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 17502 17825 gene locus_tag LOCUS_10330 17502 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 17822 18022 gene locus_tag LOCUS_10340 17822 18022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 18086 19522 gene locus_tag LOCUS_10350 gene radA 18086 19522 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_10350 19515 20213 gene locus_tag LOCUS_10360 19515 20213 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388164.1 protein_id gnl|my_center|LOCUS_10360 20380 21861 gene locus_tag LOCUS_10370 gene purF 20380 21861 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388163.1 protein_id gnl|my_center|LOCUS_10370 21864 22586 gene locus_tag LOCUS_10380 21864 22586 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_10380 23207 22623 gene locus_tag LOCUS_10390 23207 22623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 23280 24323 gene locus_tag LOCUS_10400 23280 24323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 25865 24354 gene locus_tag LOCUS_10410 25865 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 27217 25862 gene locus_tag LOCUS_10420 27217 25862 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 protein_id gnl|my_center|LOCUS_10420 28065 27307 gene locus_tag LOCUS_10430 28065 27307 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525366.1 protein_id gnl|my_center|LOCUS_10430 28380 29423 gene locus_tag LOCUS_10440 28380 29423 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975825.1 protein_id gnl|my_center|LOCUS_10440 29524 30636 gene locus_tag LOCUS_10450 29524 30636 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061794.1 protein_id gnl|my_center|LOCUS_10450 30649 32349 gene locus_tag LOCUS_10460 30649 32349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 32446 33006 gene locus_tag LOCUS_10470 32446 33006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384992.1 protein_id gnl|my_center|LOCUS_10470 33454 33945 gene locus_tag LOCUS_10480 33454 33945 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_10480 34069 34434 gene locus_tag LOCUS_10490 34069 34434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 35580 34462 gene locus_tag LOCUS_10500 gene ald 35580 34462 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261564.1 protein_id gnl|my_center|LOCUS_10500 35714 37024 gene locus_tag LOCUS_10510 35714 37024 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037403150.1 protein_id gnl|my_center|LOCUS_10510 37158 39227 gene locus_tag LOCUS_10520 37158 39227 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 protein_id gnl|my_center|LOCUS_10520 39234 39743 gene locus_tag LOCUS_10530 39234 39743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388863.1 protein_id gnl|my_center|LOCUS_10530 40126 39776 gene locus_tag LOCUS_10540 40126 39776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 41462 40176 gene locus_tag LOCUS_10550 41462 40176 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_10550 42466 41459 gene locus_tag LOCUS_10560 42466 41459 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_10560 43996 42632 gene locus_tag LOCUS_10570 gene prsR 43996 42632 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_10570 46143 43993 gene locus_tag LOCUS_10580 gene prsK 46143 43993 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_10580 47725 46277 gene locus_tag LOCUS_10590 47725 46277 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_10590 48942 47824 gene locus_tag LOCUS_10600 48942 47824 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_10600 49279 48998 gene locus_tag LOCUS_10610 49279 48998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 50370 49429 gene locus_tag LOCUS_10620 50370 49429 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_10620 50976 50623 gene locus_tag LOCUS_10630 50976 50623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 51446 52564 gene locus_tag LOCUS_10640 51446 52564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 53479 52625 gene locus_tag LOCUS_10650 53479 52625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 56629 53795 gene locus_tag LOCUS_10660 gene prsT 56629 53795 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390845.1 protein_id gnl|my_center|LOCUS_10660 56831 58000 gene locus_tag LOCUS_10670 gene fabD 56831 58000 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence015 309 109 gene locus_tag LOCUS_10680 309 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1454 618 gene locus_tag LOCUS_10690 1454 618 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_10690 1356 1571 gene locus_tag LOCUS_10700 1356 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1630 3102 gene locus_tag LOCUS_10710 1630 3102 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_10710 5130 3112 gene locus_tag LOCUS_10720 5130 3112 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389694.1 protein_id gnl|my_center|LOCUS_10720 5939 5139 gene locus_tag LOCUS_10730 5939 5139 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_10730 6763 5936 gene locus_tag LOCUS_10740 6763 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 8386 6779 gene locus_tag LOCUS_10750 8386 6779 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_10750 9240 8383 gene locus_tag LOCUS_10760 9240 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 9850 9248 gene locus_tag LOCUS_10770 9850 9248 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_10770 10415 9957 gene locus_tag LOCUS_10780 10415 9957 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_10780 11555 10416 gene locus_tag LOCUS_10790 11555 10416 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_10790 12243 11560 gene locus_tag LOCUS_10800 12243 11560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_10800 13152 12262 gene locus_tag LOCUS_10810 13152 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 14240 13152 gene locus_tag LOCUS_10820 14240 13152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 14754 14365 gene locus_tag LOCUS_10830 14754 14365 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_10830 15217 14747 gene locus_tag LOCUS_10840 15217 14747 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640072.1 protein_id gnl|my_center|LOCUS_10840 15535 15837 gene locus_tag LOCUS_10850 15535 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10850 15827 16201 gene locus_tag LOCUS_10860 15827 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 17370 16198 gene locus_tag LOCUS_10870 17370 16198 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_10870 18756 17533 gene locus_tag LOCUS_10880 18756 17533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 19227 18772 gene locus_tag LOCUS_10890 19227 18772 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_10890 20429 19224 gene locus_tag LOCUS_10900 20429 19224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_10900 20314 20523 gene locus_tag LOCUS_10910 20314 20523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 20953 20561 gene locus_tag LOCUS_10920 20953 20561 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389747.1 protein_id gnl|my_center|LOCUS_10920 22439 21030 gene locus_tag LOCUS_10930 gene mgtE 22439 21030 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_10930 22610 22524 gene locus_tag LOCUS_t00130 22610 22524 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22721 23377 gene locus_tag LOCUS_10940 gene lipB 22721 23377 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531111.1 protein_id gnl|my_center|LOCUS_10940 23457 24419 gene locus_tag LOCUS_10950 23457 24419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 24628 25578 gene locus_tag LOCUS_10960 24628 25578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 25920 25603 gene locus_tag LOCUS_10970 25920 25603 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390404.1 protein_id gnl|my_center|LOCUS_10970 26207 25917 gene locus_tag LOCUS_10980 26207 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 26155 26574 gene locus_tag LOCUS_10990 26155 26574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 27304 26582 gene locus_tag LOCUS_11000 27304 26582 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_11000 30256 27326 gene locus_tag LOCUS_11010 30256 27326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 30940 30260 gene locus_tag LOCUS_11020 30940 30260 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_11020 32131 31157 gene locus_tag LOCUS_11030 32131 31157 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_11030 32197 34128 gene locus_tag LOCUS_11040 32197 34128 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_11040 34577 34185 gene locus_tag LOCUS_11050 34577 34185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 34848 34588 gene locus_tag LOCUS_11060 34848 34588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 35001 35177 gene locus_tag LOCUS_11070 35001 35177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 36311 35151 gene locus_tag LOCUS_11080 36311 35151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 37309 41598 gene locus_tag LOCUS_11090 37309 41598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 41712 43205 gene locus_tag LOCUS_11100 41712 43205 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056367.1 protein_id gnl|my_center|LOCUS_11100 43259 43822 gene locus_tag LOCUS_11110 43259 43822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 45107 43845 gene locus_tag LOCUS_11120 45107 43845 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876398.1 protein_id gnl|my_center|LOCUS_11120 45223 45104 gene locus_tag LOCUS_11130 45223 45104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 45453 45220 gene locus_tag LOCUS_11140 45453 45220 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_11140 46827 45829 gene locus_tag LOCUS_11150 46827 45829 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_11150 48260 46971 gene locus_tag LOCUS_11160 48260 46971 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_11160 49651 48257 gene locus_tag LOCUS_11170 49651 48257 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_11170 50442 50008 gene locus_tag LOCUS_11180 gene rplQ 50442 50008 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390413.1 protein_id gnl|my_center|LOCUS_11180 51502 50486 gene locus_tag LOCUS_11190 51502 50486 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_11190 52023 51631 gene locus_tag LOCUS_11200 gene rpsK 52023 51631 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390415.1 protein_id gnl|my_center|LOCUS_11200 52367 52035 gene locus_tag LOCUS_11210 gene rpsM 52367 52035 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313984.1 protein_id gnl|my_center|LOCUS_11210 53174 52527 gene locus_tag LOCUS_11220 53174 52527 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 protein_id gnl|my_center|LOCUS_11220 54505 53171 gene locus_tag LOCUS_11230 gene secY 54505 53171 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_11230 55206 54568 gene locus_tag LOCUS_11240 55206 54568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 55430 55230 gene locus_tag LOCUS_11250 gene rpmD 55430 55230 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_11250 56031 55435 gene locus_tag LOCUS_11260 gene rpsE 56031 55435 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390421.1 protein_id gnl|my_center|LOCUS_11260 56400 56044 gene locus_tag LOCUS_11270 gene rplR 56400 56044 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390422.1 protein_id gnl|my_center|LOCUS_11270 56937 56404 gene locus_tag LOCUS_11280 gene rplF 56937 56404 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390423.1 protein_id gnl|my_center|LOCUS_11280 57359 56961 gene locus_tag LOCUS_11290 gene rpsH 57359 56961 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_11290 57678 57373 gene locus_tag LOCUS_11300 gene rpsN 57678 57373 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390425.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence016 1337 168 gene locus_tag LOCUS_11310 1337 168 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_11310 2388 1345 gene locus_tag LOCUS_11320 2388 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11320 3394 2438 gene locus_tag LOCUS_11330 3394 2438 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_11330 4349 3501 gene locus_tag LOCUS_11340 4349 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5967 4429 gene locus_tag LOCUS_11350 5967 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7087 5993 gene locus_tag LOCUS_11360 7087 5993 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390958.1 protein_id gnl|my_center|LOCUS_11360 7788 7162 gene locus_tag LOCUS_11370 7788 7162 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_11370 8198 8001 gene locus_tag LOCUS_11380 8198 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 8643 8446 gene locus_tag LOCUS_11390 8643 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 9502 8723 gene locus_tag LOCUS_11400 9502 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 9501 9896 gene locus_tag LOCUS_11410 9501 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389321.1 protein_id gnl|my_center|LOCUS_11410 11699 9927 gene locus_tag LOCUS_11420 11699 9927 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391207.1 protein_id gnl|my_center|LOCUS_11420 11805 12317 gene locus_tag LOCUS_11430 11805 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 12634 12936 gene locus_tag LOCUS_11440 12634 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 14361 12976 gene locus_tag LOCUS_11450 14361 12976 CDS product tetratricopeptide repeat-containing glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388308.1 protein_id gnl|my_center|LOCUS_11450 16788 14392 gene locus_tag LOCUS_11460 16788 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11460 17626 16814 gene locus_tag LOCUS_11470 gene otsB 17626 16814 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390302.1 protein_id gnl|my_center|LOCUS_11470 18407 17640 gene locus_tag LOCUS_11480 18407 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 18638 19516 gene locus_tag LOCUS_11490 18638 19516 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_11490 19870 19529 gene locus_tag LOCUS_11500 gene arsC 19870 19529 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 protein_id gnl|my_center|LOCUS_11500 20003 22243 gene locus_tag LOCUS_11510 20003 22243 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390820.1 protein_id gnl|my_center|LOCUS_11510 22258 23574 gene locus_tag LOCUS_11520 22258 23574 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391276.1 protein_id gnl|my_center|LOCUS_11520 23583 24386 gene locus_tag LOCUS_11530 23583 24386 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_11530 25988 24522 gene locus_tag LOCUS_11540 25988 24522 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_11540 27702 26104 gene locus_tag LOCUS_11550 27702 26104 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_11550 28574 27702 gene locus_tag LOCUS_11560 28574 27702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 28898 30082 gene locus_tag LOCUS_11570 28898 30082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 30103 30372 gene locus_tag LOCUS_11580 30103 30372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 30525 30896 gene locus_tag LOCUS_11590 gene trxA 30525 30896 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_11590 31670 30921 gene locus_tag LOCUS_11600 31670 30921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 32843 31773 gene locus_tag LOCUS_11610 32843 31773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_11610 32949 33857 gene locus_tag LOCUS_11620 32949 33857 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_11620 34682 33858 gene locus_tag LOCUS_11630 34682 33858 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626297.1 protein_id gnl|my_center|LOCUS_11630 35000 35479 gene locus_tag LOCUS_11640 35000 35479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 37455 35650 gene locus_tag LOCUS_11650 gene aspS 37455 35650 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_11650 37598 37807 gene locus_tag LOCUS_11660 37598 37807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 37804 38016 gene locus_tag LOCUS_11670 37804 38016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 38611 38042 gene locus_tag LOCUS_11680 38611 38042 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_11680 39783 38737 gene locus_tag LOCUS_11690 39783 38737 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_11690 39823 40005 gene locus_tag LOCUS_11700 39823 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 40349 41644 gene locus_tag LOCUS_11710 40349 41644 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_11710 41649 42443 gene locus_tag LOCUS_11720 41649 42443 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_11720 42709 42458 gene locus_tag LOCUS_11730 42709 42458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 42932 42714 gene locus_tag LOCUS_11740 42932 42714 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_11740 45279 43027 gene locus_tag LOCUS_11750 45279 43027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 45685 45461 gene locus_tag LOCUS_11760 gene rpmE 45685 45461 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388827.1 protein_id gnl|my_center|LOCUS_11760 45787 46119 gene locus_tag LOCUS_11770 45787 46119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 47433 46255 gene locus_tag LOCUS_11780 47433 46255 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_11780 48706 47531 gene locus_tag LOCUS_11790 48706 47531 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_11790 49954 48749 gene locus_tag LOCUS_11800 49954 48749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_11800 51002 49938 gene locus_tag LOCUS_11810 51002 49938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 51950 51144 gene locus_tag LOCUS_11820 51950 51144 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_11820 52532 51963 gene locus_tag LOCUS_11830 gene efp 52532 51963 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 protein_id gnl|my_center|LOCUS_11830 52715 52936 gene locus_tag LOCUS_11840 52715 52936 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_11840 52930 53277 gene locus_tag LOCUS_11850 gene mazF 52930 53277 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_11850 53614 53369 gene locus_tag LOCUS_11860 53614 53369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 54886 53618 gene locus_tag LOCUS_11870 54886 53618 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109254.1 protein_id gnl|my_center|LOCUS_11870 55325 54924 gene locus_tag LOCUS_11880 55325 54924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 55713 55345 gene locus_tag LOCUS_11890 55713 55345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 57318 55765 gene locus_tag LOCUS_11900 57318 55765 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence017 2150 372 gene locus_tag LOCUS_11910 2150 372 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_11910 3467 2235 gene locus_tag LOCUS_11920 gene chrA 3467 2235 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_11920 4491 3631 gene locus_tag LOCUS_11930 4491 3631 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_11930 5458 4541 gene locus_tag LOCUS_11940 5458 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 7316 5475 gene locus_tag LOCUS_11950 7316 5475 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_11950 7751 7446 gene locus_tag LOCUS_11960 7751 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 8362 7748 gene locus_tag LOCUS_11970 gene sigM 8362 7748 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_11970 8461 9096 gene locus_tag LOCUS_11980 8461 9096 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390755.1 protein_id gnl|my_center|LOCUS_11980 10324 9443 gene locus_tag LOCUS_11990 10324 9443 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205409.1 protein_id gnl|my_center|LOCUS_11990 10909 11073 gene locus_tag LOCUS_12000 10909 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 11346 12062 gene locus_tag LOCUS_12010 11346 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 12657 14252 gene locus_tag LOCUS_12020 gene pucC 12657 14252 CDS product light-harvesting complexes assembly protein PucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720481.1 protein_id gnl|my_center|LOCUS_12020 14152 14685 gene locus_tag LOCUS_12030 gene def 14152 14685 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070448.1 protein_id gnl|my_center|LOCUS_12030 15462 15298 gene locus_tag LOCUS_12040 15462 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 16179 15676 gene locus_tag LOCUS_12050 16179 15676 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243734.1 protein_id gnl|my_center|LOCUS_12050 16921 16196 gene locus_tag LOCUS_12060 16921 16196 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384660.1 protein_id gnl|my_center|LOCUS_12060 17084 18031 gene locus_tag LOCUS_12070 17084 18031 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967262.1 protein_id gnl|my_center|LOCUS_12070 18043 19077 gene locus_tag LOCUS_12080 18043 19077 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402582.1 protein_id gnl|my_center|LOCUS_12080 20069 19095 gene locus_tag LOCUS_12090 20069 19095 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244179.1 protein_id gnl|my_center|LOCUS_12090 20575 22392 gene locus_tag LOCUS_12100 gene edd 20575 22392 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538199.1 protein_id gnl|my_center|LOCUS_12100 22623 23267 gene locus_tag LOCUS_12110 gene eda 22623 23267 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719793.1 protein_id gnl|my_center|LOCUS_12110 24254 23385 gene locus_tag LOCUS_12120 24254 23385 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_12120 25148 24258 gene locus_tag LOCUS_12130 25148 24258 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_12130 26595 25267 gene locus_tag LOCUS_12140 26595 25267 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213190.1 protein_id gnl|my_center|LOCUS_12140 27736 26645 gene locus_tag LOCUS_12150 gene ugpC 27736 26645 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531923.1 protein_id gnl|my_center|LOCUS_12150 28959 28033 gene locus_tag LOCUS_12160 28959 28033 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_12160 29787 29005 gene locus_tag LOCUS_12170 29787 29005 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524357.1 protein_id gnl|my_center|LOCUS_12170 30965 29838 gene locus_tag LOCUS_12180 30965 29838 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109241.1 protein_id gnl|my_center|LOCUS_12180 31911 31213 gene locus_tag LOCUS_12190 31911 31213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 33665 31908 gene locus_tag LOCUS_12200 33665 31908 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089914.1 protein_id gnl|my_center|LOCUS_12200 35769 33679 gene locus_tag LOCUS_12210 35769 33679 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089915.1 protein_id gnl|my_center|LOCUS_12210 36263 35994 gene locus_tag LOCUS_12220 36263 35994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 37239 36253 gene locus_tag LOCUS_12230 37239 36253 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170938.1 protein_id gnl|my_center|LOCUS_12230 38343 37351 gene locus_tag LOCUS_12240 38343 37351 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186852.1 protein_id gnl|my_center|LOCUS_12240 39725 38415 gene locus_tag LOCUS_12250 39725 38415 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039977.1 protein_id gnl|my_center|LOCUS_12250 40265 39735 gene locus_tag LOCUS_12260 40265 39735 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811094.1 protein_id gnl|my_center|LOCUS_12260 41300 40317 gene locus_tag LOCUS_12270 41300 40317 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 protein_id gnl|my_center|LOCUS_12270 43150 41657 gene locus_tag LOCUS_12280 43150 41657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 44013 43147 gene locus_tag LOCUS_12290 44013 43147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 45249 44227 gene locus_tag LOCUS_12300 45249 44227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 47953 45371 gene locus_tag LOCUS_12310 47953 45371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 48374 48000 gene locus_tag LOCUS_12320 48374 48000 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_12320 51964 48398 gene locus_tag LOCUS_12330 51964 48398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12330 50123 50198 gene locus_tag LOCUS_t00140 50123 50198 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 52435 51986 gene locus_tag LOCUS_12340 52435 51986 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_12340 52919 52554 gene locus_tag LOCUS_12350 52919 52554 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_12350 54510 53017 gene locus_tag LOCUS_12360 54510 53017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 55484 54510 gene locus_tag LOCUS_12370 55484 54510 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881132.1 protein_id gnl|my_center|LOCUS_12370 <56178 55502 gene locus_tag LOCUS_12380 <56178 55502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:PAS domain S-box protein >Feature sequence018 3065 1188 gene locus_tag LOCUS_12390 gene asnB 3065 1188 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_12390 4049 3072 gene locus_tag LOCUS_12400 4049 3072 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_12400 4935 4102 gene locus_tag LOCUS_12410 4935 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7141 5615 gene locus_tag LOCUS_12420 7141 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 7288 9216 gene locus_tag LOCUS_12430 7288 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 9256 10449 gene locus_tag LOCUS_12440 9256 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 10451 12478 gene locus_tag LOCUS_12450 gene asnB 10451 12478 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_12450 13456 12578 gene locus_tag LOCUS_12460 13456 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 14499 13522 gene locus_tag LOCUS_12470 14499 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 14702 15940 gene locus_tag LOCUS_12480 14702 15940 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_12480 16053 17819 gene locus_tag LOCUS_12490 16053 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 17981 18652 gene locus_tag LOCUS_12500 17981 18652 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_12500 22654 18689 gene locus_tag LOCUS_12510 22654 18689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 26519 22734 gene locus_tag LOCUS_12520 26519 22734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 29239 26816 gene locus_tag LOCUS_12530 gene glgB 29239 26816 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_12530 29581 32139 gene locus_tag LOCUS_12540 29581 32139 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_12540 33472 32210 gene locus_tag LOCUS_12550 33472 32210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_12550 34268 33474 gene locus_tag LOCUS_12560 34268 33474 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_12560 36598 34265 gene locus_tag LOCUS_12570 36598 34265 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_12570 42819 36703 gene locus_tag LOCUS_12580 42819 36703 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105031.1 protein_id gnl|my_center|LOCUS_12580 42953 43780 gene locus_tag LOCUS_12590 42953 43780 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_12590 43824 45404 gene locus_tag LOCUS_12600 43824 45404 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_12600 47665 45416 gene locus_tag LOCUS_12610 47665 45416 CDS product cyclic nucleotide-binding and patatin-like phospholipase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390858.1 protein_id gnl|my_center|LOCUS_12610 49296 47857 gene locus_tag LOCUS_12620 49296 47857 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_12620 49407 50192 gene locus_tag LOCUS_12630 49407 50192 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389242.1 protein_id gnl|my_center|LOCUS_12630 50298 51239 gene locus_tag LOCUS_12640 50298 51239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 51362 51784 gene locus_tag LOCUS_12650 gene apaG 51362 51784 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970890.1 protein_id gnl|my_center|LOCUS_12650 51892 52533 gene locus_tag LOCUS_12660 gene folE 51892 52533 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_12660 52668 54116 gene locus_tag LOCUS_12670 52668 54116 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114825.1 protein_id gnl|my_center|LOCUS_12670 54149 54445 gene locus_tag LOCUS_12680 54149 54445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 54625 54464 gene locus_tag LOCUS_12690 54625 54464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence019 1281 103 gene locus_tag LOCUS_12700 1281 103 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 protein_id gnl|my_center|LOCUS_12700 1536 3947 gene locus_tag LOCUS_12710 1536 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 4585 3968 gene locus_tag LOCUS_12720 4585 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 5745 4630 gene locus_tag LOCUS_12730 gene mnmA 5745 4630 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337613.1 protein_id gnl|my_center|LOCUS_12730 6465 5782 gene locus_tag LOCUS_12740 6465 5782 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389778.1 protein_id gnl|my_center|LOCUS_12740 6662 6462 gene locus_tag LOCUS_12750 gene iscX 6662 6462 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_12750 7038 6694 gene locus_tag LOCUS_12760 7038 6694 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_12760 8960 7035 gene locus_tag LOCUS_12770 gene hscA 8960 7035 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_12770 9619 8957 gene locus_tag LOCUS_12780 9619 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 10041 9721 gene locus_tag LOCUS_12790 10041 9721 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597725.1 protein_id gnl|my_center|LOCUS_12790 10506 10099 gene locus_tag LOCUS_12800 gene iscU 10506 10099 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703172.1 protein_id gnl|my_center|LOCUS_12800 11833 10550 gene locus_tag LOCUS_12810 11833 10550 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_12810 12990 11872 gene locus_tag LOCUS_12820 12990 11872 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_12820 13529 13041 gene locus_tag LOCUS_12830 13529 13041 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_12830 14329 13571 gene locus_tag LOCUS_12840 gene cysE 14329 13571 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_12840 14616 15263 gene locus_tag LOCUS_12850 14616 15263 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_12850 16538 15450 gene locus_tag LOCUS_12860 16538 15450 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_12860 16649 17902 gene locus_tag LOCUS_12870 gene tyrS 16649 17902 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_12870 21280 17939 gene locus_tag LOCUS_12880 21280 17939 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_12880 21383 24394 gene locus_tag LOCUS_12890 21383 24394 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 protein_id gnl|my_center|LOCUS_12890 24613 24431 gene locus_tag LOCUS_12900 24613 24431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 24886 25326 gene locus_tag LOCUS_12910 24886 25326 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025263.1 protein_id gnl|my_center|LOCUS_12910 25433 26029 gene locus_tag LOCUS_12920 gene fliL 25433 26029 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088569.1 protein_id gnl|my_center|LOCUS_12920 26995 26039 gene locus_tag LOCUS_12930 gene prfB 26995 26039 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12930 27289 27465 gene locus_tag LOCUS_12940 27289 27465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 29898 27466 gene locus_tag LOCUS_12950 29898 27466 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_12950 31374 30004 gene locus_tag LOCUS_12960 31374 30004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 31644 34157 gene locus_tag LOCUS_12970 31644 34157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 35375 34227 gene locus_tag LOCUS_12980 35375 34227 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626375.1 protein_id gnl|my_center|LOCUS_12980 37050 35398 gene locus_tag LOCUS_12990 37050 35398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 35861 35953 gene locus_tag LOCUS_t00150 35861 35953 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37031 38392 gene locus_tag LOCUS_13000 37031 38392 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 protein_id gnl|my_center|LOCUS_13000 37076 37151 gene locus_tag LOCUS_t00160 37076 37151 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38389 39105 gene locus_tag LOCUS_13010 38389 39105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 39223 39987 gene locus_tag LOCUS_13020 39223 39987 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_13020 40101 40646 gene locus_tag LOCUS_13030 40101 40646 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390533.1 protein_id gnl|my_center|LOCUS_13030 41389 40673 gene locus_tag LOCUS_13040 41389 40673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 42336 41590 gene locus_tag LOCUS_13050 42336 41590 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975294.1 protein_id gnl|my_center|LOCUS_13050 44804 42447 gene locus_tag LOCUS_13060 44804 42447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 44878 46311 gene locus_tag LOCUS_13070 gene tldD 44878 46311 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_13070 46826 46308 gene locus_tag LOCUS_13080 46826 46308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 46882 47448 gene locus_tag LOCUS_13090 46882 47448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 47560 49557 gene locus_tag LOCUS_13100 47560 49557 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_13100 49623 50822 gene locus_tag LOCUS_13110 49623 50822 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114098.1 protein_id gnl|my_center|LOCUS_13110 50876 51349 gene locus_tag LOCUS_13120 50876 51349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 52147 51359 gene locus_tag LOCUS_13130 52147 51359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 53023 52316 gene locus_tag LOCUS_13140 53023 52316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13140 53064 53567 gene locus_tag LOCUS_13150 53064 53567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 53636 53914 gene locus_tag LOCUS_13160 53636 53914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence020 1127 246 gene locus_tag LOCUS_13170 1127 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2321 1512 gene locus_tag LOCUS_13180 2321 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 3607 2519 gene locus_tag LOCUS_13190 3607 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4053 5873 gene locus_tag LOCUS_13200 4053 5873 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_13200 5833 6369 gene locus_tag LOCUS_13210 gene moaB 5833 6369 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_13210 6880 6392 gene locus_tag LOCUS_13220 6880 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 8225 7059 gene locus_tag LOCUS_13230 8225 7059 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_13230 8930 8304 gene locus_tag LOCUS_13240 8930 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 9686 9078 gene locus_tag LOCUS_13250 9686 9078 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_13250 10415 9693 gene locus_tag LOCUS_13260 10415 9693 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_13260 10615 11226 gene locus_tag LOCUS_13270 10615 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 11259 12344 gene locus_tag LOCUS_13280 11259 12344 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_13280 12350 13153 gene locus_tag LOCUS_13290 12350 13153 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073550.1 protein_id gnl|my_center|LOCUS_13290 13421 13137 gene locus_tag LOCUS_13300 13421 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 14496 13468 gene locus_tag LOCUS_13310 14496 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 15467 14595 gene locus_tag LOCUS_13320 15467 14595 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_13320 16318 15464 gene locus_tag LOCUS_13330 16318 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 16566 16315 gene locus_tag LOCUS_13340 16566 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 18098 16842 gene locus_tag LOCUS_13350 18098 16842 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_13350 19449 18190 gene locus_tag LOCUS_13360 gene glmL 19449 18190 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583701.1 protein_id gnl|my_center|LOCUS_13360 20858 19446 gene locus_tag LOCUS_13370 20858 19446 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680091.1 protein_id gnl|my_center|LOCUS_13370 21264 20839 gene locus_tag LOCUS_13380 gene glmS 21264 20839 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_13380 22868 21300 gene locus_tag LOCUS_13390 22868 21300 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551903.1 protein_id gnl|my_center|LOCUS_13390 23671 23027 gene locus_tag LOCUS_13400 23671 23027 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112753.1 protein_id gnl|my_center|LOCUS_13400 23945 23706 gene locus_tag LOCUS_13410 23945 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 24781 24011 gene locus_tag LOCUS_13420 24781 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 25350 26945 gene locus_tag LOCUS_13430 25350 26945 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551903.1 protein_id gnl|my_center|LOCUS_13430 26942 28180 gene locus_tag LOCUS_13440 26942 28180 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_13440 30013 28211 gene locus_tag LOCUS_13450 gene asnB 30013 28211 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_13450 31257 30160 gene locus_tag LOCUS_13460 31257 30160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 34260 31501 gene locus_tag LOCUS_13470 34260 31501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_13470 34534 34274 gene locus_tag LOCUS_13480 34534 34274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 36698 34581 gene locus_tag LOCUS_13490 36698 34581 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_13490 37090 36716 gene locus_tag LOCUS_13500 37090 36716 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 protein_id gnl|my_center|LOCUS_13500 37496 39178 gene locus_tag LOCUS_13510 gene ettA 37496 39178 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_13510 39211 40746 gene locus_tag LOCUS_13520 39211 40746 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390363.1 protein_id gnl|my_center|LOCUS_13520 40836 41702 gene locus_tag LOCUS_13530 40836 41702 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_13530 41845 42621 gene locus_tag LOCUS_13540 41845 42621 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390265.1 protein_id gnl|my_center|LOCUS_13540 43099 42686 gene locus_tag LOCUS_13550 43099 42686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 44064 44855 gene locus_tag LOCUS_13560 44064 44855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 46035 44902 gene locus_tag LOCUS_13570 46035 44902 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140150.1 protein_id gnl|my_center|LOCUS_13570 46200 46388 gene locus_tag LOCUS_13580 46200 46388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 47485 46781 gene locus_tag LOCUS_13590 47485 46781 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552039.1 protein_id gnl|my_center|LOCUS_13590 47637 47562 gene locus_tag LOCUS_t00170 47637 47562 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 48957 47701 gene locus_tag LOCUS_13600 48957 47701 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807983.1 protein_id gnl|my_center|LOCUS_13600 49352 49050 gene locus_tag LOCUS_13610 49352 49050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 49485 49865 gene locus_tag LOCUS_13620 49485 49865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 50803 49883 gene locus_tag LOCUS_13630 50803 49883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 51080 50895 gene locus_tag LOCUS_13640 51080 50895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 51465 53423 gene locus_tag LOCUS_13650 51465 53423 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390754.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence021 <1 5136 gene locus_tag LOCUS_13660 <1 5136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975001.1:calcium-binding protein 6474 5287 gene locus_tag LOCUS_13670 gene nrfD 6474 5287 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_13670 7265 6474 gene locus_tag LOCUS_13680 7265 6474 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_13680 7817 7332 gene locus_tag LOCUS_13690 7817 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 9331 7931 gene locus_tag LOCUS_13700 9331 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 12045 9430 gene locus_tag LOCUS_13710 12045 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 11996 12172 gene locus_tag LOCUS_13720 11996 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 12418 13323 gene locus_tag LOCUS_13730 12418 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 13395 14147 gene locus_tag LOCUS_13740 13395 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 14234 15145 gene locus_tag LOCUS_13750 14234 15145 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_13750 15903 15169 gene locus_tag LOCUS_13760 15903 15169 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 protein_id gnl|my_center|LOCUS_13760 18510 15982 gene locus_tag LOCUS_13770 18510 15982 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_13770 19217 18507 gene locus_tag LOCUS_13780 19217 18507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_13780 19307 19927 gene locus_tag LOCUS_13790 19307 19927 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_13790 19972 21087 gene locus_tag LOCUS_13800 19972 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 21131 21673 gene locus_tag LOCUS_13810 gene thpR 21131 21673 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337456.1 protein_id gnl|my_center|LOCUS_13810 22353 21634 gene locus_tag LOCUS_13820 22353 21634 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_13820 23200 22346 gene locus_tag LOCUS_13830 23200 22346 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 protein_id gnl|my_center|LOCUS_13830 23622 23197 gene locus_tag LOCUS_13840 23622 23197 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930569.1 protein_id gnl|my_center|LOCUS_13840 23757 24482 gene locus_tag LOCUS_13850 gene cobB 23757 24482 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_13850 24841 25425 gene locus_tag LOCUS_13860 24841 25425 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_13860 25496 26950 gene locus_tag LOCUS_13870 25496 26950 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_13870 27902 26988 gene locus_tag LOCUS_13880 27902 26988 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338391.1 protein_id gnl|my_center|LOCUS_13880 28360 27914 gene locus_tag LOCUS_13890 gene dtd 28360 27914 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_13890 29592 28384 gene locus_tag LOCUS_13900 29592 28384 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626653.1 protein_id gnl|my_center|LOCUS_13900 30398 29676 gene locus_tag LOCUS_13910 30398 29676 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895526.1 protein_id gnl|my_center|LOCUS_13910 31045 30395 gene locus_tag LOCUS_13920 31045 30395 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819982.1 protein_id gnl|my_center|LOCUS_13920 31761 31180 gene locus_tag LOCUS_13930 31761 31180 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_13930 32995 31787 gene locus_tag LOCUS_13940 gene rlmN 32995 31787 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_13940 33571 33059 gene locus_tag LOCUS_13950 33571 33059 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_13950 34170 33604 gene locus_tag LOCUS_13960 34170 33604 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_13960 34250 35224 gene locus_tag LOCUS_13970 34250 35224 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391118.1 protein_id gnl|my_center|LOCUS_13970 35221 36480 gene locus_tag LOCUS_13980 35221 36480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 37118 36624 gene locus_tag LOCUS_13990 37118 36624 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531618.1 protein_id gnl|my_center|LOCUS_13990 38317 37118 gene locus_tag LOCUS_14000 38317 37118 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_14000 38220 38435 gene locus_tag LOCUS_14010 38220 38435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 38782 39054 gene locus_tag LOCUS_14020 38782 39054 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_14020 39185 40846 gene locus_tag LOCUS_14030 39185 40846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 40849 41097 gene locus_tag LOCUS_14040 40849 41097 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389170.1 protein_id gnl|my_center|LOCUS_14040 41358 41092 gene locus_tag LOCUS_14050 41358 41092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 41357 42697 gene locus_tag LOCUS_14060 41357 42697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 43832 42933 gene locus_tag LOCUS_14070 43832 42933 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_14070 44924 44271 gene locus_tag LOCUS_14080 44924 44271 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389730.1 protein_id gnl|my_center|LOCUS_14080 46768 44924 gene locus_tag LOCUS_14090 46768 44924 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389731.1 protein_id gnl|my_center|LOCUS_14090 47553 49082 gene locus_tag LOCUS_14100 47553 49082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 49547 50116 gene locus_tag LOCUS_14110 49547 50116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 50223 50963 gene locus_tag LOCUS_14120 50223 50963 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_14120 51532 51062 gene locus_tag LOCUS_14130 51532 51062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 52749 52495 gene locus_tag LOCUS_14140 52749 52495 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390667.