>Feature sequence001 130 57 gene locus_tag LOCUS_t00010 130 57 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 576 139 gene locus_tag LOCUS_00010 576 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2281 701 gene locus_tag LOCUS_00020 2281 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2501 2743 gene locus_tag LOCUS_00030 2501 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4171 2768 gene locus_tag LOCUS_00040 4171 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4526 4149 gene locus_tag LOCUS_00050 4526 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5025 4636 gene locus_tag LOCUS_00060 5025 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5176 5733 gene locus_tag LOCUS_00070 gene efp 5176 5733 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_00070 5937 6290 gene locus_tag LOCUS_00080 5937 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6268 7494 gene locus_tag LOCUS_00090 6268 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7484 8347 gene locus_tag LOCUS_00100 gene fabL 7484 8347 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_00100 8382 8735 gene locus_tag LOCUS_00110 8382 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9825 8743 gene locus_tag LOCUS_00120 9825 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9871 10026 gene locus_tag LOCUS_00130 9871 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10947 10243 gene locus_tag LOCUS_00140 10947 10243 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_00140 12020 10911 gene locus_tag LOCUS_00150 gene menC 12020 10911 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_00150 12969 12097 gene locus_tag LOCUS_00160 12969 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257044.1 protein_id gnl|my_center|LOCUS_00160 13690 12971 gene locus_tag LOCUS_00170 13690 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13577 13813 gene locus_tag LOCUS_00180 13577 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13838 14011 gene locus_tag LOCUS_00190 13838 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 14047 15285 gene locus_tag LOCUS_00200 14047 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 15307 16470 gene locus_tag LOCUS_00210 gene ftsZ 15307 16470 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_00210 16494 16739 gene locus_tag LOCUS_00220 16494 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 16750 16962 gene locus_tag LOCUS_00230 16750 16962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 16988 17740 gene locus_tag LOCUS_00240 16988 17740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 19537 17744 gene locus_tag LOCUS_00250 19537 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 19720 19565 gene locus_tag LOCUS_00260 19720 19565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 21144 19732 gene locus_tag LOCUS_00270 21144 19732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 21573 22550 gene locus_tag LOCUS_00280 gene mvaD 21573 22550 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_00280 22897 23964 gene locus_tag LOCUS_00290 22897 23964 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_00290 23964 24944 gene locus_tag LOCUS_00300 23964 24944 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258205.1 protein_id gnl|my_center|LOCUS_00300 24969 25880 gene locus_tag LOCUS_00310 24969 25880 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_00310 25882 27087 gene locus_tag LOCUS_00320 25882 27087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 27123 27416 gene locus_tag LOCUS_00330 27123 27416 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404796.1 protein_id gnl|my_center|LOCUS_00330 27849 27556 gene locus_tag LOCUS_00340 27849 27556 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088373.1 protein_id gnl|my_center|LOCUS_00340 28707 28009 gene locus_tag LOCUS_00350 gene radC 28707 28009 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_00350 28858 29397 gene locus_tag LOCUS_00360 28858 29397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 30820 29516 gene locus_tag LOCUS_00370 gene eno 30820 29516 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_00370 30978 31667 gene locus_tag LOCUS_00380 30978 31667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 33288 31678 gene locus_tag LOCUS_00390 33288 31678 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_00390 33838 33464 gene locus_tag LOCUS_00400 33838 33464 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_00400 34033 34656 gene locus_tag LOCUS_00410 34033 34656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 34659 35288 gene locus_tag LOCUS_00420 gene pth 34659 35288 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_00420 35366 38848 gene locus_tag LOCUS_00430 gene mfd 35366 38848 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_00430 38915 39634 gene locus_tag LOCUS_00440 38915 39634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 40705 39740 gene locus_tag LOCUS_00450 40705 39740 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_00450 42678 40816 gene locus_tag LOCUS_00460 gene ftsH 42678 40816 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_00460 45237 42895 gene locus_tag LOCUS_00470 45237 42895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46462 45245 gene locus_tag LOCUS_00480 46462 45245 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_00480 47173 46490 gene locus_tag LOCUS_00490 47173 46490 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080583.1 protein_id gnl|my_center|LOCUS_00490 49055 47166 gene locus_tag LOCUS_00500 49055 47166 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089039.1 protein_id gnl|my_center|LOCUS_00500 49599 49183 gene locus_tag LOCUS_00510 49599 49183 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_00510 49915 49592 gene locus_tag LOCUS_00520 49915 49592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 52140 49954 gene locus_tag LOCUS_00530 52140 49954 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_00530 53053 52526 gene locus_tag LOCUS_00540 53053 52526 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_00540 54094 53063 gene locus_tag LOCUS_00550 gene tsaD 54094 53063 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_00550 55497 54262 gene locus_tag LOCUS_00560 55497 54262 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_00560 56935 55583 gene locus_tag LOCUS_00570 gene selA 56935 55583 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_00570 57350 56958 gene locus_tag LOCUS_00580 57350 56958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57896 59212 gene locus_tag LOCUS_00590 gene dnaA 57896 59212 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_00590 60597 59365 gene locus_tag LOCUS_00600 60597 59365 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982139.1 protein_id gnl|my_center|LOCUS_00600 61779 60877 gene locus_tag LOCUS_00610 61779 60877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 61986 63632 gene locus_tag LOCUS_00620 61986 63632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 63847 65337 gene locus_tag LOCUS_00630 63847 65337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 65402 66829 gene locus_tag LOCUS_00640 gene gltA 65402 66829 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926868.1 protein_id gnl|my_center|LOCUS_00640 67132 67428 gene locus_tag LOCUS_00650 67132 67428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 67502 69541 gene locus_tag LOCUS_00660 67502 69541 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_00660 69571 70254 gene locus_tag LOCUS_00670 69571 70254 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_00670 70382 71266 gene locus_tag LOCUS_00680 gene bmt 70382 71266 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 protein_id gnl|my_center|LOCUS_00680 71368 72249 gene locus_tag LOCUS_00690 71368 72249 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873494.1 protein_id gnl|my_center|LOCUS_00690 72246 72836 gene locus_tag LOCUS_00700 72246 72836 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_00700 72985 74085 gene locus_tag LOCUS_00710 72985 74085 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_00710 77286 74146 gene locus_tag LOCUS_00720 77286 74146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 78470 77427 gene locus_tag LOCUS_00730 78470 77427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 79346 78702 gene locus_tag LOCUS_00740 79346 78702 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 protein_id gnl|my_center|LOCUS_00740 79863 80516 gene locus_tag LOCUS_00750 79863 80516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 81704 80583 gene locus_tag LOCUS_00760 81704 80583 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583306.1 protein_id gnl|my_center|LOCUS_00760 82951 81701 gene locus_tag LOCUS_00770 gene fabF 82951 81701 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_00770 84273 83152 gene locus_tag LOCUS_00780 84273 83152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 84861 84343 gene locus_tag LOCUS_00790 84861 84343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 85928 84864 gene locus_tag LOCUS_00800 85928 84864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 87623 86019 gene locus_tag LOCUS_00810 87623 86019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 88540 87599 gene locus_tag LOCUS_00820 88540 87599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 89507 88656 gene locus_tag LOCUS_00830 89507 88656 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_00830 90172 89651 gene locus_tag LOCUS_00840 90172 89651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 91687 90311 gene locus_tag LOCUS_00850 91687 90311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 92418 91957 gene locus_tag LOCUS_00860 92418 91957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 95040 92521 gene locus_tag LOCUS_00870 95040 92521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 98800 95210 gene locus_tag LOCUS_00880 98800 95210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 100592 99381 gene locus_tag LOCUS_00890 100592 99381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 100618 100776 gene locus_tag LOCUS_00900 100618 100776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 101952 100816 gene locus_tag LOCUS_00910 101952 100816 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_00910 103441 102050 gene locus_tag LOCUS_00920 103441 102050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 104670 103576 gene locus_tag LOCUS_00930 104670 103576 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973529.1 protein_id gnl|my_center|LOCUS_00930 105592 104831 gene locus_tag LOCUS_00940 105592 104831 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_00940 107584 106895 gene locus_tag LOCUS_00950 107584 106895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 108281 107571 gene locus_tag LOCUS_00960 108281 107571 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203510.1 protein_id gnl|my_center|LOCUS_00960 110551 109619 gene locus_tag LOCUS_00970 110551 109619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 111611 110664 gene locus_tag LOCUS_00980 111611 110664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 112389 111835 gene locus_tag LOCUS_00990 112389 111835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 114392 113118 gene locus_tag LOCUS_01000 114392 113118 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_01000 115836 114418 gene locus_tag LOCUS_01010 115836 114418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 116371 116093 gene locus_tag LOCUS_01020 116371 116093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 117051 116368 gene locus_tag LOCUS_01030 117051 116368 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_01030 118605 117364 gene locus_tag LOCUS_01040 118605 117364 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_01040 119416 118727 gene locus_tag LOCUS_01050 119416 118727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 120567 119926 gene locus_tag LOCUS_01060 120567 119926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 121313 121576 gene locus_tag LOCUS_01070 121313 121576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 123328 121751 gene locus_tag LOCUS_01080 123328 121751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 124650 123526 gene locus_tag LOCUS_01090 124650 123526 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_01090 126354 125731 gene locus_tag LOCUS_01100 126354 125731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 127105 126347 gene locus_tag LOCUS_01110 127105 126347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 129082 127301 gene locus_tag LOCUS_01120 gene asnB 129082 127301 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036622.1 protein_id gnl|my_center|LOCUS_01120 131018 129135 gene locus_tag LOCUS_01130 gene asnB 131018 129135 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396166.1 protein_id gnl|my_center|LOCUS_01130 131812 131021 gene locus_tag LOCUS_01140 131812 131021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 132537 131812 gene locus_tag LOCUS_01150 132537 131812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 133540 132542 gene locus_tag LOCUS_01160 133540 132542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 134504 133584 gene locus_tag LOCUS_01170 134504 133584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 135665 134631 gene locus_tag LOCUS_01180 135665 134631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 136663 135665 gene locus_tag LOCUS_01190 136663 135665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 137481 136636 gene locus_tag LOCUS_01200 137481 136636 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942157.1 protein_id gnl|my_center|LOCUS_01200 137791 137459 gene locus_tag LOCUS_01210 137791 137459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 140786 140103 gene locus_tag LOCUS_01220 140786 140103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 141284 141487 gene locus_tag LOCUS_01230 141284 141487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 141474 141866 gene locus_tag LOCUS_01240 141474 141866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 143068 142277 gene locus_tag LOCUS_01250 143068 142277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 143147 143326 gene locus_tag LOCUS_01260 143147 143326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 144757 143438 gene locus_tag LOCUS_01270 144757 143438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_01270 145669 144803 gene locus_tag LOCUS_01280 145669 144803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_01280 146554 145673 gene locus_tag LOCUS_01290 gene rfbD 146554 145673 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_01290 147447 146554 gene locus_tag LOCUS_01300 gene rfbA 147447 146554 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857518.1 protein_id gnl|my_center|LOCUS_01300 148529 147444 gene locus_tag LOCUS_01310 gene rfbB 148529 147444 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 protein_id gnl|my_center|LOCUS_01310 149079 148531 gene locus_tag LOCUS_01320 gene rfbC 149079 148531 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_01320 151223 149748 gene locus_tag LOCUS_01330 151223 149748 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_01330 152433 151258 gene locus_tag LOCUS_01340 152433 151258 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862165.1 protein_id gnl|my_center|LOCUS_01340 154452 152569 gene locus_tag LOCUS_01350 154452 152569 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_01350 155875 154565 gene locus_tag LOCUS_01360 gene hemL 155875 154565 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456470.1 protein_id gnl|my_center|LOCUS_01360 157164 155902 gene locus_tag LOCUS_01370 157164 155902 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_01370 158551 157259 gene locus_tag LOCUS_01380 158551 157259 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982178.1 protein_id gnl|my_center|LOCUS_01380 160083 158635 gene locus_tag LOCUS_01390 160083 158635 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660573.1 protein_id gnl|my_center|LOCUS_01390 161261 160206 gene locus_tag LOCUS_01400 161261 160206 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_01400 162136 161312 gene locus_tag LOCUS_01410 162136 161312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01410 163067 162129 gene locus_tag LOCUS_01420 163067 162129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257554.1 protein_id gnl|my_center|LOCUS_01420 164160 163075 gene locus_tag LOCUS_01430 164160 163075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_01430 164674 164192 gene locus_tag LOCUS_01440 164674 164192 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_01440 166386 164791 gene locus_tag LOCUS_01450 166386 164791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 166638 166411 gene locus_tag LOCUS_01460 166638 166411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 166719 169598 gene locus_tag LOCUS_01470 166719 169598 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920852.1 protein_id gnl|my_center|LOCUS_01470 170865 169576 gene locus_tag LOCUS_01480 170865 169576 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119646.1 protein_id gnl|my_center|LOCUS_01480 170980 171240 gene locus_tag LOCUS_01490 170980 171240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 171273 171713 gene locus_tag LOCUS_01500 171273 171713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 171841 173637 gene locus_tag LOCUS_01510 171841 173637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 173654 175633 gene locus_tag LOCUS_01520 173654 175633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 176484 175660 gene locus_tag LOCUS_01530 176484 175660 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065352.1 protein_id gnl|my_center|LOCUS_01530 177283 176717 gene locus_tag LOCUS_01540 177283 176717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01540 177466 177332 gene locus_tag LOCUS_01550 177466 177332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 178656 177724 gene locus_tag LOCUS_01560 gene metA 178656 177724 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_01560 179953 178667 gene locus_tag LOCUS_01570 179953 178667 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_01570 180320 180817 gene locus_tag LOCUS_01580 gene bfr 180320 180817 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336823.1 protein_id gnl|my_center|LOCUS_01580 182270 181038 gene locus_tag LOCUS_01590 182270 181038 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674376.1 protein_id gnl|my_center|LOCUS_01590 182955 182383 gene locus_tag LOCUS_01600 182955 182383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 183469 184350 gene locus_tag LOCUS_01610 183469 184350 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_01610 184739 184362 gene locus_tag LOCUS_01620 184739 184362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 184948 184736 gene locus_tag LOCUS_01630 184948 184736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 186471 185032 gene locus_tag LOCUS_01640 186471 185032 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583648.1 protein_id gnl|my_center|LOCUS_01640 189679 186569 gene locus_tag LOCUS_01650 189679 186569 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_01650 191017 189827 gene locus_tag LOCUS_01660 191017 189827 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_01660 192667 191111 gene locus_tag LOCUS_01670 gene citF 192667 191111 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_01670 193967 192750 gene locus_tag LOCUS_01680 193967 192750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 196246 194162 gene locus_tag LOCUS_01690 196246 194162 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010482.1 protein_id gnl|my_center|LOCUS_01690 197049 196273 gene locus_tag LOCUS_01700 197049 196273 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660871.1 protein_id gnl|my_center|LOCUS_01700 197364 197092 gene locus_tag LOCUS_01710 197364 197092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 197489 197271 gene locus_tag LOCUS_01720 197489 197271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 198928 197609 gene locus_tag LOCUS_01730 198928 197609 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087661.1 