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence022 <1 2299 gene locus_tag LOCUS_14150 <1 2299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339403.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase 2814 2485 gene locus_tag LOCUS_14160 2814 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3139 3396 gene locus_tag LOCUS_14170 3139 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 3572 4279 gene locus_tag LOCUS_14180 3572 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 4851 4255 gene locus_tag LOCUS_14190 4851 4255 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529391.1 protein_id gnl|my_center|LOCUS_14190 5753 4848 gene locus_tag LOCUS_14200 5753 4848 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_14200 5861 7003 gene locus_tag LOCUS_14210 5861 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 7078 7713 gene locus_tag LOCUS_14220 7078 7713 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_14220 8622 7729 gene locus_tag LOCUS_14230 8622 7729 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_14230 9677 8619 gene locus_tag LOCUS_14240 gene hisC 9677 8619 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391012.1 protein_id gnl|my_center|LOCUS_14240 10570 9704 gene locus_tag LOCUS_14250 10570 9704 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_14250 10753 11934 gene locus_tag LOCUS_14260 10753 11934 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_14260 11947 12570 gene locus_tag LOCUS_14270 gene metW 11947 12570 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_14270 13311 12583 gene locus_tag LOCUS_14280 13311 12583 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391017.1 protein_id gnl|my_center|LOCUS_14280 13381 14151 gene locus_tag LOCUS_14290 gene gloB 13381 14151 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_14290 14206 14814 gene locus_tag LOCUS_14300 14206 14814 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 protein_id gnl|my_center|LOCUS_14300 14881 15522 gene locus_tag LOCUS_14310 14881 15522 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 protein_id gnl|my_center|LOCUS_14310 16464 15556 gene locus_tag LOCUS_14320 16464 15556 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 protein_id gnl|my_center|LOCUS_14320 17449 16553 gene locus_tag LOCUS_14330 17449 16553 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_14330 17750 18382 gene locus_tag LOCUS_14340 gene phaR 17750 18382 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_14340 19057 19464 gene locus_tag LOCUS_14350 19057 19464 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388031.1 protein_id gnl|my_center|LOCUS_14350 20334 19534 gene locus_tag LOCUS_14360 20334 19534 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_14360 20499 21719 gene locus_tag LOCUS_14370 20499 21719 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_14370 22425 21727 gene locus_tag LOCUS_14380 22425 21727 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390386.1 protein_id gnl|my_center|LOCUS_14380 22569 23036 gene locus_tag LOCUS_14390 22569 23036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 23876 23040 gene locus_tag LOCUS_14400 23876 23040 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 protein_id gnl|my_center|LOCUS_14400 25548 23881 gene locus_tag LOCUS_14410 25548 23881 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 protein_id gnl|my_center|LOCUS_14410 26825 25785 gene locus_tag LOCUS_14420 gene queG 26825 25785 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_14420 26724 27383 gene locus_tag LOCUS_14430 26724 27383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 27775 28311 gene locus_tag LOCUS_14440 27775 28311 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838770.1 protein_id gnl|my_center|LOCUS_14440 28649 30073 gene locus_tag LOCUS_14450 28649 30073 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390106.1 protein_id gnl|my_center|LOCUS_14450 31132 30224 gene locus_tag LOCUS_14460 31132 30224 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_14460 32613 31129 gene locus_tag LOCUS_14470 32613 31129 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_14470 33455 32628 gene locus_tag LOCUS_14480 gene pssA 33455 32628 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_14480 34157 33468 gene locus_tag LOCUS_14490 34157 33468 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_14490 35188 34175 gene locus_tag LOCUS_14500 35188 34175 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 protein_id gnl|my_center|LOCUS_14500 36303 35251 gene locus_tag LOCUS_14510 36303 35251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 37251 36373 gene locus_tag LOCUS_14520 37251 36373 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_14520 37750 37298 gene locus_tag LOCUS_14530 37750 37298 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389911.1 protein_id gnl|my_center|LOCUS_14530 37915 38499 gene locus_tag LOCUS_14540 37915 38499 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_14540 38558 38830 gene locus_tag LOCUS_14550 38558 38830 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_14550 38823 39236 gene locus_tag LOCUS_14560 38823 39236 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651037.1 protein_id gnl|my_center|LOCUS_14560 39379 40593 gene locus_tag LOCUS_14570 39379 40593 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_14570 40842 40618 gene locus_tag LOCUS_14580 40842 40618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 41039 41335 gene locus_tag LOCUS_14590 41039 41335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 42297 41446 gene locus_tag LOCUS_14600 42297 41446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 43353 42373 gene locus_tag LOCUS_14610 43353 42373 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918557.1 protein_id gnl|my_center|LOCUS_14610 43478 44056 gene locus_tag LOCUS_14620 43478 44056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 44622 45593 gene locus_tag LOCUS_14630 44622 45593 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 protein_id gnl|my_center|LOCUS_14630 46290 45700 gene locus_tag LOCUS_14640 46290 45700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 47392 46262 gene locus_tag LOCUS_14650 47392 46262 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832172.1 protein_id gnl|my_center|LOCUS_14650 48549 47398 gene locus_tag LOCUS_14660 48549 47398 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_14660 48634 49314 gene locus_tag LOCUS_14670 48634 49314 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_14670 49311 50510 gene locus_tag LOCUS_14680 49311 50510 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941380.1 protein_id gnl|my_center|LOCUS_14680 50507 51808 gene locus_tag LOCUS_14690 50507 51808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence023 729 169 gene locus_tag LOCUS_14700 729 169 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_14700 1238 726 gene locus_tag LOCUS_14710 1238 726 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391244.1 protein_id gnl|my_center|LOCUS_14710 1869 1288 gene locus_tag LOCUS_14720 1869 1288 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_14720 2430 1888 gene locus_tag LOCUS_14730 2430 1888 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104495.1 protein_id gnl|my_center|LOCUS_14730 3353 2427 gene locus_tag LOCUS_14740 3353 2427 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626403.1 protein_id gnl|my_center|LOCUS_14740 3520 3594 gene locus_tag LOCUS_t00180 3520 3594 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3942 4958 gene locus_tag LOCUS_14750 gene nirJ2 3942 4958 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460177.1 protein_id gnl|my_center|LOCUS_14750 4967 5941 gene locus_tag LOCUS_14760 4967 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 6243 6995 gene locus_tag LOCUS_14770 6243 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 7141 8181 gene locus_tag LOCUS_14780 7141 8181 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387999.1 protein_id gnl|my_center|LOCUS_14780 8178 8891 gene locus_tag LOCUS_14790 8178 8891 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387998.1 protein_id gnl|my_center|LOCUS_14790 9347 8898 gene locus_tag LOCUS_14800 9347 8898 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087415.1 protein_id gnl|my_center|LOCUS_14800 9552 11027 gene locus_tag LOCUS_14810 gene guaB 9552 11027 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387997.1 protein_id gnl|my_center|LOCUS_14810 11073 12410 gene locus_tag LOCUS_14820 11073 12410 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_14820 12521 12997 gene locus_tag LOCUS_14830 12521 12997 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387802.1 protein_id gnl|my_center|LOCUS_14830 12963 13871 gene locus_tag LOCUS_14840 12963 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 13868 14791 gene locus_tag LOCUS_14850 13868 14791 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970180.1 protein_id gnl|my_center|LOCUS_14850 14870 15556 gene locus_tag LOCUS_14860 14870 15556 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_14860 15568 16893 gene locus_tag LOCUS_14870 15568 16893 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_14870 17595 16903 gene locus_tag LOCUS_14880 17595 16903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 17737 18693 gene locus_tag LOCUS_14890 17737 18693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 18719 19648 gene locus_tag LOCUS_14900 18719 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 19804 20061 gene locus_tag LOCUS_14910 19804 20061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 20484 20197 gene locus_tag LOCUS_14920 20484 20197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 21559 20477 gene locus_tag LOCUS_14930 21559 20477 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_14930 21694 23544 gene locus_tag LOCUS_14940 gene treZ 21694 23544 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_14940 23707 24693 gene locus_tag LOCUS_14950 23707 24693 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032931383.1 protein_id gnl|my_center|LOCUS_14950 25986 24739 gene locus_tag LOCUS_14960 25986 24739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 26967 28796 gene locus_tag LOCUS_14970 26967 28796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 31166 29034 gene locus_tag LOCUS_14980 gene glgX 31166 29034 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_14980 32325 31159 gene locus_tag LOCUS_14990 32325 31159 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931414.1 protein_id gnl|my_center|LOCUS_14990 34502 32340 gene locus_tag LOCUS_15000 34502 32340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 34682 35077 gene locus_tag LOCUS_15010 34682 35077 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941703.1 protein_id gnl|my_center|LOCUS_15010 35504 35088 gene locus_tag LOCUS_15020 gene msrB 35504 35088 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_15020 35637 36122 gene locus_tag LOCUS_15030 35637 36122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 36394 36669 gene locus_tag LOCUS_15040 36394 36669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 36679 37020 gene locus_tag LOCUS_15050 36679 37020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 37211 37447 gene locus_tag LOCUS_15060 37211 37447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 39287 37650 gene locus_tag LOCUS_15070 39287 37650 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965432.1 protein_id gnl|my_center|LOCUS_15070 40196 39474 gene locus_tag LOCUS_15080 gene rquA 40196 39474 CDS product rhodoquinone biosynthesis methyltransferase RquA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_15080 40655 40308 gene locus_tag LOCUS_15090 40655 40308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 40860 41054 gene locus_tag LOCUS_15100 40860 41054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 42219 41266 gene locus_tag LOCUS_15110 42219 41266 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391485.1 protein_id gnl|my_center|LOCUS_15110 44033 42216 gene locus_tag LOCUS_15120 44033 42216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153339851.1 protein_id gnl|my_center|LOCUS_15120 44154 44014 gene locus_tag LOCUS_15130 44154 44014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 44340 44906 gene locus_tag LOCUS_15140 44340 44906 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_15140 44903 46027 gene locus_tag LOCUS_15150 gene aroB 44903 46027 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391488.1 protein_id gnl|my_center|LOCUS_15150 46037 47332 gene locus_tag LOCUS_15160 46037 47332 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_15160 47439 47885 gene locus_tag LOCUS_15170 47439 47885 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_15170 47894 48442 gene locus_tag LOCUS_15180 47894 48442 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_15180 48852 48469 gene locus_tag LOCUS_15190 48852 48469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 49300 49022 gene locus_tag LOCUS_15200 49300 49022 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_15200 49347 50336 gene locus_tag LOCUS_15210 49347 50336 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085684.1 protein_id gnl|my_center|LOCUS_15210 50412 50996 gene locus_tag LOCUS_15220 50412 50996 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence024 75 1 gene locus_tag LOCUS_t00190 75 1 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 190 678 gene locus_tag LOCUS_15230 190 678 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330108.1 protein_id gnl|my_center|LOCUS_15230 772 1701 gene locus_tag LOCUS_15240 772 1701 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391458.1 protein_id gnl|my_center|LOCUS_15240 1698 2375 gene locus_tag LOCUS_15250 1698 2375 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_15250 2383 2610 gene locus_tag LOCUS_15260 2383 2610 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083431.1 protein_id gnl|my_center|LOCUS_15260 2607 2981 gene locus_tag LOCUS_15270 2607 2981 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_15270 4247 3006 gene locus_tag LOCUS_15280 4247 3006 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_15280 4584 4922 gene locus_tag LOCUS_15290 4584 4922 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_15290 4935 6236 gene locus_tag LOCUS_15300 4935 6236 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388884.1 protein_id gnl|my_center|LOCUS_15300 6539 7771 gene locus_tag LOCUS_15310 6539 7771 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_15310 7833 10190 gene locus_tag LOCUS_15320 7833 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 10180 10845 gene locus_tag LOCUS_15330 10180 10845 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391445.1 protein_id gnl|my_center|LOCUS_15330 11766 11077 gene locus_tag LOCUS_15340 11766 11077 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505216.1 protein_id gnl|my_center|LOCUS_15340 11938 13107 gene locus_tag LOCUS_15350 gene ribA 11938 13107 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_15350 13269 14093 gene locus_tag LOCUS_15360 13269 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 14098 14604 gene locus_tag LOCUS_15370 14098 14604 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_15370 15292 14585 gene locus_tag LOCUS_15380 15292 14585 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626629.1 protein_id gnl|my_center|LOCUS_15380 15320 15964 gene locus_tag LOCUS_15390 15320 15964 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_15390 17162 16017 gene locus_tag LOCUS_15400 17162 16017 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626331.1 protein_id gnl|my_center|LOCUS_15400 17602 18171 gene locus_tag LOCUS_15410 17602 18171 CDS product DUF3576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391379.1 protein_id gnl|my_center|LOCUS_15410 18251 20824 gene locus_tag LOCUS_15420 gene leuS 18251 20824 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391378.1 protein_id gnl|my_center|LOCUS_15420 20811 21335 gene locus_tag LOCUS_15430 gene lptE 20811 21335 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391377.1 protein_id gnl|my_center|LOCUS_15430 21332 22354 gene locus_tag LOCUS_15440 gene holA 21332 22354 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_15440 23505 22375 gene locus_tag LOCUS_15450 23505 22375 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_15450 24326 23505 gene locus_tag LOCUS_15460 24326 23505 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_15460 24978 24304 gene locus_tag LOCUS_15470 gene rsmG 24978 24304 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391373.1 protein_id gnl|my_center|LOCUS_15470 26867 24990 gene locus_tag LOCUS_15480 gene mnmG 26867 24990 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391372.1 protein_id gnl|my_center|LOCUS_15480 28262 26931 gene locus_tag LOCUS_15490 gene mnmE 28262 26931 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 protein_id gnl|my_center|LOCUS_15490 28645 28301 gene locus_tag LOCUS_15500 28645 28301 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_15500 28905 28642 gene locus_tag LOCUS_15510 28905 28642 CDS product DUF6489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 protein_id gnl|my_center|LOCUS_15510 29090 31117 gene locus_tag LOCUS_15520 29090 31117 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_15520 31126 31602 gene locus_tag LOCUS_15530 31126 31602 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 protein_id gnl|my_center|LOCUS_15530 31599 32576 gene locus_tag LOCUS_15540 31599 32576 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_15540 34009 32693 gene locus_tag LOCUS_15550 gene rho 34009 32693 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_15550 34639 34190 gene locus_tag LOCUS_15560 gene hemJ 34639 34190 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_15560 35708 34662 gene locus_tag LOCUS_15570 gene hemH 35708 34662 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 protein_id gnl|my_center|LOCUS_15570 36743 35709 gene locus_tag LOCUS_15580 gene hemE 36743 35709 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_15580 37160 37759 gene locus_tag LOCUS_15590 37160 37759 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391361.1 protein_id gnl|my_center|LOCUS_15590 37782 38633 gene locus_tag LOCUS_15600 37782 38633 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_15600 38643 39272 gene locus_tag LOCUS_15610 gene coaE 38643 39272 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_15610 39274 39942 gene locus_tag LOCUS_15620 gene dnaQ 39274 39942 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_15620 40564 39977 gene locus_tag LOCUS_15630 40564 39977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 41182 40676 gene locus_tag LOCUS_15640 gene fxsA 41182 40676 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_15640 41376 42074 gene locus_tag LOCUS_15650 41376 42074 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_15650 42121 43254 gene locus_tag LOCUS_15660 42121 43254 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 protein_id gnl|my_center|LOCUS_15660 43316 44080 gene locus_tag LOCUS_15670 43316 44080 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_15670 44085 45509 gene locus_tag LOCUS_15680 44085 45509 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_15680 45506 46192 gene locus_tag LOCUS_15690 45506 46192 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_15690 46176 46739 gene locus_tag LOCUS_15700 46176 46739 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 protein_id gnl|my_center|LOCUS_15700 46765 47145 gene locus_tag LOCUS_15710 46765 47145 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_15710 47218 47787 gene locus_tag LOCUS_15720 47218 47787 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969460.1 protein_id gnl|my_center|LOCUS_15720 49135 47825 gene locus_tag LOCUS_15730 gene hslU 49135 47825 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391347.1 protein_id gnl|my_center|LOCUS_15730 49680 49132 gene locus_tag LOCUS_15740 gene hslV 49680 49132 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391346.1 protein_id gnl|my_center|LOCUS_15740 49834 50421 gene locus_tag LOCUS_15750 gene hisB 49834 50421 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence025 347 1315 gene locus_tag LOCUS_15760 347 1315 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_15760 1315 2628 gene locus_tag LOCUS_15770 gene pyrC 1315 2628 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 protein_id gnl|my_center|LOCUS_15770 2631 3251 gene locus_tag LOCUS_15780 gene plsY 2631 3251 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390940.1 protein_id gnl|my_center|LOCUS_15780 3311 4417 gene locus_tag LOCUS_15790 gene dprA 3311 4417 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_15790 4426 6996 gene locus_tag LOCUS_15800 gene topA 4426 6996 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_15800 7053 9170 gene locus_tag LOCUS_15810 gene rnr 7053 9170 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390951.1 protein_id gnl|my_center|LOCUS_15810 9202 10770 gene locus_tag LOCUS_15820 9202 10770 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470630.1 protein_id gnl|my_center|LOCUS_15820 10903 11541 gene locus_tag LOCUS_15830 10903 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 11618 11815 gene locus_tag LOCUS_15840 gene rpmG 11618 11815 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390953.1 protein_id gnl|my_center|LOCUS_15840 12199 11834 gene locus_tag LOCUS_15850 12199 11834 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_15850 13650 12778 gene locus_tag LOCUS_15860 13650 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 14579 13710 gene locus_tag LOCUS_15870 gene purU 14579 13710 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388314.1 protein_id gnl|my_center|LOCUS_15870 16176 14617 gene locus_tag LOCUS_15880 16176 14617 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_15880 18211 16232 gene locus_tag LOCUS_15890 18211 16232 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_15890 18445 19647 gene locus_tag LOCUS_15900 18445 19647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 19644 21605 gene locus_tag LOCUS_15910 19644 21605 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_15910 21697 22305 gene locus_tag LOCUS_15920 21697 22305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 22392 23684 gene locus_tag LOCUS_15930 22392 23684 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_15930 24224 23862 gene locus_tag LOCUS_15940 24224 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 24392 24559 gene locus_tag LOCUS_15950 24392 24559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 24538 24888 gene locus_tag LOCUS_15960 24538 24888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 24979 25173 gene locus_tag LOCUS_15970 24979 25173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 25335 26000 gene locus_tag LOCUS_15980 25335 26000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 26630 26160 gene locus_tag LOCUS_15990 26630 26160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 29663 26814 gene locus_tag LOCUS_16000 gene uvrA 29663 26814 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_16000 30871 30014 gene locus_tag LOCUS_16010 30871 30014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 32976 31162 gene locus_tag LOCUS_16020 gene recJ 32976 31162 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_16020 34267 32978 gene locus_tag LOCUS_16030 34267 32978 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 protein_id gnl|my_center|LOCUS_16030 35509 34289 gene locus_tag LOCUS_16040 35509 34289 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_16040 36763 35588 gene locus_tag LOCUS_16050 36763 35588 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390165.1 protein_id gnl|my_center|LOCUS_16050 36958 38757 gene locus_tag LOCUS_16060 gene phaC 36958 38757 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_16060 39726 38767 gene locus_tag LOCUS_16070 gene meaB 39726 38767 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969975.1 protein_id gnl|my_center|LOCUS_16070 40279 39731 gene locus_tag LOCUS_16080 40279 39731 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_16080 41002 40298 gene locus_tag LOCUS_16090 41002 40298 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265848.1 protein_id gnl|my_center|LOCUS_16090 41591 41016 gene locus_tag LOCUS_16100 41591 41016 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_16100 41748 43166 gene locus_tag LOCUS_16110 41748 43166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 43201 43443 gene locus_tag LOCUS_16120 43201 43443 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626599.1 protein_id gnl|my_center|LOCUS_16120 43645 44046 gene locus_tag LOCUS_16130 43645 44046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 45190 44057 gene locus_tag LOCUS_16140 45190 44057 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440409.1 protein_id gnl|my_center|LOCUS_16140 46362 45391 gene locus_tag LOCUS_16150 gene thiS 46362 45391 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 protein_id gnl|my_center|LOCUS_16150 46787 47230 gene locus_tag LOCUS_16160 gene aroQ 46787 47230 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_16160 48276 47893 gene locus_tag LOCUS_16170 48276 47893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 48766 48539 gene locus_tag LOCUS_16180 48766 48539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 49216 49070 gene locus_tag LOCUS_16190 49216 49070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 49886 49317 gene locus_tag LOCUS_16200 49886 49317 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626340.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence026 518 186 gene locus_tag LOCUS_16210 518 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 639 884 gene locus_tag LOCUS_16220 639 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 897 1241 gene locus_tag LOCUS_16230 897 1241 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886618.1 protein_id gnl|my_center|LOCUS_16230 2655 1252 gene locus_tag LOCUS_16240 gene cysS 2655 1252 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_16240 4316 2655 gene locus_tag LOCUS_16250 4316 2655 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_16250 4402 5439 gene locus_tag LOCUS_16260 4402 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6584 5436 gene locus_tag LOCUS_16270 6584 5436 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_16270 7983 6601 gene locus_tag LOCUS_16280 7983 6601 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_16280 9477 8101 gene locus_tag LOCUS_16290 gene gor 9477 8101 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_16290 9704 9510 gene locus_tag LOCUS_16300 9704 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 11174 9717 gene locus_tag LOCUS_16310 11174 9717 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_16310 11342 11809 gene locus_tag LOCUS_16320 11342 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 13640 11817 gene locus_tag LOCUS_16330 gene glmS 13640 11817 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_16330 15074 13707 gene locus_tag LOCUS_16340 gene glmU 15074 13707 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_16340 15211 15885 gene locus_tag LOCUS_16350 gene gph 15211 15885 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338841.1 protein_id gnl|my_center|LOCUS_16350 15950 16024 gene locus_tag LOCUS_t00200 15950 16024 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16152 17864 gene locus_tag LOCUS_16360 16152 17864 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_16360 18086 17907 gene locus_tag LOCUS_16370 18086 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 20434 18083 gene locus_tag LOCUS_16380 20434 18083 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_16380 20956 20462 gene locus_tag LOCUS_16390 20956 20462 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391072.1 protein_id gnl|my_center|LOCUS_16390 22491 20959 gene locus_tag LOCUS_16400 gene ccoG 22491 20959 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626568.1 protein_id gnl|my_center|LOCUS_16400 23528 22668 gene locus_tag LOCUS_16410 gene ccoP 23528 22668 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970732.1 protein_id gnl|my_center|LOCUS_16410 23694 23533 gene locus_tag LOCUS_16420 23694 23533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 24430 23708 gene locus_tag LOCUS_16430 gene ccoO 24430 23708 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391078.1 protein_id gnl|my_center|LOCUS_16430 25923 24442 gene locus_tag LOCUS_16440 gene ccoN 25923 24442 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391079.1 protein_id gnl|my_center|LOCUS_16440 26370 28124 gene locus_tag LOCUS_16450 gene ggt 26370 28124 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065022.1 protein_id gnl|my_center|LOCUS_16450 29080 28358 gene locus_tag LOCUS_16460 29080 28358 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720931.1 protein_id gnl|my_center|LOCUS_16460 30112 29243 gene locus_tag LOCUS_16470 30112 29243 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_16470 30980 30330 gene locus_tag LOCUS_16480 30980 30330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 31455 33407 gene locus_tag LOCUS_16490 31455 33407 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_16490 33587 34669 gene locus_tag LOCUS_16500 33587 34669 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_16500 34700 35314 gene locus_tag LOCUS_16510 gene hisH 34700 35314 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817212.1 protein_id gnl|my_center|LOCUS_16510 35319 36059 gene locus_tag LOCUS_16520 gene hisF 35319 36059 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228686.1 protein_id gnl|my_center|LOCUS_16520 36117 37226 gene locus_tag LOCUS_16530 36117 37226 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841181.1 protein_id gnl|my_center|LOCUS_16530 37240 38115 gene locus_tag LOCUS_16540 37240 38115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 38130 38879 gene locus_tag LOCUS_16550 38130 38879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 38890 40332 gene locus_tag LOCUS_16560 38890 40332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 40329 41903 gene locus_tag LOCUS_16570 40329 41903 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_16570 42103 43866 gene locus_tag LOCUS_16580 42103 43866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 43880 44563 gene locus_tag LOCUS_16590 43880 44563 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388305.1 protein_id gnl|my_center|LOCUS_16590 44609 46690 gene locus_tag LOCUS_16600 44609 46690 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388304.1 protein_id gnl|my_center|LOCUS_16600 46897 47232 gene locus_tag LOCUS_16610 46897 47232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 47353 48999 gene locus_tag LOCUS_16620 gene fliF 47353 48999 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388303.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence027 1659 43 gene locus_tag LOCUS_16630 1659 43 CDS product stimulus-sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_16630 2399 1674 gene locus_tag LOCUS_16640 2399 1674 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_16640 2934 3998 gene locus_tag LOCUS_16650 2934 3998 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626331.1 protein_id gnl|my_center|LOCUS_16650 4636 5400 gene locus_tag LOCUS_16660 gene aztA 4636 5400 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383759.1 protein_id gnl|my_center|LOCUS_16660 5393 6307 gene locus_tag LOCUS_16670 5393 6307 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410031.1 protein_id gnl|my_center|LOCUS_16670 6304 7182 gene locus_tag LOCUS_16680 gene aztC 6304 7182 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532309.1 protein_id gnl|my_center|LOCUS_16680 8335 7928 gene locus_tag LOCUS_16690 gene nikR 8335 7928 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_16690 8553 8398 gene locus_tag LOCUS_16700 8553 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 8492 9028 gene locus_tag LOCUS_16710 8492 9028 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528397.1 protein_id gnl|my_center|LOCUS_16710 9264 9025 gene locus_tag LOCUS_16720 9264 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 9342 10145 gene locus_tag LOCUS_16730 9342 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 11335 10142 gene locus_tag LOCUS_16740 11335 10142 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_16740 12024 11332 gene locus_tag LOCUS_16750 12024 11332 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692227.1 protein_id gnl|my_center|LOCUS_16750 13363 12038 gene locus_tag LOCUS_16760 13363 12038 CDS product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728146.1 protein_id gnl|my_center|LOCUS_16760 14955 13516 gene locus_tag LOCUS_16770 14955 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 15508 15062 gene locus_tag LOCUS_16780 gene napB 15508 15062 CDS product nitrate reductase cytochrome c-type subunit NapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071135.1 protein_id gnl|my_center|LOCUS_16780 16482 15577 gene locus_tag LOCUS_16790 gene napH 16482 15577 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_16790 17228 16479 gene locus_tag LOCUS_16800 gene napG 17228 16479 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_16800 19784 17286 gene locus_tag LOCUS_16810 gene napA 19784 17286 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_16810 20038 19781 gene locus_tag LOCUS_16820 20038 19781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 20563 20069 gene locus_tag LOCUS_16830 gene napF 20563 20069 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705479.1 protein_id gnl|my_center|LOCUS_16830 21245 20850 gene locus_tag LOCUS_16840 21245 20850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 21793 21317 gene locus_tag LOCUS_16850 21793 21317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 22077 22292 gene locus_tag LOCUS_16860 22077 22292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 24754 22352 gene locus_tag LOCUS_16870 gene pheT 24754 22352 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 protein_id gnl|my_center|LOCUS_16870 25842 24751 gene locus_tag LOCUS_16880 gene pheS 25842 24751 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_16880 26250 25885 gene locus_tag LOCUS_16890 gene rplT 26250 25885 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391269.1 protein_id gnl|my_center|LOCUS_16890 26461 26264 gene locus_tag LOCUS_16900 gene rpmI 26461 26264 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383043.1 protein_id gnl|my_center|LOCUS_16900 27116 26646 gene locus_tag LOCUS_16910 gene infC 27116 26646 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_16910 29226 27280 gene locus_tag LOCUS_16920 gene thrS 29226 27280 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_16920 29717 30964 gene locus_tag LOCUS_16930 29717 30964 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_16930 32552 31620 gene locus_tag LOCUS_16940 32552 31620 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_16940 33793 32549 gene locus_tag LOCUS_16950 33793 32549 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_16950 33773 34600 gene locus_tag LOCUS_16960 33773 34600 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_16960 35391 34609 gene locus_tag LOCUS_16970 35391 34609 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_16970 36761 35400 gene locus_tag LOCUS_16980 36761 35400 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037468799.1 protein_id gnl|my_center|LOCUS_16980 39539 37410 gene locus_tag LOCUS_16990 39539 37410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 39663 40067 gene locus_tag LOCUS_17000 39663 40067 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106829.1 protein_id gnl|my_center|LOCUS_17000 40474 40118 gene locus_tag LOCUS_17010 40474 40118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 40431 40607 gene locus_tag LOCUS_17020 40431 40607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 41791 41030 gene locus_tag LOCUS_17030 gene flgH 41791 41030 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390472.1 protein_id gnl|my_center|LOCUS_17030 42788 41802 gene locus_tag LOCUS_17040 gene flgA 42788 41802 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 protein_id gnl|my_center|LOCUS_17040 43584 42799 gene locus_tag LOCUS_17050 gene flgG 43584 42799 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 protein_id gnl|my_center|LOCUS_17050 44388 43654 gene locus_tag LOCUS_17060 gene flgF 44388 43654 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_17060 44713 45261 gene locus_tag LOCUS_17070 44713 45261 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626461.1 protein_id gnl|my_center|LOCUS_17070 45302 46468 gene locus_tag LOCUS_17080 gene fliM 45302 46468 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390467.1 protein_id gnl|my_center|LOCUS_17080 46475 46939 gene locus_tag LOCUS_17090 46475 46939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 46954 47625 gene locus_tag LOCUS_17100 46954 47625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 protein_id gnl|my_center|LOCUS_17100 47730 48116 gene locus_tag LOCUS_17110 47730 48116 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence028 <1 1366 gene locus_tag LOCUS_17120 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921235.1:cytochrome c oxidase subunit I 1396 1992 gene locus_tag LOCUS_17130 1396 1992 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532776.1 protein_id gnl|my_center|LOCUS_17130 2032 2844 gene locus_tag LOCUS_17140 2032 2844 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_17140 2897 3247 gene locus_tag LOCUS_17150 2897 3247 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503617.1 protein_id gnl|my_center|LOCUS_17150 3273 4079 gene locus_tag LOCUS_17160 3273 4079 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_17160 4318 4049 gene locus_tag LOCUS_17170 4318 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 5862 4276 gene locus_tag LOCUS_17180 5862 4276 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390107.1 protein_id gnl|my_center|LOCUS_17180 6066 7811 gene locus_tag LOCUS_17190 6066 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 7819 8151 gene locus_tag LOCUS_17200 7819 8151 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081714.1 protein_id gnl|my_center|LOCUS_17200 8164 8979 gene locus_tag LOCUS_17210 8164 8979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390658.1 protein_id gnl|my_center|LOCUS_17210 8981 9817 gene locus_tag LOCUS_17220 8981 9817 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_17220 9814 10791 gene locus_tag LOCUS_17230 9814 10791 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390660.1 protein_id gnl|my_center|LOCUS_17230 10791 11420 gene locus_tag LOCUS_17240 10791 11420 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390661.1 protein_id gnl|my_center|LOCUS_17240 11664 11422 gene locus_tag LOCUS_17250 11664 11422 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066896.1 protein_id gnl|my_center|LOCUS_17250 11960 13024 gene locus_tag LOCUS_17260 11960 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 14335 13199 gene locus_tag LOCUS_17270 14335 13199 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_17270 15152 14337 gene locus_tag LOCUS_17280 15152 14337 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_17280 15185 16159 gene locus_tag LOCUS_17290 15185 16159 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329334.1 protein_id gnl|my_center|LOCUS_17290 17112 16687 gene locus_tag LOCUS_17300 17112 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 18217 17507 gene locus_tag LOCUS_17310 18217 17507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 18601 18783 gene locus_tag LOCUS_17320 18601 18783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 19363 20466 gene locus_tag LOCUS_17330 19363 20466 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_17330 20489 22285 gene locus_tag LOCUS_17340 20489 22285 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388917.1 protein_id gnl|my_center|LOCUS_17340 22334 23083 gene locus_tag LOCUS_17350 gene cybH 22334 23083 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 protein_id gnl|my_center|LOCUS_17350 23121 23702 gene locus_tag LOCUS_17360 23121 23702 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128947981.1 protein_id gnl|my_center|LOCUS_17360 23707 24012 gene locus_tag LOCUS_17370 gene hypC 23707 24012 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388920.1 protein_id gnl|my_center|LOCUS_17370 24017 24433 gene locus_tag LOCUS_17380 24017 24433 CDS product hydrogenase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338270.1 protein_id gnl|my_center|LOCUS_17380 24433 25224 gene locus_tag LOCUS_17390 24433 25224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 25224 25724 gene locus_tag LOCUS_17400 25224 25724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 25717 26901 gene locus_tag LOCUS_17410 25717 26901 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_17410 26894 27235 gene locus_tag LOCUS_17420 gene hypA 26894 27235 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_17420 27432 27175 gene locus_tag LOCUS_17430 27432 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 27427 28116 gene locus_tag LOCUS_17440 gene hypB 27427 28116 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388924.1 protein_id gnl|my_center|LOCUS_17440 28113 29219 gene locus_tag LOCUS_17450 28113 29219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 28633 28721 gene locus_tag LOCUS_t00210 28633 28721 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 29445 29681 gene locus_tag LOCUS_17460 29445 29681 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_17460 29678 30814 gene locus_tag LOCUS_17470 gene hypD 29678 30814 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_17470 30811 31878 gene locus_tag LOCUS_17480 gene hypE 30811 31878 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089665.1 protein_id gnl|my_center|LOCUS_17480 32116 31886 gene locus_tag LOCUS_17490 32116 31886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 32220 32960 gene locus_tag LOCUS_17500 32220 32960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 33747 32971 gene locus_tag LOCUS_17510 gene xth 33747 32971 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337637.1 protein_id gnl|my_center|LOCUS_17510 34188 33760 gene locus_tag LOCUS_17520 34188 33760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 35303 34185 gene locus_tag LOCUS_17530 gene leuB 35303 34185 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139959.1 protein_id gnl|my_center|LOCUS_17530 35950 35339 gene locus_tag LOCUS_17540 gene leuD 35950 35339 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 protein_id gnl|my_center|LOCUS_17540 38637 36067 gene locus_tag LOCUS_17550 38637 36067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 40074 38662 gene locus_tag LOCUS_17560 gene leuC 40074 38662 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_17560 40614 40114 gene locus_tag LOCUS_17570 40614 40114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 41365 40637 gene locus_tag LOCUS_17580 gene trmD 41365 40637 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388942.1 protein_id gnl|my_center|LOCUS_17580 41919 41365 gene locus_tag LOCUS_17590 gene rimM 41919 41365 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721394.1 protein_id gnl|my_center|LOCUS_17590 42573 41944 gene locus_tag LOCUS_17600 42573 41944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 43986 42619 gene locus_tag LOCUS_17610 gene ffh 43986 42619 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388939.1 protein_id gnl|my_center|LOCUS_17610 44274 45230 gene locus_tag LOCUS_17620 44274 45230 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971233.1 protein_id gnl|my_center|LOCUS_17620 45306 46205 gene locus_tag LOCUS_17630 45306 46205 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241012.1 protein_id gnl|my_center|LOCUS_17630 46198 47376 gene locus_tag LOCUS_17640 46198 47376 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence029 676 1566 gene locus_tag LOCUS_17650 676 1566 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_17650 2561 1713 gene locus_tag LOCUS_17660 2561 1713 CDS product mesaconyl-C(4)-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256090.1 protein_id gnl|my_center|LOCUS_17660 3798 2575 gene locus_tag LOCUS_17670 3798 2575 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256085.1 protein_id gnl|my_center|LOCUS_17670 4206 5513 gene locus_tag LOCUS_17680 4206 5513 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256089.1 protein_id gnl|my_center|LOCUS_17680 5547 6797 gene locus_tag LOCUS_17690 5547 6797 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256088.1 protein_id gnl|my_center|LOCUS_17690 6826 7749 gene locus_tag LOCUS_17700 gene fmt 6826 7749 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383426.1 protein_id gnl|my_center|LOCUS_17700 8814 7756 gene locus_tag LOCUS_17710 8814 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 protein_id gnl|my_center|LOCUS_17710 8979 9749 gene locus_tag LOCUS_17720 gene truA 8979 9749 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_17720 9746 10036 gene locus_tag LOCUS_17730 9746 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 10612 10046 gene locus_tag LOCUS_17740 10612 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 11769 10612 gene locus_tag LOCUS_17750 gene dapE 11769 10612 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391227.1 protein_id gnl|my_center|LOCUS_17750 12685 11795 gene locus_tag LOCUS_17760 gene dapD 12685 11795 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_17760 13419 12706 gene locus_tag LOCUS_17770 13419 12706 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 protein_id gnl|my_center|LOCUS_17770 13578 15284 gene locus_tag LOCUS_17780 13578 15284 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389349.1 protein_id gnl|my_center|LOCUS_17780 15303 17027 gene locus_tag LOCUS_17790 15303 17027 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 protein_id gnl|my_center|LOCUS_17790 17024 18346 gene locus_tag LOCUS_17800 17024 18346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 18351 19622 gene locus_tag LOCUS_17810 18351 19622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 20556 19636 gene locus_tag LOCUS_17820 gene argB 20556 19636 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391088.1 protein_id gnl|my_center|LOCUS_17820 21218 20556 gene locus_tag LOCUS_17830 gene yihA 21218 20556 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_17830 22990 21242 gene locus_tag LOCUS_17840 gene yidC 22990 21242 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_17840 23316 23044 gene locus_tag LOCUS_17850 gene yidD 23316 23044 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721423.1 protein_id gnl|my_center|LOCUS_17850 23672 23313 gene locus_tag LOCUS_17860 23672 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 23902 23768 gene locus_tag LOCUS_17870 23902 23768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 24095 24856 gene locus_tag LOCUS_17880 24095 24856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17880 24876 26300 gene locus_tag LOCUS_17890 24876 26300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 26487 27056 gene locus_tag LOCUS_17900 26487 27056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 28151 27294 gene locus_tag LOCUS_17910 28151 27294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 29614 28223 gene locus_tag LOCUS_17920 29614 28223 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_17920 29713 30435 gene locus_tag LOCUS_17930 29713 30435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 30497 30784 gene locus_tag LOCUS_17940 gene gatC 30497 30784 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390925.1 protein_id gnl|my_center|LOCUS_17940 30781 32247 gene locus_tag LOCUS_17950 gene gatA 30781 32247 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390924.1 protein_id gnl|my_center|LOCUS_17950 32252 33376 gene locus_tag LOCUS_17960 32252 33376 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_17960 33418 34914 gene locus_tag LOCUS_17970 33418 34914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 36027 38465 gene locus_tag LOCUS_17980 36027 38465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 38552 40009 gene locus_tag LOCUS_17990 gene gatB 38552 40009 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_17990 41870 40026 gene locus_tag LOCUS_18000 41870 40026 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852913.1 protein_id gnl|my_center|LOCUS_18000 42413 42057 gene locus_tag LOCUS_18010 42413 42057 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_18010 42573 42833 gene locus_tag LOCUS_18020 42573 42833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 43115 42873 gene locus_tag LOCUS_18030 43115 42873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 43171 43503 gene locus_tag LOCUS_18040 43171 43503 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398761.1 protein_id gnl|my_center|LOCUS_18040 43601 44269 gene locus_tag LOCUS_18050 43601 44269 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967809.1 protein_id gnl|my_center|LOCUS_18050 44296 46563 gene locus_tag LOCUS_18060 44296 46563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence030 <1 1005 gene locus_tag LOCUS_18070 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942194.1:tetratricopeptide repeat protein 1031 2179 gene locus_tag LOCUS_18080 1031 2179 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390673.1 protein_id gnl|my_center|LOCUS_18080 2251 2508 gene locus_tag LOCUS_18090 2251 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2881 4146 gene locus_tag LOCUS_18100 2881 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5432 4215 gene locus_tag LOCUS_18110 5432 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 6712 5510 gene locus_tag LOCUS_18120 6712 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 8156 6807 gene locus_tag LOCUS_18130 8156 6807 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_18130 8326 9396 gene locus_tag LOCUS_18140 8326 9396 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003378.1 protein_id gnl|my_center|LOCUS_18140 11774 9534 gene locus_tag LOCUS_18150 11774 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 12043 11967 gene locus_tag LOCUS_t00220 12043 11967 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12360 12064 gene locus_tag LOCUS_18160 12360 12064 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389336.1 protein_id gnl|my_center|LOCUS_18160 13045 12632 gene locus_tag LOCUS_18170 13045 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 13175 13489 gene locus_tag LOCUS_18180 13175 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 13661 14317 gene locus_tag LOCUS_18190 13661 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 14413 14622 gene locus_tag LOCUS_18200 14413 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 14619 17009 gene locus_tag LOCUS_18210 14619 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 18149 17457 gene locus_tag LOCUS_18220 18149 17457 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_18220 18886 19509 gene locus_tag LOCUS_18230 18886 19509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 19506 19778 gene locus_tag LOCUS_18240 19506 19778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 20241 21086 gene locus_tag LOCUS_18250 20241 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 21086 21397 gene locus_tag LOCUS_18260 21086 21397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 21418 21690 gene locus_tag LOCUS_18270 21418 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 21694 21960 gene locus_tag LOCUS_18280 21694 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 22912 22001 gene locus_tag LOCUS_18290 22912 22001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 23428 23078 gene locus_tag LOCUS_18300 23428 23078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 24497 23613 gene locus_tag LOCUS_18310 24497 23613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 25905 24544 gene locus_tag LOCUS_18320 25905 24544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 26087 26011 gene locus_tag LOCUS_t00230 26087 26011 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26851 26162 gene locus_tag LOCUS_18330 26851 26162 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337861.1 protein_id gnl|my_center|LOCUS_18330 27899 26889 gene locus_tag LOCUS_18340 27899 26889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 29321 27912 gene locus_tag LOCUS_18350 29321 27912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 30474 29353 gene locus_tag LOCUS_18360 30474 29353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 30943 30569 gene locus_tag LOCUS_18370 30943 30569 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_18370 31433 32437 gene locus_tag LOCUS_18380 31433 32437 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967169.1 protein_id gnl|my_center|LOCUS_18380 32704 34236 gene locus_tag LOCUS_18390 32704 34236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 33266 33361 gene locus_tag LOCUS_t00240 33266 33361 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 34233 34694 gene locus_tag LOCUS_18400 34233 34694 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_18400 34691 37144 gene locus_tag LOCUS_18410 34691 37144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 37203 39203 gene locus_tag LOCUS_18420 37203 39203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 39211 41349 gene locus_tag LOCUS_18430 39211 41349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 41467 42321 gene locus_tag LOCUS_18440 41467 42321 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_18440 42828 42331 gene locus_tag LOCUS_18450 42828 42331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 43011 43787 gene locus_tag LOCUS_18460 43011 43787 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389334.1 protein_id gnl|my_center|LOCUS_18460 43784 44539 gene locus_tag LOCUS_18470 43784 44539 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 protein_id gnl|my_center|LOCUS_18470 44550 45497 gene locus_tag LOCUS_18480 44550 45497 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 protein_id gnl|my_center|LOCUS_18480 45938 45522 gene locus_tag LOCUS_18490 45938 45522 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_18490 46237 45950 gene locus_tag LOCUS_18500 46237 45950 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence031 750 196 gene locus_tag LOCUS_18510 750 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1265 747 gene locus_tag LOCUS_18520 gene lspA 1265 747 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_18520 4117 1262 gene locus_tag LOCUS_18530 gene ileS 4117 1262 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390714.1 protein_id gnl|my_center|LOCUS_18530 5271 4330 gene locus_tag LOCUS_18540 5271 4330 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_18540 5813 5349 gene locus_tag LOCUS_18550 5813 5349 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388118.1 protein_id gnl|my_center|LOCUS_18550 6064 6618 gene locus_tag LOCUS_18560 gene petA 6064 6618 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_18560 6630 7865 gene locus_tag LOCUS_18570 6630 7865 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_18570 7865 8620 gene locus_tag LOCUS_18580 7865 8620 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_18580 9146 8748 gene locus_tag LOCUS_18590 9146 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 11313 9268 gene locus_tag LOCUS_18600 11313 9268 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_18600 12511 11417 gene locus_tag LOCUS_18610 gene mtnA 12511 11417 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_18610 13142 12516 gene locus_tag LOCUS_18620 13142 12516 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117923.1 protein_id gnl|my_center|LOCUS_18620 14296 13142 gene locus_tag LOCUS_18630 14296 13142 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_18630 15190 14303 gene locus_tag LOCUS_18640 15190 14303 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388114.1 protein_id gnl|my_center|LOCUS_18640 15341 15577 gene locus_tag LOCUS_18650 15341 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 15801 16607 gene locus_tag LOCUS_18660 15801 16607 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_18660 16604 17440 gene locus_tag LOCUS_18670 16604 17440 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_18670 17918 18385 gene locus_tag LOCUS_18680 17918 18385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 18382 18879 gene locus_tag LOCUS_18690 18382 18879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 19329 19069 gene locus_tag LOCUS_18700 19329 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 20211 19546 gene locus_tag LOCUS_18710 20211 19546 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_18710 21008 20418 gene locus_tag LOCUS_18720 21008 20418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 21098 21937 gene locus_tag LOCUS_18730 21098 21937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 21950 22711 gene locus_tag LOCUS_18740 21950 22711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 22742 23215 gene locus_tag LOCUS_18750 22742 23215 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_18750 23209 23634 gene locus_tag LOCUS_18760 23209 23634 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_18760 23735 24757 gene locus_tag LOCUS_18770 23735 24757 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387894.1 protein_id gnl|my_center|LOCUS_18770 25847 24747 gene locus_tag LOCUS_18780 gene ychF 25847 24747 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_18780 26083 26514 gene locus_tag LOCUS_18790 26083 26514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 27154 26534 gene locus_tag LOCUS_18800 gene pth 27154 26534 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391494.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18800 27877 27206 gene locus_tag LOCUS_18810 27877 27206 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529995.1 protein_id gnl|my_center|LOCUS_18810 28875 27943 gene locus_tag LOCUS_18820 28875 27943 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388403.1 protein_id gnl|my_center|LOCUS_18820 29990 29079 gene locus_tag LOCUS_18830 29990 29079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 30865 30098 gene locus_tag LOCUS_18840 gene pgeF 30865 30098 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388401.1 protein_id gnl|my_center|LOCUS_18840 32052 30916 gene locus_tag LOCUS_18850 32052 30916 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_18850 32894 32088 gene locus_tag LOCUS_18860 gene lgt 32894 32088 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_18860 33897 32911 gene locus_tag LOCUS_18870 gene rfaD 33897 32911 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391026.1 protein_id gnl|my_center|LOCUS_18870 34014 34346 gene locus_tag LOCUS_18880 34014 34346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 34544 35047 gene locus_tag LOCUS_18890 34544 35047 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_18890 35053 35868 gene locus_tag LOCUS_18900 gene proC 35053 35868 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_18900 36700 35882 gene locus_tag LOCUS_18910 36700 35882 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720768.1 protein_id gnl|my_center|LOCUS_18910 36822 37517 gene locus_tag LOCUS_18920 36822 37517 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 protein_id gnl|my_center|LOCUS_18920 37705 38184 gene locus_tag LOCUS_18930 37705 38184 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391031.1 protein_id gnl|my_center|LOCUS_18930 38265 38600 gene locus_tag LOCUS_18940 38265 38600 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_18940 39544 38606 gene locus_tag LOCUS_18950 39544 38606 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_18950 39711 42611 gene locus_tag LOCUS_18960 39711 42611 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672241.1 protein_id gnl|my_center|LOCUS_18960 42812 43987 gene locus_tag LOCUS_18970 gene rnd 42812 43987 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_18970 45633 44101 gene locus_tag LOCUS_18980 gene ppx 45633 44101 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence032 2206 1499 gene locus_tag LOCUS_18990 2206 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2340 3242 gene locus_tag LOCUS_19000 2340 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 3263 3688 gene locus_tag LOCUS_19010 3263 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 4152 3775 gene locus_tag LOCUS_19020 4152 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 6827 4236 gene locus_tag LOCUS_19030 gene clpB 6827 4236 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_19030 8562 6976 gene locus_tag LOCUS_19040 8562 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 9401 8742 gene locus_tag LOCUS_19050 9401 8742 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_19050 9775 10545 gene locus_tag LOCUS_19060 9775 10545 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_19060 10891 11694 gene locus_tag LOCUS_19070 10891 11694 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_19070 11758 13584 gene locus_tag LOCUS_19080 11758 13584 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_19080 13607 14728 gene locus_tag LOCUS_19090 13607 14728 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_19090 14732 15781 gene locus_tag LOCUS_19100 14732 15781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_19100 15778 17403 gene locus_tag LOCUS_19110 15778 17403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390917.1 protein_id gnl|my_center|LOCUS_19110 18421 17573 gene locus_tag LOCUS_19120 18421 17573 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_19120 20018 18654 gene locus_tag LOCUS_19130 20018 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 20879 20070 gene locus_tag LOCUS_19140 20879 20070 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387778.1 protein_id gnl|my_center|LOCUS_19140 21061 25680 gene locus_tag LOCUS_19150 gene gltB 21061 25680 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_19150 25687 27129 gene locus_tag LOCUS_19160 25687 27129 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_19160 27220 27459 gene locus_tag LOCUS_19170 27220 27459 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391303.1 protein_id gnl|my_center|LOCUS_19170 27505 27873 gene locus_tag LOCUS_19180 27505 27873 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705071.1 protein_id gnl|my_center|LOCUS_19180 30816 27886 gene locus_tag LOCUS_19190 30816 27886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 32213 31188 gene locus_tag LOCUS_19200 32213 31188 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391186.1 protein_id gnl|my_center|LOCUS_19200 32357 32848 gene locus_tag LOCUS_19210 gene tsaE 32357 32848 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_19210 32841 33854 gene locus_tag LOCUS_19220 32841 33854 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_19220 33869 34585 gene locus_tag LOCUS_19230 33869 34585 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_19230 34582 37551 gene locus_tag LOCUS_19240 gene addB 34582 37551 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_19240 37548 40973 gene locus_tag LOCUS_19250 gene addA 37548 40973 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_19250 41066 41383 gene locus_tag LOCUS_19260 gene trxA 41066 41383 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_19260 41479 42675 gene locus_tag LOCUS_19270 41479 42675 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_19270 42782 43144 gene locus_tag LOCUS_19280 42782 43144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 43410 45251 gene locus_tag LOCUS_19290 43410 45251 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391166.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence033 230 721 gene locus_tag LOCUS_19300 230 721 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064295.1 protein_id gnl|my_center|LOCUS_19300 3650 3195 gene locus_tag LOCUS_19310 3650 3195 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_19310 3957 4445 gene locus_tag LOCUS_19320 3957 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 6094 4727 gene locus_tag LOCUS_19330 gene nhaA 6094 4727 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_19330 6600 7451 gene locus_tag LOCUS_19340 6600 7451 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_19340 7448 8620 gene locus_tag LOCUS_19350 7448 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 8628 9974 gene locus_tag LOCUS_19360 8628 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 9974 10792 gene locus_tag LOCUS_19370 9974 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 11663 10839 gene locus_tag LOCUS_19380 11663 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115327.1 protein_id gnl|my_center|LOCUS_19380 12396 13622 gene locus_tag LOCUS_19390 12396 13622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103851.1 protein_id gnl|my_center|LOCUS_19390 14598 13612 gene locus_tag LOCUS_19400 14598 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 14772 16070 gene locus_tag LOCUS_19410 gene purB 14772 16070 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383544.1 protein_id gnl|my_center|LOCUS_19410 16443 16078 gene locus_tag LOCUS_19420 16443 16078 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088474.1 protein_id gnl|my_center|LOCUS_19420 16548 17309 gene locus_tag LOCUS_19430 16548 17309 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_19430 17348 18187 gene locus_tag LOCUS_19440 17348 18187 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388469.1 protein_id gnl|my_center|LOCUS_19440 18225 18467 gene locus_tag LOCUS_19450 gene purS 18225 18467 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_19450 18483 18779 gene locus_tag LOCUS_19460 18483 18779 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_19460 18791 19159 gene locus_tag LOCUS_19470 18791 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 19235 19924 gene locus_tag LOCUS_19480 gene purQ 19235 19924 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396502.1 protein_id gnl|my_center|LOCUS_19480 19951 20760 gene locus_tag LOCUS_19490 19951 20760 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_19490 21101 23317 gene locus_tag LOCUS_19500 gene purL 21101 23317 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_19500 23334 23573 gene locus_tag LOCUS_19510 23334 23573 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_19510 23643 23978 gene locus_tag LOCUS_19520 gene grxD 23643 23978 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388463.1 protein_id gnl|my_center|LOCUS_19520 24401 23979 gene locus_tag LOCUS_19530 24401 23979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 24569 25021 gene locus_tag LOCUS_19540 24569 25021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 25028 25285 gene locus_tag LOCUS_19550 gene rpmA 25028 25285 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529063.1 protein_id gnl|my_center|LOCUS_19550 25378 26400 gene locus_tag LOCUS_19560 gene obgE 25378 26400 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388995.1 protein_id gnl|my_center|LOCUS_19560 26397 27527 gene locus_tag LOCUS_19570 gene proB 26397 27527 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388994.1 protein_id gnl|my_center|LOCUS_19570 27618 28028 gene locus_tag LOCUS_19580 27618 28028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 28100 29386 gene locus_tag LOCUS_19590 28100 29386 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388993.1 protein_id gnl|my_center|LOCUS_19590 29374 29979 gene locus_tag LOCUS_19600 29374 29979 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388992.1 protein_id gnl|my_center|LOCUS_19600 30000 30371 gene locus_tag LOCUS_19610 30000 30371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 30593 30384 gene locus_tag LOCUS_19620 30593 30384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 30998 31447 gene locus_tag LOCUS_19630 gene rlmH 30998 31447 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388990.1 protein_id gnl|my_center|LOCUS_19630 31521 31973 gene locus_tag LOCUS_19640 31521 31973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 32131 33774 gene locus_tag LOCUS_19650 gene gpmI 32131 33774 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_19650 33783 34997 gene locus_tag LOCUS_19660 33783 34997 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_19660 34994 36313 gene locus_tag LOCUS_19670 34994 36313 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_19670 36348 37706 gene locus_tag LOCUS_19680 36348 37706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 37703 38206 gene locus_tag LOCUS_19690 37703 38206 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_19690 38237 39214 gene locus_tag LOCUS_19700 38237 39214 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_19700 39264 40034 gene locus_tag LOCUS_19710 39264 40034 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_19710 40066 40485 gene locus_tag LOCUS_19720 40066 40485 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_19720 41147 40482 gene locus_tag LOCUS_19730 41147 40482 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966301.1 protein_id gnl|my_center|LOCUS_19730 41212 41616 gene locus_tag LOCUS_19740 41212 41616 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530143.1 protein_id gnl|my_center|LOCUS_19740 42532 41771 gene locus_tag LOCUS_19750 42532 41771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 44035 42704 gene locus_tag LOCUS_19760 gene gltA 44035 42704 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence034 539 27 gene locus_tag LOCUS_19770 539 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 436 876 gene locus_tag LOCUS_19780 436 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 942 1772 gene locus_tag LOCUS_19790 942 1772 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_19790 1950 2768 gene locus_tag LOCUS_19800 1950 2768 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_19800 3228 4511 gene locus_tag LOCUS_19810 gene glgC 3228 4511 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479907.1 protein_id gnl|my_center|LOCUS_19810 6964 4712 gene locus_tag LOCUS_19820 gene glgB 6964 4712 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_19820 10235 6969 gene locus_tag LOCUS_19830 gene treS 10235 6969 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389295.1 protein_id gnl|my_center|LOCUS_19830 12419 10293 gene locus_tag LOCUS_19840 12419 10293 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389479.1 protein_id gnl|my_center|LOCUS_19840 13199 12744 gene locus_tag LOCUS_19850 13199 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 13624 14721 gene locus_tag LOCUS_19860 13624 14721 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_19860 14885 15766 gene locus_tag LOCUS_19870 14885 15766 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400692.1 protein_id gnl|my_center|LOCUS_19870 15773 16612 gene locus_tag LOCUS_19880 15773 16612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 16605 17465 gene locus_tag LOCUS_19890 16605 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 17455 18768 gene locus_tag LOCUS_19900 gene mgtE 17455 18768 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_19900 19156 19081 gene locus_tag LOCUS_t00250 19156 19081 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20525 19197 gene locus_tag LOCUS_19910 20525 19197 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528911.1 protein_id gnl|my_center|LOCUS_19910 21904 20564 gene locus_tag LOCUS_19920 21904 20564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 22737 22015 gene locus_tag LOCUS_19930 22737 22015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 23686 22757 gene locus_tag LOCUS_19940 gene hemC 23686 22757 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_19940 23768 24823 gene locus_tag LOCUS_19950 gene tsaD 23768 24823 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_19950 24842 25018 gene locus_tag LOCUS_19960 24842 25018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 25134 25658 gene locus_tag LOCUS_19970 25134 25658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 25682 26044 gene locus_tag LOCUS_19980 25682 26044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 26106 27113 gene locus_tag LOCUS_19990 26106 27113 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391318.1 protein_id gnl|my_center|LOCUS_19990 27124 29232 gene locus_tag LOCUS_20000 27124 29232 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_20000 29271 29555 gene locus_tag LOCUS_20010 29271 29555 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 protein_id gnl|my_center|LOCUS_20010 29558 29971 gene locus_tag LOCUS_20020 29558 29971 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_20020 29968 30309 gene locus_tag LOCUS_20030 29968 30309 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_20030 30487 32427 gene locus_tag LOCUS_20040 gene acs 30487 32427 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_20040 33262 32492 gene locus_tag LOCUS_20050 33262 32492 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_20050 33395 34438 gene locus_tag LOCUS_20060 gene arnC 33395 34438 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461642.1 protein_id gnl|my_center|LOCUS_20060 36519 34423 gene locus_tag LOCUS_20070 36519 34423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 37146 36940 gene locus_tag LOCUS_20080 37146 36940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 37254 38108 gene locus_tag LOCUS_20090 gene htpX 37254 38108 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391326.1 protein_id gnl|my_center|LOCUS_20090 39343 38105 gene locus_tag LOCUS_20100 39343 38105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 39459 40757 gene locus_tag LOCUS_20110 39459 40757 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_20110 40793 42439 gene locus_tag LOCUS_20120 40793 42439 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence035 1336 557 gene locus_tag LOCUS_20130 1336 557 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_20130 2120 1365 gene locus_tag LOCUS_20140 2120 1365 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_20140 3595 2117 gene locus_tag LOCUS_20150 gene nuoN 3595 2117 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_20150 5129 3615 gene locus_tag LOCUS_20160 5129 3615 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_20160 7094 5136 gene locus_tag LOCUS_20170 gene nuoL 7094 5136 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_20170 7415 7104 gene locus_tag LOCUS_20180 gene nuoK 7415 7104 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_20180 8023 7415 gene locus_tag LOCUS_20190 8023 7415 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389439.1 protein_id gnl|my_center|LOCUS_20190 8594 8103 gene locus_tag LOCUS_20200 gene nuoI 8594 8103 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 protein_id gnl|my_center|LOCUS_20200 9645 8614 gene locus_tag LOCUS_20210 gene nuoH 9645 8614 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_20210 11707 9638 gene locus_tag LOCUS_20220 gene nuoG 11707 9638 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_20220 13006 11717 gene locus_tag LOCUS_20230 gene nuoF 13006 11717 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_20230 13659 13006 gene locus_tag LOCUS_20240 13659 13006 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_20240 14834 13656 gene locus_tag LOCUS_20250 14834 13656 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389433.1 protein_id gnl|my_center|LOCUS_20250 15448 14834 gene locus_tag LOCUS_20260 15448 14834 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389432.1 protein_id gnl|my_center|LOCUS_20260 16047 15499 gene locus_tag LOCUS_20270 16047 15499 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389431.1 protein_id gnl|my_center|LOCUS_20270 16409 16044 gene locus_tag LOCUS_20280 16409 16044 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_20280 16554 16477 gene locus_tag LOCUS_t00260 16554 16477 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17446 16670 gene locus_tag LOCUS_20290 17446 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 17873 17421 gene locus_tag LOCUS_20300 17873 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 19870 18146 gene locus_tag LOCUS_20310 19870 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 20633 20558 gene locus_tag LOCUS_t00270 20633 20558 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21037 20765 gene locus_tag LOCUS_20320 21037 20765 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_20320 23723 21309 gene locus_tag LOCUS_20330 gene lon 23723 21309 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_20330 25100 23835 gene locus_tag LOCUS_20340 gene clpX 25100 23835 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389426.1 protein_id gnl|my_center|LOCUS_20340 25899 25237 gene locus_tag LOCUS_20350 gene clpP 25899 25237 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_20350 27383 25896 gene locus_tag LOCUS_20360 gene tig 27383 25896 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087709.1 protein_id gnl|my_center|LOCUS_20360 27560 27476 gene locus_tag LOCUS_t00280 27560 27476 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29142 27664 gene locus_tag LOCUS_20370 29142 27664 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389422.1 protein_id gnl|my_center|LOCUS_20370 29259 30512 gene locus_tag LOCUS_20380 29259 30512 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877942.1 protein_id gnl|my_center|LOCUS_20380 30928 30581 gene locus_tag LOCUS_20390 30928 30581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 31193 32065 gene locus_tag LOCUS_20400 31193 32065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 31968 33617 gene locus_tag LOCUS_20410 31968 33617 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921045.1 protein_id gnl|my_center|LOCUS_20410 33938 34549 gene locus_tag LOCUS_20420 33938 34549 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_20420 34667 37792 gene locus_tag LOCUS_20430 34667 37792 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156827587.1 protein_id gnl|my_center|LOCUS_20430 37976 38410 gene locus_tag LOCUS_20440 37976 38410 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531833.1 protein_id gnl|my_center|LOCUS_20440 38506 38715 gene locus_tag LOCUS_20450 38506 38715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 38776 38979 gene locus_tag LOCUS_20460 38776 38979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 39125 39781 gene locus_tag LOCUS_20470 gene parA 39125 39781 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_20470 39830 40297 gene locus_tag LOCUS_20480 39830 40297 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619982.1 protein_id gnl|my_center|LOCUS_20480 41551 40313 gene locus_tag LOCUS_20490 41551 40313 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence036 1361 723 gene locus_tag LOCUS_20500 1361 723 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387916.1 protein_id gnl|my_center|LOCUS_20500 1544 2737 gene locus_tag LOCUS_20510 1544 2737 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_20510 2734 5919 gene locus_tag LOCUS_20520 2734 5919 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_20520 5916 7064 gene locus_tag LOCUS_20530 gene dauA 5916 7064 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_20530 7441 7214 gene locus_tag LOCUS_20540 7441 7214 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690730.1 protein_id gnl|my_center|LOCUS_20540 7976 8284 gene locus_tag LOCUS_20550 7976 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 9488 8442 gene locus_tag LOCUS_20560 9488 8442 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_20560 9776 9576 gene locus_tag LOCUS_20570 9776 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 10647 9784 gene locus_tag LOCUS_20580 10647 9784 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967060.1 protein_id gnl|my_center|LOCUS_20580 11156 10668 gene locus_tag LOCUS_20590 11156 10668 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_20590 11285 11878 gene locus_tag LOCUS_20600 gene pdxH 11285 11878 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968902.1 protein_id gnl|my_center|LOCUS_20600 11875 12861 gene locus_tag LOCUS_20610 11875 12861 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_20610 12952 13992 gene locus_tag LOCUS_20620 12952 13992 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967177.1 protein_id gnl|my_center|LOCUS_20620 14006 17242 gene locus_tag LOCUS_20630 14006 17242 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088515.1 protein_id gnl|my_center|LOCUS_20630 17305 18186 gene locus_tag LOCUS_20640 17305 18186 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732449.1 protein_id gnl|my_center|LOCUS_20640 19054 18200 gene locus_tag LOCUS_20650 19054 18200 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545567.1 protein_id gnl|my_center|LOCUS_20650 20192 19107 gene locus_tag LOCUS_20660 20192 19107 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546163.1 protein_id gnl|my_center|LOCUS_20660 20501 20208 gene locus_tag LOCUS_20670 20501 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 20976 20698 gene locus_tag LOCUS_20680 20976 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 23335 21173 gene locus_tag LOCUS_20690 23335 21173 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938002.1 protein_id gnl|my_center|LOCUS_20690 24048 23332 gene locus_tag LOCUS_20700 24048 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 24796 25155 gene locus_tag LOCUS_20710 24796 25155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 25169 25639 gene locus_tag LOCUS_20720 25169 25639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 25654 26025 gene locus_tag LOCUS_20730 25654 26025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 26782 26354 gene locus_tag LOCUS_20740 26782 26354 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404578.1 protein_id gnl|my_center|LOCUS_20740 27226 27041 gene locus_tag LOCUS_20750 27226 27041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 27146 29536 gene locus_tag LOCUS_20760 27146 29536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 30834 29449 gene locus_tag LOCUS_20770 30834 29449 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938312.1 protein_id gnl|my_center|LOCUS_20770 34704 31003 gene locus_tag LOCUS_20780 34704 31003 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265799.1 protein_id gnl|my_center|LOCUS_20780 36679 34751 gene locus_tag LOCUS_20790 36679 34751 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_20790 37883 36903 gene locus_tag LOCUS_20800 37883 36903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 38057 38959 gene locus_tag LOCUS_20810 38057 38959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 39428 39129 gene locus_tag LOCUS_20820 39428 39129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 39931 39476 gene locus_tag LOCUS_20830 39931 39476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence037 187 651 gene locus_tag LOCUS_20840 gene ptsN 187 651 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_20840 952 704 gene locus_tag LOCUS_20850 952 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1493 1023 gene locus_tag LOCUS_20860 1493 1023 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_20860 1868 2854 gene locus_tag LOCUS_20870 1868 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3270 3488 gene locus_tag LOCUS_20880 3270 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3485 5029 gene locus_tag LOCUS_20890 3485 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 5328 5846 gene locus_tag LOCUS_20900 5328 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 5821 7710 gene locus_tag LOCUS_20910 5821 7710 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_20910 8034 7741 gene locus_tag LOCUS_20920 8034 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 8258 8911 gene locus_tag LOCUS_20930 8258 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 8904 10325 gene locus_tag LOCUS_20940 8904 10325 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 protein_id gnl|my_center|LOCUS_20940 10318 12156 gene locus_tag LOCUS_20950 10318 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 12160 12372 gene locus_tag LOCUS_20960 12160 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 12375 12710 gene locus_tag LOCUS_20970 12375 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 12954 13451 gene locus_tag LOCUS_20980 12954 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 13459 13818 gene locus_tag LOCUS_20990 13459 13818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 13731 14948 gene locus_tag LOCUS_21000 13731 14948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 14974 14899 gene locus_tag LOCUS_t00290 14974 14899 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 15490 15101 gene locus_tag LOCUS_21010 15490 15101 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388049.1 protein_id gnl|my_center|LOCUS_21010 15625 16953 gene locus_tag LOCUS_21020 gene aroA 15625 16953 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388048.1 protein_id gnl|my_center|LOCUS_21020 16950 17591 gene locus_tag LOCUS_21030 gene cmk 16950 17591 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388047.1 protein_id gnl|my_center|LOCUS_21030 17721 19580 gene locus_tag LOCUS_21040 gene rpsA 17721 19580 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_21040 19704 20612 gene locus_tag LOCUS_21050 gene sppA 19704 20612 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529583.1 protein_id gnl|my_center|LOCUS_21050 20702 20986 gene locus_tag LOCUS_21060 gene ihfB 20702 20986 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 protein_id gnl|my_center|LOCUS_21060 21096 21434 gene locus_tag LOCUS_21070 21096 21434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 21458 22099 gene locus_tag LOCUS_21080 21458 22099 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391172.1 protein_id gnl|my_center|LOCUS_21080 22215 23426 gene locus_tag LOCUS_21090 gene trpB 22215 23426 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391174.1 protein_id gnl|my_center|LOCUS_21090 23423 24271 gene locus_tag LOCUS_21100 gene trpA 23423 24271 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528320.1 protein_id gnl|my_center|LOCUS_21100 24268 25194 gene locus_tag LOCUS_21110 gene accD 24268 25194 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626593.