protein_id gnl|my_center|LOCUS_01730 199257 200021 gene locus_tag LOCUS_01740 199257 200021 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_01740 201233 200124 gene locus_tag LOCUS_01750 201233 200124 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_01750 202217 201249 gene locus_tag LOCUS_01760 202217 201249 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_01760 203344 202217 gene locus_tag LOCUS_01770 203344 202217 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_01770 205269 203341 gene locus_tag LOCUS_01780 gene selB 205269 203341 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_01780 206548 205370 gene locus_tag LOCUS_01790 206548 205370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 208027 206627 gene locus_tag LOCUS_01800 208027 206627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 208617 208024 gene locus_tag LOCUS_01810 208617 208024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 210192 208621 gene locus_tag LOCUS_01820 210192 208621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 210714 210253 gene locus_tag LOCUS_01830 210714 210253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 211264 212589 gene locus_tag LOCUS_01840 211264 212589 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_01840 212635 212724 gene locus_tag LOCUS_t00020 212635 212724 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 213236 212784 gene locus_tag LOCUS_01850 213236 212784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 214368 213301 gene locus_tag LOCUS_01860 214368 213301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_01860 214700 214383 gene locus_tag LOCUS_01870 214700 214383 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_01870 215071 214772 gene locus_tag LOCUS_01880 215071 214772 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_01880 215315 215076 gene locus_tag LOCUS_01890 215315 215076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 215549 215319 gene locus_tag LOCUS_01900 215549 215319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 215569 217017 gene locus_tag LOCUS_01910 215569 217017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 219081 217072 gene locus_tag LOCUS_01920 gene nirS 219081 217072 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_01920 220051 219299 gene locus_tag LOCUS_01930 220051 219299 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089821.1 protein_id gnl|my_center|LOCUS_01930 222057 220216 gene locus_tag LOCUS_01940 gene glmS 222057 220216 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256373.1 protein_id gnl|my_center|LOCUS_01940 222486 223289 gene locus_tag LOCUS_01950 222486 223289 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_01950 225819 223303 gene locus_tag LOCUS_01960 225819 223303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_01960 226063 227124 gene locus_tag LOCUS_01970 226063 227124 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_01970 227191 228039 gene locus_tag LOCUS_01980 227191 228039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 228098 228601 gene locus_tag LOCUS_01990 228098 228601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 228598 230688 gene locus_tag LOCUS_02000 gene mrdA 228598 230688 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399770.1 protein_id gnl|my_center|LOCUS_02000 230905 231579 gene locus_tag LOCUS_02010 gene minC 230905 231579 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_02010 231638 232441 gene locus_tag LOCUS_02020 gene minD 231638 232441 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_02020 232434 232697 gene locus_tag LOCUS_02030 gene minE 232434 232697 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816777.1 protein_id gnl|my_center|LOCUS_02030 232725 233900 gene locus_tag LOCUS_02040 gene rodA 232725 233900 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_02040 234070 235572 gene locus_tag LOCUS_02050 gene gltX 234070 235572 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257408.1 protein_id gnl|my_center|LOCUS_02050 235700 235771 gene locus_tag LOCUS_t00030 235700 235771 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 236703 235825 gene locus_tag LOCUS_02060 gene metF 236703 235825 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_02060 238114 236945 gene locus_tag LOCUS_02070 238114 236945 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_02070 239044 238181 gene locus_tag LOCUS_02080 239044 238181 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_02080 239526 239095 gene locus_tag LOCUS_02090 239526 239095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 239640 239885 gene locus_tag LOCUS_02100 239640 239885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 240003 241472 gene locus_tag LOCUS_02110 240003 241472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 242748 241519 gene locus_tag LOCUS_02120 242748 241519 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404091.1 protein_id gnl|my_center|LOCUS_02120 242842 243720 gene locus_tag LOCUS_02130 gene rsmA 242842 243720 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_02130 243717 244025 gene locus_tag LOCUS_02140 243717 244025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831950.1 protein_id gnl|my_center|LOCUS_02140 244022 244558 gene locus_tag LOCUS_02150 244022 244558 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174509.1 protein_id gnl|my_center|LOCUS_02150 244608 244680 gene locus_tag LOCUS_t00040 244608 244680 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 245275 244916 gene locus_tag LOCUS_02160 245275 244916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 250704 245275 gene locus_tag LOCUS_02170 250704 245275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 251319 251774 gene locus_tag LOCUS_02180 251319 251774 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603272.1 protein_id gnl|my_center|LOCUS_02180 251890 257451 gene locus_tag LOCUS_02190 251890 257451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 257459 258409 gene locus_tag LOCUS_02200 257459 258409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 259214 258429 gene locus_tag LOCUS_02210 259214 258429 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256847.1 protein_id gnl|my_center|LOCUS_02210 259550 260479 gene locus_tag LOCUS_02220 gene argF 259550 260479 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_02220 260528 261622 gene locus_tag LOCUS_02230 gene ald 260528 261622 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459459.1 protein_id gnl|my_center|LOCUS_02230 261627 262922 gene locus_tag LOCUS_02240 261627 262922 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_02240 262936 264372 gene locus_tag LOCUS_02250 gene pyk 262936 264372 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_02250 264526 265143 gene locus_tag LOCUS_02260 264526 265143 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_02260 265145 265483 gene locus_tag LOCUS_02270 265145 265483 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257803.1 protein_id gnl|my_center|LOCUS_02270 265493 265945 gene locus_tag LOCUS_02280 265493 265945 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173310.1 protein_id gnl|my_center|LOCUS_02280 268950 266035 gene locus_tag LOCUS_02290 268950 266035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 270095 269391 gene locus_tag LOCUS_02300 270095 269391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 271194 270127 gene locus_tag LOCUS_02310 271194 270127 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461600.1 protein_id gnl|my_center|LOCUS_02310 271632 271207 gene locus_tag LOCUS_02320 271632 271207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 272278 271649 gene locus_tag LOCUS_02330 272278 271649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 273124 272318 gene locus_tag LOCUS_02340 273124 272318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 273681 273124 gene locus_tag LOCUS_02350 273681 273124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 274321 274028 gene locus_tag LOCUS_02360 274321 274028 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062094.1 protein_id gnl|my_center|LOCUS_02360 275737 274427 gene locus_tag LOCUS_02370 275737 274427 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_02370 277071 275875 gene locus_tag LOCUS_02380 277071 275875 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723307.1 protein_id gnl|my_center|LOCUS_02380 278417 277392 gene locus_tag LOCUS_02390 278417 277392 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_02390 278758 279477 gene locus_tag LOCUS_02400 278758 279477 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205380.1 protein_id gnl|my_center|LOCUS_02400 280340 279636 gene locus_tag LOCUS_02410 280340 279636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 280567 280340 gene locus_tag LOCUS_02420 280567 280340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 280644 281657 gene locus_tag LOCUS_02430 280644 281657 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_02430 281683 283053 gene locus_tag LOCUS_02440 281683 283053 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259710.1 protein_id gnl|my_center|LOCUS_02440 285861 283114 gene locus_tag LOCUS_02450 285861 283114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 286076 287056 gene locus_tag LOCUS_02460 286076 287056 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920860.1 protein_id gnl|my_center|LOCUS_02460 287192 287896 gene locus_tag LOCUS_02470 287192 287896 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_02470 287898 289652 gene locus_tag LOCUS_02480 gene phoR 287898 289652 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_02480 290891 289737 gene locus_tag LOCUS_02490 290891 289737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 292646 290973 gene locus_tag LOCUS_02500 292646 290973 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_02500 292615 293523 gene locus_tag LOCUS_02510 292615 293523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 293581 294699 gene locus_tag LOCUS_02520 293581 294699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 294686 295801 gene locus_tag LOCUS_02530 294686 295801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 296024 296581 gene locus_tag LOCUS_02540 gene sigW 296024 296581 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_02540 296568 297149 gene locus_tag LOCUS_02550 296568 297149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 297146 298261 gene locus_tag LOCUS_02560 297146 298261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 298293 298811 gene locus_tag LOCUS_02570 298293 298811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 298808 299767 gene locus_tag LOCUS_02580 298808 299767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 300986 299982 gene locus_tag LOCUS_02590 300986 299982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 302777 301434 gene locus_tag LOCUS_02600 gene asnS 302777 301434 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_02600 304654 302888 gene locus_tag LOCUS_02610 gene aspS 304654 302888 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_02610 305360 305707 gene locus_tag LOCUS_02620 305360 305707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 305735 306967 gene locus_tag LOCUS_02630 305735 306967 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_02630 306979 307650 gene locus_tag LOCUS_02640 306979 307650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 307686 307991 gene locus_tag LOCUS_02650 307686 307991 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_02650 308025 308528 gene locus_tag LOCUS_02660 308025 308528 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880208.1 protein_id gnl|my_center|LOCUS_02660 309248 308607 gene locus_tag LOCUS_02670 309248 308607 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258019.1 protein_id gnl|my_center|LOCUS_02670 309569 311335 gene locus_tag LOCUS_02680 309569 311335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 313611 311470 gene locus_tag LOCUS_02690 313611 311470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 314104 313757 gene locus_tag LOCUS_02700 314104 313757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 315004 314357 gene locus_tag LOCUS_02710 315004 314357 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_02710 316866 315175 gene locus_tag LOCUS_02720 316866 315175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 318239 316920 gene locus_tag LOCUS_02730 318239 316920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 318572 318249 gene locus_tag LOCUS_02740 318572 318249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 318785 319702 gene locus_tag LOCUS_02750 318785 319702 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_02750 319749 320777 gene locus_tag LOCUS_02760 319749 320777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 320758 321579 gene locus_tag LOCUS_02770 320758 321579 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_02770 321581 322813 gene locus_tag LOCUS_02780 gene nrfD 321581 322813 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937995.1 protein_id gnl|my_center|LOCUS_02780 323956 322928 gene locus_tag LOCUS_02790 323956 322928 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_02790 325924 323972 gene locus_tag LOCUS_02800 325924 323972 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_02800 326838 325909 gene locus_tag LOCUS_02810 326838 325909 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901998.1 protein_id gnl|my_center|LOCUS_02810 328254 326839 gene locus_tag LOCUS_02820 328254 326839 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_02820 329274 328267 gene locus_tag LOCUS_02830 gene exoA 329274 328267 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061866.1 protein_id gnl|my_center|LOCUS_02830 330741 329305 gene locus_tag LOCUS_02840 330741 329305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 331440 330757 gene locus_tag LOCUS_02850 331440 330757 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_02850 331869 331480 gene locus_tag LOCUS_02860 331869 331480 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_02860 332744 332061 gene locus_tag LOCUS_02870 332744 332061 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124419.1 protein_id gnl|my_center|LOCUS_02870 333931 332759 gene locus_tag LOCUS_02880 333931 332759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 335654 333921 gene locus_tag LOCUS_02890 335654 333921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285995.1 protein_id gnl|my_center|LOCUS_02890 336416 335727 gene locus_tag LOCUS_02900 336416 335727 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122393.1 protein_id gnl|my_center|LOCUS_02900 337152 336421 gene locus_tag LOCUS_02910 337152 336421 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122393.1 protein_id gnl|my_center|LOCUS_02910 337837 337139 gene locus_tag LOCUS_02920 337837 337139 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122393.1 protein_id gnl|my_center|LOCUS_02920 338562 337849 gene locus_tag LOCUS_02930 338562 337849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 339438 338725 gene locus_tag LOCUS_02940 339438 338725 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122393.1 protein_id gnl|my_center|LOCUS_02940 341045 340569 gene locus_tag LOCUS_02950 341045 340569 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528271.1 protein_id gnl|my_center|LOCUS_02950 342206 341259 gene locus_tag LOCUS_02960 342206 341259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 344689 342224 gene locus_tag LOCUS_02970 gene leuS 344689 342224 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479923.1 protein_id gnl|my_center|LOCUS_02970 345335 345261 gene locus_tag LOCUS_t00050 345335 345261 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 346326 345457 gene locus_tag LOCUS_02980 346326 345457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 348083 346605 gene locus_tag LOCUS_02990 348083 346605 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940212.1 protein_id gnl|my_center|LOCUS_02990 348254 349243 gene locus_tag LOCUS_03000 348254 349243 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456725.1 protein_id gnl|my_center|LOCUS_03000 351220 349766 gene locus_tag LOCUS_03010 gene gnd 351220 349766 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263332.1 protein_id gnl|my_center|LOCUS_03010 351720 351235 gene locus_tag LOCUS_03020 351720 351235 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089501.1 protein_id gnl|my_center|LOCUS_03020 352979 351729 gene locus_tag LOCUS_03030 352979 351729 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_03030 353989 352976 gene locus_tag LOCUS_03040 gene hisC 353989 352976 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_03040 355682 354039 gene locus_tag LOCUS_03050 gene ilvB 355682 354039 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_03050 357487 355679 gene locus_tag LOCUS_03060 357487 355679 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392243.1 protein_id gnl|my_center|LOCUS_03060 359990 357498 gene locus_tag LOCUS_03070 359990 357498 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_03070 361292 360006 gene locus_tag LOCUS_03080 361292 360006 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117040.1 protein_id gnl|my_center|LOCUS_03080 362478 361285 gene locus_tag LOCUS_03090 362478 361285 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_03090 363461 362475 gene locus_tag LOCUS_03100 363461 362475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582574.1 protein_id gnl|my_center|LOCUS_03100 364477 363458 gene locus_tag LOCUS_03110 364477 363458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706885.1 protein_id gnl|my_center|LOCUS_03110 365406 364474 gene locus_tag LOCUS_03120 365406 364474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868060.1 protein_id gnl|my_center|LOCUS_03120 366419 365409 gene locus_tag LOCUS_03130 366419 365409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582577.1 protein_id gnl|my_center|LOCUS_03130 368389 366518 gene locus_tag LOCUS_03140 368389 366518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 369421 368477 gene locus_tag LOCUS_03150 369421 368477 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_03150 369657 369424 gene locus_tag LOCUS_03160 369657 369424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 370810 369659 gene locus_tag LOCUS_03170 370810 369659 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612378.1 protein_id gnl|my_center|LOCUS_03170 372409 370820 gene locus_tag LOCUS_03180 372409 370820 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_03180 373029 372442 gene locus_tag LOCUS_03190 373029 372442 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_03190 373821 373291 gene locus_tag LOCUS_03200 373821 373291 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_03200 375722 376072 gene locus_tag LOCUS_03210 375722 376072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 376632 376327 gene locus_tag LOCUS_03220 376632 376327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 377789 376914 gene locus_tag LOCUS_03230 377789 376914 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140159.1 protein_id gnl|my_center|LOCUS_03230 378314 378241 gene locus_tag LOCUS_t00060 378314 378241 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 378779 378381 gene locus_tag LOCUS_03240 378779 378381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 379016 378931 gene locus_tag LOCUS_t00070 379016 378931 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 379116 381518 gene locus_tag LOCUS_03250 379116 381518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 381933 381718 gene locus_tag LOCUS_03260 381933 381718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 382437 382126 gene locus_tag LOCUS_03270 382437 382126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 382719 382447 gene locus_tag LOCUS_03280 382719 382447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 382694 383539 gene locus_tag LOCUS_03290 382694 383539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 383684 384793 gene locus_tag LOCUS_03300 383684 384793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 387354 384904 gene locus_tag LOCUS_03310 gene gyrA 387354 384904 