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21110 25319 26467 gene locus_tag LOCUS_21120 25319 26467 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_21120 26788 26498 gene locus_tag LOCUS_21130 26788 26498 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_21130 27103 26801 gene locus_tag LOCUS_21140 27103 26801 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_21140 27928 27206 gene locus_tag LOCUS_21150 27928 27206 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391167.1 protein_id gnl|my_center|LOCUS_21150 28364 27936 gene locus_tag LOCUS_21160 28364 27936 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_21160 28711 28361 gene locus_tag LOCUS_21170 28711 28361 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_21170 29499 28708 gene locus_tag LOCUS_21180 29499 28708 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_21180 30244 29501 gene locus_tag LOCUS_21190 30244 29501 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_21190 30438 31406 gene locus_tag LOCUS_21200 gene dmeF 30438 31406 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389388.1 protein_id gnl|my_center|LOCUS_21200 31491 31724 gene locus_tag LOCUS_21210 31491 31724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 31869 32102 gene locus_tag LOCUS_21220 31869 32102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 32691 32494 gene locus_tag LOCUS_21230 32691 32494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 33799 32720 gene locus_tag LOCUS_21240 33799 32720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 34121 34405 gene locus_tag LOCUS_21250 34121 34405 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390588.1 protein_id gnl|my_center|LOCUS_21250 34405 34710 gene locus_tag LOCUS_21260 34405 34710 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968628.1 protein_id gnl|my_center|LOCUS_21260 34966 34890 gene locus_tag LOCUS_t00300 34966 34890 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35531 35004 gene locus_tag LOCUS_21270 35531 35004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 35962 36144 gene locus_tag LOCUS_21280 35962 36144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 36216 37493 gene locus_tag LOCUS_21290 36216 37493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 37829 38005 gene locus_tag LOCUS_21300 37829 38005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 38079 38600 gene locus_tag LOCUS_21310 38079 38600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence038 248 1192 gene locus_tag LOCUS_21320 248 1192 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_21320 1225 2718 gene locus_tag LOCUS_21330 1225 2718 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940278.1 protein_id gnl|my_center|LOCUS_21330 2715 3488 gene locus_tag LOCUS_21340 2715 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3485 4489 gene locus_tag LOCUS_21350 3485 4489 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383609.1 protein_id gnl|my_center|LOCUS_21350 4486 5070 gene locus_tag LOCUS_21360 4486 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 8221 5054 gene locus_tag LOCUS_21370 8221 5054 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922389.1 protein_id gnl|my_center|LOCUS_21370 9427 8240 gene locus_tag LOCUS_21380 9427 8240 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_21380 9647 10609 gene locus_tag LOCUS_21390 9647 10609 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563806.1 protein_id gnl|my_center|LOCUS_21390 11167 12513 gene locus_tag LOCUS_21400 11167 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 12733 12996 gene locus_tag LOCUS_21410 12733 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 13631 13059 gene locus_tag LOCUS_21420 13631 13059 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_21420 15264 13648 gene locus_tag LOCUS_21430 15264 13648 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390812.1 protein_id gnl|my_center|LOCUS_21430 15608 17620 gene locus_tag LOCUS_21440 15608 17620 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_21440 18066 17632 gene locus_tag LOCUS_21450 18066 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 19075 18293 gene locus_tag LOCUS_21460 19075 18293 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388500.1 protein_id gnl|my_center|LOCUS_21460 19266 20486 gene locus_tag LOCUS_21470 19266 20486 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_21470 20476 21561 gene locus_tag LOCUS_21480 20476 21561 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_21480 21564 23837 gene locus_tag LOCUS_21490 gene ptsP 21564 23837 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 protein_id gnl|my_center|LOCUS_21490 24079 25422 gene locus_tag LOCUS_21500 24079 25422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 25566 26852 gene locus_tag LOCUS_21510 gene ispG 25566 26852 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615358.1 protein_id gnl|my_center|LOCUS_21510 26870 28132 gene locus_tag LOCUS_21520 gene hisS 26870 28132 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 protein_id gnl|my_center|LOCUS_21520 28125 29441 gene locus_tag LOCUS_21530 gene hemA 28125 29441 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626014.1 protein_id gnl|my_center|LOCUS_21530 29438 30511 gene locus_tag LOCUS_21540 gene prfA 29438 30511 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388508.1 protein_id gnl|my_center|LOCUS_21540 30508 31425 gene locus_tag LOCUS_21550 gene prmC 30508 31425 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_21550 31611 32117 gene locus_tag LOCUS_21560 31611 32117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 32949 32131 gene locus_tag LOCUS_21570 32949 32131 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_21570 34550 32973 gene locus_tag LOCUS_21580 34550 32973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 35772 34987 gene locus_tag LOCUS_21590 35772 34987 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_21590 37700 36084 gene locus_tag LOCUS_21600 gene cimA 37700 36084 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence039 597 193 gene locus_tag LOCUS_21610 597 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 688 1038 gene locus_tag LOCUS_21620 688 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1242 1048 gene locus_tag LOCUS_21630 1242 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1418 1717 gene locus_tag LOCUS_21640 1418 1717 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_21640 1710 2051 gene locus_tag LOCUS_21650 1710 2051 CDS product DUF167 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391273.1 protein_id gnl|my_center|LOCUS_21650 2048 2947 gene locus_tag LOCUS_21660 gene folD 2048 2947 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_21660 3181 3987 gene locus_tag LOCUS_21670 3181 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 6658 4163 gene locus_tag LOCUS_21680 6658 4163 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968934.1 protein_id gnl|my_center|LOCUS_21680 7391 6819 gene locus_tag LOCUS_21690 gene napC 7391 6819 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 protein_id gnl|my_center|LOCUS_21690 8277 7528 gene locus_tag LOCUS_21700 8277 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 9715 8414 gene locus_tag LOCUS_21710 9715 8414 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071265.1 protein_id gnl|my_center|LOCUS_21710 11466 9712 gene locus_tag LOCUS_21720 11466 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 14278 11582 gene locus_tag LOCUS_21730 14278 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 15718 14639 gene locus_tag LOCUS_21740 15718 14639 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869031.1 protein_id gnl|my_center|LOCUS_21740 16535 15834 gene locus_tag LOCUS_21750 16535 15834 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390641.1 protein_id gnl|my_center|LOCUS_21750 16963 16532 gene locus_tag LOCUS_21760 16963 16532 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_21760 19298 17079 gene locus_tag LOCUS_21770 19298 17079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 21530 19311 gene locus_tag LOCUS_21780 21530 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921545.1 protein_id gnl|my_center|LOCUS_21780 22857 21550 gene locus_tag LOCUS_21790 22857 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 23129 24328 gene locus_tag LOCUS_21800 gene glgA 23129 24328 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_21800 24347 25660 gene locus_tag LOCUS_21810 24347 25660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 25688 27721 gene locus_tag LOCUS_21820 25688 27721 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389479.1 protein_id gnl|my_center|LOCUS_21820 27935 31198 gene locus_tag LOCUS_21830 gene treS 27935 31198 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389295.1 protein_id gnl|my_center|LOCUS_21830 31768 34359 gene locus_tag LOCUS_21840 31768 34359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 34381 36147 gene locus_tag LOCUS_21850 34381 36147 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_21850 36144 37577 gene locus_tag LOCUS_21860 36144 37577 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence040 701 246 gene locus_tag LOCUS_21870 701 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391427.1 protein_id gnl|my_center|LOCUS_21870 868 1629 gene locus_tag LOCUS_21880 868 1629 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_21880 1732 1965 gene locus_tag LOCUS_21890 1732 1965 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034798187.1 protein_id gnl|my_center|LOCUS_21890 1958 2251 gene locus_tag LOCUS_21900 1958 2251 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971677.1 protein_id gnl|my_center|LOCUS_21900 3028 2393 gene locus_tag LOCUS_21910 3028 2393 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_21910 3771 3025 gene locus_tag LOCUS_21920 gene cobS 3771 3025 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086039.1 protein_id gnl|my_center|LOCUS_21920 3900 4931 gene locus_tag LOCUS_21930 gene cobT 3900 4931 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388425.1 protein_id gnl|my_center|LOCUS_21930 4957 6357 gene locus_tag LOCUS_21940 4957 6357 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330170.1 protein_id gnl|my_center|LOCUS_21940 6837 6373 gene locus_tag LOCUS_21950 6837 6373 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_21950 7384 6887 gene locus_tag LOCUS_21960 7384 6887 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387840.1 protein_id gnl|my_center|LOCUS_21960 8029 7694 gene locus_tag LOCUS_21970 8029 7694 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_21970 8543 8052 gene locus_tag LOCUS_21980 8543 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 8647 9318 gene locus_tag LOCUS_21990 8647 9318 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_21990 10210 9302 gene locus_tag LOCUS_22000 10210 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 12714 10207 gene locus_tag LOCUS_22010 12714 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 12825 13394 gene locus_tag LOCUS_22020 12825 13394 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_22020 14075 13404 gene locus_tag LOCUS_22030 14075 13404 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_22030 14315 14905 gene locus_tag LOCUS_22040 14315 14905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 15326 15766 gene locus_tag LOCUS_22050 15326 15766 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274661.1 protein_id gnl|my_center|LOCUS_22050 15793 16212 gene locus_tag LOCUS_22060 15793 16212 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_22060 16377 17855 gene locus_tag LOCUS_22070 16377 17855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 18090 19193 gene locus_tag LOCUS_22080 18090 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22080 19252 20364 gene locus_tag LOCUS_22090 19252 20364 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_22090 20509 20673 gene locus_tag LOCUS_22100 20509 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 21452 20697 gene locus_tag LOCUS_22110 21452 20697 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_22110 22827 21634 gene locus_tag LOCUS_22120 22827 21634 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_22120 23264 25156 gene locus_tag LOCUS_22130 23264 25156 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_22130 25270 26820 gene locus_tag LOCUS_22140 25270 26820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 26817 27404 gene locus_tag LOCUS_22150 26817 27404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 27666 28739 gene locus_tag LOCUS_22160 gene fbaA 27666 28739 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_22160 28905 29579 gene locus_tag LOCUS_22170 28905 29579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22170 29652 31163 gene locus_tag LOCUS_22180 29652 31163 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391128.1 protein_id gnl|my_center|LOCUS_22180 31259 31582 gene locus_tag LOCUS_22190 31259 31582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 31527 31874 gene locus_tag LOCUS_22200 31527 31874 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626476.1 protein_id gnl|my_center|LOCUS_22200 33305 32313 gene locus_tag LOCUS_22210 33305 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 33841 33638 gene locus_tag LOCUS_22220 33841 33638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 34013 34252 gene locus_tag LOCUS_22230 34013 34252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 34626 34258 gene locus_tag LOCUS_22240 34626 34258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 35257 35847 gene locus_tag LOCUS_22250 35257 35847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 36253 35963 gene locus_tag LOCUS_22260 36253 35963 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_22260 36638 36847 gene locus_tag LOCUS_22270 36638 36847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 37153 36848 gene locus_tag LOCUS_22280 37153 36848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence041 1007 111 gene locus_tag LOCUS_22290 1007 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1232 1870 gene locus_tag LOCUS_22300 gene nudF 1232 1870 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 protein_id gnl|my_center|LOCUS_22300 1918 2940 gene locus_tag LOCUS_22310 1918 2940 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531459.1 protein_id gnl|my_center|LOCUS_22310 2950 3807 gene locus_tag LOCUS_22320 gene sseA 2950 3807 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_22320 3839 4696 gene locus_tag LOCUS_22330 gene sseA 3839 4696 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389305.1 protein_id gnl|my_center|LOCUS_22330 4753 5961 gene locus_tag LOCUS_22340 gene metC 4753 5961 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_22340 6428 7588 gene locus_tag LOCUS_22350 6428 7588 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077380485.1 protein_id gnl|my_center|LOCUS_22350 7588 8739 gene locus_tag LOCUS_22360 7588 8739 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077380485.1 protein_id gnl|my_center|LOCUS_22360 9128 10414 gene locus_tag LOCUS_22370 9128 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 11222 10431 gene locus_tag LOCUS_22380 gene znuB 11222 10431 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341611.1 protein_id gnl|my_center|LOCUS_22380 12018 11215 gene locus_tag LOCUS_22390 gene znuC 12018 11215 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266293.1 protein_id gnl|my_center|LOCUS_22390 12550 12026 gene locus_tag LOCUS_22400 12550 12026 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_22400 12630 13601 gene locus_tag LOCUS_22410 gene znuA 12630 13601 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_22410 13658 14059 gene locus_tag LOCUS_22420 gene hisI 13658 14059 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_22420 14056 15159 gene locus_tag LOCUS_22430 14056 15159 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_22430 16261 15143 gene locus_tag LOCUS_22440 16261 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 16722 17252 gene locus_tag LOCUS_22450 16722 17252 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_22450 17731 17387 gene locus_tag LOCUS_22460 17731 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 18037 18732 gene locus_tag LOCUS_22470 gene modA 18037 18732 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970293.1 protein_id gnl|my_center|LOCUS_22470 18739 19431 gene locus_tag LOCUS_22480 gene modB 18739 19431 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_22480 19436 20551 gene locus_tag LOCUS_22490 gene modC 19436 20551 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_22490 20816 21406 gene locus_tag LOCUS_22500 20816 21406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 21542 21955 gene locus_tag LOCUS_22510 21542 21955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 22473 22027 gene locus_tag LOCUS_22520 22473 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 23069 22470 gene locus_tag LOCUS_22530 23069 22470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 24064 23066 gene locus_tag LOCUS_22540 24064 23066 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_22540 24861 24061 gene locus_tag LOCUS_22550 24861 24061 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388722.1 protein_id gnl|my_center|LOCUS_22550 25343 24858 gene locus_tag LOCUS_22560 25343 24858 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399852.1 protein_id gnl|my_center|LOCUS_22560 25919 25353 gene locus_tag LOCUS_22570 25919 25353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 26154 27593 gene locus_tag LOCUS_22580 26154 27593 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391137.1 protein_id gnl|my_center|LOCUS_22580 27598 28533 gene locus_tag LOCUS_22590 27598 28533 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_22590 28544 29353 gene locus_tag LOCUS_22600 28544 29353 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967763.1 protein_id gnl|my_center|LOCUS_22600 29378 30121 gene locus_tag LOCUS_22610 29378 30121 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_22610 30262 30792 gene locus_tag LOCUS_22620 30262 30792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389320.1 protein_id gnl|my_center|LOCUS_22620 31217 32347 gene locus_tag LOCUS_22630 31217 32347 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_22630 32340 34502 gene locus_tag LOCUS_22640 32340 34502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 36212 34515 gene locus_tag LOCUS_22650 36212 34515 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_22650 36474 36202 gene locus_tag LOCUS_22660 36474 36202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 <37410 36471 gene locus_tag LOCUS_22670 <37410 36471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921413.1:proton-conducting transporter membrane subunit >Feature sequence042 152 1387 gene locus_tag LOCUS_22680 152 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1380 2081 gene locus_tag LOCUS_22690 1380 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2101 3240 gene locus_tag LOCUS_22700 2101 3240 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226109.1 protein_id gnl|my_center|LOCUS_22700 3237 4580 gene locus_tag LOCUS_22710 3237 4580 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_22710 5541 4537 gene locus_tag LOCUS_22720 5541 4537 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640348.1 protein_id gnl|my_center|LOCUS_22720 5601 7259 gene locus_tag LOCUS_22730 5601 7259 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_22730 7252 7767 gene locus_tag LOCUS_22740 7252 7767 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_22740 8278 7769 gene locus_tag LOCUS_22750 8278 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129608315.1 protein_id gnl|my_center|LOCUS_22750 8507 8289 gene locus_tag LOCUS_22760 8507 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 8488 11085 gene locus_tag LOCUS_22770 gene mutS 8488 11085 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_22770 11169 13946 gene locus_tag LOCUS_22780 11169 13946 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_22780 14017 15570 gene locus_tag LOCUS_22790 gene murJ 14017 15570 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_22790 15656 16654 gene locus_tag LOCUS_22800 gene trpS 15656 16654 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391282.1 protein_id gnl|my_center|LOCUS_22800 16750 17301 gene locus_tag LOCUS_22810 16750 17301 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_22810 17572 18549 gene locus_tag LOCUS_22820 17572 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 19559 18564 gene locus_tag LOCUS_22830 19559 18564 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_22830 19729 20319 gene locus_tag LOCUS_22840 19729 20319 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_22840 20890 20339 gene locus_tag LOCUS_22850 gene ddpX 20890 20339 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391509.1 protein_id gnl|my_center|LOCUS_22850 20968 21651 gene locus_tag LOCUS_22860 gene tsaB 20968 21651 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 protein_id gnl|my_center|LOCUS_22860 21648 22100 gene locus_tag LOCUS_22870 21648 22100 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391511.1 protein_id gnl|my_center|LOCUS_22870 23505 22264 gene locus_tag LOCUS_22880 23505 22264 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626639.1 protein_id gnl|my_center|LOCUS_22880 23826 24665 gene locus_tag LOCUS_22890 gene rsmI 23826 24665 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391440.1 protein_id gnl|my_center|LOCUS_22890 24662 25024 gene locus_tag LOCUS_22900 24662 25024 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083496.1 protein_id gnl|my_center|LOCUS_22900 25143 25742 gene locus_tag LOCUS_22910 gene dolP 25143 25742 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646043.1 protein_id gnl|my_center|LOCUS_22910 25739 26578 gene locus_tag LOCUS_22920 25739 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 27673 28623 gene locus_tag LOCUS_22930 gene gshB 27673 28623 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_22930 28814 29023 gene locus_tag LOCUS_22940 28814 29023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 29020 29244 gene locus_tag LOCUS_22950 29020 29244 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_22950 29340 30881 gene locus_tag LOCUS_22960 29340 30881 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_22960 30917 31210 gene locus_tag LOCUS_22970 30917 31210 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976351.1 protein_id gnl|my_center|LOCUS_22970 31516 31740 gene locus_tag LOCUS_22980 31516 31740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 32400 31747 gene locus_tag LOCUS_22990 32400 31747 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084104.1 protein_id gnl|my_center|LOCUS_22990 33261 32752 gene locus_tag LOCUS_23000 33261 32752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 33979 33611 gene locus_tag LOCUS_23010 33979 33611 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_23010 34316 33981 gene locus_tag LOCUS_23020 34316 33981 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391340.1 protein_id gnl|my_center|LOCUS_23020 35083 34313 gene locus_tag LOCUS_23030 gene hisF 35083 34313 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_23030 35823 35089 gene locus_tag LOCUS_23040 gene hisA 35823 35089 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_23040 36490 35846 gene locus_tag LOCUS_23050 gene hisH 36490 35846 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391343.1 protein_id gnl|my_center|LOCUS_23050 36861 36487 gene locus_tag LOCUS_23060 36861 36487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence043 284 1102 gene locus_tag LOCUS_23070 284 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2515 2360 gene locus_tag LOCUS_23080 2515 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2694 3149 gene locus_tag LOCUS_23090 2694 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5436 3175 gene locus_tag LOCUS_23100 5436 3175 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389289.1 protein_id gnl|my_center|LOCUS_23100 5554 6624 gene locus_tag LOCUS_23110 5554 6624 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530631.1 protein_id gnl|my_center|LOCUS_23110 6702 7715 gene locus_tag LOCUS_23120 6702 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 9011 7719 gene locus_tag LOCUS_23130 9011 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 10988 9216 gene locus_tag LOCUS_23140 10988 9216 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 protein_id gnl|my_center|LOCUS_23140 12007 11315 gene locus_tag LOCUS_23150 gene phoB 12007 11315 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_23150 12747 12004 gene locus_tag LOCUS_23160 gene phoU 12747 12004 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_23160 13640 12780 gene locus_tag LOCUS_23170 gene pstB 13640 12780 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529271.1 protein_id gnl|my_center|LOCUS_23170 14984 13653 gene locus_tag LOCUS_23180 gene pstA 14984 13653 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_23180 16359 14977 gene locus_tag LOCUS_23190 gene pstC 16359 14977 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_23190 17491 16457 gene locus_tag LOCUS_23200 17491 16457 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_23200 18957 17647 gene locus_tag LOCUS_23210 18957 17647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 19088 19798 gene locus_tag LOCUS_23220 19088 19798 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_23220 19795 20601 gene locus_tag LOCUS_23230 gene fetB 19795 20601 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_23230 20718 21527 gene locus_tag LOCUS_23240 20718 21527 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_23240 21524 22255 gene locus_tag LOCUS_23250 21524 22255 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939331.1 protein_id gnl|my_center|LOCUS_23250 22252 23901 gene locus_tag LOCUS_23260 22252 23901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 24030 24320 gene locus_tag LOCUS_23270 gene groES 24030 24320 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975443.1 protein_id gnl|my_center|LOCUS_23270 24355 25998 gene locus_tag LOCUS_23280 gene groL 24355 25998 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387923.1 protein_id gnl|my_center|LOCUS_23280 26204 28636 gene locus_tag LOCUS_23290 gene fxsT 26204 28636 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029781.1 protein_id gnl|my_center|LOCUS_23290 28696 30549 gene locus_tag LOCUS_23300 28696 30549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 30960 30556 gene locus_tag LOCUS_23310 30960 30556 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390786.1 protein_id gnl|my_center|LOCUS_23310 31158 31445 gene locus_tag LOCUS_23320 31158 31445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 31940 31452 gene locus_tag LOCUS_23330 31940 31452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 34693 31937 gene locus_tag LOCUS_23340 34693 31937 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_23340 34942 35313 gene locus_tag LOCUS_23350 34942 35313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 35652 35864 gene locus_tag LOCUS_23360 35652 35864 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_23360 35854 36075 gene locus_tag LOCUS_23370 35854 36075 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence044 573 313 gene locus_tag LOCUS_23380 573 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1036 1437 gene locus_tag LOCUS_23390 1036 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134761981.1 protein_id gnl|my_center|LOCUS_23390 1434 3167 gene locus_tag LOCUS_23400 1434 3167 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136619149.1 protein_id gnl|my_center|LOCUS_23400 5099 3576 gene locus_tag LOCUS_23410 5099 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 5537 7807 gene locus_tag LOCUS_23420 gene nosZ 5537 7807 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_23420 7887 8567 gene locus_tag LOCUS_23430 7887 8567 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_23430 8649 9356 gene locus_tag LOCUS_23440 8649 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 9438 10424 gene locus_tag LOCUS_23450 9438 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 10440 11750 gene locus_tag LOCUS_23460 10440 11750 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403089.1 protein_id gnl|my_center|LOCUS_23460 11763 12542 gene locus_tag LOCUS_23470 gene napG 11763 12542 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_23470 12539 13516 gene locus_tag LOCUS_23480 12539 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 13527 14465 gene locus_tag LOCUS_23490 13527 14465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902458.1 protein_id gnl|my_center|LOCUS_23490 14465 14947 gene locus_tag LOCUS_23500 14465 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 14954 15781 gene locus_tag LOCUS_23510 14954 15781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 15796 16452 gene locus_tag LOCUS_23520 15796 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 16508 17347 gene locus_tag LOCUS_23530 16508 17347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142942.1 protein_id gnl|my_center|LOCUS_23530 17509 18408 gene locus_tag LOCUS_23540 17509 18408 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920157.1 protein_id gnl|my_center|LOCUS_23540 19406 18435 gene locus_tag LOCUS_23550 gene menA 19406 18435 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_23550 20086 19847 gene locus_tag LOCUS_23560 20086 19847 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141679.1 protein_id gnl|my_center|LOCUS_23560 20235 20846 gene locus_tag LOCUS_23570 20235 20846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 21329 20874 gene locus_tag LOCUS_23580 21329 20874 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388478.1 protein_id gnl|my_center|LOCUS_23580 21476 22294 gene locus_tag LOCUS_23590 21476 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 22751 22314 gene locus_tag LOCUS_23600 22751 22314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 24028 23012 gene locus_tag LOCUS_23610 24028 23012 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968386.1 protein_id gnl|my_center|LOCUS_23610 25014 24025 gene locus_tag LOCUS_23620 25014 24025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 26624 25011 gene locus_tag LOCUS_23630 26624 25011 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011854072.1 protein_id gnl|my_center|LOCUS_23630 27856 26624 gene locus_tag LOCUS_23640 27856 26624 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084254.1 protein_id gnl|my_center|LOCUS_23640 28605 27859 gene locus_tag LOCUS_23650 28605 27859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 30005 28620 gene locus_tag LOCUS_23660 30005 28620 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859716.1 protein_id gnl|my_center|LOCUS_23660 30886 30017 gene locus_tag LOCUS_23670 gene cpaB 30886 30017 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 protein_id gnl|my_center|LOCUS_23670 31402 30899 gene locus_tag LOCUS_23680 31402 30899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 31808 31626 gene locus_tag LOCUS_23690 31808 31626 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209602232.1 protein_id gnl|my_center|LOCUS_23690 32218 33747 gene locus_tag LOCUS_23700 32218 33747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 33857 34192 gene locus_tag LOCUS_23710 33857 34192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 34412 34681 gene locus_tag LOCUS_23720 34412 34681 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143987.1 protein_id gnl|my_center|LOCUS_23720 34678 34983 gene locus_tag LOCUS_23730 34678 34983 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390987.1 protein_id gnl|my_center|LOCUS_23730 36148 35054 gene locus_tag LOCUS_23740 36148 35054 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948100.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence045 <1 581 gene locus_tag LOCUS_23750 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975246.1:CTP synthase 595 1233 gene locus_tag LOCUS_23760 595 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 1178 1909 gene locus_tag LOCUS_23770 1178 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23770 1906 2451 gene locus_tag LOCUS_23780 1906 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2499 3350 gene locus_tag LOCUS_23790 gene kdsA 2499 3350 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_23790 3382 4656 gene locus_tag LOCUS_23800 gene eno 3382 4656 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_23800 4961 5287 gene locus_tag LOCUS_23810 4961 5287 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087554.1 protein_id gnl|my_center|LOCUS_23810 5284 5616 gene locus_tag LOCUS_23820 5284 5616 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 protein_id gnl|my_center|LOCUS_23820 7353 6352 gene locus_tag LOCUS_23830 7353 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 7465 8211 gene locus_tag LOCUS_23840 gene fabG 7465 8211 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225822.1 protein_id gnl|my_center|LOCUS_23840 8865 8227 gene locus_tag LOCUS_23850 8865 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 9334 10416 gene locus_tag LOCUS_23860 9334 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 11465 10488 gene locus_tag LOCUS_23870 11465 10488 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640561.1 protein_id gnl|my_center|LOCUS_23870 13804 11465 gene locus_tag LOCUS_23880 gene xdhA 13804 11465 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_23880 14274 13801 gene locus_tag LOCUS_23890 14274 13801 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975049.1 protein_id gnl|my_center|LOCUS_23890 15610 14288 gene locus_tag LOCUS_23900 15610 14288 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389729.1 protein_id gnl|my_center|LOCUS_23900 17085 15649 gene locus_tag LOCUS_23910 17085 15649 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_23910 19247 17082 gene locus_tag LOCUS_23920 19247 17082 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 protein_id gnl|my_center|LOCUS_23920 20838 19252 gene locus_tag LOCUS_23930 20838 19252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 23576 20835 gene locus_tag LOCUS_23940 23576 20835 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_23940 24062 23607 gene locus_tag LOCUS_23950 24062 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 24189 24623 gene locus_tag LOCUS_23960 24189 24623 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064928.1 protein_id gnl|my_center|LOCUS_23960 24636 25100 gene locus_tag LOCUS_23970 24636 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 25731 25117 gene locus_tag LOCUS_23980 25731 25117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_23980 26591 25833 gene locus_tag LOCUS_23990 26591 25833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_23990 27565 26588 gene locus_tag LOCUS_24000 27565 26588 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_24000 28434 27562 gene locus_tag LOCUS_24010 28434 27562 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_24010 29730 28510 gene locus_tag LOCUS_24020 29730 28510 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 protein_id gnl|my_center|LOCUS_24020 30647 29874 gene locus_tag LOCUS_24030 30647 29874 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084062.1 protein_id gnl|my_center|LOCUS_24030 31576 30653 gene locus_tag LOCUS_24040 31576 30653 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_24040 31916 32101 gene locus_tag LOCUS_24050 31916 32101 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389492.1 protein_id gnl|my_center|LOCUS_24050 32114 32509 gene locus_tag LOCUS_24060 32114 32509 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123150893.1 protein_id gnl|my_center|LOCUS_24060 32940 33794 gene locus_tag LOCUS_24070 32940 33794 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_24070 33825 34115 gene locus_tag LOCUS_24080 33825 34115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence046 2236 1433 gene locus_tag LOCUS_24090 2236 1433 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067119.1 protein_id gnl|my_center|LOCUS_24090 3105 2236 gene locus_tag LOCUS_24100 3105 2236 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810946.1 protein_id gnl|my_center|LOCUS_24100 4205 3120 gene locus_tag LOCUS_24110 4205 3120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104697.1 protein_id gnl|my_center|LOCUS_24110 5298 4186 gene locus_tag LOCUS_24120 5298 4186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040012.1 protein_id gnl|my_center|LOCUS_24120 6833 5295 gene locus_tag LOCUS_24130 gene glpD 6833 5295 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531813.1 protein_id gnl|my_center|LOCUS_24130 7780 6998 gene locus_tag LOCUS_24140 7780 6998 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437127.1 protein_id gnl|my_center|LOCUS_24140 8022 9515 gene locus_tag LOCUS_24150 gene glpK 8022 9515 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_24150 12733 9560 gene locus_tag LOCUS_24160 12733 9560 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189169828.1 protein_id gnl|my_center|LOCUS_24160 12789 13127 gene locus_tag LOCUS_24170 12789 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 13613 14335 gene locus_tag LOCUS_24180 13613 14335 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_24180 15543 16310 gene locus_tag LOCUS_24190 15543 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 16386 17036 gene locus_tag LOCUS_24200 16386 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 17033 18355 gene locus_tag LOCUS_24210 17033 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 20162 18477 gene locus_tag LOCUS_24220 20162 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 20331 20256 gene locus_tag LOCUS_t00310 20331 20256 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20651 20442 gene locus_tag LOCUS_24230 gene yacG 20651 20442 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720789.1 protein_id gnl|my_center|LOCUS_24230 22104 20638 gene locus_tag LOCUS_24240 gene rng 22104 20638 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813204.1 protein_id gnl|my_center|LOCUS_24240 22701 22111 gene locus_tag LOCUS_24250 22701 22111 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390578.1 protein_id gnl|my_center|LOCUS_24250 22939 22721 gene locus_tag LOCUS_24260 gene infA 22939 22721 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327290.1 protein_id gnl|my_center|LOCUS_24260 23185 23613 gene locus_tag LOCUS_24270 23185 23613 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_24270 23959 23795 gene locus_tag LOCUS_24280 23959 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 24721 24092 gene locus_tag LOCUS_24290 24721 24092 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_24290 26033 25062 gene locus_tag LOCUS_24300 26033 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 26121 26333 gene locus_tag LOCUS_24310 26121 26333 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_24310 27255 26470 gene locus_tag LOCUS_24320 27255 26470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 27402 27893 gene locus_tag LOCUS_24330 gene purE 27402 27893 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529209.1 protein_id gnl|my_center|LOCUS_24330 27980 29803 gene locus_tag LOCUS_24340 27980 29803 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_24340 30628 30203 gene locus_tag LOCUS_24350 30628 30203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 31341 30625 gene locus_tag LOCUS_24360 31341 30625 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950692.1 protein_id gnl|my_center|LOCUS_24360 32187 31678 gene locus_tag LOCUS_24370 32187 31678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 32449 33591 gene locus_tag LOCUS_24380 32449 33591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence047 243 2471 gene locus_tag LOCUS_24390 gene parC 243 2471 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_24390 2620 3105 gene locus_tag LOCUS_24400 2620 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3011 3802 gene locus_tag LOCUS_24410 3011 3802 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170303643.1 protein_id gnl|my_center|LOCUS_24410 3864 5336 gene locus_tag LOCUS_24420 3864 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 5610 6404 gene locus_tag LOCUS_24430 5610 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 8117 6483 gene locus_tag LOCUS_24440 8117 6483 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_24440 8258 10180 gene locus_tag LOCUS_24450 8258 10180 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_24450 10271 10588 gene locus_tag LOCUS_24460 10271 10588 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_24460 10595 12097 gene locus_tag LOCUS_24470 10595 12097 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926191.1 protein_id gnl|my_center|LOCUS_24470 12612 13559 gene locus_tag LOCUS_24480 gene fabD 12612 13559 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_24480 13598 14335 gene locus_tag LOCUS_24490 gene fabG 13598 14335 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_24490 14422 14658 gene locus_tag LOCUS_24500 14422 14658 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_24500 14742 16004 gene locus_tag LOCUS_24510 gene fabF 14742 16004 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388177.1 protein_id gnl|my_center|LOCUS_24510 16001 16996 gene locus_tag LOCUS_24520 gene mltG 16001 16996 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388178.1 protein_id gnl|my_center|LOCUS_24520 17451 17128 gene locus_tag LOCUS_24530 17451 17128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 17700 18035 gene locus_tag LOCUS_24540 17700 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 18218 18027 gene locus_tag LOCUS_24550 18218 18027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 18499 18215 gene locus_tag LOCUS_24560 18499 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 19466 18741 gene locus_tag LOCUS_24570 19466 18741 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533476.1 protein_id gnl|my_center|LOCUS_24570 20921 19569 gene locus_tag LOCUS_24580 20921 19569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 21145 20948 gene locus_tag LOCUS_24590 21145 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 21811 21170 gene locus_tag LOCUS_24600 21811 21170 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338011.1 protein_id gnl|my_center|LOCUS_24600 22736 22017 gene locus_tag LOCUS_24610 22736 22017 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391142.1 protein_id gnl|my_center|LOCUS_24610 22748 23053 gene locus_tag LOCUS_24620 22748 23053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 23838 22990 gene locus_tag LOCUS_24630 23838 22990 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_24630 24758 24081 gene locus_tag LOCUS_24640 24758 24081 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 protein_id gnl|my_center|LOCUS_24640 25070 25459 gene locus_tag LOCUS_24650 25070 25459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 26430 25486 gene locus_tag LOCUS_24660 26430 25486 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_24660 28097 26412 gene locus_tag LOCUS_24670 28097 26412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 29557 28301 gene locus_tag LOCUS_24680 29557 28301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 29680 31821 gene locus_tag LOCUS_24690 29680 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 32117 31812 gene locus_tag LOCUS_24700 32117 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence048 163 2265 gene locus_tag LOCUS_24710 163 2265 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389571.1 protein_id gnl|my_center|LOCUS_24710 2843 2385 gene locus_tag LOCUS_24720 gene bamE 2843 2385 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389352.1 protein_id gnl|my_center|LOCUS_24720 2988 3551 gene locus_tag LOCUS_24730 2988 3551 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_24730 3548 4108 gene locus_tag LOCUS_24740 3548 4108 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_24740 4189 4371 gene locus_tag LOCUS_24750 gene rpmF 4189 4371 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_24750 4439 5470 gene locus_tag LOCUS_24760 gene plsX 4439 5470 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 protein_id gnl|my_center|LOCUS_24760 5470 6444 gene locus_tag LOCUS_24770 5470 6444 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389357.1 protein_id gnl|my_center|LOCUS_24770 6597 6869 gene locus_tag LOCUS_24780 6597 6869 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 protein_id gnl|my_center|LOCUS_24780 6872 7327 gene locus_tag LOCUS_24790 6872 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 7412 7488 gene locus_tag LOCUS_t00320 7412 7488 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7690 8190 gene locus_tag LOCUS_24800 7690 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 8875 8534 gene locus_tag LOCUS_24810 8875 8534 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184042971.1 protein_id gnl|my_center|LOCUS_24810 8997 9341 gene locus_tag LOCUS_24820 8997 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 9940 9698 gene locus_tag LOCUS_24830 9940 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 10048 10365 gene locus_tag LOCUS_24840 10048 10365 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_24840 11307 10387 gene locus_tag LOCUS_24850 11307 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 12571 11381 gene locus_tag LOCUS_24860 12571 11381 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_24860 12712 13512 gene locus_tag LOCUS_24870 gene ccsA 12712 13512 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626222.1 protein_id gnl|my_center|LOCUS_24870 13658 14590 gene locus_tag LOCUS_24880 gene dusB 13658 14590 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411626.1 protein_id gnl|my_center|LOCUS_24880 14590 15705 gene locus_tag LOCUS_24890 14590 15705 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389367.1 protein_id gnl|my_center|LOCUS_24890 15707 17149 gene locus_tag LOCUS_24900 gene ntrC 15707 17149 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_24900 17146 19440 gene locus_tag LOCUS_24910 17146 19440 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_24910 19451 20830 gene locus_tag LOCUS_24920 19451 20830 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_24920 20837 22213 gene locus_tag LOCUS_24930 gene trkA 20837 22213 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_24930 22223 23086 gene locus_tag LOCUS_24940 22223 23086 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389372.1 protein_id gnl|my_center|LOCUS_24940 23137 23739 gene locus_tag LOCUS_24950 23137 23739 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389373.1 protein_id gnl|my_center|LOCUS_24950 23890 24144 gene locus_tag LOCUS_24960 gene hfq 23890 24144 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 protein_id gnl|my_center|LOCUS_24960 24212 25528 gene locus_tag LOCUS_24970 gene hflX 24212 25528 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_24970 25698 27404 gene locus_tag LOCUS_24980 25698 27404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 27449 28255 gene locus_tag LOCUS_24990 27449 28255 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532140.1 protein_id gnl|my_center|LOCUS_24990 28877 28272 gene locus_tag LOCUS_25000 28877 28272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 29727 28930 gene locus_tag LOCUS_25010 gene mazG 29727 28930 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_25010 30666 29893 gene locus_tag LOCUS_25020 30666 29893 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_25020 31469 30663 gene locus_tag LOCUS_25030 31469 30663 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence049 1340 111 gene locus_tag LOCUS_25040 1340 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1807 1340 gene locus_tag LOCUS_25050 1807 1340 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 protein_id gnl|my_center|LOCUS_25050 2538 1999 gene locus_tag LOCUS_25060 2538 1999 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387795.1 protein_id gnl|my_center|LOCUS_25060 4535 2550 gene locus_tag LOCUS_25070 4535 2550 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_25070 5014 4532 gene locus_tag LOCUS_25080 gene ccmE 5014 4532 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_25080 5186 4998 gene locus_tag LOCUS_25090 5186 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 5919 5191 gene locus_tag LOCUS_25100 5919 5191 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_25100 6034 6348 gene locus_tag LOCUS_25110 6034 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 7476 6961 gene locus_tag LOCUS_25120 7476 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 7893 7714 gene locus_tag LOCUS_25130 7893 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 8230 7955 gene locus_tag LOCUS_25140 gene yefM 8230 7955 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259253.1 protein_id gnl|my_center|LOCUS_25140 8959 8294 gene locus_tag LOCUS_25150 gene ccmB 8959 8294 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387800.1 protein_id gnl|my_center|LOCUS_25150 9594 8956 gene locus_tag LOCUS_25160 gene ccmA 9594 8956 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_25160 11186 9954 gene locus_tag LOCUS_25170 11186 9954 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_25170 12193 11375 gene locus_tag LOCUS_25180 12193 11375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_25180 13579 12242 gene locus_tag LOCUS_25190 13579 12242 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528156.1 protein_id gnl|my_center|LOCUS_25190 14847 13720 gene locus_tag LOCUS_25200 14847 13720 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_25200 16096 14852 gene locus_tag LOCUS_25210 16096 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 17307 16132 gene locus_tag LOCUS_25220 17307 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 19328 17340 gene locus_tag LOCUS_25230 19328 17340 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_25230 19699 20211 gene locus_tag LOCUS_25240 19699 20211 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_25240 21991 20240 gene locus_tag LOCUS_25250 21991 20240 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391220.1 protein_id gnl|my_center|LOCUS_25250 22779 22261 gene locus_tag LOCUS_25260 22779 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 23399 22923 gene locus_tag LOCUS_25270 23399 22923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 23511 24449 gene locus_tag LOCUS_25280 23511 24449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 24904 24689 gene locus_tag LOCUS_25290 24904 24689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 25777 24914 gene locus_tag LOCUS_25300 25777 24914 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390910.1 protein_id gnl|my_center|LOCUS_25300 26545 25796 gene locus_tag LOCUS_25310 26545 25796 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 protein_id gnl|my_center|LOCUS_25310 28048 27602 gene locus_tag LOCUS_25320 28048 27602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 29029 29751 gene locus_tag LOCUS_25330 29029 29751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 30705 30397 gene locus_tag LOCUS_25340 30705 30397 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_25340 31002 30721 gene locus_tag LOCUS_25350 31002 30721 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_25350 31020 31214 gene locus_tag LOCUS_25360 31020 31214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence050 27 1238 gene locus_tag LOCUS_25370 gene hemA 27 1238 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390261.1 protein_id gnl|my_center|LOCUS_25370 1327 1881 gene locus_tag LOCUS_25380 1327 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390263.1 protein_id gnl|my_center|LOCUS_25380 3666 2026 gene locus_tag LOCUS_25390 3666 2026 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_25390 5690 5139 gene locus_tag LOCUS_25400 5690 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 6878 5943 gene locus_tag LOCUS_25410 6878 5943 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392264.1 protein_id gnl|my_center|LOCUS_25410 7370 6966 gene locus_tag LOCUS_25420 7370 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 7546 8271 gene locus_tag LOCUS_25430 7546 8271 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_25430 8268 9683 gene locus_tag LOCUS_25440 8268 9683 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029723090.1 protein_id gnl|my_center|LOCUS_25440 11411 9696 gene locus_tag LOCUS_25450 11411 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 12373 11474 gene locus_tag LOCUS_25460 12373 11474 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850619.1 protein_id gnl|my_center|LOCUS_25460 12741 12379 gene locus_tag LOCUS_25470 12741 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 12628 14523 gene locus_tag LOCUS_25480 12628 14523 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141384.1 protein_id gnl|my_center|LOCUS_25480 14744 16642 gene locus_tag LOCUS_25490 14744 16642 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_25490 16970 16653 gene locus_tag LOCUS_25500 gene hspQ 16970 16653 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 protein_id gnl|my_center|LOCUS_25500 17126 18655 gene locus_tag LOCUS_25510 17126 18655 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_25510 18873 20258 gene locus_tag LOCUS_25520 18873 20258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 20432 20902 gene locus_tag LOCUS_25530 20432 20902 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888850.1 protein_id gnl|my_center|LOCUS_25530 21326 21126 gene locus_tag LOCUS_25540 21326 21126 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 protein_id gnl|my_center|LOCUS_25540 21384 21992 gene locus_tag LOCUS_25550 21384 21992 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_25550 22103 22441 gene locus_tag LOCUS_25560 22103 22441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25560 23194 22451 gene locus_tag LOCUS_25570 23194 22451 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230275.1 protein_id gnl|my_center|LOCUS_25570 24627 23194 gene locus_tag LOCUS_25580 24627 23194 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_25580 24905 24672 gene locus_tag LOCUS_25590 24905 24672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 25425 25003 gene locus_tag LOCUS_25600 25425 25003 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_25600 25656 27326 gene locus_tag LOCUS_25610 25656 27326 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_25610 28052 27477 gene locus_tag LOCUS_25620 28052 27477 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705445.1 protein_id gnl|my_center|LOCUS_25620 28298 29281 gene locus_tag LOCUS_25630 28298 29281 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_25630 29314 29973 gene locus_tag LOCUS_25640 29314 29973 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_25640 30072 30356 gene locus_tag LOCUS_25650 30072 30356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 30353 30781 gene locus_tag LOCUS_25660 30353 30781 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence051 1926 853 gene locus_tag LOCUS_25670 gene adhP 1926 853 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_25670 2119 2526 gene locus_tag LOCUS_25680 2119 2526 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_25680 2549 3733 gene locus_tag LOCUS_25690 2549 3733 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_25690 4662 3805 gene locus_tag LOCUS_25700 4662 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 4977 5435 gene locus_tag LOCUS_25710 4977 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 6627 5458 gene locus_tag LOCUS_25720 6627 5458 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_25720 6766 8010 gene locus_tag LOCUS_25730 6766 8010 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921422.1 protein_id gnl|my_center|LOCUS_25730 8462 8142 gene locus_tag LOCUS_25740 8462 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 12225 9082 gene locus_tag LOCUS_25750 12225 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 12552 13706 gene locus_tag LOCUS_25760 12552 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 13894 14646 gene locus_tag LOCUS_25770 13894 14646 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_25770 15140 14688 gene locus_tag LOCUS_25780 15140 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 15548 15318 gene locus_tag LOCUS_25790 15548 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 15844 16659 gene locus_tag LOCUS_25800 15844 16659 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_25800 17700 16975 gene locus_tag LOCUS_25810 17700 16975 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391054.1 protein_id gnl|my_center|LOCUS_25810 18379 17813 gene locus_tag LOCUS_25820 18379 17813 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_25820 20568 18376 gene locus_tag LOCUS_25830 20568 18376 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_25830 20975 23182 gene locus_tag LOCUS_25840 20975 23182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 24908 23217 gene locus_tag LOCUS_25850 24908 23217 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_25850 26022 24934 gene locus_tag LOCUS_25860 gene porB 26022 24934 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_25860 27199 26024 gene locus_tag LOCUS_25870 27199 26024 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879197.1 protein_id gnl|my_center|LOCUS_25870 27758 27183 gene locus_tag LOCUS_25880 27758 27183 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_25880 28209 29225 gene locus_tag LOCUS_25890 gene nadA 28209 29225 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_25890 30326 29427 gene locus_tag LOCUS_25900 30326 29427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence052 2 1006 gene locus_tag LOCUS_25910 2 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1926 1015 gene locus_tag LOCUS_25920 1926 1015 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_25920 2070 2939 gene locus_tag LOCUS_25930 2070 2939 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_25930 2867 3865 gene locus_tag LOCUS_25940 2867 3865 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_25940 3951 5750 gene locus_tag LOCUS_25950 3951 5750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 protein_id gnl|my_center|LOCUS_25950 5758 6480 gene locus_tag LOCUS_25960 5758 6480 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_25960 6480 7760 gene locus_tag LOCUS_25970 6480 7760 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_25970 7747 8730 gene locus_tag LOCUS_25980 gene lpxK 7747 8730 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_25980 8727 9632 gene locus_tag LOCUS_25990 8727 9632 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_25990 9809 10657 gene locus_tag LOCUS_26000 9809 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 10707 10988 gene locus_tag LOCUS_26010 10707 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 11008 12534 gene locus_tag LOCUS_26020 gene kaiC 11008 12534 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391043.1 protein_id gnl|my_center|LOCUS_26020 13478 12663 gene locus_tag LOCUS_26030 13478 12663 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_26030 14899 13475 gene locus_tag LOCUS_26040 gene xseA 14899 13475 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387920.1 protein_id gnl|my_center|LOCUS_26040 14955 16229 gene locus_tag LOCUS_26050 gene purD 14955 16229 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_26050 16364 16984 gene locus_tag LOCUS_26060 16364 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625904.1 protein_id gnl|my_center|LOCUS_26060 18647 17031 gene locus_tag LOCUS_26070 18647 17031 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_26070 18883 19197 gene locus_tag LOCUS_26080 18883 19197 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314681.1 protein_id gnl|my_center|LOCUS_26080 19231 19479 gene locus_tag LOCUS_26090 19231 19479 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532091.1 protein_id gnl|my_center|LOCUS_26090 19942 19490 gene locus_tag LOCUS_26100 19942 19490 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532358.1 protein_id gnl|my_center|LOCUS_26100 20022 20750 gene locus_tag LOCUS_26110 20022 20750 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_26110 20750 21484 gene locus_tag LOCUS_26120 20750 21484 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388410.1 protein_id gnl|my_center|LOCUS_26120 21481 22098 gene locus_tag LOCUS_26130 gene rsmD 21481 22098 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532356.1 protein_id gnl|my_center|LOCUS_26130 22835 22044 gene locus_tag LOCUS_26140 22835 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390709.1 protein_id gnl|my_center|LOCUS_26140 24678 22891 gene locus_tag LOCUS_26150 gene mutL 24678 22891 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537966.1 protein_id gnl|my_center|LOCUS_26150 25579 24713 gene locus_tag LOCUS_26160 25579 24713 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_26160 25679 26071 gene locus_tag LOCUS_26170 25679 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 27715 26075 gene locus_tag LOCUS_26180 gene pgi 27715 26075 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_26180 27886 28428 gene locus_tag LOCUS_26190 27886 28428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 28725 28441 gene locus_tag LOCUS_26200 28725 28441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 29853 28858 gene locus_tag LOCUS_26210 29853 28858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence053 90 353 gene locus_tag LOCUS_26220 90 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 457 1137 gene locus_tag LOCUS_26230 457 1137 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532722.1 protein_id gnl|my_center|LOCUS_26230 1152 2021 gene locus_tag LOCUS_26240 1152 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2163 3032 gene locus_tag LOCUS_26250 2163 3032 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_26250 3203 4369 gene locus_tag LOCUS_26260 3203 4369 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930732.1 protein_id gnl|my_center|LOCUS_26260 4505 5377 gene locus_tag LOCUS_26270 gene hisG 4505 5377 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_26270 5805 5500 gene locus_tag LOCUS_26280 5805 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 6609 5848 gene locus_tag LOCUS_26290 6609 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 6857 7141 gene locus_tag LOCUS_26300 6857 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 8445 7222 gene locus_tag LOCUS_26310 8445 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 8646 9341 gene locus_tag LOCUS_26320 8646 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 9976 9428 gene locus_tag LOCUS_26330 9976 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 11267 10062 gene locus_tag LOCUS_26340 gene pcaF 11267 10062 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522007.1 protein_id gnl|my_center|LOCUS_26340 11721 11260 gene locus_tag LOCUS_26350 gene paaI 11721 11260 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535436.1 protein_id gnl|my_center|LOCUS_26350 13229 11718 gene locus_tag LOCUS_26360 13229 11718 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_26360 14298 13252 gene locus_tag LOCUS_26370 14298 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 14668 14306 gene locus_tag LOCUS_26380 14668 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 15548 14751 gene locus_tag LOCUS_26390 gene paaG 15548 14751 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_26390 15934 16539 gene locus_tag LOCUS_26400 gene caiE 15934 16539 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122894.1 protein_id gnl|my_center|LOCUS_26400 16661 16861 gene locus_tag LOCUS_26410 16661 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 16993 17262 gene locus_tag LOCUS_26420 16993 17262 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387921.1 protein_id gnl|my_center|LOCUS_26420 19350 17371 gene locus_tag LOCUS_26430 19350 17371 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209877314.1 protein_id gnl|my_center|LOCUS_26430 20137 19379 gene locus_tag LOCUS_26440 gene tpiA 20137 19379 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389642.1 protein_id gnl|my_center|LOCUS_26440 20349 22229 gene locus_tag LOCUS_26450 20349 22229 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389643.1 protein_id gnl|my_center|LOCUS_26450 22252 23766 gene locus_tag LOCUS_26460 gene trpE 22252 23766 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_26460 23827 24876 gene locus_tag LOCUS_26470 23827 24876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 24993 25727 gene locus_tag LOCUS_26480 24993 25727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 25946 25743 gene locus_tag LOCUS_26490 25946 25743 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389645.1 protein_id gnl|my_center|LOCUS_26490 27168 26020 gene locus_tag LOCUS_26500 27168 26020 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389646.1 protein_id gnl|my_center|LOCUS_26500 27911 27195 gene locus_tag LOCUS_26510 27911 27195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 28553 29695 gene locus_tag LOCUS_26520 28553 29695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence054 <1 1122 gene locus_tag LOCUS_26530 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390244.1:MFS transporter 1231 2082 gene locus_tag LOCUS_26540 1231 2082 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 protein_id gnl|my_center|LOCUS_26540 2117 3295 gene locus_tag LOCUS_26550 2117 3295 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_26550 3851 3306 gene locus_tag LOCUS_26560 3851 3306 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389495.1 protein_id gnl|my_center|LOCUS_26560 4440 3982 gene locus_tag LOCUS_26570 4440 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 4618 6033 gene locus_tag LOCUS_26580 gene pyk 4618 6033 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_26580 6063 6938 gene locus_tag LOCUS_26590 6063 6938 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_26590 6935 7831 gene locus_tag LOCUS_26600 gene rarD 6935 7831 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535550.1 protein_id gnl|my_center|LOCUS_26600 11297 7851 gene locus_tag LOCUS_26610 11297 7851 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390034.1 protein_id gnl|my_center|LOCUS_26610 12169 11405 gene locus_tag LOCUS_26620 12169 11405 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_26620 14482 12698 gene locus_tag LOCUS_26630 14482 12698 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_26630 14605 16410 gene locus_tag LOCUS_26640 14605 16410 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_26640 16472 17842 gene locus_tag LOCUS_26650 16472 17842 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_26650 17866 18189 gene locus_tag LOCUS_26660 17866 18189 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174327.1 protein_id gnl|my_center|LOCUS_26660 19216 18377 gene locus_tag LOCUS_26670 19216 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 20538 19222 gene locus_tag LOCUS_26680 20538 19222 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_26680 20732 21889 gene locus_tag LOCUS_26690 20732 21889 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_26690 21892 22311 gene locus_tag LOCUS_26700 21892 22311 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390031.1 protein_id gnl|my_center|LOCUS_26700 22324 23712 gene locus_tag LOCUS_26710 22324 23712 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_26710 23804 24025 gene locus_tag LOCUS_26720 23804 24025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 <27831 24064 gene locus_tag LOCUS_26730 <27831 24064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975001.1:calcium-binding protein >Feature sequence055 994 119 gene locus_tag LOCUS_26740 gene speE 994 119 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389381.1 protein_id gnl|my_center|LOCUS_26740 1434 991 gene locus_tag LOCUS_26750 gene speD 1434 991 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389382.1 protein_id gnl|my_center|LOCUS_26750 2173 1559 gene locus_tag LOCUS_26760 gene rpsD 2173 1559 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388459.1 protein_id gnl|my_center|LOCUS_26760 2881 2327 gene locus_tag LOCUS_26770 2881 2327 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 protein_id gnl|my_center|LOCUS_26770 3365 2994 gene locus_tag LOCUS_26780 3365 2994 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 protein_id gnl|my_center|LOCUS_26780 3923 3468 gene locus_tag LOCUS_26790 gene hicB 3923 3468 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 protein_id gnl|my_center|LOCUS_26790 4169 3975 gene locus_tag LOCUS_26800 4169 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 5035 4358 gene locus_tag LOCUS_26810 5035 4358 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_26810 5107 5994 gene locus_tag LOCUS_26820 gene gluQRS 5107 5994 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_26820 6010 7023 gene locus_tag LOCUS_26830 6010 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 7880 7035 gene locus_tag LOCUS_26840 7880 7035 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_26840 8202 7903 gene locus_tag LOCUS_26850 8202 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 8454 8936 gene locus_tag LOCUS_26860 8454 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 9473 9105 gene locus_tag LOCUS_26870 9473 9105 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_26870 9993 10490 gene locus_tag LOCUS_26880 9993 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 10706 10873 gene locus_tag LOCUS_26890 10706 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 11141 10803 gene locus_tag LOCUS_26900 11141 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 11580 11197 gene locus_tag LOCUS_26910 11580 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 12075 11584 gene locus_tag LOCUS_26920 12075 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 12407 12072 gene locus_tag LOCUS_26930 12407 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 12561 12863 gene locus_tag LOCUS_26940 gene mqsR 12561 12863 CDS product type II toxin-antitoxin system toxin MqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415585.1 protein_id gnl|my_center|LOCUS_26940 12860 13318 gene locus_tag LOCUS_26950 12860 13318 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809516.1 protein_id gnl|my_center|LOCUS_26950 14850 13327 gene locus_tag LOCUS_26960 14850 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 15216 14860 gene locus_tag LOCUS_26970 15216 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 15459 15256 gene locus_tag LOCUS_26980 15459 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 17124 15535 gene locus_tag LOCUS_26990 17124 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 17607 17152 gene locus_tag LOCUS_27000 17607 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 19595 17694 gene locus_tag LOCUS_27010 19595 17694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791750.1 protein_id gnl|my_center|LOCUS_27010 20164 19595 gene locus_tag LOCUS_27020 20164 19595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 20461 20901 gene locus_tag LOCUS_27030 20461 20901 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532281.1 protein_id gnl|my_center|LOCUS_27030 21201 20932 gene locus_tag LOCUS_27040 21201 20932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 22030 21212 gene locus_tag LOCUS_27050 22030 21212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 23493 22225 gene locus_tag LOCUS_27060 23493 22225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 24262 23660 gene locus_tag LOCUS_27070 24262 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 25035 24325 gene locus_tag LOCUS_27080 25035 24325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 25198 25046 gene locus_tag LOCUS_27090 25198 25046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 26900 25317 gene locus_tag LOCUS_27100 26900 25317 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064788614.1 protein_id gnl|my_center|LOCUS_27100 27115 26903 gene locus_tag LOCUS_27110 27115 26903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence056 176 1390 gene locus_tag LOCUS_27120 176 1390 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090273.1 protein_id gnl|my_center|LOCUS_27120 1407 2684 gene locus_tag LOCUS_27130 gene glcF 1407 2684 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401690.1 protein_id gnl|my_center|LOCUS_27130 3823 2849 gene locus_tag LOCUS_27140 3823 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 4241 5401 gene locus_tag LOCUS_27150 4241 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 5555 6952 gene locus_tag LOCUS_27160 5555 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 7449 8513 gene locus_tag LOCUS_27170 7449 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 8957 9030 gene locus_tag LOCUS_t00330 8957 9030 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9731 9090 gene locus_tag LOCUS_27180 gene thiE 9731 9090 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_27180 10213 9791 gene locus_tag LOCUS_27190 10213 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 11518 10511 gene locus_tag LOCUS_27200 gene gap 11518 10511 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 protein_id gnl|my_center|LOCUS_27200 11769 12005 gene locus_tag LOCUS_27210 11769 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 12005 12337 gene locus_tag LOCUS_27220 gene zapA 12005 12337 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388838.1 protein_id gnl|my_center|LOCUS_27220 12552 13142 gene locus_tag LOCUS_27230 12552 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 13139 13951 gene locus_tag LOCUS_27240 13139 13951 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_27240 13983 14744 gene locus_tag LOCUS_27250 13983 14744 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_27250 14761 14901 gene locus_tag LOCUS_27260 14761 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 15590 14973 gene locus_tag LOCUS_27270 15590 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 16038 16787 gene locus_tag LOCUS_27280 16038 16787 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388841.1 protein_id gnl|my_center|LOCUS_27280 16806 17312 gene locus_tag LOCUS_27290 gene ruvC 16806 17312 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_27290 17309 17947 gene locus_tag LOCUS_27300 gene ruvA 17309 17947 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388843.1 protein_id gnl|my_center|LOCUS_27300 17947 18987 gene locus_tag LOCUS_27310 gene ruvB 17947 18987 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_27310 18980 19459 gene locus_tag LOCUS_27320 gene ybgC 18980 19459 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 protein_id gnl|my_center|LOCUS_27320 19452 20177 gene locus_tag LOCUS_27330 gene tolQ 19452 20177 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388846.1 protein_id gnl|my_center|LOCUS_27330 20180 20662 gene locus_tag LOCUS_27340 gene tolR 20180 20662 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_27340 20679 21572 gene locus_tag LOCUS_27350 20679 21572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27350 21569 22906 gene locus_tag LOCUS_27360 gene tolB 21569 22906 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_27360 23085 23660 gene locus_tag LOCUS_27370 gene pal 23085 23660 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 protein_id gnl|my_center|LOCUS_27370 23795 24790 gene locus_tag LOCUS_27380 gene ybgF 23795 24790 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_27380 24781 26133 gene locus_tag LOCUS_27390 gene tilS 24781 26133 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388852.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence057 803 1633 gene locus_tag LOCUS_27400 803 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1637 2440 gene locus_tag LOCUS_27410 1637 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2443 2802 gene locus_tag LOCUS_27420 2443 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2827 5787 gene locus_tag LOCUS_27430 2827 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 5788 7008 gene locus_tag LOCUS_27440 5788 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7008 9317 gene locus_tag LOCUS_27450 7008 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 9410 9925 gene locus_tag LOCUS_27460 9410 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 9929 12496 gene locus_tag LOCUS_27470 9929 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 12512 15838 gene locus_tag LOCUS_27480 12512 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 15835 18360 gene locus_tag LOCUS_27490 15835 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183368010.1 protein_id gnl|my_center|LOCUS_27490 18843 18364 gene locus_tag LOCUS_27500 18843 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 19204 18932 gene locus_tag LOCUS_27510 19204 18932 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384043.1 protein_id gnl|my_center|LOCUS_27510 19445 19182 gene locus_tag LOCUS_27520 19445 19182 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719915.1 protein_id gnl|my_center|LOCUS_27520 19634 19834 gene locus_tag LOCUS_27530 19634 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 20248 19991 gene locus_tag LOCUS_27540 20248 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 20336 20530 gene locus_tag LOCUS_27550 20336 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 20605 21369 gene locus_tag LOCUS_27560 20605 21369 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148557.1 protein_id gnl|my_center|LOCUS_27560 21665 21429 gene locus_tag LOCUS_27570 21665 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 21861 22616 gene locus_tag LOCUS_27580 21861 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 22613 22861 gene locus_tag LOCUS_27590 22613 22861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 23114 23674 gene locus_tag LOCUS_27600 23114 23674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 23698 24057 gene locus_tag LOCUS_27610 23698 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 24061 25011 gene locus_tag LOCUS_27620 24061 25011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 25066 25278 gene locus_tag LOCUS_27630 25066 25278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 25262 25996 gene locus_tag LOCUS_27640 25262 25996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 25993 26211 gene locus_tag LOCUS_27650 25993 26211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 26208 26552 gene locus_tag LOCUS_27660 26208 26552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 26476 26742 gene locus_tag LOCUS_27670 26476 26742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence058 <1 3213 gene locus_tag LOCUS_27680 <1 3213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390194.1:vitamin B12-dependent ribonucleotide reductase 5289 3532 gene locus_tag LOCUS_27690 5289 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 5678 5295 gene locus_tag LOCUS_27700 5678 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 5880 6203 gene locus_tag LOCUS_27710 5880 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 7015 6458 gene locus_tag LOCUS_27720 7015 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 8201 7020 gene locus_tag LOCUS_27730 8201 7020 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104822.1 protein_id gnl|my_center|LOCUS_27730 9949 8345 gene locus_tag LOCUS_27740 9949 8345 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_27740 11663 9942 gene locus_tag LOCUS_27750 11663 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 12702 11677 gene locus_tag LOCUS_27760 12702 11677 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_27760 12850 13530 gene locus_tag LOCUS_27770 12850 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 13780 14601 gene locus_tag LOCUS_27780 13780 14601 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 protein_id gnl|my_center|LOCUS_27780 14626 15093 gene locus_tag LOCUS_27790 14626 15093 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_27790 15479 15111 gene locus_tag LOCUS_27800 15479 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 18487 15692 gene locus_tag LOCUS_27810 18487 15692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 20138 18639 gene locus_tag LOCUS_27820 20138 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 20820 20341 gene locus_tag LOCUS_27830 20820 20341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 20955 20830 gene locus_tag LOCUS_27840 20955 20830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 21861 21025 gene locus_tag LOCUS_27850 21861 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 24266 22251 gene locus_tag LOCUS_27860 24266 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 24483 25676 gene locus_tag LOCUS_27870 24483 25676 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_27870 25931 26533 gene locus_tag LOCUS_27880 25931 26533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence059 2370 1933 gene locus_tag LOCUS_27890 2370 1933 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_27890 2573 2929 gene locus_tag LOCUS_27900 2573 2929 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969264.1 protein_id gnl|my_center|LOCUS_27900 4159 3068 gene locus_tag LOCUS_27910 4159 3068 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_27910 5271 4156 gene locus_tag LOCUS_27920 5271 4156 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243787.1 protein_id gnl|my_center|LOCUS_27920 6148 5288 gene locus_tag LOCUS_27930 6148 5288 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_27930 8132 6162 gene locus_tag LOCUS_27940 8132 6162 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395919.1 protein_id gnl|my_center|LOCUS_27940 9307 8201 gene locus_tag LOCUS_27950 9307 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 9534 10202 gene locus_tag LOCUS_27960 9534 10202 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200763.1 protein_id gnl|my_center|LOCUS_27960 10199 11596 gene locus_tag LOCUS_27970 10199 11596 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532453.1 protein_id gnl|my_center|LOCUS_27970 11910 13292 gene locus_tag LOCUS_27980 gene tcuA 11910 13292 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065185.1 protein_id gnl|my_center|LOCUS_27980 13282 14412 gene locus_tag LOCUS_27990 gene tcuB 13282 14412 CDS product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930078.1 protein_id gnl|my_center|LOCUS_27990 14458 15408 gene locus_tag LOCUS_28000 14458 15408 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224591.1 protein_id gnl|my_center|LOCUS_28000 15405 15689 gene locus_tag LOCUS_28010 15405 15689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090162.1 protein_id gnl|my_center|LOCUS_28010 15809 17182 gene locus_tag LOCUS_28020 15809 17182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 18272 17325 gene locus_tag LOCUS_28030 18272 17325 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_28030 18365 19063 gene locus_tag LOCUS_28040 18365 19063 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388128.1 protein_id gnl|my_center|LOCUS_28040 19163 19414 gene locus_tag LOCUS_28050 19163 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 19727 19422 gene locus_tag LOCUS_28060 19727 19422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 21919 19727 gene locus_tag LOCUS_28070 21919 19727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 22725 21916 gene locus_tag LOCUS_28080 22725 21916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_28080 23153 22722 gene locus_tag LOCUS_28090 23153 22722 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_28090 23303 23680 gene locus_tag LOCUS_28100 23303 23680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence060 517 224 gene locus_tag LOCUS_28110 517 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 773 522 gene locus_tag LOCUS_28120 773 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2046 802 gene locus_tag LOCUS_28130 2046 802 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_28130 3963 2116 gene locus_tag LOCUS_28140 3963 2116 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_28140 4458 3976 gene locus_tag LOCUS_28150 4458 3976 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_28150 4743 6317 gene locus_tag LOCUS_28160 4743 6317 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040058.1 protein_id gnl|my_center|LOCUS_28160 6314 7234 gene locus_tag LOCUS_28170 6314 7234 CDS product XamI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040059.1 protein_id gnl|my_center|LOCUS_28170 7911 7276 gene locus_tag LOCUS_28180 7911 7276 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085315.1 protein_id gnl|my_center|LOCUS_28180 9516 7942 gene locus_tag LOCUS_28190 gene serA 9516 7942 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921048.1 protein_id gnl|my_center|LOCUS_28190 10732 9557 gene locus_tag LOCUS_28200 10732 9557 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_28200 10877 11245 gene locus_tag LOCUS_28210 10877 11245 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_28210 11251 11580 gene locus_tag LOCUS_28220 11251 11580 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_28220 12058 11660 gene locus_tag LOCUS_28230 gene pspC 12058 11660 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024941345.1 protein_id gnl|my_center|LOCUS_28230 12282 12055 gene locus_tag LOCUS_28240 gene pspB 12282 12055 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388972.1 protein_id gnl|my_center|LOCUS_28240 13012 12332 gene locus_tag LOCUS_28250 gene pspA 13012 12332 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 protein_id gnl|my_center|LOCUS_28250 13225 14253 gene locus_tag LOCUS_28260 gene pspF 13225 14253 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_28260 14439 15551 gene locus_tag LOCUS_28270 14439 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 15548 16114 gene locus_tag LOCUS_28280 15548 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 16523 16119 gene locus_tag LOCUS_28290 16523 16119 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_28290 16788 16624 gene locus_tag LOCUS_28300 16788 16624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 17302 18429 gene locus_tag LOCUS_28310 17302 18429 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_28310 19225 18458 gene locus_tag LOCUS_28320 19225 18458 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625959.1 protein_id gnl|my_center|LOCUS_28320 19384 20253 gene locus_tag LOCUS_28330 19384 20253 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806887.1 protein_id gnl|my_center|LOCUS_28330 20395 20643 gene locus_tag LOCUS_28340 20395 20643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 22047 20833 gene locus_tag LOCUS_28350 22047 20833 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_28350 22287 22364 gene locus_tag LOCUS_t00340 22287 22364 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 22422 22628 gene locus_tag LOCUS_28360 22422 22628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 22842 23324 gene locus_tag LOCUS_28370 22842 23324 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192281448.1 protein_id gnl|my_center|LOCUS_28370 23419 24786 gene locus_tag LOCUS_28380 23419 24786 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_28380 24984 24844 gene locus_tag LOCUS_28390 24984 24844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 25797 25072 gene locus_tag LOCUS_28400 25797 25072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170101.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence061 1299 667 gene locus_tag LOCUS_28410 1299 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3635 1314 gene locus_tag LOCUS_28420 3635 1314 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_28420 3997 3647 gene locus_tag LOCUS_28430 3997 3647 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_28430 5121 3994 gene locus_tag LOCUS_28440 gene nifV 5121 3994 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_28440 5458 5135 gene locus_tag LOCUS_28450 5458 5135 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389926.1 protein_id gnl|my_center|LOCUS_28450 6177 5572 gene locus_tag LOCUS_28460 6177 5572 CDS product nitrogen fixation protein NifQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389936.1 protein_id gnl|my_center|LOCUS_28460 6505 6203 gene locus_tag LOCUS_28470 gene fdxB 6505 6203 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389937.1 protein_id gnl|my_center|LOCUS_28470 7005 6529 gene locus_tag LOCUS_28480 7005 6529 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533485.1 protein_id gnl|my_center|LOCUS_28480 7511 7005 gene locus_tag LOCUS_28490 gene nifX 7511 7005 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440142.1 protein_id gnl|my_center|LOCUS_28490 8853 7489 gene locus_tag LOCUS_28500 gene nifN 8853 7489 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_28500 10250 8850 gene locus_tag LOCUS_28510 gene nifE 10250 8850 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389941.1 protein_id gnl|my_center|LOCUS_28510 11808 10270 gene locus_tag LOCUS_28520 gene nifK 11808 10270 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338303.1 protein_id gnl|my_center|LOCUS_28520 13307 11853 gene locus_tag LOCUS_28530 gene nifD 13307 11853 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388766.1 protein_id gnl|my_center|LOCUS_28530 14244 13351 gene locus_tag LOCUS_28540 gene nifH 14244 13351 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084578.1 protein_id gnl|my_center|LOCUS_28540 14578 15396 gene locus_tag LOCUS_28550 14578 15396 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626076.1 protein_id gnl|my_center|LOCUS_28550 15420 16319 gene locus_tag LOCUS_28560 gene draG 15420 16319 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_28560 17199 16330 gene locus_tag LOCUS_28570 gene modC 17199 16330 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388460.1 protein_id gnl|my_center|LOCUS_28570 17888 17202 gene locus_tag LOCUS_28580 gene modB 17888 17202 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_28580 18666 17872 gene locus_tag LOCUS_28590 gene modA 18666 17872 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388462.1 protein_id gnl|my_center|LOCUS_28590 18878 18663 gene locus_tag LOCUS_28600 gene nifT 18878 18663 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388753.1 protein_id gnl|my_center|LOCUS_28600 19142 18879 gene locus_tag LOCUS_28610 19142 18879 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720708.1 protein_id gnl|my_center|LOCUS_28610 19339 19148 gene locus_tag LOCUS_28620 19339 19148 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456679.1 protein_id gnl|my_center|LOCUS_28620 20848 19382 gene locus_tag LOCUS_28630 gene nifB 20848 19382 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338307.1 protein_id gnl|my_center|LOCUS_28630 22600 21014 gene locus_tag LOCUS_28640 gene nifA 22600 21014 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388748.1 protein_id gnl|my_center|LOCUS_28640 23155 24033 gene locus_tag LOCUS_28650 23155 24033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence062 2646 238 gene locus_tag LOCUS_28660 2646 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 3936 2650 gene locus_tag LOCUS_28670 gene lysA 3936 2650 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720913.1 protein_id gnl|my_center|LOCUS_28670 4133 3960 gene locus_tag LOCUS_28680 4133 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 5515 4145 gene locus_tag LOCUS_28690 gene argH 5515 4145 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388156.1 protein_id gnl|my_center|LOCUS_28690 5585 6142 gene locus_tag LOCUS_28700 5585 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 6231 7244 gene locus_tag LOCUS_28710 6231 7244 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023154.1 protein_id gnl|my_center|LOCUS_28710 7241 8266 gene locus_tag LOCUS_28720 7241 8266 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_28720 8382 11198 gene locus_tag LOCUS_28730 8382 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 11270 11575 gene locus_tag LOCUS_28740 11270 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 11664 13694 gene locus_tag LOCUS_28750 11664 13694 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_28750 13714 14604 gene locus_tag LOCUS_28760 gene fdhD 13714 14604 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966588.1 protein_id gnl|my_center|LOCUS_28760 14738 17524 gene locus_tag LOCUS_28770 14738 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 17762 20578 gene locus_tag LOCUS_28780 gene prsT 17762 20578 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390845.1 protein_id gnl|my_center|LOCUS_28780 20754 21533 gene locus_tag LOCUS_28790 20754 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 22673 21711 gene locus_tag LOCUS_28800 22673 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 24236 23103 gene locus_tag LOCUS_28810 gene wecB 24236 23103 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867673.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence063 410 2764 gene locus_tag LOCUS_28820 gene glgB 410 2764 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_28820 2724 4850 gene locus_tag LOCUS_28830 gene glgX 2724 4850 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_28830 4881 7061 gene locus_tag LOCUS_28840 gene malQ 4881 7061 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389297.1 protein_id gnl|my_center|LOCUS_28840 7262 8527 gene locus_tag LOCUS_28850 7262 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 11066 8604 gene locus_tag LOCUS_28860 11066 8604 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389899.1 protein_id gnl|my_center|LOCUS_28860 12607 11135 gene locus_tag LOCUS_28870 gene glgA 12607 11135 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_28870 12870 14147 gene locus_tag LOCUS_28880 gene glgC 12870 14147 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_28880 15818 14544 gene locus_tag LOCUS_28890 15818 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 18499 16451 gene locus_tag LOCUS_28900 18499 16451 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085126.1 protein_id gnl|my_center|LOCUS_28900 19123 18521 gene locus_tag LOCUS_28910 19123 18521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 19331 21088 gene locus_tag LOCUS_28920 19331 21088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 21118 22419 gene locus_tag LOCUS_28930 21118 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 23336 22713 gene locus_tag LOCUS_28940 23336 22713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 23478 23969 gene locus_tag LOCUS_28950 23478 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 24013 24456 gene locus_tag LOCUS_28960 24013 24456 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974564.