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_03310 391770 387469 gene locus_tag LOCUS_03320 gene rpoC 391770 387469 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256762.1 protein_id gnl|my_center|LOCUS_03320 395189 392070 gene locus_tag LOCUS_03330 395189 392070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 396262 395597 gene locus_tag LOCUS_03340 396262 395597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 397055 396306 gene locus_tag LOCUS_03350 397055 396306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 397728 397024 gene locus_tag LOCUS_03360 397728 397024 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_03360 398423 397725 gene locus_tag LOCUS_03370 gene cmk 398423 397725 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_03370 400212 398458 gene locus_tag LOCUS_03380 400212 398458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 402763 400241 gene locus_tag LOCUS_03390 402763 400241 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141612405.1 protein_id gnl|my_center|LOCUS_03390 407713 402779 gene locus_tag LOCUS_03400 407713 402779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 409909 407729 gene locus_tag LOCUS_03410 409909 407729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 410792 409968 gene locus_tag LOCUS_03420 410792 409968 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259313.1 protein_id gnl|my_center|LOCUS_03420 410852 411127 gene locus_tag LOCUS_03430 410852 411127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 411114 411509 gene locus_tag LOCUS_03440 411114 411509 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250207.1 protein_id gnl|my_center|LOCUS_03440 412692 411529 gene locus_tag LOCUS_03450 412692 411529 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259312.1 protein_id gnl|my_center|LOCUS_03450 413759 412719 gene locus_tag LOCUS_03460 413759 412719 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909115.1 protein_id gnl|my_center|LOCUS_03460 414790 413777 gene locus_tag LOCUS_03470 414790 413777 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_03470 416210 414972 gene locus_tag LOCUS_03480 416210 414972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 417037 416237 gene locus_tag LOCUS_03490 417037 416237 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_03490 417178 418047 gene locus_tag LOCUS_03500 417178 418047 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_03500 418062 419039 gene locus_tag LOCUS_03510 gene mvk 418062 419039 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_03510 421092 419209 gene locus_tag LOCUS_03520 421092 419209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 423428 421617 gene locus_tag LOCUS_03530 423428 421617 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_03530 423606 424430 gene locus_tag LOCUS_03540 423606 424430 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_03540 425417 424455 gene locus_tag LOCUS_03550 425417 424455 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_03550 426074 425523 gene locus_tag LOCUS_03560 426074 425523 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929712.1 protein_id gnl|my_center|LOCUS_03560 427397 426207 gene locus_tag LOCUS_03570 gene dinB 427397 426207 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence002 1338 175 gene locus_tag LOCUS_03580 1338 175 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_03580 1421 1909 gene locus_tag LOCUS_03590 1421 1909 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_03590 2022 2783 gene locus_tag LOCUS_03600 gene udp 2022 2783 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_03600 5720 2856 gene locus_tag LOCUS_03610 5720 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 11081 5724 gene locus_tag LOCUS_03620 11081 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 11418 11089 gene locus_tag LOCUS_03630 11418 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 11604 12173 gene locus_tag LOCUS_03640 11604 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 12288 12959 gene locus_tag LOCUS_03650 12288 12959 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_03650 13058 13627 gene locus_tag LOCUS_03660 13058 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 14296 13667 gene locus_tag LOCUS_03670 14296 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 14767 14306 gene locus_tag LOCUS_03680 14767 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 15706 14876 gene locus_tag LOCUS_03690 15706 14876 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869876.1 protein_id gnl|my_center|LOCUS_03690 17690 15774 gene locus_tag LOCUS_03700 17690 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 17903 17721 gene locus_tag LOCUS_03710 17903 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 18578 18105 gene locus_tag LOCUS_03720 18578 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 19677 18595 gene locus_tag LOCUS_03730 gene mnmA 19677 18595 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_03730 20921 19758 gene locus_tag LOCUS_03740 gene nifS 20921 19758 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_03740 21018 22439 gene locus_tag LOCUS_03750 21018 22439 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_03750 22476 23285 gene locus_tag LOCUS_03760 22476 23285 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_03760 23282 24244 gene locus_tag LOCUS_03770 23282 24244 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_03770 25838 24351 gene locus_tag LOCUS_03780 25838 24351 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258467.1 protein_id gnl|my_center|LOCUS_03780 26013 26975 gene locus_tag LOCUS_03790 26013 26975 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_03790 28515 27052 gene locus_tag LOCUS_03800 28515 27052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 29718 28594 gene locus_tag LOCUS_03810 29718 28594 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_03810 31169 29715 gene locus_tag LOCUS_03820 31169 29715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 32367 31153 gene locus_tag LOCUS_03830 32367 31153 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_03830 33601 32399 gene locus_tag LOCUS_03840 33601 32399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 36011 33582 gene locus_tag LOCUS_03850 36011 33582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 38827 35996 gene locus_tag LOCUS_03860 38827 35996 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_03860 39566 38919 gene locus_tag LOCUS_03870 39566 38919 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_03870 40325 39612 gene locus_tag LOCUS_03880 40325 39612 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_03880 43056 40330 gene locus_tag LOCUS_03890 43056 40330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 44454 43090 gene locus_tag LOCUS_03900 44454 43090 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_03900 45121 44576 gene locus_tag LOCUS_03910 45121 44576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 45868 45233 gene locus_tag LOCUS_03920 gene udk 45868 45233 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_03920 46721 45966 gene locus_tag LOCUS_03930 46721 45966 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_03930 47152 46736 gene locus_tag LOCUS_03940 47152 46736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 47423 47351 gene locus_tag LOCUS_t00080 47423 47351 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 47520 48764 gene locus_tag LOCUS_03950 47520 48764 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_03950 49874 48771 gene locus_tag LOCUS_03960 49874 48771 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_03960 50108 50584 gene locus_tag LOCUS_03970 50108 50584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 50619 51521 gene locus_tag LOCUS_03980 50619 51521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 51550 52782 gene locus_tag LOCUS_03990 51550 52782 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062420975.1 protein_id gnl|my_center|LOCUS_03990 52874 53257 gene locus_tag LOCUS_04000 52874 53257 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_04000 53254 54168 gene locus_tag LOCUS_04010 53254 54168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 55530 54208 gene locus_tag LOCUS_04020 55530 54208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 55782 55531 gene locus_tag LOCUS_04030 55782 55531 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255927.1 protein_id gnl|my_center|LOCUS_04030 56200 55796 gene locus_tag LOCUS_04040 56200 55796 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660364.1 protein_id gnl|my_center|LOCUS_04040 56294 58309 gene locus_tag LOCUS_04050 56294 58309 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_04050 58606 58394 gene locus_tag LOCUS_04060 58606 58394 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_04060 59838 58786 gene locus_tag LOCUS_04070 59838 58786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 60945 59884 gene locus_tag LOCUS_04080 60945 59884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 61759 61121 gene locus_tag LOCUS_04090 61759 61121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 62592 61783 gene locus_tag LOCUS_04100 62592 61783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 63488 62589 gene locus_tag LOCUS_04110 63488 62589 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_04110 64162 63485 gene locus_tag LOCUS_04120 64162 63485 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436215.1 protein_id gnl|my_center|LOCUS_04120 65177 64065 gene locus_tag LOCUS_04130 65177 64065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 65774 65196 gene locus_tag LOCUS_04140 65774 65196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 66456 65971 gene locus_tag LOCUS_04150 66456 65971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 66559 67104 gene locus_tag LOCUS_04160 66559 67104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 67986 67105 gene locus_tag LOCUS_04170 67986 67105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 69616 68045 gene locus_tag LOCUS_04180 69616 68045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365927.1 protein_id gnl|my_center|LOCUS_04180 70449 69898 gene locus_tag LOCUS_04190 70449 69898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 71388 70699 gene locus_tag LOCUS_04200 71388 70699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 72426 71644 gene locus_tag LOCUS_04210 72426 71644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 72946 72862 gene locus_tag LOCUS_t00090 72946 72862 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 73073 73840 gene locus_tag LOCUS_04220 73073 73840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 76296 73933 gene locus_tag LOCUS_04230 76296 73933 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257190.1 protein_id gnl|my_center|LOCUS_04230 76748 77980 gene locus_tag LOCUS_04240 gene rpoD 76748 77980 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280530.1 protein_id gnl|my_center|LOCUS_04240 79621 78017 gene locus_tag LOCUS_04250 79621 78017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257117.1 protein_id gnl|my_center|LOCUS_04250 81190 79631 gene locus_tag LOCUS_04260 81190 79631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 81242 82948 gene locus_tag LOCUS_04270 81242 82948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 82932 84026 gene locus_tag LOCUS_04280 82932 84026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 84023 84982 gene locus_tag LOCUS_04290 84023 84982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 84979 86475 gene locus_tag LOCUS_04300 84979 86475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965503.1 protein_id gnl|my_center|LOCUS_04300 86527 86946 gene locus_tag LOCUS_04310 86527 86946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 87027 88505 gene locus_tag LOCUS_04320 87027 88505 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_04320 89225 89704 gene locus_tag LOCUS_04330 89225 89704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 89705 90463 gene locus_tag LOCUS_04340 89705 90463 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780983.1 protein_id gnl|my_center|LOCUS_04340 90465 91643 gene locus_tag LOCUS_04350 90465 91643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 91630 92385 gene locus_tag LOCUS_04360 91630 92385 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_04360 92392 93804 gene locus_tag LOCUS_04370 92392 93804 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_04370 93809 96259 gene locus_tag LOCUS_04380 93809 96259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 96361 97602 gene locus_tag LOCUS_04390 96361 97602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 97765 99138 gene locus_tag LOCUS_04400 97765 99138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 99223 101157 gene locus_tag LOCUS_04410 99223 101157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 101154 102722 gene locus_tag LOCUS_04420 101154 102722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 102923 104257 gene locus_tag LOCUS_04430 102923 104257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 104395 105111 gene locus_tag LOCUS_04440 104395 105111 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_04440 105117 106193 gene locus_tag LOCUS_04450 105117 106193 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257187.1 protein_id gnl|my_center|LOCUS_04450 106283 106429 gene locus_tag LOCUS_04460 106283 106429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 106705 107817 gene locus_tag LOCUS_04470 106705 107817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 107860 109104 gene locus_tag LOCUS_04480 107860 109104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 109144 110532 gene locus_tag LOCUS_04490 109144 110532 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_04490 110567 111529 gene locus_tag LOCUS_04500 110567 111529 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_04500 111579 112529 gene locus_tag LOCUS_04510 111579 112529 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_04510 112768 113277 gene locus_tag LOCUS_04520 112768 113277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 113307 113870 gene locus_tag LOCUS_04530 gene raiA 113307 113870 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_04530 114100 114777 gene locus_tag LOCUS_04540 114100 114777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 114795 116357 gene locus_tag LOCUS_04550 114795 116357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 116404 119391 gene locus_tag LOCUS_04560 116404 119391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 119637 119437 gene locus_tag LOCUS_04570 119637 119437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 120093 119650 gene locus_tag LOCUS_04580 120093 119650 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259432.1 protein_id gnl|my_center|LOCUS_04580 121072 120317 gene locus_tag LOCUS_04590 121072 120317 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258357.1 protein_id gnl|my_center|LOCUS_04590 121632 121072 gene locus_tag LOCUS_04600 121632 121072 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_04600 121804 122172 gene locus_tag LOCUS_04610 121804 122172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 122188 122415 gene locus_tag LOCUS_04620 122188 122415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 122633 122902 gene locus_tag LOCUS_04630 122633 122902 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_04630 122940 123146 gene locus_tag LOCUS_04640 gene copP 122940 123146 CDS product copper-binding metallochaperone CopP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648265.1 protein_id gnl|my_center|LOCUS_04640 123225 123470 gene locus_tag LOCUS_04650 123225 123470 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272729.1 protein_id gnl|my_center|LOCUS_04650 123470 125920 gene locus_tag LOCUS_04660 123470 125920 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_04660 126068 126967 gene locus_tag LOCUS_04670 126068 126967 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_04670 127055 130180 gene locus_tag LOCUS_04680 127055 130180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 131346 130261 gene locus_tag LOCUS_04690 131346 130261 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_04690 132131 131460 gene locus_tag LOCUS_04700 gene rpe 132131 131460 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_04700 132851 132171 gene locus_tag LOCUS_04710 gene rpiA 132851 132171 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250377.1 protein_id gnl|my_center|LOCUS_04710 134886 132889 gene locus_tag LOCUS_04720 gene tkt 134886 132889 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_04720 135219 135680 gene locus_tag LOCUS_04730 135219 135680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 136179 136580 gene locus_tag LOCUS_04740 136179 136580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 137851 136706 gene locus_tag LOCUS_04750 137851 136706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 138341 137862 gene locus_tag LOCUS_04760 138341 137862 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808186.1 protein_id gnl|my_center|LOCUS_04760 139131 138364 gene locus_tag LOCUS_04770 139131 138364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 139900 139142 gene locus_tag LOCUS_04780 gene qcrB 139900 139142 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 protein_id gnl|my_center|LOCUS_04780 142029 139960 gene locus_tag LOCUS_04790 142029 139960 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_04790 142104 142529 gene locus_tag LOCUS_04800 142104 142529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 142981 142607 gene locus_tag LOCUS_04810 142981 142607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 145385 143061 gene locus_tag LOCUS_04820 145385 143061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 147178 145523 gene locus_tag LOCUS_04830 147178 145523 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258288.1 protein_id gnl|my_center|LOCUS_04830 147675 147184 gene locus_tag LOCUS_04840 147675 147184 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_04840 148521 147886 gene locus_tag LOCUS_04850 148521 147886 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_04850 149011 148529 gene locus_tag LOCUS_04860 149011 148529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 149631 149026 gene locus_tag LOCUS_04870 149631 149026 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229033.1 protein_id gnl|my_center|LOCUS_04870 150585 149653 gene locus_tag LOCUS_04880 150585 149653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 151305 150631 gene locus_tag LOCUS_04890 151305 150631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 151547 151714 gene locus_tag LOCUS_04900 151547 151714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 151665 152699 gene locus_tag LOCUS_04910 151665 152699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 152833 153555 gene locus_tag LOCUS_04920 152833 153555 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_04920 153565 154122 gene locus_tag LOCUS_04930 153565 154122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 154181 155218 gene locus_tag LOCUS_04940 154181 155218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 155280 156047 gene locus_tag LOCUS_04950 gene pgeF 155280 156047 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_04950 156059 156793 gene locus_tag LOCUS_04960 156059 156793 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_04960 156843 157106 gene locus_tag LOCUS_04970 156843 157106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 157132 157443 gene locus_tag LOCUS_04980 157132 157443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 159948 157462 gene locus_tag LOCUS_04990 159948 157462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 160654 159953 gene locus_tag LOCUS_05000 160654 159953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 160767 162353 gene locus_tag LOCUS_05010 160767 162353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 162360 164555 gene locus_tag LOCUS_05020 162360 164555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933858.1 protein_id gnl|my_center|LOCUS_05020 164552 166213 gene locus_tag LOCUS_05030 164552 166213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 166248 168578 gene locus_tag LOCUS_05040 166248 168578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 168643 169527 gene locus_tag LOCUS_05050 168643 169527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 169536 170258 gene locus_tag LOCUS_05060 169536 170258 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 protein_id gnl|my_center|LOCUS_05060 170263 171528 gene locus_tag LOCUS_05070 170263 171528 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215505108.1 protein_id gnl|my_center|LOCUS_05070 171696 172814 gene locus_tag LOCUS_05080 171696 172814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 172854 174320 gene locus_tag LOCUS_05090 172854 174320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 174317 175801 gene locus_tag LOCUS_05100 174317 175801 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_05100 175798 176961 gene locus_tag LOCUS_05110 175798 176961 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_05110 176961 178145 gene locus_tag LOCUS_05120 176961 178145 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_05120 178253 179335 gene locus_tag LOCUS_05130 178253 179335 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_05130 179364 181619 gene locus_tag LOCUS_05140 179364 181619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 181719 182606 gene locus_tag LOCUS_05150 181719 182606 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142189.1 protein_id gnl|my_center|LOCUS_05150 182621 182812 gene locus_tag LOCUS_05160 182621 182812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 182809 183579 gene locus_tag LOCUS_05170 gene rfbF 182809 183579 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435696.1 protein_id gnl|my_center|LOCUS_05170 183598 184626 gene locus_tag LOCUS_05180 183598 184626 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_05180 184623 185855 gene locus_tag LOCUS_05190 184623 185855 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_05190 185901 186719 gene locus_tag LOCUS_05200 185901 186719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 187117 187953 gene locus_tag LOCUS_05210 187117 187953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 188911 189888 gene locus_tag LOCUS_05220 188911 189888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 189940 191073 gene locus_tag LOCUS_05230 189940 191073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 191158 192309 gene locus_tag LOCUS_05240 191158 192309 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264255.1 protein_id gnl|my_center|LOCUS_05240 192302 193459 gene locus_tag LOCUS_05250 192302 193459 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975518.1 protein_id gnl|my_center|LOCUS_05250 193697 194596 gene locus_tag LOCUS_05260 193697 194596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 195779 194580 gene locus_tag LOCUS_05270 195779 194580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 196736 195864 gene locus_tag LOCUS_05280 196736 195864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 197556 196744 gene locus_tag LOCUS_05290 197556 196744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 198561 197593 gene locus_tag LOCUS_05300 198561 197593 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_05300 200224 198626 gene locus_tag LOCUS_05310 200224 198626 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_05310 201100 200237 gene locus_tag LOCUS_05320 201100 200237 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_05320 201921 201127 gene locus_tag LOCUS_05330 201921 201127 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_05330 202771 201926 gene locus_tag LOCUS_05340 202771 201926 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_05340 203935 202805 gene locus_tag LOCUS_05350 203935 202805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 204121 203939 gene locus_tag LOCUS_05360 204121 203939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 205923 204124 gene locus_tag LOCUS_05370 205923 204124 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_05370 205998 206171 gene locus_tag LOCUS_05380 205998 206171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 206975 206211 gene locus_tag LOCUS_05390 206975 206211 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_05390 207753 206992 gene locus_tag LOCUS_05400 207753 206992 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462332.1 protein_id gnl|my_center|LOCUS_05400 208927 207842 gene locus_tag LOCUS_05410 208927 207842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 209642 209241 gene locus_tag LOCUS_05420 209642 209241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 210152 211489 gene locus_tag LOCUS_05430 210152 211489 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_05430 212746 219204 gene locus_tag LOCUS_05440 212746 219204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 219836 219201 gene locus_tag LOCUS_05450 219836 219201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 221127 220123 gene locus_tag LOCUS_05460 221127 220123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 221230 221979 gene locus_tag LOCUS_05470 221230 221979 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392941.1 protein_id gnl|my_center|LOCUS_05470 222707 222009 gene locus_tag LOCUS_05480 222707 222009 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_05480 224298 222745 gene locus_tag LOCUS_05490 224298 222745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 225236 224436 gene locus_tag LOCUS_05500 225236 224436 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_05500 225879 225229 gene locus_tag LOCUS_05510 225879 225229 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918171.1 protein_id gnl|my_center|LOCUS_05510 225961 227733 gene locus_tag LOCUS_05520 gene mutL 225961 227733 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_05520 227737 228771 gene locus_tag LOCUS_05530 227737 228771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 230013 228823 gene locus_tag LOCUS_05540 230013 228823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 230539 230006 gene locus_tag LOCUS_05550 230539 230006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 231952 230795 gene locus_tag LOCUS_05560 231952 230795 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_05560 232051 233484 gene locus_tag LOCUS_05570 gene tilS 232051 233484 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_05570 233572 234600 gene locus_tag LOCUS_05580 233572 234600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 234612 235058 gene locus_tag LOCUS_05590 234612 235058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 235073 235771 gene locus_tag LOCUS_05600 235073 235771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 235937 237208 gene locus_tag LOCUS_05610 235937 237208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142052.1 protein_id gnl|my_center|LOCUS_05610 237205 237930 gene locus_tag LOCUS_05620 237205 237930 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641277.1 protein_id gnl|my_center|LOCUS_05620 237950 238447 gene locus_tag LOCUS_05630 237950 238447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 238444 238992 gene locus_tag LOCUS_05640 238444 238992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 239948 239046 gene locus_tag LOCUS_05650 239948 239046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 240280 241401 gene locus_tag LOCUS_05660 240280 241401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 242490 243008 gene locus_tag LOCUS_05670 242490 243008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 243612 243130 gene locus_tag LOCUS_05680 243612 243130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 244114 243905 gene locus_tag LOCUS_05690 244114 243905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 244394 244107 gene locus_tag LOCUS_05700 244394 244107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 244918 244376 gene locus_tag LOCUS_05710 244918 244376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 245282 245208 gene locus_tag LOCUS_t00100 245282 245208 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 246349 245345 gene locus_tag LOCUS_05720 246349 245345 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_05720 247619 246372 gene locus_tag LOCUS_05730 gene coaBC 247619 246372 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 protein_id gnl|my_center|LOCUS_05730 247791 249638 gene locus_tag LOCUS_05740 247791 249638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 249656 253519 gene locus_tag LOCUS_05750 249656 253519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 254410 253598 gene locus_tag LOCUS_05760 254410 253598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 254476 254551 gene locus_tag LOCUS_t00110 254476 254551 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 254823 255038 gene locus_tag LOCUS_05770 254823 255038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 256010 255804 gene locus_tag LOCUS_05780 256010 255804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 256597 258477 gene locus_tag LOCUS_05790 256597 258477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 258520 259785 gene locus_tag LOCUS_05800 258520 259785 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_05800 259822 260811 gene locus_tag LOCUS_05810 259822 260811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 260825 261853 gene locus_tag LOCUS_05820 260825 261853 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931000.1 protein_id gnl|my_center|LOCUS_05820 261932 263908 gene locus_tag LOCUS_05830 261932 263908 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_05830 264024 264659 gene locus_tag LOCUS_05840 264024 264659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 264663 265100 gene locus_tag LOCUS_05850 264663 265100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 266304 265321 gene locus_tag LOCUS_05860 266304 265321 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_05860 267685 266318 gene locus_tag LOCUS_05870 267685 266318 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_05870 268370 267693 gene locus_tag LOCUS_05880 268370 267693 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_05880 268800 271355 gene locus_tag LOCUS_05890 268800 271355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 271427 272518 gene locus_tag LOCUS_05900 271427 272518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 272523 273656 gene locus_tag LOCUS_05910 272523 273656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 274557 275195 gene locus_tag LOCUS_05920 274557 275195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 275875 276027 gene locus_tag LOCUS_05930 275875 276027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 276146 276748 gene locus_tag LOCUS_05940 276146 276748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 277322 277987 gene locus_tag LOCUS_05950 277322 277987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 278042 279214 gene locus_tag LOCUS_05960 278042 279214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 279595 279224 gene locus_tag LOCUS_05970 279595 279224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 280135 281223 gene locus_tag LOCUS_05980 280135 281223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 281853 282527 gene locus_tag LOCUS_05990 281853 282527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 283358 284200 gene locus_tag LOCUS_06000 283358 284200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence003 436 173 gene locus_tag LOCUS_06010 436 173 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_06010 957 679 gene locus_tag LOCUS_06020 957 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 1575 967 gene locus_tag LOCUS_06030 1575 967 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_06030 2038 2430 gene locus_tag LOCUS_06040 2038 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2434 4455 gene locus_tag LOCUS_06050 gene cooS 2434 4455 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_06050 4528 8196 gene locus_tag LOCUS_06060 4528 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 8264 9595 gene locus_tag LOCUS_06070 gene acsC 8264 9595 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_06070 9662 11584 gene locus_tag LOCUS_06080 9662 11584 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_06080 11694 12617 gene locus_tag LOCUS_06090 11694 12617 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546439.1 protein_id gnl|my_center|LOCUS_06090 12718 14076 gene locus_tag LOCUS_06100 12718 14076 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_06100 14090 14995 gene locus_tag LOCUS_06110 14090 14995 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978410.1 protein_id gnl|my_center|LOCUS_06110 15190 15846 gene locus_tag LOCUS_06120 15190 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 15986 16771 gene locus_tag LOCUS_06130 15986 16771 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_06130 16787 17578 gene locus_tag LOCUS_06140 16787 17578 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_06140 17666 18208 gene locus_tag LOCUS_06150 gene msrA 17666 18208 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_06150 18239 18550 gene locus_tag LOCUS_06160 18239 18550 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_06160 18553 19122 gene locus_tag LOCUS_06170 18553 19122 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090717.1 protein_id gnl|my_center|LOCUS_06170 19221 19715 gene locus_tag LOCUS_06180 19221 19715 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_06180 19773 19958 gene locus_tag LOCUS_06190 19773 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 19980 20393 gene locus_tag LOCUS_06200 19980 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 20706 21218 gene locus_tag LOCUS_06210 20706 21218 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529616.1 protein_id gnl|my_center|LOCUS_06210 21225 21743 gene locus_tag LOCUS_06220 21225 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 21801 22700 gene locus_tag LOCUS_06230 21801 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 22707 23765 gene locus_tag LOCUS_06240 22707 23765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 23783 24421 gene locus_tag LOCUS_06250 23783 24421 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387519.1 protein_id gnl|my_center|LOCUS_06250 24454 24930 gene locus_tag LOCUS_06260 24454 24930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 24964 25200 gene locus_tag LOCUS_06270 24964 25200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 25181 26161 gene locus_tag LOCUS_06280 25181 26161 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222033.1 protein_id gnl|my_center|LOCUS_06280 26254 29319 gene locus_tag LOCUS_06290 26254 29319 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256767.1 protein_id gnl|my_center|LOCUS_06290 29671 30030 gene locus_tag LOCUS_06300 29671 30030 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_06300 30206 30769 gene locus_tag LOCUS_06310 30206 30769 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_06310 30830 31732 gene locus_tag LOCUS_06320 30830 31732 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_06320 32292 31819 gene locus_tag LOCUS_06330 32292 31819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 33615 32308 gene locus_tag LOCUS_06340 33615 32308 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_06340 34458 33676 gene locus_tag LOCUS_06350 34458 33676 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_06350 35330 34458 gene locus_tag LOCUS_06360 35330 34458 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_06360 36451 35333 gene locus_tag LOCUS_06370 36451 35333 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_06370 36934 36455 gene locus_tag LOCUS_06380 36934 36455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 39940 37259 gene locus_tag LOCUS_06390 gene fdhF 39940 37259 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(38900..38902),aa:Sec) note codon on position 347 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_06390 41768 39954 gene locus_tag LOCUS_06400 gene nuoF 41768 39954 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_06400 42222 41755 gene locus_tag LOCUS_06410 gene nuoE 42222 41755 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877157.1 protein_id gnl|my_center|LOCUS_06410 43203 42502 gene locus_tag LOCUS_06420 43203 42502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 44040 43222 gene locus_tag LOCUS_06430 44040 43222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 45766 44033 gene locus_tag LOCUS_06440 45766 44033 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_06440 47860 45932 gene locus_tag LOCUS_06450 47860 45932 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705499.1 protein_id gnl|my_center|LOCUS_06450 48896 48006 gene locus_tag LOCUS_06460 gene folD 48896 48006 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_06460 49464 50315 gene locus_tag LOCUS_06470 gene panB 49464 50315 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_06470 50405 51667 gene locus_tag LOCUS_06480 50405 51667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 51852 52892 gene locus_tag LOCUS_06490 51852 52892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_06490 52934 55384 gene locus_tag LOCUS_06500 52934 55384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 55624 56598 gene locus_tag LOCUS_06510 55624 56598 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_06510 56603 57370 gene locus_tag LOCUS_06520 56603 57370 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_06520 57381 57683 gene locus_tag LOCUS_06530 57381 57683 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 protein_id gnl|my_center|LOCUS_06530 57695 59764 gene locus_tag LOCUS_06540 57695 59764 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_06540 59757 60881 gene locus_tag LOCUS_06550 59757 60881 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_06550 62124 60997 gene locus_tag LOCUS_06560 62124 60997 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_06560 63143 62124 gene locus_tag LOCUS_06570 63143 62124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 64812 63172 gene locus_tag LOCUS_06580 64812 63172 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_06580 65501 65160 gene locus_tag LOCUS_06590 65501 65160 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705759.1 protein_id gnl|my_center|LOCUS_06590 65722 65510 gene locus_tag LOCUS_06600 65722 65510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 66186 65719 gene locus_tag LOCUS_06610 66186 65719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 66333 67856 gene locus_tag LOCUS_06620 66333 67856 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_06620 68878 67997 gene locus_tag LOCUS_06630 gene cmrA 68878 67997 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_06630 69137 70024 gene locus_tag LOCUS_06640 69137 70024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 protein_id gnl|my_center|LOCUS_06640 70059 70292 gene locus_tag LOCUS_06650 70059 70292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 70366 72174 gene locus_tag LOCUS_06660 gene glmS 70366 72174 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875810.1 protein_id gnl|my_center|LOCUS_06660 73303 72176 gene locus_tag LOCUS_06670 73303 72176 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583905.1 protein_id gnl|my_center|LOCUS_06670 74689 73325 gene locus_tag LOCUS_06680 74689 73325 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_06680 75544 74768 gene locus_tag LOCUS_06690 75544 74768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 76744 75713 gene locus_tag LOCUS_06700 76744 75713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 77565 76879 gene locus_tag LOCUS_06710 77565 76879 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_06710 78056 77610 gene locus_tag LOCUS_06720 78056 77610 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140259.1 protein_id gnl|my_center|LOCUS_06720 78578 78120 gene locus_tag LOCUS_06730 78578 78120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 78905 78759 gene locus_tag LOCUS_06740 78905 78759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 79411 79202 gene locus_tag LOCUS_06750 gene cspC 79411 79202 