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence064 434 2026 gene locus_tag LOCUS_28970 434 2026 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086531.1 protein_id gnl|my_center|LOCUS_28970 2335 2120 gene locus_tag LOCUS_28980 2335 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 2349 2828 gene locus_tag LOCUS_28990 2349 2828 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530129.1 protein_id gnl|my_center|LOCUS_28990 3459 2839 gene locus_tag LOCUS_29000 3459 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_29000 5196 3574 gene locus_tag LOCUS_29010 5196 3574 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_29010 5819 5322 gene locus_tag LOCUS_29020 5819 5322 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089258.1 protein_id gnl|my_center|LOCUS_29020 7032 6223 gene locus_tag LOCUS_29030 7032 6223 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106691.1 protein_id gnl|my_center|LOCUS_29030 7103 8044 gene locus_tag LOCUS_29040 gene thyX 7103 8044 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_29040 8509 8084 gene locus_tag LOCUS_29050 8509 8084 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_29050 8739 8506 gene locus_tag LOCUS_29060 8739 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967281.1 protein_id gnl|my_center|LOCUS_29060 10003 8897 gene locus_tag LOCUS_29070 10003 8897 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528006.1 protein_id gnl|my_center|LOCUS_29070 9884 10117 gene locus_tag LOCUS_29080 9884 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 10314 11276 gene locus_tag LOCUS_29090 gene hflK 10314 11276 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_29090 11273 12178 gene locus_tag LOCUS_29100 gene hflC 11273 12178 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_29100 12281 12478 gene locus_tag LOCUS_29110 12281 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 12663 14171 gene locus_tag LOCUS_29120 12663 14171 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_29120 14396 15760 gene locus_tag LOCUS_29130 14396 15760 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_29130 15769 16998 gene locus_tag LOCUS_29140 15769 16998 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_29140 17137 17388 gene locus_tag LOCUS_29150 17137 17388 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390813.1 protein_id gnl|my_center|LOCUS_29150 17472 18038 gene locus_tag LOCUS_29160 17472 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 18113 18445 gene locus_tag LOCUS_29170 18113 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 18442 18747 gene locus_tag LOCUS_29180 18442 18747 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626476.1 protein_id gnl|my_center|LOCUS_29180 18862 19467 gene locus_tag LOCUS_29190 18862 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 21017 20487 gene locus_tag LOCUS_29200 21017 20487 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301452.1 protein_id gnl|my_center|LOCUS_29200 21298 21005 gene locus_tag LOCUS_29210 21298 21005 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801912.1 protein_id gnl|my_center|LOCUS_29210 22778 21930 gene locus_tag LOCUS_29220 22778 21930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 22941 23423 gene locus_tag LOCUS_29230 gene ruvX 22941 23423 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390926.1 protein_id gnl|my_center|LOCUS_29230 23420 24343 gene locus_tag LOCUS_29240 23420 24343 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence065 2726 1671 gene locus_tag LOCUS_29250 2726 1671 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_29250 6832 4160 gene locus_tag LOCUS_29260 6832 4160 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_29260 7166 6825 gene locus_tag LOCUS_29270 gene nirD 7166 6825 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_29270 9626 7182 gene locus_tag LOCUS_29280 gene nirB 9626 7182 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530460.1 protein_id gnl|my_center|LOCUS_29280 11368 9644 gene locus_tag LOCUS_29290 11368 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 12393 11383 gene locus_tag LOCUS_29300 12393 11383 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_29300 13885 12467 gene locus_tag LOCUS_29310 13885 12467 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_29310 14754 14233 gene locus_tag LOCUS_29320 14754 14233 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_29320 14686 15045 gene locus_tag LOCUS_29330 14686 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 15279 17552 gene locus_tag LOCUS_29340 15279 17552 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994151.1 protein_id gnl|my_center|LOCUS_29340 17607 18044 gene locus_tag LOCUS_29350 17607 18044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 18137 21289 gene locus_tag LOCUS_29360 18137 21289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 21305 21850 gene locus_tag LOCUS_29370 21305 21850 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_29370 21867 22253 gene locus_tag LOCUS_29380 21867 22253 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_29380 22253 23287 gene locus_tag LOCUS_29390 22253 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence066 183 419 gene locus_tag LOCUS_29400 183 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 575 1159 gene locus_tag LOCUS_29410 575 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1162 1626 gene locus_tag LOCUS_29420 1162 1626 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_29420 1623 3272 gene locus_tag LOCUS_29430 1623 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 3560 3470 gene locus_tag LOCUS_t00350 3560 3470 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3869 3783 gene locus_tag LOCUS_t00360 3869 3783 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4394 5470 gene locus_tag LOCUS_29440 4394 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 5557 6621 gene locus_tag LOCUS_29450 5557 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 6714 7406 gene locus_tag LOCUS_29460 6714 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 7573 7439 gene locus_tag LOCUS_29470 7573 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 7621 8922 gene locus_tag LOCUS_29480 7621 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 9571 9215 gene locus_tag LOCUS_29490 9571 9215 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640651.1 protein_id gnl|my_center|LOCUS_29490 9866 9561 gene locus_tag LOCUS_29500 9866 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 11967 10612 gene locus_tag LOCUS_29510 11967 10612 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625924.1 protein_id gnl|my_center|LOCUS_29510 12363 12097 gene locus_tag LOCUS_29520 12363 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 13040 12360 gene locus_tag LOCUS_29530 13040 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 13588 12989 gene locus_tag LOCUS_29540 13588 12989 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440306.1 protein_id gnl|my_center|LOCUS_29540 13625 14650 gene locus_tag LOCUS_29550 13625 14650 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 protein_id gnl|my_center|LOCUS_29550 14664 15548 gene locus_tag LOCUS_29560 14664 15548 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_29560 15552 18245 gene locus_tag LOCUS_29570 15552 18245 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388124.1 protein_id gnl|my_center|LOCUS_29570 18242 20305 gene locus_tag LOCUS_29580 18242 20305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388125.1 protein_id gnl|my_center|LOCUS_29580 21271 20387 gene locus_tag LOCUS_29590 gene rpoH 21271 20387 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_29590 22417 21410 gene locus_tag LOCUS_29600 22417 21410 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_29600 22404 22739 gene locus_tag LOCUS_29610 22404 22739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 22736 23194 gene locus_tag LOCUS_29620 22736 23194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 23271 23346 gene locus_tag LOCUS_t00370 23271 23346 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence067 498 154 gene locus_tag LOCUS_29630 498 154 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390473.1 protein_id gnl|my_center|LOCUS_29630 746 1177 gene locus_tag LOCUS_29640 746 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2745 1324 gene locus_tag LOCUS_29650 2745 1324 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965780.1 protein_id gnl|my_center|LOCUS_29650 2897 3931 gene locus_tag LOCUS_29660 2897 3931 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389350.1 protein_id gnl|my_center|LOCUS_29660 4322 3918 gene locus_tag LOCUS_29670 4322 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 4663 5025 gene locus_tag LOCUS_29680 4663 5025 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_29680 5250 6452 gene locus_tag LOCUS_29690 gene metZ 5250 6452 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390962.1 protein_id gnl|my_center|LOCUS_29690 7245 6622 gene locus_tag LOCUS_29700 7245 6622 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_29700 7867 7409 gene locus_tag LOCUS_29710 7867 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 8372 7965 gene locus_tag LOCUS_29720 8372 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 8556 11000 gene locus_tag LOCUS_29730 gene copA1 8556 11000 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_29730 11021 12151 gene locus_tag LOCUS_29740 11021 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 13076 12126 gene locus_tag LOCUS_29750 13076 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 13770 13345 gene locus_tag LOCUS_29760 13770 13345 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_29760 13987 17490 gene locus_tag LOCUS_29770 13987 17490 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_29770 17613 17870 gene locus_tag LOCUS_29780 17613 17870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 17857 18138 gene locus_tag LOCUS_29790 17857 18138 CDS product type II toxin-antitoxin system mRNA interferase toxin, HP0892 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955518.1 protein_id gnl|my_center|LOCUS_29790 18128 18277 gene locus_tag LOCUS_29800 18128 18277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 18465 18770 gene locus_tag LOCUS_29810 18465 18770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 18834 19025 gene locus_tag LOCUS_29820 18834 19025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 19298 19600 gene locus_tag LOCUS_29830 19298 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 20001 20267 gene locus_tag LOCUS_29840 20001 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 20552 20683 gene locus_tag LOCUS_29850 20552 20683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 20750 21508 gene locus_tag LOCUS_29860 20750 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 22125 21577 gene locus_tag LOCUS_29870 22125 21577 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388541.1 protein_id gnl|my_center|LOCUS_29870 22482 22144 gene locus_tag LOCUS_29880 22482 22144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence068 223 1173 gene locus_tag LOCUS_29890 gene mdh 223 1173 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388965.1 protein_id gnl|my_center|LOCUS_29890 1219 2388 gene locus_tag LOCUS_29900 gene sucC 1219 2388 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_29900 2388 3263 gene locus_tag LOCUS_29910 gene sucD 2388 3263 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_29910 3325 6249 gene locus_tag LOCUS_29920 3325 6249 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_29920 6292 7626 gene locus_tag LOCUS_29930 gene odhB 6292 7626 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972452.1 protein_id gnl|my_center|LOCUS_29930 7736 8014 gene locus_tag LOCUS_29940 7736 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 8044 8646 gene locus_tag LOCUS_29950 gene dcd 8044 8646 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_29950 8691 10100 gene locus_tag LOCUS_29960 gene lpdA 8691 10100 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_29960 10209 10994 gene locus_tag LOCUS_29970 10209 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 11594 11181 gene locus_tag LOCUS_29980 11594 11181 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_29980 11839 11591 gene locus_tag LOCUS_29990 11839 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 12050 12310 gene locus_tag LOCUS_30000 12050 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 12392 12673 gene locus_tag LOCUS_30010 12392 12673 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_30010 12685 12978 gene locus_tag LOCUS_30020 12685 12978 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_30020 13024 14226 gene locus_tag LOCUS_30030 13024 14226 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965724.1 protein_id gnl|my_center|LOCUS_30030 15308 14361 gene locus_tag LOCUS_30040 15308 14361 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388975.1 protein_id gnl|my_center|LOCUS_30040 16039 15305 gene locus_tag LOCUS_30050 16039 15305 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918234.1 protein_id gnl|my_center|LOCUS_30050 16080 18287 gene locus_tag LOCUS_30060 16080 18287 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970369.1 protein_id gnl|my_center|LOCUS_30060 18982 18272 gene locus_tag LOCUS_30070 18982 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 19336 19896 gene locus_tag LOCUS_30080 19336 19896 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_30080 19896 21428 gene locus_tag LOCUS_30090 gene atpA 19896 21428 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388979.1 protein_id gnl|my_center|LOCUS_30090 21456 22349 gene locus_tag LOCUS_30100 21456 22349 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence069 2998 2039 gene locus_tag LOCUS_30110 2998 2039 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_30110 3291 3443 gene locus_tag LOCUS_30120 3291 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3552 4655 gene locus_tag LOCUS_30130 3552 4655 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_30130 4717 5844 gene locus_tag LOCUS_30140 4717 5844 CDS product alpha-1,4-polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390399.1 protein_id gnl|my_center|LOCUS_30140 9036 5848 gene locus_tag LOCUS_30150 9036 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 9937 9230 gene locus_tag LOCUS_30160 gene cobC 9937 9230 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_30160 10907 9969 gene locus_tag LOCUS_30170 10907 9969 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_30170 12146 11208 gene locus_tag LOCUS_30180 12146 11208 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_30180 13407 12205 gene locus_tag LOCUS_30190 gene nhaA 13407 12205 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387889.1 protein_id gnl|my_center|LOCUS_30190 13649 14566 gene locus_tag LOCUS_30200 13649 14566 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036667.1 protein_id gnl|my_center|LOCUS_30200 14617 15609 gene locus_tag LOCUS_30210 14617 15609 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_30210 16606 15623 gene locus_tag LOCUS_30220 gene ala 16606 15623 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_30220 17277 18554 gene locus_tag LOCUS_30230 17277 18554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 18541 19626 gene locus_tag LOCUS_30240 18541 19626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 21837 21004 gene locus_tag LOCUS_30250 21837 21004 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083358.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence070 575 1942 gene locus_tag LOCUS_30260 575 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2850 2017 gene locus_tag LOCUS_30270 2850 2017 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_30270 4484 2847 gene locus_tag LOCUS_30280 4484 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 4627 5325 gene locus_tag LOCUS_30290 4627 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 6128 5451 gene locus_tag LOCUS_30300 6128 5451 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_30300 6796 6128 gene locus_tag LOCUS_30310 6796 6128 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605277.1 protein_id gnl|my_center|LOCUS_30310 7283 6831 gene locus_tag LOCUS_30320 7283 6831 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 protein_id gnl|my_center|LOCUS_30320 7553 7302 gene locus_tag LOCUS_30330 gene moaD 7553 7302 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_30330 8806 7550 gene locus_tag LOCUS_30340 8806 7550 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_30340 9369 8803 gene locus_tag LOCUS_30350 gene mobB 9369 8803 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039619.1 protein_id gnl|my_center|LOCUS_30350 9952 9380 gene locus_tag LOCUS_30360 gene pgsA 9952 9380 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_30360 10487 10065 gene locus_tag LOCUS_30370 10487 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 10922 10488 gene locus_tag LOCUS_30380 10922 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 11152 10919 gene locus_tag LOCUS_30390 11152 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 12495 11185 gene locus_tag LOCUS_30400 12495 11185 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_30400 12705 12499 gene locus_tag LOCUS_30410 12705 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 13072 12776 gene locus_tag LOCUS_30420 13072 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 13527 13345 gene locus_tag LOCUS_30430 13527 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 15552 13669 gene locus_tag LOCUS_30440 gene uvrC 15552 13669 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_30440 16861 16040 gene locus_tag LOCUS_30450 16861 16040 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_30450 17284 17024 gene locus_tag LOCUS_30460 gene grxC 17284 17024 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_30460 18226 17342 gene locus_tag LOCUS_30470 18226 17342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 18225 19133 gene locus_tag LOCUS_30480 18225 19133 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_30480 19157 19873 gene locus_tag LOCUS_30490 gene sfsA 19157 19873 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388493.1 protein_id gnl|my_center|LOCUS_30490 19870 20718 gene locus_tag LOCUS_30500 gene map 19870 20718 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 protein_id gnl|my_center|LOCUS_30500 20718 21434 gene locus_tag LOCUS_30510 gene radC 20718 21434 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_30510 >Feature sequence071 530 96 gene locus_tag LOCUS_30520 530 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1259 534 gene locus_tag LOCUS_30530 1259 534 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_30530 2607 1297 gene locus_tag LOCUS_30540 2607 1297 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_30540 4028 2664 gene locus_tag LOCUS_30550 4028 2664 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_30550 4947 4033 gene locus_tag LOCUS_30560 gene galU 4947 4033 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_30560 5323 6111 gene locus_tag LOCUS_30570 5323 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 6130 8013 gene locus_tag LOCUS_30580 6130 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 8776 8051 gene locus_tag LOCUS_30590 8776 8051 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_30590 9515 8802 gene locus_tag LOCUS_30600 9515 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_30600 10180 9647 gene locus_tag LOCUS_30610 10180 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 11057 10281 gene locus_tag LOCUS_30620 11057 10281 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_30620 13114 11054 gene locus_tag LOCUS_30630 13114 11054 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389968.1 protein_id gnl|my_center|LOCUS_30630 15549 13639 gene locus_tag LOCUS_30640 15549 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 16039 16578 gene locus_tag LOCUS_30650 16039 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 16819 19854 gene locus_tag LOCUS_30660 16819 19854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 <21446 19985 gene locus_tag LOCUS_30670 <21446 19985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200284324.1:NACHT domain-containing protein >Feature sequence072 1497 205 gene locus_tag LOCUS_30680 1497 205 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389589.1 protein_id gnl|my_center|LOCUS_30680 1724 5014 gene locus_tag LOCUS_30690 1724 5014 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_30690 5028 6062 gene locus_tag LOCUS_30700 5028 6062 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_30700 6107 6322 gene locus_tag LOCUS_30710 6107 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 6561 7475 gene locus_tag LOCUS_30720 6561 7475 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 protein_id gnl|my_center|LOCUS_30720 7781 9244 gene locus_tag LOCUS_30730 7781 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 9241 10113 gene locus_tag LOCUS_30740 9241 10113 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389502.1 protein_id gnl|my_center|LOCUS_30740 10120 10830 gene locus_tag LOCUS_30750 10120 10830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389501.1 protein_id gnl|my_center|LOCUS_30750 10832 11176 gene locus_tag LOCUS_30760 10832 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389500.1 protein_id gnl|my_center|LOCUS_30760 11349 12452 gene locus_tag LOCUS_30770 11349 12452 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_30770 13083 12679 gene locus_tag LOCUS_30780 13083 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 13553 14011 gene locus_tag LOCUS_30790 13553 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 14011 14697 gene locus_tag LOCUS_30800 14011 14697 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920760.1 protein_id gnl|my_center|LOCUS_30800 14694 15218 gene locus_tag LOCUS_30810 14694 15218 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265877.1 protein_id gnl|my_center|LOCUS_30810 15410 15877 gene locus_tag LOCUS_30820 15410 15877 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 protein_id gnl|my_center|LOCUS_30820 16119 16844 gene locus_tag LOCUS_30830 16119 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 16841 17980 gene locus_tag LOCUS_30840 16841 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 18536 21370 gene locus_tag LOCUS_30850 18536 21370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 >Feature sequence073 1448 234 gene locus_tag LOCUS_30860 1448 234 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_30860 1692 3656 gene locus_tag LOCUS_30870 1692 3656 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_30870 3779 4468 gene locus_tag LOCUS_30880 3779 4468 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_30880 4468 5343 gene locus_tag LOCUS_30890 4468 5343 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_30890 5854 5357 gene locus_tag LOCUS_30900 5854 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 7157 5838 gene locus_tag LOCUS_30910 7157 5838 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389621.1 protein_id gnl|my_center|LOCUS_30910 7415 7897 gene locus_tag LOCUS_30920 7415 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 7894 8412 gene locus_tag LOCUS_30930 7894 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 9134 8394 gene locus_tag LOCUS_30940 9134 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 9571 9131 gene locus_tag LOCUS_30950 9571 9131 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_30950 10533 9580 gene locus_tag LOCUS_30960 gene lipA 10533 9580 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389630.1 protein_id gnl|my_center|LOCUS_30960 11374 10565 gene locus_tag LOCUS_30970 11374 10565 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_30970 11859 11371 gene locus_tag LOCUS_30980 11859 11371 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391205.1 protein_id gnl|my_center|LOCUS_30980 12680 11856 gene locus_tag LOCUS_30990 12680 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 14093 12693 gene locus_tag LOCUS_31000 gene lpdA 14093 12693 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_31000 15430 14114 gene locus_tag LOCUS_31010 15430 14114 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975254.1 protein_id gnl|my_center|LOCUS_31010 16856 15477 gene locus_tag LOCUS_31020 16856 15477 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_31020 17903 16860 gene locus_tag LOCUS_31030 gene pdhA 17903 16860 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_31030 18176 21022 gene locus_tag LOCUS_31040 18176 21022 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence074 3493 1655 gene locus_tag LOCUS_31050 gene dnaG 3493 1655 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_31050 4101 3646 gene locus_tag LOCUS_31060 4101 3646 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_31060 4334 5542 gene locus_tag LOCUS_31070 gene carA 4334 5542 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_31070 6118 5666 gene locus_tag LOCUS_31080 6118 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 6150 7007 gene locus_tag LOCUS_31090 6150 7007 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325363.1 protein_id gnl|my_center|LOCUS_31090 7095 8819 gene locus_tag LOCUS_31100 7095 8819 CDS product MOSC and FAD-binding oxidoreductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966240.1 protein_id gnl|my_center|LOCUS_31100 8893 11592 gene locus_tag LOCUS_31110 8893 11592 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_31110 13144 11735 gene locus_tag LOCUS_31120 13144 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 13991 13275 gene locus_tag LOCUS_31130 13991 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 15567 14026 gene locus_tag LOCUS_31140 15567 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 15992 15672 gene locus_tag LOCUS_31150 15992 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 16258 16824 gene locus_tag LOCUS_31160 16258 16824 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_31160 16906 17571 gene locus_tag LOCUS_31170 16906 17571 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_31170 17568 18911 gene locus_tag LOCUS_31180 17568 18911 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 protein_id gnl|my_center|LOCUS_31180 18925 20253 gene locus_tag LOCUS_31190 gene der 18925 20253 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086828.1 protein_id gnl|my_center|LOCUS_31190 21162 20644 gene locus_tag LOCUS_31200 21162 20644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence075 1146 313 gene locus_tag LOCUS_31210 1146 313 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444002.1 protein_id gnl|my_center|LOCUS_31210 1299 1763 gene locus_tag LOCUS_31220 1299 1763 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_31220 2009 1872 gene locus_tag LOCUS_31230 2009 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 2516 2205 gene locus_tag LOCUS_31240 2516 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 5728 2552 gene locus_tag LOCUS_31250 gene putA 5728 2552 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_31250 7194 5725 gene locus_tag LOCUS_31260 7194 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 7278 8186 gene locus_tag LOCUS_31270 7278 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 8714 8202 gene locus_tag LOCUS_31280 8714 8202 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_31280 9508 8774 gene locus_tag LOCUS_31290 9508 8774 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_31290 10280 9489 gene locus_tag LOCUS_31300 10280 9489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816696.1 protein_id gnl|my_center|LOCUS_31300 11248 10277 gene locus_tag LOCUS_31310 11248 10277 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 protein_id gnl|my_center|LOCUS_31310 12120 11245 gene locus_tag LOCUS_31320 12120 11245 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_31320 12773 12333 gene locus_tag LOCUS_31330 12773 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 13262 12795 gene locus_tag LOCUS_31340 13262 12795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 13435 15108 gene locus_tag LOCUS_31350 gene boxC 13435 15108 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_31350 15105 16520 gene locus_tag LOCUS_31360 gene boxB 15105 16520 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_31360 16738 18306 gene locus_tag LOCUS_31370 16738 18306 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_31370 18419 19123 gene locus_tag LOCUS_31380 18419 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence076 982 1959 gene locus_tag LOCUS_31390 982 1959 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_31390 1956 2912 gene locus_tag LOCUS_31400 gene metF 1956 2912 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_31400 2912 6409 gene locus_tag LOCUS_31410 gene metH 2912 6409 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 protein_id gnl|my_center|LOCUS_31410 7099 6488 gene locus_tag LOCUS_31420 7099 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 7397 8635 gene locus_tag LOCUS_31430 7397 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 8639 9739 gene locus_tag LOCUS_31440 8639 9739 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089975.1 protein_id gnl|my_center|LOCUS_31440 9791 11293 gene locus_tag LOCUS_31450 9791 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 11319 12788 gene locus_tag LOCUS_31460 11319 12788 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173812.1 protein_id gnl|my_center|LOCUS_31460 13011 13562 gene locus_tag LOCUS_31470 13011 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 13688 13969 gene locus_tag LOCUS_31480 13688 13969 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_31480 13998 14300 gene locus_tag LOCUS_31490 13998 14300 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_31490 14646 14458 gene locus_tag LOCUS_31500 14646 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 14784 14711 gene locus_tag LOCUS_t00380 14784 14711 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14979 15434 gene locus_tag LOCUS_31510 14979 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 15452 15961 gene locus_tag LOCUS_31520 15452 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102045240.1 protein_id gnl|my_center|LOCUS_31520 15986 16348 gene locus_tag LOCUS_31530 15986 16348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 17310 16543 gene locus_tag LOCUS_31540 17310 16543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 18274 17912 gene locus_tag LOCUS_31550 18274 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 18436 19362 gene locus_tag LOCUS_31560 gene gcvA 18436 19362 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence077 538 116 gene locus_tag LOCUS_31570 538 116 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 protein_id gnl|my_center|LOCUS_31570 725 1531 gene locus_tag LOCUS_31580 725 1531 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551489.1 protein_id gnl|my_center|LOCUS_31580 1849 1607 gene locus_tag LOCUS_31590 1849 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2278 2150 gene locus_tag LOCUS_31600 2278 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 3168 2503 gene locus_tag LOCUS_31610 3168 2503 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444780.1 protein_id gnl|my_center|LOCUS_31610 3334 3771 gene locus_tag LOCUS_31620 3334 3771 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_31620 4634 4987 gene locus_tag LOCUS_31630 4634 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31630 5094 5864 gene locus_tag LOCUS_31640 5094 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 5871 6227 gene locus_tag LOCUS_31650 5871 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 6282 6779 gene locus_tag LOCUS_31660 6282 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31660 6776 8083 gene locus_tag LOCUS_31670 6776 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31670 8486 8097 gene locus_tag LOCUS_31680 8486 8097 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 protein_id gnl|my_center|LOCUS_31680 9691 8495 gene locus_tag LOCUS_31690 9691 8495 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089466.1 protein_id gnl|my_center|LOCUS_31690 9929 10378 gene locus_tag LOCUS_31700 9929 10378 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391345.1 protein_id gnl|my_center|LOCUS_31700 11690 10413 gene locus_tag LOCUS_31710 11690 10413 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970031.1 protein_id gnl|my_center|LOCUS_31710 11891 14125 gene locus_tag LOCUS_31720 11891 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 14217 15002 gene locus_tag LOCUS_31730 14217 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 15008 17125 gene locus_tag LOCUS_31740 15008 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 17122 18135 gene locus_tag LOCUS_31750 17122 18135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461144.1 protein_id gnl|my_center|LOCUS_31750 18147 19397 gene locus_tag LOCUS_31760 18147 19397 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809685.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence078 884 507 gene locus_tag LOCUS_31770 gene gcvH 884 507 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390798.1 protein_id gnl|my_center|LOCUS_31770 2025 916 gene locus_tag LOCUS_31780 gene gcvT 2025 916 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390799.1 protein_id gnl|my_center|LOCUS_31780 2963 2391 gene locus_tag LOCUS_31790 2963 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470665.1 protein_id gnl|my_center|LOCUS_31790 3199 2960 gene locus_tag LOCUS_31800 3199 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 5083 3323 gene locus_tag LOCUS_31810 5083 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 5283 6176 gene locus_tag LOCUS_31820 5283 6176 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_31820 6181 6645 gene locus_tag LOCUS_31830 gene rnhA 6181 6645 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917867.1 protein_id gnl|my_center|LOCUS_31830 7178 6696 gene locus_tag LOCUS_31840 7178 6696 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_31840 9409 7292 gene locus_tag LOCUS_31850 9409 7292 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 protein_id gnl|my_center|LOCUS_31850 9654 10232 gene locus_tag LOCUS_31860 9654 10232 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_31860 11529 10273 gene locus_tag LOCUS_31870 11529 10273 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_31870 12932 11526 gene locus_tag LOCUS_31880 gene thrC 12932 11526 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_31880 14523 13030 gene locus_tag LOCUS_31890 14523 13030 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_31890 15533 14526 gene locus_tag LOCUS_31900 15533 14526 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241141.1 protein_id gnl|my_center|LOCUS_31900 17009 15570 gene locus_tag LOCUS_31910 17009 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 17430 17002 gene locus_tag LOCUS_31920 17430 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 17953 18804 gene locus_tag LOCUS_31930 17953 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 >Feature sequence079 866 390 gene locus_tag LOCUS_31940 866 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 1820 948 gene locus_tag LOCUS_31950 1820 948 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192193.1 protein_id gnl|my_center|LOCUS_31950 1921 3087 gene locus_tag LOCUS_31960 1921 3087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972214.1 protein_id gnl|my_center|LOCUS_31960 3122 3619 gene locus_tag LOCUS_31970 3122 3619 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_31970 3612 4094 gene locus_tag LOCUS_31980 3612 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 4104 4709 gene locus_tag LOCUS_31990 4104 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 4973 4737 gene locus_tag LOCUS_32000 4973 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 5090 5992 gene locus_tag LOCUS_32010 5090 5992 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817370.1 protein_id gnl|my_center|LOCUS_32010 6120 6044 gene locus_tag LOCUS_t00390 6120 6044 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6895 6182 gene locus_tag LOCUS_32020 6895 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 7548 7078 gene locus_tag LOCUS_32030 7548 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 8652 7648 gene locus_tag LOCUS_32040 8652 7648 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_32040 9131 8760 gene locus_tag LOCUS_32050 9131 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 9714 9340 gene locus_tag LOCUS_32060 9714 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 11208 9877 gene locus_tag LOCUS_32070 11208 9877 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 protein_id gnl|my_center|LOCUS_32070 11349 11807 gene locus_tag LOCUS_32080 11349 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 11906 12793 gene locus_tag LOCUS_32090 gene panB 11906 12793 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969735.1 protein_id gnl|my_center|LOCUS_32090 12798 13661 gene locus_tag LOCUS_32100 gene panC 12798 13661 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626566.1 protein_id gnl|my_center|LOCUS_32100 13987 14418 gene locus_tag LOCUS_32110 13987 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 14940 14428 gene locus_tag LOCUS_32120 14940 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 16191 15160 gene locus_tag LOCUS_32130 16191 15160 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_32130 16079 16462 gene locus_tag LOCUS_32140 16079 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 16975 16499 gene locus_tag LOCUS_32150 gene gpt 16975 16499 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975542.1 protein_id gnl|my_center|LOCUS_32150 18233 16998 gene locus_tag LOCUS_32160 18233 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 protein_id gnl|my_center|LOCUS_32160 18515 18591 gene locus_tag LOCUS_t00400 18515 18591 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18648 18869 gene locus_tag LOCUS_32170 18648 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence080 732 223 gene locus_tag LOCUS_32180 gene folK 732 223 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_32180 920 1522 gene locus_tag LOCUS_32190 920 1522 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_32190 1539 2186 gene locus_tag LOCUS_32200 1539 2186 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_32200 2238 2852 gene locus_tag LOCUS_32210 gene thrH 2238 2852 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_32210 2849 3031 gene locus_tag LOCUS_32220 2849 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3102 3902 gene locus_tag LOCUS_32230 3102 3902 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 protein_id gnl|my_center|LOCUS_32230 4917 4102 gene locus_tag LOCUS_32240 gene phnE 4917 4102 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_32240 5720 4917 gene locus_tag LOCUS_32250 gene phnE 5720 4917 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_32250 6579 5731 gene locus_tag LOCUS_32260 gene phnC 6579 5731 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_32260 7671 6685 gene locus_tag LOCUS_32270 gene phnD 7671 6685 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_32270 9262 7850 gene locus_tag LOCUS_32280 9262 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 13228 9269 gene locus_tag LOCUS_32290 13228 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 13644 13402 gene locus_tag LOCUS_32300 13644 13402 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_32300 14086 13670 gene locus_tag LOCUS_32310 14086 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 14640 14158 gene locus_tag LOCUS_32320 gene smpB 14640 14158 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389617.1 protein_id gnl|my_center|LOCUS_32320 15538 14666 gene locus_tag LOCUS_32330 gene dapA 15538 14666 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_32330 15688 16887 gene locus_tag LOCUS_32340 15688 16887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 16983 17441 gene locus_tag LOCUS_32350 16983 17441 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 protein_id gnl|my_center|LOCUS_32350 17469 18092 gene locus_tag LOCUS_32360 17469 18092 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 protein_id gnl|my_center|LOCUS_32360 18693 18127 gene locus_tag LOCUS_32370 18693 18127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence081 605 96 gene locus_tag LOCUS_32380 605 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 922 1386 gene locus_tag LOCUS_32390 gene rplM 922 1386 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720164.1 protein_id gnl|my_center|LOCUS_32390 1392 1877 gene locus_tag LOCUS_32400 gene rpsI 1392 1877 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087725.1 protein_id gnl|my_center|LOCUS_32400 1965 3011 gene locus_tag LOCUS_32410 gene argC 1965 3011 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390174.1 protein_id gnl|my_center|LOCUS_32410 3591 3022 gene locus_tag LOCUS_32420 3591 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 5845 3737 gene locus_tag LOCUS_32430 gene parE 5845 3737 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_32430 5819 6211 gene locus_tag LOCUS_32440 gene yciA 5819 6211 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299258.1 protein_id gnl|my_center|LOCUS_32440 6416 6991 gene locus_tag LOCUS_32450 6416 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 8015 7074 gene locus_tag LOCUS_32460 8015 7074 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_32460 8875 8015 gene locus_tag LOCUS_32470 8875 8015 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_32470 9593 8889 gene locus_tag LOCUS_32480 9593 8889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_32480 10372 9590 gene locus_tag LOCUS_32490 10372 9590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_32490 10883 10437 gene locus_tag LOCUS_32500 10883 10437 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389582.1 protein_id gnl|my_center|LOCUS_32500 11376 12686 gene locus_tag LOCUS_32510 11376 12686 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389580.1 protein_id gnl|my_center|LOCUS_32510 12746 13204 gene locus_tag LOCUS_32520 gene nrdR 12746 13204 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389579.1 protein_id gnl|my_center|LOCUS_32520 13236 14321 gene locus_tag LOCUS_32530 gene ribD 13236 14321 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_32530 14332 14919 gene locus_tag LOCUS_32540 14332 14919 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_32540 14924 16042 gene locus_tag LOCUS_32550 gene ribB 14924 16042 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_32550 16046 16510 gene locus_tag LOCUS_32560 16046 16510 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389575.1 protein_id gnl|my_center|LOCUS_32560 16507 17028 gene locus_tag LOCUS_32570 gene nusB 16507 17028 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087789.1 protein_id gnl|my_center|LOCUS_32570 17163 18056 gene locus_tag LOCUS_32580 gene thiL 17163 18056 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_32580 18120 18575 gene locus_tag LOCUS_32590 18120 18575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence082 1092 58 gene locus_tag LOCUS_32600 1092 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1399 2026 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccgtgcattcgaggcggcacgtcgcctgtcttgat 2446 2213 gene locus_tag LOCUS_32610 2446 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3672 2443 gene locus_tag LOCUS_32620 3672 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 4098 3676 gene locus_tag LOCUS_32630 4098 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 4378 4085 gene locus_tag LOCUS_32640 4378 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 5128 4391 gene locus_tag LOCUS_32650 5128 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 6303 5167 gene locus_tag LOCUS_32660 6303 5167 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714175.1 protein_id gnl|my_center|LOCUS_32660 7645 6362 gene locus_tag LOCUS_32670 7645 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 7779 7642 gene locus_tag LOCUS_32680 7779 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 8264 7776 gene locus_tag LOCUS_32690 8264 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087299.1 protein_id gnl|my_center|LOCUS_32690 8563 8264 gene locus_tag LOCUS_32700 8563 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 8781 8560 gene locus_tag LOCUS_32710 8781 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 8963 8781 gene locus_tag LOCUS_32720 8963 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 9467 8967 gene locus_tag LOCUS_32730 9467 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 10312 9719 gene locus_tag LOCUS_32740 10312 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 11262 10786 gene locus_tag LOCUS_32750 11262 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 11467 11622 gene locus_tag LOCUS_32760 11467 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 11625 12047 gene locus_tag LOCUS_32770 11625 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 12155 12436 gene locus_tag LOCUS_32780 12155 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 12671 12399 gene locus_tag LOCUS_32790 12671 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 12758 12925 gene locus_tag LOCUS_32800 12758 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 12922 13422 gene locus_tag LOCUS_32810 12922 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 13827 14246 gene locus_tag LOCUS_32820 13827 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 14270 15640 gene locus_tag LOCUS_32830 14270 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 15640 16653 gene locus_tag LOCUS_32840 15640 16653 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025227807.1 protein_id gnl|my_center|LOCUS_32840 16737 17276 gene locus_tag LOCUS_32850 16737 17276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence083 <1 835 gene locus_tag LOCUS_32860 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_089725526.1:bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada 890 2137 gene locus_tag LOCUS_32870 890 2137 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 protein_id gnl|my_center|LOCUS_32870 2134 2553 gene locus_tag LOCUS_32880 2134 2553 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396765.1 protein_id gnl|my_center|LOCUS_32880 2567 3325 gene locus_tag LOCUS_32890 2567 3325 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_32890 3430 4089 gene locus_tag LOCUS_32900 3430 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 4254 4601 gene locus_tag LOCUS_32910 4254 4601 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_32910 4718 5188 gene locus_tag LOCUS_32920 4718 5188 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_32920 5224 5661 gene locus_tag LOCUS_32930 5224 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 5803 5727 gene locus_tag LOCUS_t00410 5803 5727 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6858 5833 gene locus_tag LOCUS_32940 6858 5833 