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_06750 79633 80049 gene locus_tag LOCUS_06760 79633 80049 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_06760 80051 81076 gene locus_tag LOCUS_06770 gene meaB 80051 81076 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_06770 81073 81630 gene locus_tag LOCUS_06780 81073 81630 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102425.1 protein_id gnl|my_center|LOCUS_06780 81663 82652 gene locus_tag LOCUS_06790 81663 82652 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_06790 82693 83523 gene locus_tag LOCUS_06800 gene mutM 82693 83523 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_06800 83539 84150 gene locus_tag LOCUS_06810 83539 84150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 85311 84265 gene locus_tag LOCUS_06820 gene add 85311 84265 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259176.1 protein_id gnl|my_center|LOCUS_06820 89567 85431 gene locus_tag LOCUS_06830 89567 85431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 89817 91403 gene locus_tag LOCUS_06840 gene murJ 89817 91403 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_06840 92019 91558 gene locus_tag LOCUS_06850 92019 91558 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_06850 92249 92016 gene locus_tag LOCUS_06860 gene xseB 92249 92016 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428410.1 protein_id gnl|my_center|LOCUS_06860 92685 92242 gene locus_tag LOCUS_06870 92685 92242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 93916 92690 gene locus_tag LOCUS_06880 gene xseA 93916 92690 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_06880 94066 95055 gene locus_tag LOCUS_06890 94066 95055 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_06890 95374 97248 gene locus_tag LOCUS_06900 95374 97248 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_06900 97305 97703 gene locus_tag LOCUS_06910 97305 97703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 98589 97855 gene locus_tag LOCUS_06920 98589 97855 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_06920 99160 98774 gene locus_tag LOCUS_06930 99160 98774 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_06930 99876 99157 gene locus_tag LOCUS_06940 99876 99157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 100602 99898 gene locus_tag LOCUS_06950 100602 99898 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531970.1 protein_id gnl|my_center|LOCUS_06950 101393 100599 gene locus_tag LOCUS_06960 101393 100599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 102535 101402 gene locus_tag LOCUS_06970 102535 101402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 103296 102574 gene locus_tag LOCUS_06980 103296 102574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 104067 103312 gene locus_tag LOCUS_06990 104067 103312 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_06990 106486 104159 gene locus_tag LOCUS_07000 106486 104159 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485759.1 protein_id gnl|my_center|LOCUS_07000 107982 106543 gene locus_tag LOCUS_07010 107982 106543 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_07010 108948 108094 gene locus_tag LOCUS_07020 108948 108094 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249525.1 protein_id gnl|my_center|LOCUS_07020 109978 108941 gene locus_tag LOCUS_07030 109978 108941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 110657 110055 gene locus_tag LOCUS_07040 110657 110055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 111564 110716 gene locus_tag LOCUS_07050 111564 110716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_07050 112814 111624 gene locus_tag LOCUS_07060 112814 111624 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256713.1 protein_id gnl|my_center|LOCUS_07060 115075 112835 gene locus_tag LOCUS_07070 115075 112835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 117329 115089 gene locus_tag LOCUS_07080 117329 115089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 117250 117435 gene locus_tag LOCUS_07090 117250 117435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 118235 117432 gene locus_tag LOCUS_07100 118235 117432 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106189613.1 protein_id gnl|my_center|LOCUS_07100 118913 118239 gene locus_tag LOCUS_07110 118913 118239 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_07110 119102 120007 gene locus_tag LOCUS_07120 119102 120007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 protein_id gnl|my_center|LOCUS_07120 120009 120791 gene locus_tag LOCUS_07130 120009 120791 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227758.1 protein_id gnl|my_center|LOCUS_07130 120788 121303 gene locus_tag LOCUS_07140 120788 121303 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704824.1 protein_id gnl|my_center|LOCUS_07140 121352 122449 gene locus_tag LOCUS_07150 121352 122449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 122452 124197 gene locus_tag LOCUS_07160 gene polX 122452 124197 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_07160 125056 124232 gene locus_tag LOCUS_07170 gene murI 125056 124232 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_07170 125784 125053 gene locus_tag LOCUS_07180 125784 125053 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_07180 126208 125858 gene locus_tag LOCUS_07190 gene rplS 126208 125858 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140830.1 protein_id gnl|my_center|LOCUS_07190 126921 126340 gene locus_tag LOCUS_07200 126921 126340 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_07200 127692 126988 gene locus_tag LOCUS_07210 127692 126988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 128042 129253 gene locus_tag LOCUS_07220 128042 129253 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_07220 129653 129303 gene locus_tag LOCUS_07230 129653 129303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 130217 129795 gene locus_tag LOCUS_07240 130217 129795 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249134.1 protein_id gnl|my_center|LOCUS_07240 131461 130307 gene locus_tag LOCUS_07250 131461 130307 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_07250 132545 131469 gene locus_tag LOCUS_07260 132545 131469 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256144.1 protein_id gnl|my_center|LOCUS_07260 133872 132577 gene locus_tag LOCUS_07270 133872 132577 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_07270 134007 135719 gene locus_tag LOCUS_07280 134007 135719 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080372.1 protein_id gnl|my_center|LOCUS_07280 135899 135826 gene locus_tag LOCUS_t00120 135899 135826 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 136856 136263 gene locus_tag LOCUS_07290 gene lepB 136856 136263 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_07290 137240 136962 gene locus_tag LOCUS_07300 137240 136962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 137605 137285 gene locus_tag LOCUS_07310 gene eutN 137605 137285 CDS product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762193.1 protein_id gnl|my_center|LOCUS_07310 138029 137661 gene locus_tag LOCUS_07320 138029 137661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 138716 138078 gene locus_tag LOCUS_07330 138716 138078 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726800.1 protein_id gnl|my_center|LOCUS_07330 139592 138726 gene locus_tag LOCUS_07340 gene eutJ 139592 138726 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815263.1 protein_id gnl|my_center|LOCUS_07340 139954 139595 gene locus_tag LOCUS_07350 139954 139595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 141521 140052 gene locus_tag LOCUS_07360 141521 140052 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868830.1 protein_id gnl|my_center|LOCUS_07360 141823 141518 gene locus_tag LOCUS_07370 141823 141518 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382338.1 protein_id gnl|my_center|LOCUS_07370 142116 141826 gene locus_tag LOCUS_07380 142116 141826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 143107 142172 gene locus_tag LOCUS_07390 143107 142172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 143715 143116 gene locus_tag LOCUS_07400 143715 143116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 144512 143721 gene locus_tag LOCUS_07410 144512 143721 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976109.1 protein_id gnl|my_center|LOCUS_07410 144768 145487 gene locus_tag LOCUS_07420 144768 145487 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528636.1 protein_id gnl|my_center|LOCUS_07420 145687 146229 gene locus_tag LOCUS_07430 145687 146229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 146247 147203 gene locus_tag LOCUS_07440 146247 147203 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742245.1 protein_id gnl|my_center|LOCUS_07440 147605 148819 gene locus_tag LOCUS_07450 147605 148819 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 protein_id gnl|my_center|LOCUS_07450 148822 149988 gene locus_tag LOCUS_07460 148822 149988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 151184 150180 gene locus_tag LOCUS_07470 151184 150180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 152984 151266 gene locus_tag LOCUS_07480 152984 151266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 153857 153273 gene locus_tag LOCUS_07490 153857 153273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 155378 153993 gene locus_tag LOCUS_07500 gene der 155378 153993 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_07500 156665 155403 gene locus_tag LOCUS_07510 156665 155403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 157516 156662 gene locus_tag LOCUS_07520 gene cdaA 157516 156662 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_07520 158710 157571 gene locus_tag LOCUS_07530 158710 157571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 159878 158868 gene locus_tag LOCUS_07540 159878 158868 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_07540 160947 159913 gene locus_tag LOCUS_07550 160947 159913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_07550 161897 160962 gene locus_tag LOCUS_07560 161897 160962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_07560 162984 161905 gene locus_tag LOCUS_07570 162984 161905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_07570 164806 163097 gene locus_tag LOCUS_07580 164806 163097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 165038 166198 gene locus_tag LOCUS_07590 gene queG 165038 166198 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 protein_id gnl|my_center|LOCUS_07590 166195 167340 gene locus_tag LOCUS_07600 166195 167340 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_07600 168340 167498 gene locus_tag LOCUS_07610 168340 167498 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_07610 168583 168347 gene locus_tag LOCUS_07620 168583 168347 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_07620 168819 168580 gene locus_tag LOCUS_07630 168819 168580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 169697 168852 gene locus_tag LOCUS_07640 169697 168852 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_07640 170765 169752 gene locus_tag LOCUS_07650 170765 169752 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257862.1 protein_id gnl|my_center|LOCUS_07650 170925 171938 gene locus_tag LOCUS_07660 170925 171938 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_07660 171950 172705 gene locus_tag LOCUS_07670 171950 172705 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409939.1 protein_id gnl|my_center|LOCUS_07670 172715 174070 gene locus_tag LOCUS_07680 172715 174070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 174635 174078 gene locus_tag LOCUS_07690 174635 174078 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_07690 175479 174637 gene locus_tag LOCUS_07700 175479 174637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889428.1 protein_id gnl|my_center|LOCUS_07700 176308 175493 gene locus_tag LOCUS_07710 gene modA 176308 175493 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_07710 176852 176319 gene locus_tag LOCUS_07720 176852 176319 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258349.1 protein_id gnl|my_center|LOCUS_07720 177046 177924 gene locus_tag LOCUS_07730 177046 177924 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_07730 178760 177996 gene locus_tag LOCUS_07740 178760 177996 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259517.1 protein_id gnl|my_center|LOCUS_07740 179554 178760 gene locus_tag LOCUS_07750 gene cbiQ 179554 178760 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259516.1 protein_id gnl|my_center|LOCUS_07750 180528 179584 gene locus_tag LOCUS_07760 180528 179584 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_07760 181002 180580 gene locus_tag LOCUS_07770 181002 180580 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_07770 181299 181691 gene locus_tag LOCUS_07780 181299 181691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 182401 181943 gene locus_tag LOCUS_07790 182401 181943 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392657.1 protein_id gnl|my_center|LOCUS_07790 183264 182482 gene locus_tag LOCUS_07800 183264 182482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 184564 183341 gene locus_tag LOCUS_07810 184564 183341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 185991 184663 gene locus_tag LOCUS_07820 gene miaB 185991 184663 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_07820 186060 186494 gene locus_tag LOCUS_07830 186060 186494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 186491 186937 gene locus_tag LOCUS_07840 186491 186937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 187170 188849 gene locus_tag LOCUS_07850 187170 188849 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_07850 188932 189531 gene locus_tag LOCUS_07860 188932 189531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 189535 190731 gene locus_tag LOCUS_07870 189535 190731 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259731.1 protein_id gnl|my_center|LOCUS_07870 190877 191617 gene locus_tag LOCUS_07880 190877 191617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 192625 191651 gene locus_tag LOCUS_07890 gene galE 192625 191651 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_07890 193080 192682 gene locus_tag LOCUS_07900 193080 192682 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196772272.1 protein_id gnl|my_center|LOCUS_07900 194169 193141 gene locus_tag LOCUS_07910 194169 193141 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_07910 194250 195065 gene locus_tag LOCUS_07920 194250 195065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 196780 195290 gene locus_tag LOCUS_07930 196780 195290 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860163.1 protein_id gnl|my_center|LOCUS_07930 198033 196801 gene locus_tag LOCUS_07940 198033 196801 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_07940 198001 198210 gene locus_tag LOCUS_07950 198001 198210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 199410 198133 gene locus_tag LOCUS_07960 199410 198133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 199918 199490 gene locus_tag LOCUS_07970 199918 199490 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890858.1 protein_id gnl|my_center|LOCUS_07970 200054 200746 gene locus_tag LOCUS_07980 200054 200746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 200793 201728 gene locus_tag LOCUS_07990 200793 201728 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_07990 201725 202894 gene locus_tag LOCUS_08000 201725 202894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966542.1 protein_id gnl|my_center|LOCUS_08000 203719 202895 gene locus_tag LOCUS_08010 203719 202895 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651943.1 protein_id gnl|my_center|LOCUS_08010 203847 204212 gene locus_tag LOCUS_08020 203847 204212 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_08020 204563 204234 gene locus_tag LOCUS_08030 204563 204234 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_08030 205192 204617 gene locus_tag LOCUS_08040 205192 204617 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_08040 206106 205189 gene locus_tag LOCUS_08050 206106 205189 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_08050 206462 206193 gene locus_tag LOCUS_08060 206462 206193 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722106.1 protein_id gnl|my_center|LOCUS_08060 208983 206467 gene locus_tag LOCUS_08070 208983 206467 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170304.1 protein_id gnl|my_center|LOCUS_08070 211167 209017 gene locus_tag LOCUS_08080 211167 209017 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_08080 211178 211399 gene locus_tag LOCUS_08090 211178 211399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 211532 212482 gene locus_tag LOCUS_08100 gene rnz 211532 212482 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 protein_id gnl|my_center|LOCUS_08100 213526 212483 gene locus_tag LOCUS_08110 213526 212483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 214243 213605 gene locus_tag LOCUS_08120 214243 213605 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_08120 215095 214409 gene locus_tag LOCUS_08130 215095 214409 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_08130 216197 215136 gene locus_tag LOCUS_08140 216197 215136 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_08140 217072 216194 gene locus_tag LOCUS_08150 gene rsmI 217072 216194 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257838.1 protein_id gnl|my_center|LOCUS_08150 218248 217076 gene locus_tag LOCUS_08160 218248 217076 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_08160 218441 218232 gene locus_tag LOCUS_08170 218441 218232 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704318.1 protein_id gnl|my_center|LOCUS_08170 218492 219142 gene locus_tag LOCUS_08180 218492 219142 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_08180 219253 219672 gene locus_tag LOCUS_08190 219253 219672 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812954.1 protein_id gnl|my_center|LOCUS_08190 219683 220681 gene locus_tag LOCUS_08200 219683 220681 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_08200 220700 221005 gene locus_tag LOCUS_08210 220700 221005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 221002 222186 gene locus_tag LOCUS_08220 221002 222186 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_08220 222218 223210 gene locus_tag LOCUS_08230 222218 223210 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_08230 223234 223737 gene locus_tag LOCUS_08240 gene tsaA 223234 223737 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_08240 224661 223717 gene locus_tag LOCUS_08250 224661 223717 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_08250 225848 224724 gene locus_tag LOCUS_08260 gene dnaJ 225848 224724 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_08260 227851 225920 gene locus_tag LOCUS_08270 gene dnaK 227851 225920 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_08270 228489 227884 gene locus_tag LOCUS_08280 228489 227884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 229544 228486 gene locus_tag LOCUS_08290 gene hrcA 229544 228486 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_08290 230424 229762 gene locus_tag LOCUS_08300 230424 229762 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_08300 231262 230522 gene locus_tag LOCUS_08310 gene trmD 231262 230522 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_08310 231626 232096 gene locus_tag LOCUS_08320 231626 232096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 232249 232455 gene locus_tag LOCUS_08330 232249 232455 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_08330 232883 234802 gene locus_tag LOCUS_08340 gene dnaG 232883 234802 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258766.1 protein_id gnl|my_center|LOCUS_08340 234817 236403 gene locus_tag LOCUS_08350 234817 236403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 236416 237987 gene locus_tag LOCUS_08360 gene pruA 236416 237987 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257665.1 protein_id gnl|my_center|LOCUS_08360 238115 238993 gene locus_tag LOCUS_08370 238115 238993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 239105 239833 gene locus_tag LOCUS_08380 239105 239833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 239906 241435 gene locus_tag LOCUS_08390 239906 241435 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808649.1 protein_id gnl|my_center|LOCUS_08390 241438 241986 gene locus_tag LOCUS_08400 gene nimA 241438 241986 CDS product 5-nitroimidazole antibiotic resistance protein NimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887488.1 protein_id gnl|my_center|LOCUS_08400 242036 242218 gene locus_tag LOCUS_08410 242036 242218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 242256 243065 gene locus_tag LOCUS_08420 242256 243065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 243125 244606 gene locus_tag LOCUS_08430 243125 244606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 244710 245078 gene locus_tag LOCUS_08440 244710 245078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 245085 245735 gene locus_tag LOCUS_08450 245085 245735 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_08450 245799 246956 gene locus_tag LOCUS_08460 245799 246956 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_08460 246968 247747 gene locus_tag LOCUS_08470 246968 247747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258540.1 protein_id gnl|my_center|LOCUS_08470 248541 249611 gene locus_tag LOCUS_08480 248541 249611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 249637 250899 gene locus_tag LOCUS_08490 249637 250899 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886935.1 protein_id gnl|my_center|LOCUS_08490 251043 251450 gene locus_tag LOCUS_08500 251043 251450 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_08500 252756 251497 gene locus_tag LOCUS_08510 252756 251497 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_08510 253013 252931 gene locus_tag LOCUS_t00130 253013 252931 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 253090 253338 gene locus_tag LOCUS_08520 253090 253338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 253366 253566 gene locus_tag LOCUS_08530 253366 253566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 253596 254147 gene locus_tag LOCUS_08540 253596 254147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 254150 254716 gene locus_tag LOCUS_08550 254150 254716 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459818.1 protein_id gnl|my_center|LOCUS_08550 254863 256635 gene locus_tag LOCUS_08560 254863 256635 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence004 <1 746 gene locus_tag LOCUS_08570 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038991.1:drug/metabolite exporter YedA 843 2147 gene locus_tag LOCUS_08580 843 2147 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_08580 3061 2189 gene locus_tag LOCUS_08590 3061 2189 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_08590 3480 3118 gene locus_tag LOCUS_08600 3480 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4606 3494 gene locus_tag LOCUS_08610 4606 3494 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925640.1 protein_id gnl|my_center|LOCUS_08610 5468 4623 gene locus_tag LOCUS_08620 5468 4623 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172618.1 protein_id gnl|my_center|LOCUS_08620 6315 5647 gene locus_tag LOCUS_08630 6315 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 7557 6514 gene locus_tag LOCUS_08640 7557 6514 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257871.1 protein_id gnl|my_center|LOCUS_08640 8213 7554 gene locus_tag LOCUS_08650 8213 7554 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887247.1 protein_id gnl|my_center|LOCUS_08650 9292 8327 gene locus_tag LOCUS_08660 gene fmt 9292 8327 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_08660 10204 9332 gene locus_tag LOCUS_08670 10204 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 10848 10297 gene locus_tag LOCUS_08680 10848 10297 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_08680 11550 10900 gene locus_tag LOCUS_08690 11550 10900 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_08690 13195 11672 gene locus_tag LOCUS_08700 13195 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 13998 13192 gene locus_tag LOCUS_08710 gene phnC 13998 13192 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 protein_id gnl|my_center|LOCUS_08710 14146 15480 gene locus_tag LOCUS_08720 14146 15480 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_08720 15484 17967 gene locus_tag LOCUS_08730 gene lon 15484 17967 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255996.1 protein_id gnl|my_center|LOCUS_08730 19144 18083 gene locus_tag LOCUS_08740 gene mltG 19144 18083 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_08740 19661 19242 gene locus_tag LOCUS_08750 gene ruvX 19661 19242 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964987.1 protein_id gnl|my_center|LOCUS_08750 21245 19710 gene locus_tag LOCUS_08760 21245 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 22444 21335 gene locus_tag LOCUS_08770 22444 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 25337 22590 gene locus_tag LOCUS_08780 gene alaS 25337 22590 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_08780 26703 25738 gene locus_tag LOCUS_08790 26703 25738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 27674 26715 gene locus_tag LOCUS_08800 27674 26715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 27799 29376 gene locus_tag LOCUS_08810 27799 29376 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_08810 29387 30052 gene locus_tag LOCUS_08820 29387 30052 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881332.1 protein_id gnl|my_center|LOCUS_08820 31271 30057 gene locus_tag LOCUS_08830 31271 30057 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_08830 32483 31383 gene locus_tag LOCUS_08840 32483 31383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_08840 32707 35289 gene locus_tag LOCUS_08850 gene mutS 32707 35289 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_08850 35733 35302 gene locus_tag LOCUS_08860 35733 35302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 36299 35940 gene locus_tag LOCUS_08870 36299 35940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 38624 36447 gene locus_tag LOCUS_08880 38624 36447 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_08880 38782 38612 gene locus_tag LOCUS_08890 38782 38612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 39676 38813 gene locus_tag LOCUS_08900 39676 38813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 40533 39874 gene locus_tag LOCUS_08910 40533 39874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 40636 41463 gene locus_tag LOCUS_08920 40636 41463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 41500 43275 gene locus_tag LOCUS_08930 41500 43275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257645.1 protein_id gnl|my_center|LOCUS_08930 43283 45106 gene locus_tag LOCUS_08940 43283 45106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257644.1 protein_id gnl|my_center|LOCUS_08940 45198 46055 gene locus_tag LOCUS_08950 45198 46055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 46052 46642 gene locus_tag LOCUS_08960 46052 46642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 46681 47643 gene locus_tag LOCUS_08970 46681 47643 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_08970 47686 48978 gene locus_tag LOCUS_08980 47686 48978 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250796.1 protein_id gnl|my_center|LOCUS_08980 48975 49472 gene locus_tag LOCUS_08990 48975 49472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 49796 52297 gene locus_tag LOCUS_09000 49796 52297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 52298 53026 gene locus_tag LOCUS_09010 52298 53026 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461631.1 protein_id gnl|my_center|LOCUS_09010 53138 54154 gene locus_tag LOCUS_09020 53138 54154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 54943 54221 gene locus_tag LOCUS_09030 54943 54221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 55880 55110 gene locus_tag LOCUS_09040 55880 55110 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258788.1 protein_id gnl|my_center|LOCUS_09040 56795 55884 gene locus_tag LOCUS_09050 56795 55884 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840120.1 protein_id gnl|my_center|LOCUS_09050 57166 57969 gene locus_tag LOCUS_09060 57166 57969 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_09060 60611 58047 gene locus_tag LOCUS_09070 60611 58047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 62192 61203 gene locus_tag LOCUS_09080 62192 61203 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_09080 62334 62738 gene locus_tag LOCUS_09090 62334 62738 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528902.1 protein_id gnl|my_center|LOCUS_09090 65605 62894 gene locus_tag LOCUS_09100 65605 62894 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258507.1 protein_id gnl|my_center|LOCUS_09100 66571 65681 gene locus_tag LOCUS_09110 66571 65681 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898106.1 protein_id gnl|my_center|LOCUS_09110 67781 66681 gene locus_tag LOCUS_09120 67781 66681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 67804 68025 gene locus_tag LOCUS_09130 67804 68025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 68462 69322 gene locus_tag LOCUS_09140 68462 69322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 70093 69398 gene locus_tag LOCUS_09150 gene plsY 70093 69398 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583521.1 protein_id gnl|my_center|LOCUS_09150 71072 70251 gene locus_tag LOCUS_09160 71072 70251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 71252 72454 gene locus_tag LOCUS_09170 71252 72454 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887089.1 protein_id gnl|my_center|LOCUS_09170 72451 72816 gene locus_tag LOCUS_09180 72451 72816 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_09180 72788 73738 gene locus_tag LOCUS_09190 gene miaA 72788 73738 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_09190 73807 75486 gene locus_tag LOCUS_09200 73807 75486 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_09200 75603 75445 gene locus_tag LOCUS_09210 75603 75445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 76593 75667 gene locus_tag LOCUS_09220 76593 75667 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_09220 77165 76590 gene locus_tag LOCUS_09230 77165 76590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 77286 79349 gene locus_tag LOCUS_09240 gene fusA 77286 79349 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_09240 79472 80239 gene locus_tag LOCUS_09250 79472 80239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 80433 81923 gene locus_tag LOCUS_09260 80433 81923 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461267.1 protein_id gnl|my_center|LOCUS_09260 81920 83284 gene locus_tag LOCUS_09270 81920 83284 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_09270 83333 84592 gene locus_tag LOCUS_09280 83333 84592 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387859.1 protein_id gnl|my_center|LOCUS_09280 84821 84612 gene locus_tag LOCUS_09290 84821 84612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 85848 84859 gene locus_tag LOCUS_09300 85848 84859 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257805.1 protein_id gnl|my_center|LOCUS_09300 86466 85852 gene locus_tag LOCUS_09310 86466 85852 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392092.1 protein_id gnl|my_center|LOCUS_09310 88474 86546 gene locus_tag LOCUS_09320 88474 86546 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_09320 89132 88683 gene locus_tag LOCUS_09330 gene ndk 89132 88683 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_09330 93185 89253 gene locus_tag LOCUS_09340 93185 89253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 94401 93409 gene locus_tag LOCUS_09350 94401 93409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 95411 94581 gene locus_tag LOCUS_09360 gene trxA 95411 94581 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_09360 95573 96061 gene locus_tag LOCUS_09370 95573 96061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 96536 96114 gene locus_tag LOCUS_09380 96536 96114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 97194 96613 gene locus_tag LOCUS_09390 97194 96613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903971.1 protein_id gnl|my_center|LOCUS_09390 98273 97254 gene locus_tag LOCUS_09400 98273 97254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 99298 98273 gene locus_tag LOCUS_09410 99298 98273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 100074 99295 gene locus_tag LOCUS_09420 100074 99295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 100286 100858 gene locus_tag LOCUS_09430 100286 100858 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_09430 101259 100993 gene locus_tag LOCUS_09440 101259 100993 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_09440 101551 101285 gene locus_tag LOCUS_09450 101551 101285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 103587 101551 gene locus_tag LOCUS_09460 103587 101551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 105974 103584 gene locus_tag LOCUS_09470 105974 103584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 106082 106552 gene locus_tag LOCUS_09480 106082 106552 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_09480 106611 110006 gene locus_tag LOCUS_09490 106611 110006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 112232 110082 gene locus_tag LOCUS_09500 112232 110082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 112636 114117 gene locus_tag LOCUS_09510 112636 114117 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_09510 114176 115066 gene locus_tag LOCUS_09520 gene rarD 114176 115066 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_09520 115459 115142 gene locus_tag LOCUS_09530 115459 115142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 116662 115715 gene locus_tag LOCUS_09540 116662 115715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 116890 117120 gene locus_tag LOCUS_09550 116890 117120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 117173 117895 gene locus_tag LOCUS_09560 117173 117895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_09560 117892 120282 gene locus_tag LOCUS_09570 117892 120282 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_09570 120330 121550 gene locus_tag LOCUS_09580 120330 121550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 122565 121726 gene locus_tag LOCUS_09590 122565 121726 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272245.1 protein_id gnl|my_center|LOCUS_09590 123026 122562 gene locus_tag LOCUS_09600 123026 122562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 123259 123014 gene locus_tag LOCUS_09610 123259 123014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 123887 123387 gene locus_tag LOCUS_09620 123887 123387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 125760 123949 gene locus_tag LOCUS_09630 gene pepF 125760 123949 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256129.1 protein_id gnl|my_center|LOCUS_09630 125948 127276 gene locus_tag LOCUS_09640 125948 127276 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_09640 127304 128056 gene locus_tag LOCUS_09650 127304 128056 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014941.1 protein_id gnl|my_center|LOCUS_09650 129996 128116 gene locus_tag LOCUS_09660 129996 128116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 130762 130034 gene locus_tag LOCUS_09670 130762 130034 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_09670 131503 130769 gene locus_tag LOCUS_09680 131503 130769 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_09680 132654 131500 gene locus_tag LOCUS_09690 132654 131500 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_09690 133214 132738 gene locus_tag LOCUS_09700 133214 132738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 134263 133250 gene locus_tag LOCUS_09710 134263 133250 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_09710 136676 134277 gene locus_tag LOCUS_09720 gene recJ 136676 134277 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057085.1 protein_id gnl|my_center|LOCUS_09720 137500 136730 gene locus_tag LOCUS_09730 137500 136730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 139856 137607 gene locus_tag LOCUS_09740 139856 137607 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143631.1 protein_id gnl|my_center|LOCUS_09740 140713 139913 gene locus_tag LOCUS_09750 140713 139913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 142850 140733 gene locus_tag LOCUS_09760 142850 140733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929249.1 protein_id gnl|my_center|LOCUS_09760 143108 143317 gene locus_tag LOCUS_09770 143108 143317 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292860.1 protein_id gnl|my_center|LOCUS_09770 143910 143452 gene locus_tag LOCUS_09780 143910 143452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 145213 143972 gene locus_tag LOCUS_09790 145213 143972 CDS product 23S rRNA (cytosine(2499)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_09790 145945 145217 gene locus_tag LOCUS_09800 145945 145217 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555511.1 protein_id gnl|my_center|LOCUS_09800 146074 146985 gene locus_tag LOCUS_09810 146074 146985 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_09810 147090 147437 gene locus_tag LOCUS_09820 147090 147437 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_09820 147449 148132 gene locus_tag LOCUS_09830 147449 148132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 148101 148949 gene locus_tag LOCUS_09840 148101 148949 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258504.1 protein_id gnl|my_center|LOCUS_09840 149017 149778 gene locus_tag LOCUS_09850 149017 149778 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_09850 149914 150729 gene locus_tag LOCUS_09860 149914 150729 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256562.1 protein_id gnl|my_center|LOCUS_09860 150784 151323 gene locus_tag LOCUS_09870 150784 151323 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256561.1 protein_id gnl|my_center|LOCUS_09870 152423 153310 gene locus_tag LOCUS_09880 152423 153310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258504.1 protein_id gnl|my_center|LOCUS_09880 153351 155642 gene locus_tag LOCUS_09890 153351 155642 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256365.1 protein_id gnl|my_center|LOCUS_09890 155708 156091 gene locus_tag LOCUS_09900 155708 156091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 156171 156965 gene locus_tag LOCUS_09910 156171 156965 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_09910 156977 157477 gene locus_tag LOCUS_09920 gene dfrA 156977 157477 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_09920 157578 157652 gene locus_tag LOCUS_t00140 157578 157652 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 159727 158213 gene locus_tag LOCUS_09930 159727 158213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 160832 160984 gene locus_tag LOCUS_09940 160832 160984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 161057 162025 gene locus_tag LOCUS_09950 161057 162025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 162700 162008 gene locus_tag LOCUS_09960 gene degU 162700 162008 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_09960 163093 163431 gene locus_tag LOCUS_09970 163093 163431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 164159 163503 gene locus_tag LOCUS_09980 164159 163503 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226222.1 protein_id gnl|my_center|LOCUS_09980 164936 164220 gene locus_tag LOCUS_09990 164936 164220 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_09990 165181 164933 gene locus_tag LOCUS_10000 165181 164933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 165710 165195 gene locus_tag LOCUS_10010 165710 165195 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_10010 167191 165707 gene locus_tag LOCUS_10020 167191 165707 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259646.1 protein_id gnl|my_center|LOCUS_10020 