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_32940 7088 6753 gene locus_tag LOCUS_32950 7088 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 7376 9232 gene locus_tag LOCUS_32960 7376 9232 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_32960 9299 10135 gene locus_tag LOCUS_32970 9299 10135 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921185.1 protein_id gnl|my_center|LOCUS_32970 10285 11601 gene locus_tag LOCUS_32980 10285 11601 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_32980 11598 12602 gene locus_tag LOCUS_32990 11598 12602 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_32990 12599 15748 gene locus_tag LOCUS_33000 12599 15748 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence084 4619 3186 gene locus_tag LOCUS_33010 4619 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 5638 4745 gene locus_tag LOCUS_33020 5638 4745 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_33020 7674 5764 gene locus_tag LOCUS_33030 gene aprA 7674 5764 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_33030 8189 7767 gene locus_tag LOCUS_33040 gene aprB 8189 7767 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_33040 9189 8503 gene locus_tag LOCUS_33050 9189 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 9665 9450 gene locus_tag LOCUS_33060 9665 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 10216 10055 gene locus_tag LOCUS_33070 10216 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 11619 10447 gene locus_tag LOCUS_33080 gene sat 11619 10447 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_33080 11960 12298 gene locus_tag LOCUS_33090 11960 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 12295 12582 gene locus_tag LOCUS_33100 12295 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 12834 13487 gene locus_tag LOCUS_33110 12834 13487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 13592 14755 gene locus_tag LOCUS_33120 13592 14755 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_33120 14752 15471 gene locus_tag LOCUS_33130 14752 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389961.1 protein_id gnl|my_center|LOCUS_33130 15612 15803 gene locus_tag LOCUS_33140 15612 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33140 15887 16186 gene locus_tag LOCUS_33150 15887 16186 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110750833.1 protein_id gnl|my_center|LOCUS_33150 >Feature sequence085 123 374 gene locus_tag LOCUS_33160 123 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 628 410 gene locus_tag LOCUS_33170 628 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 981 1700 gene locus_tag LOCUS_33180 981 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 1782 2546 gene locus_tag LOCUS_33190 1782 2546 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_33190 2580 3467 gene locus_tag LOCUS_33200 2580 3467 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216362.1 protein_id gnl|my_center|LOCUS_33200 3464 4132 gene locus_tag LOCUS_33210 3464 4132 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_33210 4231 4989 gene locus_tag LOCUS_33220 4231 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 5004 5660 gene locus_tag LOCUS_33230 5004 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 5680 6156 gene locus_tag LOCUS_33240 5680 6156 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 protein_id gnl|my_center|LOCUS_33240 6261 6797 gene locus_tag LOCUS_33250 6261 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 6846 8873 gene locus_tag LOCUS_33260 6846 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 8981 10468 gene locus_tag LOCUS_33270 8981 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 10591 10959 gene locus_tag LOCUS_33280 10591 10959 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_33280 13916 11178 gene locus_tag LOCUS_33290 13916 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 15844 14252 gene locus_tag LOCUS_33300 15844 14252 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_33300 15954 16217 gene locus_tag LOCUS_33310 15954 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 >Feature sequence086 5287 7689 gene locus_tag LOCUS_33320 5287 7689 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_33320 7697 9103 gene locus_tag LOCUS_33330 7697 9103 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_33330 9468 9208 gene locus_tag LOCUS_33340 9468 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 9669 9478 gene locus_tag LOCUS_33350 9669 9478 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566084.1 protein_id gnl|my_center|LOCUS_33350 10057 12927 gene locus_tag LOCUS_33360 10057 12927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 13069 13203 gene locus_tag LOCUS_33370 13069 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 13500 13934 gene locus_tag LOCUS_33380 13500 13934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 14882 14163 gene locus_tag LOCUS_33390 gene ugpQ 14882 14163 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568486.1 protein_id gnl|my_center|LOCUS_33390 <15824 14964 gene locus_tag LOCUS_33400 <15824 14964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein >Feature sequence087 5641 6072 gene locus_tag LOCUS_33410 5641 6072 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_33410 6750 6094 gene locus_tag LOCUS_33420 6750 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 7656 6757 gene locus_tag LOCUS_33430 7656 6757 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_33430 7823 8776 gene locus_tag LOCUS_33440 7823 8776 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_33440 8776 9561 gene locus_tag LOCUS_33450 8776 9561 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946557.1 protein_id gnl|my_center|LOCUS_33450 9558 10316 gene locus_tag LOCUS_33460 9558 10316 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_33460 10317 11351 gene locus_tag LOCUS_33470 10317 11351 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390689.1 protein_id gnl|my_center|LOCUS_33470 11351 12373 gene locus_tag LOCUS_33480 11351 12373 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_33480 12373 14157 gene locus_tag LOCUS_33490 gene asnB 12373 14157 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_33490 14160 14996 gene locus_tag LOCUS_33500 14160 14996 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_33500 >Feature sequence088 835 425 gene locus_tag LOCUS_33510 835 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2604 928 gene locus_tag LOCUS_33520 2604 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 4338 2728 gene locus_tag LOCUS_33530 gene nirS 4338 2728 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_33530 4748 5551 gene locus_tag LOCUS_33540 4748 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 5544 5876 gene locus_tag LOCUS_33550 5544 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 5873 7033 gene locus_tag LOCUS_33560 gene nirF 5873 7033 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_33560 7037 7486 gene locus_tag LOCUS_33570 7037 7486 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_33570 7477 7989 gene locus_tag LOCUS_33580 7477 7989 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_33580 8004 8468 gene locus_tag LOCUS_33590 8004 8468 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_33590 8476 8961 gene locus_tag LOCUS_33600 8476 8961 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_33600 8977 10173 gene locus_tag LOCUS_33610 gene nirJ 8977 10173 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_33610 10266 10541 gene locus_tag LOCUS_33620 10266 10541 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844596.1 protein_id gnl|my_center|LOCUS_33620 10538 10873 gene locus_tag LOCUS_33630 10538 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 10941 11702 gene locus_tag LOCUS_33640 10941 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 12189 11710 gene locus_tag LOCUS_33650 gene creA 12189 11710 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815531.1 protein_id gnl|my_center|LOCUS_33650 12854 12231 gene locus_tag LOCUS_33660 12854 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 13757 12879 gene locus_tag LOCUS_33670 13757 12879 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966578.1 protein_id gnl|my_center|LOCUS_33670 13966 14952 gene locus_tag LOCUS_33680 gene moaA 13966 14952 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 protein_id gnl|my_center|LOCUS_33680 >Feature sequence089 1579 512 gene locus_tag LOCUS_33690 gene ugpC 1579 512 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532490.1 protein_id gnl|my_center|LOCUS_33690 2410 1583 gene locus_tag LOCUS_33700 2410 1583 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975209.1 protein_id gnl|my_center|LOCUS_33700 3324 2407 gene locus_tag LOCUS_33710 3324 2407 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403357.1 protein_id gnl|my_center|LOCUS_33710 4045 3311 gene locus_tag LOCUS_33720 4045 3311 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_33720 5317 4052 gene locus_tag LOCUS_33730 5317 4052 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266612.1 protein_id gnl|my_center|LOCUS_33730 5716 6000 gene locus_tag LOCUS_33740 5716 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 6001 6582 gene locus_tag LOCUS_33750 6001 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_33750 6779 6937 gene locus_tag LOCUS_33760 6779 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 6957 7499 gene locus_tag LOCUS_33770 gene cbaB 6957 7499 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_33770 7513 9201 gene locus_tag LOCUS_33780 7513 9201 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_33780 9310 10122 gene locus_tag LOCUS_33790 9310 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 10119 11783 gene locus_tag LOCUS_33800 10119 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 11783 12532 gene locus_tag LOCUS_33810 11783 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 13297 12545 gene locus_tag LOCUS_33820 13297 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 14869 13565 gene locus_tag LOCUS_33830 14869 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence090 1199 552 gene locus_tag LOCUS_33840 1199 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2006 1362 gene locus_tag LOCUS_33850 2006 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 5131 2003 gene locus_tag LOCUS_33860 5131 2003 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_33860 5930 7132 gene locus_tag LOCUS_33870 5930 7132 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388890.1 protein_id gnl|my_center|LOCUS_33870 8067 7462 gene locus_tag LOCUS_33880 gene cobO 8067 7462 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391114.1 protein_id gnl|my_center|LOCUS_33880 8426 8064 gene locus_tag LOCUS_33890 8426 8064 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_33890 8737 8426 gene locus_tag LOCUS_33900 8737 8426 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920916.1 protein_id gnl|my_center|LOCUS_33900 12608 8826 gene locus_tag LOCUS_33910 gene cobN 12608 8826 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391113.1 protein_id gnl|my_center|LOCUS_33910 13643 12618 gene locus_tag LOCUS_33920 gene cobW 13643 12618 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388429.1 protein_id gnl|my_center|LOCUS_33920 14182 13640 gene locus_tag LOCUS_33930 gene cobU 14182 13640 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence091 369 79 gene locus_tag LOCUS_33940 369 79 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390753.1 protein_id gnl|my_center|LOCUS_33940 1089 472 gene locus_tag LOCUS_33950 1089 472 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 protein_id gnl|my_center|LOCUS_33950 1686 1219 gene locus_tag LOCUS_33960 1686 1219 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_33960 4753 2075 gene locus_tag LOCUS_33970 gene ppdK 4753 2075 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_33970 6850 4760 gene locus_tag LOCUS_33980 gene glyS 6850 4760 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390705.1 protein_id gnl|my_center|LOCUS_33980 7730 6855 gene locus_tag LOCUS_33990 7730 6855 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_33990 8079 7807 gene locus_tag LOCUS_34000 8079 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 8992 8129 gene locus_tag LOCUS_34010 8992 8129 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 protein_id gnl|my_center|LOCUS_34010 9787 9044 gene locus_tag LOCUS_34020 9787 9044 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_34020 9998 9777 gene locus_tag LOCUS_34030 9998 9777 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390701.1 protein_id gnl|my_center|LOCUS_34030 10084 11145 gene locus_tag LOCUS_34040 10084 11145 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_34040 12525 11158 gene locus_tag LOCUS_34050 12525 11158 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_34050 13320 12553 gene locus_tag LOCUS_34060 13320 12553 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388329.1 protein_id gnl|my_center|LOCUS_34060 13386 14306 gene locus_tag LOCUS_34070 gene ubiA 13386 14306 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388330.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence092 972 286 gene locus_tag LOCUS_34080 972 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 5649 1141 gene locus_tag LOCUS_34090 5649 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 6398 5730 gene locus_tag LOCUS_34100 gene ispD 6398 5730 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174170.1 protein_id gnl|my_center|LOCUS_34100 9766 6395 gene locus_tag LOCUS_34110 9766 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 10106 9759 gene locus_tag LOCUS_34120 10106 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 11157 10114 gene locus_tag LOCUS_34130 11157 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 12638 11154 gene locus_tag LOCUS_34140 12638 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 12811 14226 gene locus_tag LOCUS_34150 12811 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence093 896 2212 gene locus_tag LOCUS_34160 896 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 2461 2237 gene locus_tag LOCUS_34170 2461 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 3075 2530 gene locus_tag LOCUS_34180 3075 2530 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_34180 3226 3531 gene locus_tag LOCUS_34190 3226 3531 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868933.1 protein_id gnl|my_center|LOCUS_34190 3566 4234 gene locus_tag LOCUS_34200 3566 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 4231 5415 gene locus_tag LOCUS_34210 4231 5415 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_34210 5715 7964 gene locus_tag LOCUS_34220 5715 7964 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 protein_id gnl|my_center|LOCUS_34220 8249 10084 gene locus_tag LOCUS_34230 8249 10084 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_34230 10212 13406 gene locus_tag LOCUS_34240 10212 13406 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_34240 13974 13495 gene locus_tag LOCUS_34250 13974 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence094 1616 831 gene locus_tag LOCUS_34260 gene surE 1616 831 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389522.1 protein_id gnl|my_center|LOCUS_34260 2884 1613 gene locus_tag LOCUS_34270 gene serS 2884 1613 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389523.1 protein_id gnl|my_center|LOCUS_34270 4124 2937 gene locus_tag LOCUS_34280 4124 2937 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_34280 5183 4128 gene locus_tag LOCUS_34290 5183 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 5685 5224 gene locus_tag LOCUS_34300 5685 5224 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_34300 6988 5678 gene locus_tag LOCUS_34310 6988 5678 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_34310 7763 6981 gene locus_tag LOCUS_34320 7763 6981 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_34320 8614 7766 gene locus_tag LOCUS_34330 8614 7766 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_34330 9102 8617 gene locus_tag LOCUS_34340 9102 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 10277 9105 gene locus_tag LOCUS_34350 10277 9105 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_34350 10379 11383 gene locus_tag LOCUS_34360 10379 11383 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_34360 12255 12701 gene locus_tag LOCUS_34370 12255 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 13049 12759 gene locus_tag LOCUS_34380 13049 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 >Feature sequence095 <1 4114 gene locus_tag LOCUS_34390 <1 4114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966116.1:FecR domain-containing protein 4545 4282 gene locus_tag LOCUS_34400 4545 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 4433 4900 gene locus_tag LOCUS_34410 4433 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 5203 4934 gene locus_tag LOCUS_34420 5203 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 5463 6551 gene locus_tag LOCUS_34430 gene queA 5463 6551 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388034.1 protein_id gnl|my_center|LOCUS_34430 6572 7675 gene locus_tag LOCUS_34440 gene tgt 6572 7675 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388033.1 protein_id gnl|my_center|LOCUS_34440 7677 7853 gene locus_tag LOCUS_34450 7677 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 7855 8319 gene locus_tag LOCUS_34460 gene queF 7855 8319 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969898.1 protein_id gnl|my_center|LOCUS_34460 9045 8554 gene locus_tag LOCUS_34470 9045 8554 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017263267.1 protein_id gnl|my_center|LOCUS_34470 9180 10085 gene locus_tag LOCUS_34480 9180 10085 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_34480 11813 10089 gene locus_tag LOCUS_34490 11813 10089 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_34490 12400 11810 gene locus_tag LOCUS_34500 gene recR 12400 11810 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309918.1 protein_id gnl|my_center|LOCUS_34500 12755 12432 gene locus_tag LOCUS_34510 12755 12432 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391219.1 protein_id gnl|my_center|LOCUS_34510 13483 12854 gene locus_tag LOCUS_34520 13483 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence096 <1 635 gene locus_tag LOCUS_34530 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531080.1:bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase 632 1333 gene locus_tag LOCUS_34540 632 1333 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526969.1 protein_id gnl|my_center|LOCUS_34540 1330 3159 gene locus_tag LOCUS_34550 gene cobJ 1330 3159 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203935.1 protein_id gnl|my_center|LOCUS_34550 3156 3920 gene locus_tag LOCUS_34560 gene cobM 3156 3920 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391131.1 protein_id gnl|my_center|LOCUS_34560 4672 3917 gene locus_tag LOCUS_34570 4672 3917 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_34570 5720 4659 gene locus_tag LOCUS_34580 5720 4659 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 protein_id gnl|my_center|LOCUS_34580 6166 6726 gene locus_tag LOCUS_34590 6166 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 6833 7603 gene locus_tag LOCUS_34600 6833 7603 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391108.1 protein_id gnl|my_center|LOCUS_34600 7617 8258 gene locus_tag LOCUS_34610 7617 8258 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_34610 8269 9594 gene locus_tag LOCUS_34620 8269 9594 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 protein_id gnl|my_center|LOCUS_34620 9657 10118 gene locus_tag LOCUS_34630 9657 10118 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327718.1 protein_id gnl|my_center|LOCUS_34630 10106 11032 gene locus_tag LOCUS_34640 10106 11032 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170938.1 protein_id gnl|my_center|LOCUS_34640 11086 11742 gene locus_tag LOCUS_34650 11086 11742 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_34650 11963 11757 gene locus_tag LOCUS_34660 11963 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 13478 12078 gene locus_tag LOCUS_34670 13478 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 >Feature sequence097 402 1082 gene locus_tag LOCUS_34680 402 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 2421 1018 gene locus_tag LOCUS_34690 gene trmFO 2421 1018 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531313.1 protein_id gnl|my_center|LOCUS_34690 2526 3875 gene locus_tag LOCUS_34700 2526 3875 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_34700 3899 4384 gene locus_tag LOCUS_34710 3899 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 4524 4982 gene locus_tag LOCUS_34720 4524 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 5185 5379 gene locus_tag LOCUS_34730 5185 5379 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 protein_id gnl|my_center|LOCUS_34730 6283 5639 gene locus_tag LOCUS_34740 gene msrA 6283 5639 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_34740 7671 6394 gene locus_tag LOCUS_34750 7671 6394 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640276.1 protein_id gnl|my_center|LOCUS_34750 8708 7668 gene locus_tag LOCUS_34760 gene bioB 8708 7668 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_34760 8790 9962 gene locus_tag LOCUS_34770 gene bioF 8790 9962 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640275.1 protein_id gnl|my_center|LOCUS_34770 10093 10770 gene locus_tag LOCUS_34780 gene bioD 10093 10770 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203536601.1 protein_id gnl|my_center|LOCUS_34780 11010 11831 gene locus_tag LOCUS_34790 11010 11831 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_34790 11828 12679 gene locus_tag LOCUS_34800 11828 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 13520 12738 gene locus_tag LOCUS_34810 13520 12738 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878408.1 protein_id gnl|my_center|LOCUS_34810 >Feature sequence098 1631 726 gene locus_tag LOCUS_34820 1631 726 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_34820 2341 1628 gene locus_tag LOCUS_34830 2341 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3376 2351 gene locus_tag LOCUS_34840 3376 2351 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_34840 3583 4257 gene locus_tag LOCUS_34850 3583 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 4519 5763 gene locus_tag LOCUS_34860 4519 5763 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_34860 5825 6724 gene locus_tag LOCUS_34870 5825 6724 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_34870 6721 7758 gene locus_tag LOCUS_34880 6721 7758 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_34880 7755 8501 gene locus_tag LOCUS_34890 7755 8501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243767.1 protein_id gnl|my_center|LOCUS_34890 8501 9343 gene locus_tag LOCUS_34900 8501 9343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083874.1 protein_id gnl|my_center|LOCUS_34900 9347 11143 gene locus_tag LOCUS_34910 9347 11143 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_34910 11352 12821 gene locus_tag LOCUS_34920 gene glgA 11352 12821 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_34920 12868 13617 gene locus_tag LOCUS_34930 12868 13617 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence099 2852 213 gene locus_tag LOCUS_34940 gene alaS 2852 213 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969477.1 protein_id gnl|my_center|LOCUS_34940 4212 3124 gene locus_tag LOCUS_34950 gene recA 4212 3124 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_34950 4846 4427 gene locus_tag LOCUS_34960 4846 4427 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_34960 5100 4843 gene locus_tag LOCUS_34970 5100 4843 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_34970 7672 5189 gene locus_tag LOCUS_34980 7672 5189 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390447.1 protein_id gnl|my_center|LOCUS_34980 8781 7708 gene locus_tag LOCUS_34990 gene flhB 8781 7708 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_34990 9567 8806 gene locus_tag LOCUS_35000 gene fliR 9567 8806 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390449.1 protein_id gnl|my_center|LOCUS_35000 9828 9574 gene locus_tag LOCUS_35010 gene fliQ 9828 9574 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626457.1 protein_id gnl|my_center|LOCUS_35010 10182 9865 gene locus_tag LOCUS_35020 10182 9865 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390451.1 protein_id gnl|my_center|LOCUS_35020 10650 10240 gene locus_tag LOCUS_35030 gene flgC 10650 10240 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390452.1 protein_id gnl|my_center|LOCUS_35030 11341 10922 gene locus_tag LOCUS_35040 gene flgB 11341 10922 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626458.1 protein_id gnl|my_center|LOCUS_35040 11513 11863 gene locus_tag LOCUS_35050 11513 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 11860 12195 gene locus_tag LOCUS_35060 11860 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 12259 12582 gene locus_tag LOCUS_35070 12259 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 12579 13340 gene locus_tag LOCUS_35080 gene fliP 12579 13340 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390457.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence100 1876 812 gene locus_tag LOCUS_35090 1876 812 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_35090 2505 1873 gene locus_tag LOCUS_35100 2505 1873 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403382.1 protein_id gnl|my_center|LOCUS_35100 3569 2502 gene locus_tag LOCUS_35110 gene neuB 3569 2502 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403381.1 protein_id gnl|my_center|LOCUS_35110 4748 3570 gene locus_tag LOCUS_35120 gene neuC 4748 3570 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 protein_id gnl|my_center|LOCUS_35120 5928 4741 gene locus_tag LOCUS_35130 5928 4741 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_35130 6941 5925 gene locus_tag LOCUS_35140 6941 5925 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533118.1 protein_id gnl|my_center|LOCUS_35140 7546 7043 gene locus_tag LOCUS_35150 gene rfaH 7546 7043 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_35150 8200 7556 gene locus_tag LOCUS_35160 8200 7556 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957830.1 protein_id gnl|my_center|LOCUS_35160 8877 8359 gene locus_tag LOCUS_35170 gene def 8877 8359 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 protein_id gnl|my_center|LOCUS_35170 10428 8959 gene locus_tag LOCUS_35180 10428 8959 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_35180 10519 11601 gene locus_tag LOCUS_35190 10519 11601 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 protein_id gnl|my_center|LOCUS_35190 >Feature sequence101 1329 232 gene locus_tag LOCUS_35200 1329 232 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_35200 2217 1477 gene locus_tag LOCUS_35210 2217 1477 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389598.1 protein_id gnl|my_center|LOCUS_35210 3154 2246 gene locus_tag LOCUS_35220 3154 2246 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 protein_id gnl|my_center|LOCUS_35220 4024 3164 gene locus_tag LOCUS_35230 gene motA 4024 3164 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_35230 4248 4733 gene locus_tag LOCUS_35240 4248 4733 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723432.1 protein_id gnl|my_center|LOCUS_35240 5953 4724 gene locus_tag LOCUS_35250 5953 4724 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_35250 8333 5964 gene locus_tag LOCUS_35260 8333 5964 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_35260 9508 8330 gene locus_tag LOCUS_35270 9508 8330 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_35270 10163 9531 gene locus_tag LOCUS_35280 10163 9531 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470637.1 protein_id gnl|my_center|LOCUS_35280 10347 11198 gene locus_tag LOCUS_35290 10347 11198 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_35290 <12119 11203 gene locus_tag LOCUS_35300 <12119 11203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389590.1:porphobilinogen synthase >Feature sequence102 1093 101 gene locus_tag LOCUS_35310 1093 101 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_35310 1259 1930 gene locus_tag LOCUS_35320 1259 1930 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387911.1 protein_id gnl|my_center|LOCUS_35320 1966 2613 gene locus_tag LOCUS_35330 1966 2613 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470593.1 protein_id gnl|my_center|LOCUS_35330 2610 3089 gene locus_tag LOCUS_35340 2610 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 3726 3091 gene locus_tag LOCUS_35350 gene nth 3726 3091 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_35350 3828 4319 gene locus_tag LOCUS_35360 3828 4319 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_35360 5130 4330 gene locus_tag LOCUS_35370 gene dapB 5130 4330 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_35370 6319 5159 gene locus_tag LOCUS_35380 gene dnaJ 6319 5159 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 protein_id gnl|my_center|LOCUS_35380 8306 6360 gene locus_tag LOCUS_35390 gene dnaK 8306 6360 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391302.1 protein_id gnl|my_center|LOCUS_35390 8602 8384 gene locus_tag LOCUS_35400 8602 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 8859 9740 gene locus_tag LOCUS_35410 8859 9740 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391304.1 protein_id gnl|my_center|LOCUS_35410 10053 10511 gene locus_tag LOCUS_35420 10053 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 10511 11851 gene locus_tag LOCUS_35430 10511 11851 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_35430 >Feature sequence103 293 2065 gene locus_tag LOCUS_35440 293 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 2102 3571 gene locus_tag LOCUS_35450 2102 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 3850 3590 gene locus_tag LOCUS_35460 3850 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 4112 4450 gene locus_tag LOCUS_35470 gene clpS 4112 4450 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_35470 4458 6788 gene locus_tag LOCUS_35480 gene clpA 4458 6788 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_35480 6806 7918 gene locus_tag LOCUS_35490 6806 7918 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389856.1 protein_id gnl|my_center|LOCUS_35490 8209 9324 gene locus_tag LOCUS_35500 8209 9324 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_35500 11697 9352 gene locus_tag LOCUS_35510 11697 9352 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395821.1 protein_id gnl|my_center|LOCUS_35510 >Feature sequence104 691 56 gene locus_tag LOCUS_35520 gene nth 691 56 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_35520 755 1249 gene locus_tag LOCUS_35530 755 1249 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_35530 2058 1246 gene locus_tag LOCUS_35540 gene dapB 2058 1246 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_35540 3240 2125 gene locus_tag LOCUS_35550 gene dnaJ 3240 2125 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338764.1 protein_id gnl|my_center|LOCUS_35550 5300 3324 gene locus_tag LOCUS_35560 gene dnaK 5300 3324 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391302.1 protein_id gnl|my_center|LOCUS_35560 5581 5868 gene locus_tag LOCUS_35570 5581 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 5865 6791 gene locus_tag LOCUS_35580 5865 6791 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391304.1 protein_id gnl|my_center|LOCUS_35580 7526 6819 gene locus_tag LOCUS_35590 7526 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 8648 7566 gene locus_tag LOCUS_35600 gene hrcA 8648 7566 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 protein_id gnl|my_center|LOCUS_35600 8846 9562 gene locus_tag LOCUS_35610 gene rph 8846 9562 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391388.1 protein_id gnl|my_center|LOCUS_35610 9567 10169 gene locus_tag LOCUS_35620 gene rdgB 9567 10169 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_35620 10166 11362 gene locus_tag LOCUS_35630 gene hemW 10166 11362 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391386.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence105 <1 585 gene locus_tag LOCUS_35640 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388228.1:ketol-acid reductoisomerase 1062 1263 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tagccgccccacgggccgc 3520 1751 gene locus_tag LOCUS_35650 3520 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 3781 4428 gene locus_tag LOCUS_35660 3781 4428 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_35660 4380 5000 gene locus_tag LOCUS_35670 4380 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4985 5536 gene locus_tag LOCUS_35680 4985 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 6547 5555 gene locus_tag LOCUS_35690 gene egtD 6547 5555 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_35690 7845 6544 gene locus_tag LOCUS_35700 gene egtB 7845 6544 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_35700 7872 8825 gene locus_tag LOCUS_35710 7872 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 8908 9477 gene locus_tag LOCUS_35720 gene pyrE 8908 9477 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547500.1 protein_id gnl|my_center|LOCUS_35720 11234 9585 gene locus_tag LOCUS_35730 11234 9585 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765656.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence106 201 989 gene locus_tag LOCUS_35740 201 989 CDS product AAC(3)-VI family aminoglycoside N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969832.1 protein_id gnl|my_center|LOCUS_35740 1227 2090 gene locus_tag LOCUS_35750 1227 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 3210 2233 gene locus_tag LOCUS_35760 3210 2233 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530338.1 protein_id gnl|my_center|LOCUS_35760 3336 3746 gene locus_tag LOCUS_35770 3336 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 3842 4135 gene locus_tag LOCUS_35780 3842 4135 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329069.1 protein_id gnl|my_center|LOCUS_35780 5384 4320 gene locus_tag LOCUS_35790 5384 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 6889 5381 gene locus_tag LOCUS_35800 6889 5381 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_35800 8131 6902 gene locus_tag LOCUS_35810 8131 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 8789 8223 gene locus_tag LOCUS_35820 gene rfbC 8789 8223 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_35820 9670 8786 gene locus_tag LOCUS_35830 gene rfbA 9670 8786 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070079022.1 protein_id gnl|my_center|LOCUS_35830 <10709 9716 gene locus_tag LOCUS_35840 <10709 9716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387761.1:dTDP-glucose 4,6-dehydratase >Feature sequence107 1073 264 gene locus_tag LOCUS_35850 1073 264 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_35850 4071 1081 gene locus_tag LOCUS_35860 4071 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 5128 4124 gene locus_tag LOCUS_35870 5128 4124 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_35870 5445 6668 gene locus_tag LOCUS_35880 5445 6668 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090483425.1 protein_id gnl|my_center|LOCUS_35880 6743 7444 gene locus_tag LOCUS_35890 6743 7444 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_35890 7938 7495 gene locus_tag LOCUS_35900 7938 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 8829 7978 gene locus_tag LOCUS_35910 8829 7978 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_35910 9119 9703 gene locus_tag LOCUS_35920 9119 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 9700 10263 gene locus_tag LOCUS_35930 9700 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence108 741 325 gene locus_tag LOCUS_35940 741 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 1758 790 gene locus_tag LOCUS_35950 1758 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 2222 1761 gene locus_tag LOCUS_35960 2222 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 3710 2298 gene locus_tag LOCUS_35970 3710 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 4488 3805 gene locus_tag LOCUS_35980 4488 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 4938 4696 gene locus_tag LOCUS_35990 4938 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 4823 5458 gene locus_tag LOCUS_36000 4823 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 8734 5483 gene locus_tag LOCUS_36010 8734 5483 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390459.1 protein_id gnl|my_center|LOCUS_36010 9551 8823 gene locus_tag LOCUS_36020 9551 8823 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895795.1 protein_id gnl|my_center|LOCUS_36020 10252 9548 gene locus_tag LOCUS_36030 10252 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence109 376 1794 gene locus_tag LOCUS_36040 376 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1804 2715 gene locus_tag LOCUS_36050 1804 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 2712 3728 gene locus_tag LOCUS_36060 gene iolG 2712 3728 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612369.1 protein_id gnl|my_center|LOCUS_36060 3725 4885 gene locus_tag LOCUS_36070 3725 4885 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_36070 4915 5529 gene locus_tag LOCUS_36080 4915 5529 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531936.1 protein_id gnl|my_center|LOCUS_36080 6287 5526 gene locus_tag LOCUS_36090 6287 5526 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173869.1 protein_id gnl|my_center|LOCUS_36090 6397 9636 gene locus_tag LOCUS_36100 gene carB 6397 9636 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390636.1 protein_id gnl|my_center|LOCUS_36100 9735 10208 gene locus_tag LOCUS_36110 gene greA 9735 10208 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_36110 >Feature sequence110 1927 488 gene locus_tag LOCUS_36120 1927 488 CDS product IS1182-like element ISCc5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918162.1 protein_id gnl|my_center|LOCUS_36120 2264 2746 gene locus_tag LOCUS_36130 gene rpoZ 2264 2746 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389610.1 protein_id gnl|my_center|LOCUS_36130 2786 4939 gene locus_tag LOCUS_36140 2786 4939 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_36140 5085 5702 gene locus_tag LOCUS_36150 5085 5702 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389608.1 protein_id gnl|my_center|LOCUS_36150 5707 6444 gene locus_tag LOCUS_36160 5707 6444 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 protein_id gnl|my_center|LOCUS_36160 6441 6842 gene locus_tag LOCUS_36170 gene acpS 6441 6842 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 protein_id gnl|my_center|LOCUS_36170 6972 7709 gene locus_tag LOCUS_36180 gene lepB 6972 7709 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_36180 7716 8405 gene locus_tag LOCUS_36190 gene rnc 7716 8405 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_36190 8418 9332 gene locus_tag LOCUS_36200 gene era 8418 9332 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844236.1 protein_id gnl|my_center|LOCUS_36200 >Feature sequence111 192 521 gene locus_tag LOCUS_36210 gene hspQ 192 521 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087359.1 protein_id gnl|my_center|LOCUS_36210 1902 571 gene locus_tag LOCUS_36220 1902 571 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 protein_id gnl|my_center|LOCUS_36220 3521 3333 gene locus_tag LOCUS_36230 3521 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 3900 3568 gene locus_tag LOCUS_36240 3900 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 4114 3890 gene locus_tag LOCUS_36250 4114 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 6895 4244 gene locus_tag LOCUS_36260 6895 4244 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389549.1 protein_id gnl|my_center|LOCUS_36260 7694 6990 gene locus_tag LOCUS_36270 7694 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 9170 7788 gene locus_tag LOCUS_36280 9170 7788 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_36280 9977 9315 gene locus_tag LOCUS_36290 9977 9315 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_36290 >Feature sequence112 3206 96 gene locus_tag LOCUS_36300 gene vmeI 3206 96 CDS product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_36300 4357 3236 gene locus_tag LOCUS_36310 4357 3236 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_36310 5397 4444 gene locus_tag LOCUS_36320 5397 4444 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_36320 5555 6307 gene locus_tag LOCUS_36330 5555 6307 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 protein_id gnl|my_center|LOCUS_36330 6487 6326 gene locus_tag LOCUS_36340 6487 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 6559 8397 gene locus_tag LOCUS_36350 6559 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 8532 9911 gene locus_tag LOCUS_36360 8532 9911 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939113.1 protein_id gnl|my_center|LOCUS_36360 >Feature sequence113 547 230 gene locus_tag LOCUS_36370 547 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 731 1363 gene locus_tag LOCUS_36380 731 1363 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974351.1 protein_id gnl|my_center|LOCUS_36380 1490 2350 gene locus_tag LOCUS_36390 1490 2350 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388266.1 protein_id gnl|my_center|LOCUS_36390 4214 2595 gene locus_tag LOCUS_36400 4214 2595 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_36400 5820 4297 gene locus_tag LOCUS_36410 5820 4297 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 protein_id gnl|my_center|LOCUS_36410 6032 6484 gene locus_tag LOCUS_36420 6032 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 6698 8497 gene locus_tag LOCUS_36430 6698 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 8506 9246 gene locus_tag LOCUS_36440 8506 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 9308 9817 gene locus_tag LOCUS_36450 9308 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence114 <1 693 gene locus_tag LOCUS_36460 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388981.1:F0F1 ATP synthase subunit beta 725 1150 gene locus_tag LOCUS_36470 725 1150 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_36470 1203 1688 gene locus_tag LOCUS_36480 gene sixA 1203 1688 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_36480 2163 1822 gene locus_tag LOCUS_36490 2163 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 2386 3780 gene locus_tag LOCUS_36500 gene fliI 2386 3780 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_36500 3801 4223 gene locus_tag LOCUS_36510 3801 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 4618 4226 gene locus_tag LOCUS_36520 4618 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 6257 4635 gene locus_tag LOCUS_36530 6257 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 7057 6266 gene locus_tag LOCUS_36540 7057 6266 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440322.1 protein_id gnl|my_center|LOCUS_36540 8040 7054 gene locus_tag LOCUS_36550 8040 7054 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440034.1 protein_id gnl|my_center|LOCUS_36550 9477 8047 gene locus_tag LOCUS_36560 9477 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence115 284 2890 gene locus_tag LOCUS_36570 284 2890 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_36570 3299 4900 gene locus_tag LOCUS_36580 3299 4900 CDS product CRISPR-associated protein Cse1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388094.1 protein_id gnl|my_center|LOCUS_36580 4897 5529 gene locus_tag LOCUS_36590 4897 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 5526 6776 gene locus_tag LOCUS_36600 gene cas7e 5526 6776 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_36600 6773 7546 gene locus_tag LOCUS_36610 gene cas5e 6773 7546 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_36610 7543 8304 gene locus_tag LOCUS_36620 7543 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 8333 9217 gene locus_tag LOCUS_36630 gene cas1e 8333 9217 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 protein_id gnl|my_center|LOCUS_36630 9189 9494 gene locus_tag LOCUS_36640 gene cas2e 9189 9494 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 protein_id gnl|my_center|LOCUS_36640 >Feature sequence116 417 2273 gene locus_tag LOCUS_36650 gene cobT 417 2273 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_36650 2771 2280 gene locus_tag LOCUS_36660 2771 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 3784 2768 gene locus_tag LOCUS_36670 3784 2768 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 protein_id gnl|my_center|LOCUS_36670 4690 3797 gene locus_tag LOCUS_36680 4690 3797 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086303.1 protein_id gnl|my_center|LOCUS_36680 4885 6795 gene locus_tag LOCUS_36690 4885 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 7700 6837 gene locus_tag LOCUS_36700 7700 6837 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172317.1 protein_id gnl|my_center|LOCUS_36700 7840 8709 gene locus_tag LOCUS_36710 gene hpnC 7840 8709 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_36710 8949 9455 gene locus_tag LOCUS_36720 8949 9455 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_36720 >Feature sequence117 1092 145 gene locus_tag LOCUS_36730 1092 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 2968 1184 gene locus_tag LOCUS_36740 2968 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 2849 3211 gene locus_tag LOCUS_36750 2849 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 4613 3789 gene locus_tag LOCUS_36760 4613 