168164 167193 gene locus_tag LOCUS_10030 168164 167193 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259647.1 protein_id gnl|my_center|LOCUS_10030 170045 168192 gene locus_tag LOCUS_10040 170045 168192 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259648.1 protein_id gnl|my_center|LOCUS_10040 170253 171650 gene locus_tag LOCUS_10050 gene purB 170253 171650 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438353.1 protein_id gnl|my_center|LOCUS_10050 171787 172320 gene locus_tag LOCUS_10060 171787 172320 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227754.1 protein_id gnl|my_center|LOCUS_10060 172313 172936 gene locus_tag LOCUS_10070 172313 172936 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_10070 172996 174024 gene locus_tag LOCUS_10080 172996 174024 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110591.1 protein_id gnl|my_center|LOCUS_10080 174103 175734 gene locus_tag LOCUS_10090 174103 175734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 175734 176396 gene locus_tag LOCUS_10100 175734 176396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_10100 176501 177904 gene locus_tag LOCUS_10110 176501 177904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 177897 178139 gene locus_tag LOCUS_10120 177897 178139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 178345 180111 gene locus_tag LOCUS_10130 178345 180111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 180123 180305 gene locus_tag LOCUS_10140 180123 180305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 180354 181127 gene locus_tag LOCUS_10150 gene tatC 180354 181127 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124617.1 protein_id gnl|my_center|LOCUS_10150 181137 181349 gene locus_tag LOCUS_10160 181137 181349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 181397 181807 gene locus_tag LOCUS_10170 181397 181807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 182121 183518 gene locus_tag LOCUS_10180 182121 183518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 183534 183812 gene locus_tag LOCUS_10190 183534 183812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 183913 184149 gene locus_tag LOCUS_10200 183913 184149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 184349 186337 gene locus_tag LOCUS_10210 184349 186337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 186457 186885 gene locus_tag LOCUS_10220 186457 186885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 186978 188183 gene locus_tag LOCUS_10230 186978 188183 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679166.1 protein_id gnl|my_center|LOCUS_10230 188180 188938 gene locus_tag LOCUS_10240 188180 188938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_10240 188931 190046 gene locus_tag LOCUS_10250 188931 190046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 190060 190452 gene locus_tag LOCUS_10260 190060 190452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 191694 190699 gene locus_tag LOCUS_10270 191694 190699 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_10270 192617 191817 gene locus_tag LOCUS_10280 192617 191817 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_10280 192690 193013 gene locus_tag LOCUS_10290 192690 193013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 193410 193063 gene locus_tag LOCUS_10300 193410 193063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 193571 193407 gene locus_tag LOCUS_10310 193571 193407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 194438 193587 gene locus_tag LOCUS_10320 194438 193587 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_10320 196431 194449 gene locus_tag LOCUS_10330 196431 194449 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257772.1 protein_id gnl|my_center|LOCUS_10330 197631 196462 gene locus_tag LOCUS_10340 197631 196462 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257079.1 protein_id gnl|my_center|LOCUS_10340 198776 197793 gene locus_tag LOCUS_10350 198776 197793 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_10350 199715 199002 gene locus_tag LOCUS_10360 199715 199002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_10360 200506 199730 gene locus_tag LOCUS_10370 200506 199730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_10370 202196 200526 gene locus_tag LOCUS_10380 202196 200526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 203268 202207 gene locus_tag LOCUS_10390 203268 202207 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_10390 204571 203369 gene locus_tag LOCUS_10400 204571 203369 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228602.1 protein_id gnl|my_center|LOCUS_10400 204805 205917 gene locus_tag LOCUS_10410 204805 205917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 206013 207932 gene locus_tag LOCUS_10420 gene gyrB 206013 207932 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_10420 207985 210234 gene locus_tag LOCUS_10430 207985 210234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 210387 211232 gene locus_tag LOCUS_10440 gene ppk2 210387 211232 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_10440 213453 211324 gene locus_tag LOCUS_10450 gene ppk1 213453 211324 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_10450 214132 213497 gene locus_tag LOCUS_10460 214132 213497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 214350 215960 gene locus_tag LOCUS_10470 214350 215960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 216456 215962 gene locus_tag LOCUS_10480 216456 215962 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222279.1 protein_id gnl|my_center|LOCUS_10480 216589 217767 gene locus_tag LOCUS_10490 216589 217767 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_10490 218070 220871 gene locus_tag LOCUS_10500 218070 220871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 220907 222631 gene locus_tag LOCUS_10510 220907 222631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 224401 222644 gene locus_tag LOCUS_10520 224401 222644 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_10520 225778 224408 gene locus_tag LOCUS_10530 gene mggS 225778 224408 CDS product mannosylglucosylglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080052.1 protein_id gnl|my_center|LOCUS_10530 226904 226002 gene locus_tag LOCUS_10540 226904 226002 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224665.1 protein_id gnl|my_center|LOCUS_10540 227842 226901 gene locus_tag LOCUS_10550 227842 226901 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_10550 229418 227961 gene locus_tag LOCUS_10560 229418 227961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 230550 229534 gene locus_tag LOCUS_10570 230550 229534 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_10570 231561 230755 gene locus_tag LOCUS_10580 231561 230755 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_10580 231666 233057 gene locus_tag LOCUS_10590 231666 233057 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_10590 233956 233081 gene locus_tag LOCUS_10600 233956 233081 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_10600 234534 233956 gene locus_tag LOCUS_10610 gene cobU 234534 233956 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_10610 236045 234522 gene locus_tag LOCUS_10620 236045 234522 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258419.1 protein_id gnl|my_center|LOCUS_10620 236681 236061 gene locus_tag LOCUS_10630 gene cobC 236681 236061 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_10630 237778 236678 gene locus_tag LOCUS_10640 237778 236678 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258420.1 protein_id gnl|my_center|LOCUS_10640 238746 237775 gene locus_tag LOCUS_10650 gene cbiB 238746 237775 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258432.1 protein_id gnl|my_center|LOCUS_10650 239297 238806 gene locus_tag LOCUS_10660 gene bcp 239297 238806 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_10660 240093 239347 gene locus_tag LOCUS_10670 gene cobS 240093 239347 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_10670 241190 240141 gene locus_tag LOCUS_10680 gene cobT 241190 240141 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_10680 242067 241165 gene locus_tag LOCUS_10690 242067 241165 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392617.1 protein_id gnl|my_center|LOCUS_10690 242598 242068 gene locus_tag LOCUS_10700 gene cobO 242598 242068 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_10700 243692 242661 gene locus_tag LOCUS_10710 243692 242661 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228165.1 protein_id gnl|my_center|LOCUS_10710 244792 244136 gene locus_tag LOCUS_10720 244792 244136 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_10720 246319 244820 gene locus_tag LOCUS_10730 246319 244820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence005 1138 146 gene locus_tag LOCUS_10740 1138 146 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_10740 2108 1131 gene locus_tag LOCUS_10750 2108 1131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_10750 3052 2105 gene locus_tag LOCUS_10760 3052 2105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_10760 4070 3060 gene locus_tag LOCUS_10770 4070 3060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385787.1 protein_id gnl|my_center|LOCUS_10770 5399 4077 gene locus_tag LOCUS_10780 5399 4077 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_10780 6679 5477 gene locus_tag LOCUS_10790 gene rocD 6679 5477 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085639.1 protein_id gnl|my_center|LOCUS_10790 8742 6700 gene locus_tag LOCUS_10800 8742 6700 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967138.1 protein_id gnl|my_center|LOCUS_10800 9839 8757 gene locus_tag LOCUS_10810 9839 8757 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 protein_id gnl|my_center|LOCUS_10810 10495 9851 gene locus_tag LOCUS_10820 10495 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 11595 10495 gene locus_tag LOCUS_10830 11595 10495 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814320.1 protein_id gnl|my_center|LOCUS_10830 11956 11714 gene locus_tag LOCUS_10840 11956 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 13845 12133 gene locus_tag LOCUS_10850 13845 12133 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_10850 15271 14000 gene locus_tag LOCUS_10860 15271 14000 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461347.1 protein_id gnl|my_center|LOCUS_10860 15900 15268 gene locus_tag LOCUS_10870 15900 15268 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798635.1 protein_id gnl|my_center|LOCUS_10870 16790 15918 gene locus_tag LOCUS_10880 16790 15918 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461199.1 protein_id gnl|my_center|LOCUS_10880 17521 16814 gene locus_tag LOCUS_10890 17521 16814 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061181.1 protein_id gnl|my_center|LOCUS_10890 18243 17530 gene locus_tag LOCUS_10900 18243 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 18680 18270 gene locus_tag LOCUS_10910 18680 18270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 19149 18673 gene locus_tag LOCUS_10920 19149 18673 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250161.1 protein_id gnl|my_center|LOCUS_10920 20410 19319 gene locus_tag LOCUS_10930 gene serC 20410 19319 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_10930 20530 21918 gene locus_tag LOCUS_10940 20530 21918 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_10940 21970 24888 gene locus_tag LOCUS_10950 21970 24888 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_10950 24976 26562 gene locus_tag LOCUS_10960 24976 26562 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256402.1 protein_id gnl|my_center|LOCUS_10960 26962 28626 gene locus_tag LOCUS_10970 gene ilvD 26962 28626 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255814.1 protein_id gnl|my_center|LOCUS_10970 28670 30373 gene locus_tag LOCUS_10980 gene ilvB 28670 30373 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942556.1 protein_id gnl|my_center|LOCUS_10980 30393 30944 gene locus_tag LOCUS_10990 gene ilvN 30393 30944 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_10990 30995 32008 gene locus_tag LOCUS_11000 gene ilvC 30995 32008 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_11000 32058 33728 gene locus_tag LOCUS_11010 32058 33728 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142287.1 protein_id gnl|my_center|LOCUS_11010 33800 34000 gene locus_tag LOCUS_11020 33800 34000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 34042 35448 gene locus_tag LOCUS_11030 gene leuC 34042 35448 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_11030 35464 36069 gene locus_tag LOCUS_11040 gene leuD 35464 36069 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_11040 36149 37711 gene locus_tag LOCUS_11050 gene cimA 36149 37711 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_11050 37708 38778 gene locus_tag LOCUS_11060 gene leuB 37708 38778 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_11060 38841 39773 gene locus_tag LOCUS_11070 38841 39773 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 protein_id gnl|my_center|LOCUS_11070 39853 40719 gene locus_tag LOCUS_11080 gene pheA 39853 40719 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933330.1 protein_id gnl|my_center|LOCUS_11080 41226 40786 gene locus_tag LOCUS_11090 gene aroQ 41226 40786 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_11090 42896 41286 gene locus_tag LOCUS_11100 42896 41286 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_11100 44161 42893 gene locus_tag LOCUS_11110 gene aroC 44161 42893 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_11110 45362 44148 gene locus_tag LOCUS_11120 45362 44148 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_11120 46270 45359 gene locus_tag LOCUS_11130 46270 45359 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405001.1 protein_id gnl|my_center|LOCUS_11130 47553 46267 gene locus_tag LOCUS_11140 gene aroA 47553 46267 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633771.1 protein_id gnl|my_center|LOCUS_11140 48423 47563 gene locus_tag LOCUS_11150 48423 47563 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_11150 49476 48433 gene locus_tag LOCUS_11160 gene aroF 49476 48433 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_11160 49963 49592 gene locus_tag LOCUS_11170 gene aroH 49963 49592 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 protein_id gnl|my_center|LOCUS_11170 49998 50213 gene locus_tag LOCUS_11180 49998 50213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 52650 50239 gene locus_tag LOCUS_11190 52650 50239 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_11190 54640 52718 gene locus_tag LOCUS_11200 54640 52718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 55754 54966 gene locus_tag LOCUS_11210 55754 54966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 56261 56683 gene locus_tag LOCUS_11220 56261 56683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 56684 59290 gene locus_tag LOCUS_11230 gene lon 56684 59290 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_11230 59328 59693 gene locus_tag LOCUS_11240 59328 59693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 59759 61510 gene locus_tag LOCUS_11250 59759 61510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 61513 62016 gene locus_tag LOCUS_11260 61513 62016 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_11260 63523 62159 gene locus_tag LOCUS_11270 63523 62159 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_11270 64645 63599 gene locus_tag LOCUS_11280 gene trpS 64645 63599 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889658.1 protein_id gnl|my_center|LOCUS_11280 65231 65449 gene locus_tag LOCUS_11290 65231 65449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 66710 65559 gene locus_tag LOCUS_11300 66710 65559 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_11300 68499 66799 gene locus_tag LOCUS_11310 68499 66799 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878005.1 protein_id gnl|my_center|LOCUS_11310 68667 69470 gene locus_tag LOCUS_11320 68667 69470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_11320 70029 69502 gene locus_tag LOCUS_11330 70029 69502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 70679 70155 gene locus_tag LOCUS_11340 gene coaD 70679 70155 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_11340 73194 70690 gene locus_tag LOCUS_11350 gene recG 73194 70690 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_11350 74049 73219 gene locus_tag LOCUS_11360 74049 73219 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722646.1 protein_id gnl|my_center|LOCUS_11360 75880 74192 gene locus_tag LOCUS_11370 gene fakA 75880 74192 CDS product fatty acid kinase catalytic subunit FakA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830116.1 protein_id gnl|my_center|LOCUS_11370 76210 75962 gene locus_tag LOCUS_11380 76210 75962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 77838 76783 gene locus_tag LOCUS_11390 77838 76783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 77962 78906 gene locus_tag LOCUS_11400 77962 78906 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_11400 78913 79395 gene locus_tag LOCUS_11410 78913 79395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 82213 79568 gene locus_tag LOCUS_11420 82213 79568 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_11420 82424 83761 gene locus_tag LOCUS_11430 82424 83761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 84135 84809 gene locus_tag LOCUS_11440 84135 84809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 84972 85283 gene locus_tag LOCUS_11450 84972 85283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 86068 85568 gene locus_tag LOCUS_11460 86068 85568 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837148.1 protein_id gnl|my_center|LOCUS_11460 87152 86082 gene locus_tag LOCUS_11470 87152 86082 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_11470 88135 87167 gene locus_tag LOCUS_11480 88135 87167 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083105.1 protein_id gnl|my_center|LOCUS_11480 88888 88334 gene locus_tag LOCUS_11490 88888 88334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 89493 88885 gene locus_tag LOCUS_11500 89493 88885 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133875918.1 protein_id gnl|my_center|LOCUS_11500 89542 90630 gene locus_tag LOCUS_11510 89542 90630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932826.1 protein_id gnl|my_center|LOCUS_11510 91496 90594 gene locus_tag LOCUS_11520 91496 90594 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256264.1 protein_id gnl|my_center|LOCUS_11520 92214 91588 gene locus_tag LOCUS_11530 92214 91588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11530 92733 92236 gene locus_tag LOCUS_11540 92733 92236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11540 93392 92733 gene locus_tag LOCUS_11550 93392 92733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 94269 94057 gene locus_tag LOCUS_11560 94269 94057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 95119 94313 gene locus_tag LOCUS_11570 gene surE 95119 94313 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_11570 95410 96288 gene locus_tag LOCUS_11580 95410 96288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 96579 98210 gene locus_tag LOCUS_11590 96579 98210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365927.1 protein_id gnl|my_center|LOCUS_11590 98210 99997 gene locus_tag LOCUS_11600 gene ade 98210 99997 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531322.1 protein_id gnl|my_center|LOCUS_11600 100025 100741 gene locus_tag LOCUS_11610 100025 100741 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292782.1 protein_id gnl|my_center|LOCUS_11610 100829 101782 gene locus_tag LOCUS_11620 gene pyrB 100829 101782 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_11620 101825 102805 gene locus_tag LOCUS_11630 gene argF 101825 102805 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_11630 102810 103754 gene locus_tag LOCUS_11640 gene arcC 102810 103754 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240546.1 protein_id gnl|my_center|LOCUS_11640 104035 105321 gene locus_tag LOCUS_11650 104035 105321 