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 4745 6373 gene locus_tag LOCUS_36770 4745 6373 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_36770 6684 8360 gene locus_tag LOCUS_36780 6684 8360 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_36780 8353 9282 gene locus_tag LOCUS_36790 8353 9282 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388016.1 protein_id gnl|my_center|LOCUS_36790 >Feature sequence118 <1 1251 gene locus_tag LOCUS_36800 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388853.1:ATP-dependent zinc metalloprotease FtsH 1335 2138 gene locus_tag LOCUS_36810 gene folP 1335 2138 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_36810 2188 3534 gene locus_tag LOCUS_36820 gene glmM 2188 3534 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388855.1 protein_id gnl|my_center|LOCUS_36820 3544 4347 gene locus_tag LOCUS_36830 gene thiD 3544 4347 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_36830 4355 5329 gene locus_tag LOCUS_36840 4355 5329 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_36840 6957 5542 gene locus_tag LOCUS_36850 6957 5542 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400962.1 protein_id gnl|my_center|LOCUS_36850 7035 7259 gene locus_tag LOCUS_36860 7035 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 7281 8003 gene locus_tag LOCUS_36870 7281 8003 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969351.1 protein_id gnl|my_center|LOCUS_36870 8019 8999 gene locus_tag LOCUS_36880 8019 8999 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_36880 >Feature sequence119 912 3092 gene locus_tag LOCUS_36890 912 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 3151 3894 gene locus_tag LOCUS_36900 3151 3894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_36900 3901 6264 gene locus_tag LOCUS_36910 3901 6264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_36910 6275 7483 gene locus_tag LOCUS_36920 6275 7483 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_36920 7558 7914 gene locus_tag LOCUS_36930 7558 7914 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_36930 7966 8442 gene locus_tag LOCUS_36940 7966 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 8445 8906 gene locus_tag LOCUS_36950 8445 8906 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence120 86 1084 gene locus_tag LOCUS_36960 86 1084 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188904793.1 protein_id gnl|my_center|LOCUS_36960 1180 1464 gene locus_tag LOCUS_36970 1180 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 1669 2358 gene locus_tag LOCUS_36980 1669 2358 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383987.1 protein_id gnl|my_center|LOCUS_36980 2525 3514 gene locus_tag LOCUS_36990 2525 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 4645 3911 gene locus_tag LOCUS_37000 4645 3911 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_37000 5514 4657 gene locus_tag LOCUS_37010 5514 4657 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389519.1 protein_id gnl|my_center|LOCUS_37010 5639 6052 gene locus_tag LOCUS_37020 gene yajC 5639 6052 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626242.1 protein_id gnl|my_center|LOCUS_37020 6081 7664 gene locus_tag LOCUS_37030 6081 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37030 7682 8608 gene locus_tag LOCUS_37040 7682 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37040 8618 9004 gene locus_tag LOCUS_37050 8618 9004 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_37050 >Feature sequence121 <1 1033 gene locus_tag LOCUS_37060 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727162.1:aerobic carbon-monoxide dehydrogenase large subunit 1098 1976 gene locus_tag LOCUS_37070 1098 1976 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388723.1 protein_id gnl|my_center|LOCUS_37070 1980 3170 gene locus_tag LOCUS_37080 1980 3170 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967595.1 protein_id gnl|my_center|LOCUS_37080 3187 4050 gene locus_tag LOCUS_37090 3187 4050 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876861.1 protein_id gnl|my_center|LOCUS_37090 4170 4760 gene locus_tag LOCUS_37100 4170 4760 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527711.1 protein_id gnl|my_center|LOCUS_37100 4990 6024 gene locus_tag LOCUS_37110 4990 6024 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000281.1 protein_id gnl|my_center|LOCUS_37110 6077 6844 gene locus_tag LOCUS_37120 6077 6844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082944.1 protein_id gnl|my_center|LOCUS_37120 6837 7655 gene locus_tag LOCUS_37130 6837 7655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966629.1 protein_id gnl|my_center|LOCUS_37130 7847 8254 gene locus_tag LOCUS_37140 7847 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence122 408 1283 gene locus_tag LOCUS_37150 gene sucD 408 1283 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_37150 1422 4232 gene locus_tag LOCUS_37160 1422 4232 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669772.1 protein_id gnl|my_center|LOCUS_37160 4259 5509 gene locus_tag LOCUS_37170 gene odhB 4259 5509 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_37170 5559 6968 gene locus_tag LOCUS_37180 gene lpdA 5559 6968 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_37180 7061 8251 gene locus_tag LOCUS_37190 7061 8251 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965724.1 protein_id gnl|my_center|LOCUS_37190 >Feature sequence123 903 343 gene locus_tag LOCUS_37200 903 343 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021906.1 protein_id gnl|my_center|LOCUS_37200 1364 1116 gene locus_tag LOCUS_37210 1364 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 1650 1441 gene locus_tag LOCUS_37220 1650 1441 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_37220 3008 2577 gene locus_tag LOCUS_37230 3008 2577 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_37230 3395 4264 gene locus_tag LOCUS_37240 gene nadC 3395 4264 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_37240 4389 5171 gene locus_tag LOCUS_37250 4389 5171 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086104.1 protein_id gnl|my_center|LOCUS_37250 5176 5871 gene locus_tag LOCUS_37260 5176 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 6713 6030 gene locus_tag LOCUS_37270 6713 6030 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_37270 7780 6710 gene locus_tag LOCUS_37280 7780 6710 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_37280 8373 7777 gene locus_tag LOCUS_37290 8373 7777 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_37290 >Feature sequence124 1768 386 gene locus_tag LOCUS_37300 1768 386 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_37300 1961 2497 gene locus_tag LOCUS_37310 1961 2497 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_37310 2537 3442 gene locus_tag LOCUS_37320 gene liuE 2537 3442 CDS product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 protein_id gnl|my_center|LOCUS_37320 3439 3858 gene locus_tag LOCUS_37330 3439 3858 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087921.1 protein_id gnl|my_center|LOCUS_37330 3859 4761 gene locus_tag LOCUS_37340 3859 4761 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090007.1 protein_id gnl|my_center|LOCUS_37340 5012 5503 gene locus_tag LOCUS_37350 5012 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 5550 6497 gene locus_tag LOCUS_37360 5550 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 6494 7459 gene locus_tag LOCUS_37370 6494 7459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173671.1 protein_id gnl|my_center|LOCUS_37370 7456 8358 gene locus_tag LOCUS_37380 7456 8358 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258637.1 protein_id gnl|my_center|LOCUS_37380 >Feature sequence125 72 521 gene locus_tag LOCUS_37390 72 521 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_37390 518 1468 gene locus_tag LOCUS_37400 gene rapZ 518 1468 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_37400 1733 2140 gene locus_tag LOCUS_37410 1733 2140 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_37410 2137 2433 gene locus_tag LOCUS_37420 2137 2433 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626594.1 protein_id gnl|my_center|LOCUS_37420 2491 4269 gene locus_tag LOCUS_37430 gene ptsP 2491 4269 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_37430 4361 5761 gene locus_tag LOCUS_37440 gene ahcY 4361 5761 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391191.1 protein_id gnl|my_center|LOCUS_37440 5901 8192 gene locus_tag LOCUS_37450 5901 8192 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_37450 >Feature sequence126 311 138 gene locus_tag LOCUS_37460 311 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 569 1948 gene locus_tag LOCUS_37470 569 1948 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_37470 1945 3630 gene locus_tag LOCUS_37480 gene menD 1945 3630 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_37480 3627 4460 gene locus_tag LOCUS_37490 gene menB 3627 4460 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640002.1 protein_id gnl|my_center|LOCUS_37490 4457 5554 gene locus_tag LOCUS_37500 gene menC 4457 5554 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838743.1 protein_id gnl|my_center|LOCUS_37500 6751 5498 gene locus_tag LOCUS_37510 6751 5498 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_37510 7833 7477 gene locus_tag LOCUS_37520 7833 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723356.1 protein_id gnl|my_center|LOCUS_37520 >Feature sequence127 217 585 gene locus_tag LOCUS_37530 217 585 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210342306.1 protein_id gnl|my_center|LOCUS_37530 1330 668 gene locus_tag LOCUS_37540 1330 668 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_37540 3343 1418 gene locus_tag LOCUS_37550 gene dxs 3343 1418 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532789.1 protein_id gnl|my_center|LOCUS_37550 4300 3413 gene locus_tag LOCUS_37560 4300 3413 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_37560 4560 4309 gene locus_tag LOCUS_37570 4560 4309 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919931.1 protein_id gnl|my_center|LOCUS_37570 5600 4671 gene locus_tag LOCUS_37580 5600 4671 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_37580 >Feature sequence128 141 917 gene locus_tag LOCUS_37590 141 917 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_37590 1131 1553 gene locus_tag LOCUS_37600 1131 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 2161 1475 gene locus_tag LOCUS_37610 gene aat 2161 1475 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401515.1 protein_id gnl|my_center|LOCUS_37610 2428 2943 gene locus_tag LOCUS_37620 2428 2943 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445544.1 protein_id gnl|my_center|LOCUS_37620 3137 4579 gene locus_tag LOCUS_37630 3137 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 4905 7448 gene locus_tag LOCUS_37640 4905 7448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 >Feature sequence129 524 2020 gene locus_tag LOCUS_37650 524 2020 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975977.1 protein_id gnl|my_center|LOCUS_37650 4856 2037 gene locus_tag LOCUS_37660 4856 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 5079 5453 gene locus_tag LOCUS_37670 5079 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 5457 5651 gene locus_tag LOCUS_37680 5457 5651 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681551.1 protein_id gnl|my_center|LOCUS_37680 <7513 5666 gene locus_tag LOCUS_37690 <7513 5666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399687.1:DNA polymerase >Feature sequence130 415 179 gene locus_tag LOCUS_37700 415 179 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_37700 1544 474 gene locus_tag LOCUS_37710 gene aroC 1544 474 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_37710 2364 1552 gene locus_tag LOCUS_37720 gene fabI 2364 1552 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390374.1 protein_id gnl|my_center|LOCUS_37720 2534 3853 gene locus_tag LOCUS_37730 2534 3853 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390375.1 protein_id gnl|my_center|LOCUS_37730 4015 5154 gene locus_tag LOCUS_37740 4015 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 5440 6141 gene locus_tag LOCUS_37750 5440 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 6175 6867 gene locus_tag LOCUS_37760 6175 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 6864 7178 gene locus_tag LOCUS_37770 6864 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 >Feature sequence131 2 1582 gene locus_tag LOCUS_37780 2 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 1612 5841 gene locus_tag LOCUS_37790 gene rpoC 1612 5841 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390504.1 protein_id gnl|my_center|LOCUS_37790 6188 6559 gene locus_tag LOCUS_37800 gene rpsL 6188 6559 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_37800 6572 7042 gene locus_tag LOCUS_37810 gene rpsG 6572 7042 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_37810 >Feature sequence132 1330 281 gene locus_tag LOCUS_37820 1330 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 2707 1637 gene locus_tag LOCUS_37830 2707 1637 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388199.1 protein_id gnl|my_center|LOCUS_37830 2795 3250 gene locus_tag LOCUS_37840 2795 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 4463 3633 gene locus_tag LOCUS_37850 4463 3633 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_37850 5605 4478 gene locus_tag LOCUS_37860 gene phnW 5605 4478 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112368.1 protein_id gnl|my_center|LOCUS_37860 5819 7000 gene locus_tag LOCUS_37870 5819 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 >Feature sequence133 933 457 gene locus_tag LOCUS_37880 933 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 1415 2041 gene locus_tag LOCUS_37890 1415 2041 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448965.1 protein_id gnl|my_center|LOCUS_37890 2200 2685 gene locus_tag LOCUS_37900 2200 2685 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976218.1 protein_id gnl|my_center|LOCUS_37900 2682 3191 gene locus_tag LOCUS_37910 2682 3191 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976217.1 protein_id gnl|my_center|LOCUS_37910 4463 3267 gene locus_tag LOCUS_37920 4463 3267 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 protein_id gnl|my_center|LOCUS_37920 4609 6345 gene locus_tag LOCUS_37930 4609 6345 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_37930 6509 6934 gene locus_tag LOCUS_37940 6509 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence134 697 122 gene locus_tag LOCUS_37950 gene raiA 697 122 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385412.1 protein_id gnl|my_center|LOCUS_37950 2412 862 gene locus_tag LOCUS_37960 gene rpoN 2412 862 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387771.1 protein_id gnl|my_center|LOCUS_37960 3234 2434 gene locus_tag LOCUS_37970 gene lptB 3234 2434 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_37970 4136 3267 gene locus_tag LOCUS_37980 4136 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_37980 4843 4133 gene locus_tag LOCUS_37990 4843 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 5835 4840 gene locus_tag LOCUS_38000 5835 4840 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 protein_id gnl|my_center|LOCUS_38000 6694 6068 gene locus_tag LOCUS_38010 6694 6068 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_38010 6810 6724 gene locus_tag LOCUS_t00420 6810 6724 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 403 1626 gene locus_tag LOCUS_38020 403 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 1681 1839 gene locus_tag LOCUS_38030 1681 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 1920 2108 gene locus_tag LOCUS_38040 1920 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 2242 3879 gene locus_tag LOCUS_38050 2242 3879 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114317.1 protein_id gnl|my_center|LOCUS_38050 4454 3894 gene locus_tag LOCUS_38060 gene aac(6') 4454 3894 CDS product aminoglycoside N-acetyltransferase AAC(6')-Ii inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289795.1 protein_id gnl|my_center|LOCUS_38060 5159 4530 gene locus_tag LOCUS_38070 5159 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 6590 5241 gene locus_tag LOCUS_38080 gene hemN 6590 5241 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390257.1 protein_id gnl|my_center|LOCUS_38080 6970 6644 gene locus_tag LOCUS_38090 6970 6644 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088474.1 protein_id gnl|my_center|LOCUS_38090 >Feature sequence136 273 2579 gene locus_tag LOCUS_38100 273 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 2782 5457 gene locus_tag LOCUS_38110 2782 5457 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_38110 5479 6306 gene locus_tag LOCUS_38120 gene fabI 5479 6306 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_38120 >Feature sequence137 113 188 gene locus_tag LOCUS_t00430 113 188 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 252 449 gene locus_tag LOCUS_38130 gene secE 252 449 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390511.1 protein_id gnl|my_center|LOCUS_38130 454 984 gene locus_tag LOCUS_38140 gene nusG 454 984 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_38140 1062 1490 gene locus_tag LOCUS_38150 gene rplK 1062 1490 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 protein_id gnl|my_center|LOCUS_38150 1493 2188 gene locus_tag LOCUS_38160 gene rplA 1493 2188 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390508.1 protein_id gnl|my_center|LOCUS_38160 2431 3006 gene locus_tag LOCUS_38170 gene rplJ 2431 3006 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_38170 3047 3430 gene locus_tag LOCUS_38180 gene rplL 3047 3430 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_38180 >Feature sequence138 1555 701 gene locus_tag LOCUS_38190 1555 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 1633 2388 gene locus_tag LOCUS_38200 gene recO 1633 2388 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389602.1 protein_id gnl|my_center|LOCUS_38200 6043 2498 gene locus_tag LOCUS_38210 6043 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence139 460 1836 gene locus_tag LOCUS_38220 460 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 4753 2117 gene locus_tag LOCUS_38230 gene clpB 4753 2117 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_38230 4962 5720 gene locus_tag LOCUS_38240 4962 5720 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence140 1303 110 gene locus_tag LOCUS_38250 1303 110 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387974.1 protein_id gnl|my_center|LOCUS_38250 2043 1564 gene locus_tag LOCUS_38260 2043 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 2527 2282 gene locus_tag LOCUS_38270 2527 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 2409 3464 gene locus_tag LOCUS_38280 2409 3464 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_38280 3498 4898 gene locus_tag LOCUS_38290 3498 4898 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_38290 5974 4964 gene locus_tag LOCUS_38300 5974 4964 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387777.1 protein_id gnl|my_center|LOCUS_38300 >Feature sequence141 153 461 gene locus_tag LOCUS_38310 gene rpsJ 153 461 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_38310 471 1322 gene locus_tag LOCUS_38320 gene rplC 471 1322 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563652.1 protein_id gnl|my_center|LOCUS_38320 1329 1949 gene locus_tag LOCUS_38330 gene rplD 1329 1949 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390437.1 protein_id gnl|my_center|LOCUS_38330 1946 2269 gene locus_tag LOCUS_38340 1946 2269 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_38340 2279 3115 gene locus_tag LOCUS_38350 gene rplB 2279 3115 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390435.1 protein_id gnl|my_center|LOCUS_38350 3139 3417 gene locus_tag LOCUS_38360 gene rpsS 3139 3417 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_38360 3420 3800 gene locus_tag LOCUS_38370 gene rplV 3420 3800 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390433.1 protein_id gnl|my_center|LOCUS_38370 3800 4477 gene locus_tag LOCUS_38380 gene rpsC 3800 4477 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_38380 4505 4924 gene locus_tag LOCUS_38390 gene rplP 4505 4924 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_38390 4930 5139 gene locus_tag LOCUS_38400 gene rpmC 4930 5139 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390430.1 protein_id gnl|my_center|LOCUS_38400 5157 5399 gene locus_tag LOCUS_38410 gene rpsQ 5157 5399 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390429.1 protein_id gnl|my_center|LOCUS_38410 5427 5795 gene locus_tag LOCUS_38420 gene rplN 5427 5795 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_38420 5795 6112 gene locus_tag LOCUS_38430 gene rplX 5795 6112 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence142 997 155 gene locus_tag LOCUS_38440 997 155 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_38440 2320 1010 gene locus_tag LOCUS_38450 2320 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 3635 2334 gene locus_tag LOCUS_38460 3635 2334 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392521.1 protein_id gnl|my_center|LOCUS_38460 4813 3632 gene locus_tag LOCUS_38470 gene hadC 4813 3632 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_38470 5587 4817 gene locus_tag LOCUS_38480 5587 4817 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405712.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence143 2533 410 gene locus_tag LOCUS_38490 gene flhA 2533 410 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966504.1 protein_id gnl|my_center|LOCUS_38490 3933 2578 gene locus_tag LOCUS_38500 3933 2578 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388298.1 protein_id gnl|my_center|LOCUS_38500 4767 3958 gene locus_tag LOCUS_38510 4767 3958 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388299.1 protein_id gnl|my_center|LOCUS_38510 5197 4778 gene locus_tag LOCUS_38520 5197 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 5942 5190 gene locus_tag LOCUS_38530 5942 5190 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 protein_id gnl|my_center|LOCUS_38530 >Feature sequence144 497 1162 gene locus_tag LOCUS_38540 497 1162 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066868938.1 protein_id gnl|my_center|LOCUS_38540 1878 1642 gene locus_tag LOCUS_38550 1878 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 2167 1892 gene locus_tag LOCUS_38560 2167 1892 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064047.1 protein_id gnl|my_center|LOCUS_38560 2493 3461 gene locus_tag LOCUS_38570 gene miaA 2493 3461 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388225.1 protein_id gnl|my_center|LOCUS_38570 3567 5327 gene locus_tag LOCUS_38580 3567 5327 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 protein_id gnl|my_center|LOCUS_38580 >Feature sequence145 718 293 gene locus_tag LOCUS_38590 718 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 1608 1036 gene locus_tag LOCUS_38600 1608 1036 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389448.1 protein_id gnl|my_center|LOCUS_38600 3362 1605 gene locus_tag LOCUS_38610 3362 1605 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_38610 3633 3394 gene locus_tag LOCUS_38620 3633 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 4231 3755 gene locus_tag LOCUS_38630 4231 3755 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_38630 5544 4342 gene locus_tag LOCUS_38640 5544 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 >Feature sequence146 1982 99 gene locus_tag LOCUS_38650 1982 99 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_38650 2410 3006 gene locus_tag LOCUS_38660 2410 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 3065 3631 gene locus_tag LOCUS_38670 3065 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 4049 3720 gene locus_tag LOCUS_38680 4049 3720 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 protein_id gnl|my_center|LOCUS_38680 4209 5015 gene locus_tag LOCUS_38690 4209 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 >Feature sequence147 433 200 gene locus_tag LOCUS_38700 433 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 2135 483 gene locus_tag LOCUS_38710 2135 483 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939009.1 protein_id gnl|my_center|LOCUS_38710 2326 2132 gene locus_tag LOCUS_38720 2326 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 2792 2262 gene locus_tag LOCUS_38730 2792 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 3142 2858 gene locus_tag LOCUS_38740 3142 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 3395 3117 gene locus_tag LOCUS_38750 3395 3117 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_38750 4148 4411 gene locus_tag LOCUS_38760 4148 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 4587 5204 gene locus_tag LOCUS_38770 4587 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence148 182 418 gene locus_tag LOCUS_38780 182 418 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_38780 402 818 gene locus_tag LOCUS_38790 402 818 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770968.1 protein_id gnl|my_center|LOCUS_38790 1879 1013 gene locus_tag LOCUS_38800 1879 1013 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387844.1 protein_id gnl|my_center|LOCUS_38800 1937 2425 gene locus_tag LOCUS_38810 1937 2425 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312626.1 protein_id gnl|my_center|LOCUS_38810 2435 3388 gene locus_tag LOCUS_38820 gene pip 2435 3388 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_38820 4438 3815 gene locus_tag LOCUS_38830 4438 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 >Feature sequence149 1632 292 gene locus_tag LOCUS_38840 1632 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 2380 1772 gene locus_tag LOCUS_38850 2380 1772 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_38850 3277 2570 gene locus_tag LOCUS_38860 3277 2570 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_38860 3415 4581 gene locus_tag LOCUS_38870 3415 4581 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_38870 >Feature sequence150 115 630 gene locus_tag LOCUS_38880 115 630 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_38880 633 920 gene locus_tag LOCUS_38890 633 920 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_38890 920 1276 gene locus_tag LOCUS_38900 gene mnhG 920 1276 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_38900 1291 1842 gene locus_tag LOCUS_38910 1291 1842 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_38910 1839 2270 gene locus_tag LOCUS_38920 1839 2270 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_38920 2274 2627 gene locus_tag LOCUS_38930 2274 2627 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_38930 2624 4105 gene locus_tag LOCUS_38940 2624 4105 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_38940 >Feature sequence151 233 628 gene locus_tag LOCUS_38950 233 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 1518 2105 gene locus_tag LOCUS_38960 1518 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 3701 2181 gene locus_tag LOCUS_38970 gene gcvPB 3701 2181 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390796.1 protein_id gnl|my_center|LOCUS_38970 <4661 3698 gene locus_tag LOCUS_38980 <4661 3698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390797.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA >Feature sequence152 933 154 gene locus_tag LOCUS_38990 933 154 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807577.1 protein_id gnl|my_center|LOCUS_38990 3740 1224 gene locus_tag LOCUS_39000 gene napA 3740 1224 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_39000 >Feature sequence153 8 478 gene locus_tag LOCUS_39010 8 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 513 1097 gene locus_tag LOCUS_39020 513 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 1900 1634 gene locus_tag LOCUS_39030 1900 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 2021 2761 gene locus_tag LOCUS_39040 2021 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 2775 3338 gene locus_tag LOCUS_39050 2775 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 3381 3815 gene locus_tag LOCUS_39060 3381 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 >Feature sequence154 2814 967 gene locus_tag LOCUS_39070 gene ybtP 2814 967 CDS product yersiniabactin ABC transporter ATP-binding/permease protein YbtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327262.1 protein_id gnl|my_center|LOCUS_39070 <3786 2824 gene locus_tag LOCUS_39080 <3786 2824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390089.1:MFS transporter >Feature sequence155 >Feature sequence156 1422 700 gene locus_tag LOCUS_39090 1422 700 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_39090 2278 1325 gene locus_tag LOCUS_39100 2278 1325 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_39100 2479 3489 gene locus_tag LOCUS_39110 gene cbiB 2479 3489 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391129.1 protein_id gnl|my_center|LOCUS_39110 >Feature sequence157 1816 3174 gene locus_tag LOCUS_39120 1816 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 >Feature sequence158 1331 612 gene locus_tag LOCUS_39130 gene rph 1331 612 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391388.1 protein_id gnl|my_center|LOCUS_39130 1470 2507 gene locus_tag LOCUS_39140 gene hrcA 1470 2507 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 protein_id gnl|my_center|LOCUS_39140 2525 3259 gene locus_tag LOCUS_39150 2525 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence159 <1 923 gene locus_tag LOCUS_39160 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259387.1:glycosyltransferase 2147 963 gene locus_tag LOCUS_39170 2147 963 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_39170 <3431 2209 gene locus_tag LOCUS_39180 <3431 2209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256083.1:MaoC family dehydratase >Feature sequence160 2196 271 gene locus_tag LOCUS_39190 2196 271 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973829.1 protein_id gnl|my_center|LOCUS_39190 <3280 2461 gene locus_tag LOCUS_39200 <3280 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546778.1:methyl-accepting chemotaxis protein >Feature sequence161 >Feature sequence162 945 1030 gene locus_tag LOCUS_t00440 945 1030 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1065 1138 gene locus_tag LOCUS_t00450 1065 1138 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1260 2450 gene locus_tag LOCUS_39210 gene tuf 1260 2450 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390500.1 protein_id gnl|my_center|LOCUS_39210 2811 2886 gene locus_tag LOCUS_t00460 2811 2886 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3010 3207 gene locus_tag LOCUS_39220 gene secE 3010 3207 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390511.1 protein_id gnl|my_center|LOCUS_39220 >Feature sequence163 1231 911 gene locus_tag LOCUS_39230 1231 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 1834 2907 gene locus_tag LOCUS_39240 1834 2907 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_39240 3025 3114 gene locus_tag LOCUS_t00470 3025 3114 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence164 76 1428 gene locus_tag LOCUS_39250 76 1428 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_39250 1581 1506 gene locus_tag LOCUS_t00480 1581 1506 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2374 1652 gene locus_tag LOCUS_39260 2374 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39260 2624 2709 gene locus_tag LOCUS_t00490 2624 2709 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2742 2815 gene locus_tag LOCUS_t00500 2742 2815 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence165 1594 275 gene locus_tag LOCUS_39270 1594 275 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390721.1 protein_id gnl|my_center|LOCUS_39270 2973 1594 gene locus_tag LOCUS_39280 2973 1594 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_39280 >Feature sequence166 1845 451 gene locus_tag LOCUS_39290 gene trmFO 1845 451 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389510.1 protein_id gnl|my_center|LOCUS_39290 2421 1921 gene locus_tag LOCUS_39300 2421 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 2922 2587 gene locus_tag LOCUS_39310 2922 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 >Feature sequence167 128 1045 gene locus_tag LOCUS_39320 128 1045 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_39320 1223 1023 gene locus_tag LOCUS_39330 1223 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 1470 2729 gene locus_tag LOCUS_39340 gene istA 1470 2729 CDS product IS21-like element ISMac3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020064.1 protein_id gnl|my_center|LOCUS_39340 >Feature sequence168 310 1590 gene locus_tag LOCUS_39350 310 1590 CDS product succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880832.1 protein_id gnl|my_center|LOCUS_39350 1614 2099 gene locus_tag LOCUS_39360 gene rraA 1614 2099 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948542.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence169 1968 400 gene locus_tag LOCUS_39370 1968 400 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_39370 2523 1990 gene locus_tag LOCUS_39380 2523 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 protein_id gnl|my_center|LOCUS_39380 >Feature sequence170 <1 544 gene locus_tag LOCUS_39390 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388454.1:RNA methyltransferase 934 545 gene locus_tag LOCUS_39400 934 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 2688 1105 gene locus_tag LOCUS_39410 2688 1105 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_39410 >Feature sequence171 1293 130 gene locus_tag LOCUS_39420 1293 130 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336820.1 protein_id gnl|my_center|LOCUS_39420 2224 1295 gene locus_tag LOCUS_39430 2224 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence172 659 105 gene locus_tag LOCUS_39440 659 105 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721261.1 protein_id gnl|my_center|LOCUS_39440 1523 687 gene locus_tag LOCUS_39450 1523 687 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_39450 1792 2586 gene locus_tag LOCUS_39460 gene nadE 1792 2586 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348575.1 protein_id gnl|my_center|LOCUS_39460 >Feature sequence173 1671 184 gene locus_tag LOCUS_39470 1671 184 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 protein_id gnl|my_center|LOCUS_39470 2042 2515 gene locus_tag LOCUS_39480 2042 2515 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_39480 >Feature sequence174 754 1863 gene locus_tag LOCUS_39490 754 1863 CDS product IS4-like element IS421 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300563.1 protein_id gnl|my_center|LOCUS_39490 >Feature sequence175 205 1014 gene locus_tag LOCUS_39500 205 1014 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_39500 1160 1918 gene locus_tag LOCUS_39510 1160 1918 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206876.1 protein_id gnl|my_center|LOCUS_39510 >Feature sequence176 1564 329 gene locus_tag LOCUS_39520 1564 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 <2535 1567 gene locus_tag LOCUS_39530 <2535 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405397.1:AarF/UbiB family protein >Feature sequence177 <1 2083 gene locus_tag LOCUS_39540 <1 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390501.1:elongation factor G >Feature sequence178 1873 119 gene locus_tag LOCUS_39550 1873 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 2374 2141 gene locus_tag LOCUS_39560 2374 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 >Feature sequence179 503 1954 gene locus_tag LOCUS_39570 503 1954 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_39570 >Feature sequence180 <1 1135 gene locus_tag LOCUS_39580 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968474.1:phenylalanine--tRNA ligase subunit beta 1218 1646 gene locus_tag LOCUS_39590 1218 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 >Feature sequence181 390 34 gene locus_tag LOCUS_39600 390 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 872 411 gene locus_tag LOCUS_39610 872 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 1609 869 gene locus_tag LOCUS_39620 1609 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 1986 1642 gene locus_tag LOCUS_39630 1986 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 2268 2017 gene locus_tag LOCUS_39640 2268 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 >Feature sequence182 <1 817 gene locus_tag LOCUS_39650 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231929.1:translation elongation factor Ts 1105 1950 gene locus_tag LOCUS_39660 1105 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence183 140 622 gene locus_tag LOCUS_39670 140 622 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 protein_id gnl|my_center|LOCUS_39670 1522 638 gene locus_tag LOCUS_39680 1522 638 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250014.1 protein_id gnl|my_center|LOCUS_39680 2153 1707 gene locus_tag LOCUS_39690 2153 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 >Feature sequence184 341 87 gene locus_tag LOCUS_39700 341 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 650 2032 gene locus_tag LOCUS_39710 650 2032 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_39710 >Feature sequence185 <1 996 gene locus_tag LOCUS_39720 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083210.1:L-arabinonate dehydratase <2166 1024 gene locus_tag LOCUS_39730 <2166 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086798.1:MFS transporter >Feature sequence186 510 854 gene locus_tag LOCUS_39740 510 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 867 2150 gene locus_tag LOCUS_39750 867 2150 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_39750 >Feature sequence187 196 1998 gene locus_tag LOCUS_39760 gene lepA 196 1998 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626581.1 protein_id gnl|my_center|LOCUS_39760 >Feature sequence188 1 351 gene locus_tag LOCUS_39770 1 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 >Feature sequence189 >Feature sequence190 1730 1461 gene locus_tag LOCUS_39780 1730 1461 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 protein_id gnl|my_center|LOCUS_39780 >Feature sequence191 <1 1708 gene locus_tag LOCUS_39790 <1 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809423.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase >Feature sequence192 489 196 gene locus_tag LOCUS_39800 489 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 <2002 624 gene locus_tag LOCUS_39810 <2002 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085105.1:formate dehydrogenase subunit alpha >Feature sequence193 204 1145 gene locus_tag LOCUS_39820 204 1145 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390046.1 protein_id gnl|my_center|LOCUS_39820 >Feature sequence194 34 495 gene locus_tag LOCUS_39830 34 495 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085245.1 protein_id gnl|my_center|LOCUS_39830 1492 515 gene locus_tag LOCUS_39840 1492 515 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 protein_id gnl|my_center|LOCUS_39840 >Feature sequence195 <1 1183 gene locus_tag LOCUS_39850 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552132.1:S8 family peptidase 1180 1722 gene locus_tag LOCUS_39860 1180 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 >Feature sequence196 1860 1090 gene locus_tag LOCUS_39870 1860 1090 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311931.1 protein_id gnl|my_center|LOCUS_39870 >Feature sequence197 <1 503 gene locus_tag LOCUS_39880 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072000.1:hydroxymethylglutaryl-CoA lyase 586 1005 gene locus_tag LOCUS_39890 586 1005 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536712.1 protein_id gnl|my_center|LOCUS_39890 >Feature sequence198 >Feature sequence199 1222 185 gene locus_tag LOCUS_39900 1222 185 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 protein_id gnl|my_center|LOCUS_39900 1619 1278 gene locus_tag LOCUS_39910 1619 1278 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530552.1 protein_id gnl|my_center|LOCUS_39910 >Feature sequence200 484 1242 gene locus_tag LOCUS_39920 484 1242 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_39920 <1819 1250 gene locus_tag LOCUS_39930 <1819 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525764.1:NADH:flavin oxidoreductase/NADH oxidase >Feature sequence201 1445 570 gene locus_tag LOCUS_39940 1445 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39940 1758 1480 gene locus_tag LOCUS_39950 1758 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39950 >Feature sequence202 >Feature sequence203 1089 529 gene locus_tag LOCUS_39960 1089 529 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 protein_id gnl|my_center|LOCUS_39960 1370 1089 gene locus_tag LOCUS_39970 1370 1089 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643418.1 protein_id gnl|my_center|LOCUS_39970 >Feature sequence204 >Feature sequence205 <1 1272 gene locus_tag LOCUS_39980 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086717.1:propionyl-CoA carboxylase subunit beta >Feature sequence206 >Feature sequence207 >Feature sequence208 465 1490 gene locus_tag LOCUS_39990 465 1490 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_39990 >Feature sequence209 1411 485 gene locus_tag LOCUS_40000 1411 485 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_40000 >Feature sequence210 >Feature sequence211 259 1494 gene locus_tag LOCUS_40010 259 1494 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_40010 >Feature sequence212 <1604 192 gene locus_tag LOCUS_40020 <1604 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460998.1:IS1634 family transposase >Feature sequence213 <1 793 gene locus_tag LOCUS_40030 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970364.1:helix-turn-helix transcriptional regulator >Feature sequence214 101 1444 gene locus_tag LOCUS_40040 101 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence215 <1 507 gene locus_tag LOCUS_40050 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241142.1:cytochrome c oxidase subunit I 537 938 gene locus_tag LOCUS_40060 537 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence216 >Feature sequence217 <1 739 gene locus_tag LOCUS_40070 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337020.1:S-methyl-5'-thioadenosine phosphorylase >Feature sequence218 1367 270 gene locus_tag LOCUS_40080 1367 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 >Feature sequence219 1214 300 gene locus_tag LOCUS_40090 1214 300 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533158.1 protein_id gnl|my_center|LOCUS_40090 >Feature sequence220 >Feature sequence221 >Feature sequence222 >Feature sequence223 <1 735 gene locus_tag LOCUS_40100 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein >Feature sequence224 <1 1079 gene locus_tag LOCUS_40110 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387994.1:site-specific DNA-methyltransferase >Feature sequence225 1261 14 gene locus_tag LOCUS_40120 1261 14 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024749659.1 protein_id gnl|my_center|LOCUS_40120 >Feature sequence226 95 1174 gene locus_tag LOCUS_40130 95 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence227 >Feature sequence228 369 665 gene locus_tag LOCUS_40140 369 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 >Feature sequence229 >Feature sequence230 <1 1113 gene locus_tag LOCUS_40150 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119332.1:FG-GAP-like repeat-containing protein >Feature sequence231 <1 1122 gene locus_tag LOCUS_40160 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113780.1:FAD-dependent catabolic D-arginine dehydrogenase DauA >Feature sequence232 <1359 270 gene locus_tag LOCUS_40170 <1359 270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020064.1:IS21-like element ISMac3 family transposase >Feature sequence233 >Feature sequence234 <1286 157 gene locus_tag LOCUS_40180 <1286 157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014496845.1:malate/lactate/ureidoglycolate dehydrogenase >Feature sequence235 >Feature sequence236 3 293 gene locus_tag LOCUS_40190 3 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence237 <1 908 gene locus_tag LOCUS_40200 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405157.1:dimethylglycine demethylation protein DgcA >Feature sequence238 <1 962 gene locus_tag LOCUS_40210 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263237.1:efflux RND transporter permease subunit >Feature sequence239 >Feature sequence240 <1168 23 gene locus_tag LOCUS_40220 <1168 23 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181672422.1:ISAs1-like element ISEc1 family transposase >Feature sequence241 >Feature sequence242 <1143 143 gene locus_tag LOCUS_40230 <1143 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417347.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence243 592 185 gene locus_tag LOCUS_40240 592 185 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_40240 <1143 633 gene locus_tag LOCUS_40250 <1143 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083272.1:F0F1 ATP synthase subunit beta >Feature sequence244 >Feature sequence245 >Feature sequence246 >Feature sequence247 <1 964 gene locus_tag LOCUS_40260 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114537.1:FAD-dependent oxidoreductase >Feature sequence248 >Feature sequence249 >Feature sequence250 >Feature sequence251 >Feature sequence252 <1022 119 gene locus_tag LOCUS_40270 <1022 119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151614010.1:IS701 family transposase >Feature sequence253