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_11650 105625 107016 gene locus_tag LOCUS_11660 105625 107016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_11660 107018 108151 gene locus_tag LOCUS_11670 107018 108151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_11670 108154 109125 gene locus_tag LOCUS_11680 108154 109125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_11680 109224 110984 gene locus_tag LOCUS_11690 gene ade 109224 110984 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_11690 111025 111897 gene locus_tag LOCUS_11700 111025 111897 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_11700 111899 112378 gene locus_tag LOCUS_11710 111899 112378 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969634.1 protein_id gnl|my_center|LOCUS_11710 112371 114638 gene locus_tag LOCUS_11720 gene pucD 112371 114638 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_11720 114635 115870 gene locus_tag LOCUS_11730 114635 115870 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_11730 115948 117048 gene locus_tag LOCUS_11740 115948 117048 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_11740 117050 117988 gene locus_tag LOCUS_11750 117050 117988 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_11750 118085 119551 gene locus_tag LOCUS_11760 118085 119551 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_11760 119630 120184 gene locus_tag LOCUS_11770 119630 120184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 120208 121629 gene locus_tag LOCUS_11780 gene hydA 120208 121629 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_11780 121684 121962 gene locus_tag LOCUS_11790 121684 121962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 121971 122414 gene locus_tag LOCUS_11800 121971 122414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 122475 122900 gene locus_tag LOCUS_11810 122475 122900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 123042 125747 gene locus_tag LOCUS_11820 gene acnA 123042 125747 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_11820 125937 127796 gene locus_tag LOCUS_11830 gene htpG 125937 127796 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257066.1 protein_id gnl|my_center|LOCUS_11830 127853 128626 gene locus_tag LOCUS_11840 gene surE 127853 128626 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_11840 129166 128684 gene locus_tag LOCUS_11850 129166 128684 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966159.1 protein_id gnl|my_center|LOCUS_11850 129729 129163 gene locus_tag LOCUS_11860 129729 129163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 131065 129788 gene locus_tag LOCUS_11870 131065 129788 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_11870 132378 131083 gene locus_tag LOCUS_11880 132378 131083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 132587 133336 gene locus_tag LOCUS_11890 132587 133336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 133412 133966 gene locus_tag LOCUS_11900 133412 133966 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_11900 133989 134336 gene locus_tag LOCUS_11910 133989 134336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 134398 134601 gene locus_tag LOCUS_11920 134398 134601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 135178 134708 gene locus_tag LOCUS_11930 135178 134708 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259248.1 protein_id gnl|my_center|LOCUS_11930 136203 135175 gene locus_tag LOCUS_11940 136203 135175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_11940 137961 136255 gene locus_tag LOCUS_11950 137961 136255 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_11950 139108 138041 gene locus_tag LOCUS_11960 139108 138041 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228931.1 protein_id gnl|my_center|LOCUS_11960 139845 139177 gene locus_tag LOCUS_11970 139845 139177 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_11970 140957 140034 gene locus_tag LOCUS_11980 140957 140034 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_11980 141909 140992 gene locus_tag LOCUS_11990 gene truB 141909 140992 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_11990 142952 141996 gene locus_tag LOCUS_12000 142952 141996 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_12000 143340 142945 gene locus_tag LOCUS_12010 gene rbfA 143340 142945 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931015.1 protein_id gnl|my_center|LOCUS_12010 145147 143354 gene locus_tag LOCUS_12020 145147 143354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 145577 145281 gene locus_tag LOCUS_12030 145577 145281 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583568.1 protein_id gnl|my_center|LOCUS_12030 147653 145614 gene locus_tag LOCUS_12040 147653 145614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 150424 147788 gene locus_tag LOCUS_12050 150424 147788 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081021.1 protein_id gnl|my_center|LOCUS_12050 150559 151104 gene locus_tag LOCUS_12060 150559 151104 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632567.1 protein_id gnl|my_center|LOCUS_12060 151124 151939 gene locus_tag LOCUS_12070 151124 151939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 152706 151990 gene locus_tag LOCUS_12080 gene lexA 152706 151990 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_12080 153126 154166 gene locus_tag LOCUS_12090 153126 154166 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350864.1 protein_id gnl|my_center|LOCUS_12090 154169 154942 gene locus_tag LOCUS_12100 154169 154942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 protein_id gnl|my_center|LOCUS_12100 155240 156151 gene locus_tag LOCUS_12110 155240 156151 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444370.1 protein_id gnl|my_center|LOCUS_12110 156470 156153 gene locus_tag LOCUS_12120 156470 156153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 157165 156461 gene locus_tag LOCUS_12130 157165 156461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12130 157898 157176 gene locus_tag LOCUS_12140 157898 157176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 158090 158353 gene locus_tag LOCUS_12150 158090 158353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 159111 158491 gene locus_tag LOCUS_12160 159111 158491 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073404.1 protein_id gnl|my_center|LOCUS_12160 159246 159887 gene locus_tag LOCUS_12170 159246 159887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 159902 161641 gene locus_tag LOCUS_12180 159902 161641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 161717 162346 gene locus_tag LOCUS_12190 161717 162346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 162574 163656 gene locus_tag LOCUS_12200 162574 163656 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_12200 163832 164653 gene locus_tag LOCUS_12210 163832 164653 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_12210 164734 165909 gene locus_tag LOCUS_12220 164734 165909 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_12220 167420 166044 gene locus_tag LOCUS_12230 167420 166044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 167627 168316 gene locus_tag LOCUS_12240 167627 168316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 168395 170227 gene locus_tag LOCUS_12250 168395 170227 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_12250 170229 171263 gene locus_tag LOCUS_12260 170229 171263 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_12260 171889 171290 gene locus_tag LOCUS_12270 171889 171290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 172201 172512 gene locus_tag LOCUS_12280 172201 172512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 172556 172933 gene locus_tag LOCUS_12290 172556 172933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 173001 173825 gene locus_tag LOCUS_12300 173001 173825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 174087 174014 gene locus_tag LOCUS_t00150 174087 174014 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 175426 174323 gene locus_tag LOCUS_12310 175426 174323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 175943 176722 gene locus_tag LOCUS_12320 175943 176722 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_12320 176990 178756 gene locus_tag LOCUS_12330 176990 178756 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974099.1 protein_id gnl|my_center|LOCUS_12330 178889 179653 gene locus_tag LOCUS_12340 178889 179653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 179724 180683 gene locus_tag LOCUS_12350 gene appB 179724 180683 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_12350 180779 181609 gene locus_tag LOCUS_12360 180779 181609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537833.1 protein_id gnl|my_center|LOCUS_12360 181616 182689 gene locus_tag LOCUS_12370 181616 182689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 182692 184266 gene locus_tag LOCUS_12380 182692 184266 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_12380 184272 185372 gene locus_tag LOCUS_12390 184272 185372 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_12390 185408 186307 gene locus_tag LOCUS_12400 185408 186307 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_12400 186304 187425 gene locus_tag LOCUS_12410 186304 187425 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_12410 187431 188606 gene locus_tag LOCUS_12420 187431 188606 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_12420 188603 189694 gene locus_tag LOCUS_12430 188603 189694 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_12430 189691 190674 gene locus_tag LOCUS_12440 189691 190674 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_12440 190772 192646 gene locus_tag LOCUS_12450 gene aor 190772 192646 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_12450 192639 193862 gene locus_tag LOCUS_12460 192639 193862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 protein_id gnl|my_center|LOCUS_12460 193881 194672 gene locus_tag LOCUS_12470 193881 194672 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_12470 194704 195339 gene locus_tag LOCUS_12480 194704 195339 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_12480 195400 196422 gene locus_tag LOCUS_12490 195400 196422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_12490 196436 197419 gene locus_tag LOCUS_12500 196436 197419 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_12500 197412 198386 gene locus_tag LOCUS_12510 197412 198386 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974651.1 protein_id gnl|my_center|LOCUS_12510 198403 199044 gene locus_tag LOCUS_12520 198403 199044 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906064.1 protein_id gnl|my_center|LOCUS_12520 199453 199082 gene locus_tag LOCUS_12530 199453 199082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 200154 199510 gene locus_tag LOCUS_12540 200154 199510 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_12540 200565 201431 gene locus_tag LOCUS_12550 200565 201431 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_12550 201441 201809 gene locus_tag LOCUS_12560 201441 201809 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258525.1 protein_id gnl|my_center|LOCUS_12560 201806 202216 gene locus_tag LOCUS_12570 gene rsbT 201806 202216 CDS product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 protein_id gnl|my_center|LOCUS_12570 202220 202657 gene locus_tag LOCUS_12580 gene rsbT 202220 202657 CDS product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 protein_id gnl|my_center|LOCUS_12580 202729 203226 gene locus_tag LOCUS_12590 202729 203226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 203229 204392 gene locus_tag LOCUS_12600 203229 204392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 204423 206351 gene locus_tag LOCUS_12610 204423 206351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 206462 207397 gene locus_tag LOCUS_12620 206462 207397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 207413 210292 gene locus_tag LOCUS_12630 207413 210292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 210296 210646 gene locus_tag LOCUS_12640 210296 210646 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_12640 211596 210676 gene locus_tag LOCUS_12650 211596 210676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 212720 211638 gene locus_tag LOCUS_12660 212720 211638 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256070.1 protein_id gnl|my_center|LOCUS_12660 213098 212721 gene locus_tag LOCUS_12670 213098 212721 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404257.1 protein_id gnl|my_center|LOCUS_12670 213599 213114 gene locus_tag LOCUS_12680 213599 213114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259754.1 protein_id gnl|my_center|LOCUS_12680 214814 213798 gene locus_tag LOCUS_12690 214814 213798 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902730.1 protein_id gnl|my_center|LOCUS_12690 215585 214872 gene locus_tag LOCUS_12700 215585 214872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12700 216222 215572 gene locus_tag LOCUS_12710 216222 215572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12710 217241 216279 gene locus_tag LOCUS_12720 217241 216279 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_12720 218338 217262 gene locus_tag LOCUS_12730 218338 217262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 218855 219979 gene locus_tag LOCUS_12740 218855 219979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 222024 220087 gene locus_tag LOCUS_12750 222024 220087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 222522 222160 gene locus_tag LOCUS_12760 222522 222160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 222744 224072 gene locus_tag LOCUS_12770 222744 224072 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_12770 224103 225668 gene locus_tag LOCUS_12780 224103 225668 CDS product type B diterpene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417905.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence006 80 472 gene locus_tag LOCUS_12790 80 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 589 2511 gene locus_tag LOCUS_12800 589 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 3445 2870 gene locus_tag LOCUS_12810 3445 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5259 3448 gene locus_tag LOCUS_12820 5259 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5784 5371 gene locus_tag LOCUS_12830 5784 5371 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240265.1 protein_id gnl|my_center|LOCUS_12830 7316 5793 gene locus_tag LOCUS_12840 7316 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 8008 7340 gene locus_tag LOCUS_12850 8008 7340 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_12850 9312 8032 gene locus_tag LOCUS_12860 9312 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10300 9290 gene locus_tag LOCUS_12870 10300 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 11405 10332 gene locus_tag LOCUS_12880 11405 10332 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227687.1 protein_id gnl|my_center|LOCUS_12880 12286 11453 gene locus_tag LOCUS_12890 12286 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 14410 12314 gene locus_tag LOCUS_12900 14410 12314 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256365.1 protein_id gnl|my_center|LOCUS_12900 15082 14567 gene locus_tag LOCUS_12910 15082 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 16383 15382 gene locus_tag LOCUS_12920 gene holB 16383 15382 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_12920 16524 18719 gene locus_tag LOCUS_12930 16524 18719 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_12930 18806 19306 gene locus_tag LOCUS_12940 gene tsaE 18806 19306 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_12940 19306 19974 gene locus_tag LOCUS_12950 gene tsaB 19306 19974 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_12950 19997 20623 gene locus_tag LOCUS_12960 19997 20623 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_12960 20706 22022 gene locus_tag LOCUS_12970 20706 22022 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_12970 22120 23100 gene locus_tag LOCUS_12980 22120 23100 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_12980 23097 24476 gene locus_tag LOCUS_12990 23097 24476 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_12990 24473 25606 gene locus_tag LOCUS_13000 24473 25606 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_13000 25728 27296 gene locus_tag LOCUS_13010 25728 27296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 27351 28319 gene locus_tag LOCUS_13020 gene gmd 27351 28319 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_13020 28319 30238 gene locus_tag LOCUS_13030 28319 30238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 30305 31459 gene locus_tag LOCUS_13040 30305 31459 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_13040 31461 33158 gene locus_tag LOCUS_13050 31461 33158 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_13050 33155 34126 gene locus_tag LOCUS_13060 33155 34126 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390629.1 protein_id gnl|my_center|LOCUS_13060 34218 35177 gene locus_tag LOCUS_13070 34218 35177 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_13070 35174 36121 gene locus_tag LOCUS_13080 35174 36121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 36114 38165 gene locus_tag LOCUS_13090 36114 38165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 38248 39399 gene locus_tag LOCUS_13100 38248 39399 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022158.1 protein_id gnl|my_center|LOCUS_13100 39506 41338 gene locus_tag LOCUS_13110 gene asnB 39506 41338 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_13110 41501 42340 gene locus_tag LOCUS_13120 41501 42340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_13120 42340 43608 gene locus_tag LOCUS_13130 42340 43608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 43605 45158 gene locus_tag LOCUS_13140 43605 45158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 45260 46288 gene locus_tag LOCUS_13150 45260 46288 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546727.1 protein_id gnl|my_center|LOCUS_13150 46295 47449 gene locus_tag LOCUS_13160 gene neuC 46295 47449 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545909.1 protein_id gnl|my_center|LOCUS_13160 47446 48162 gene locus_tag LOCUS_13170 47446 48162 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_13170 48159 49490 gene locus_tag LOCUS_13180 48159 49490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 49491 50426 gene locus_tag LOCUS_13190 49491 50426 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_13190 50430 51593 gene locus_tag LOCUS_13200 50430 51593 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_13200 51590 53680 gene locus_tag LOCUS_13210 51590 53680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 53692 56367 gene locus_tag LOCUS_13220 53692 56367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 57862 56393 gene locus_tag LOCUS_13230 57862 56393 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_13230 58952 57894 gene locus_tag LOCUS_13240 58952 57894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 59136 59624 gene locus_tag LOCUS_13250 59136 59624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 59614 60627 gene locus_tag LOCUS_13260 59614 60627 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_13260 60636 61718 gene locus_tag LOCUS_13270 gene gmd 60636 61718 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_13270 61721 62695 gene locus_tag LOCUS_13280 61721 62695 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_13280 62710 63567 gene locus_tag LOCUS_13290 62710 63567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_13290 63682 64965 gene locus_tag LOCUS_13300 63682 64965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_13300 64971 66560 gene locus_tag LOCUS_13310 64971 66560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 66562 67428 gene locus_tag LOCUS_13320 66562 67428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 67465 68475 gene locus_tag LOCUS_13330 gene pseB 67465 68475 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869431.1 protein_id gnl|my_center|LOCUS_13330 68635 69552 gene locus_tag LOCUS_13340 gene rfbD 68635 69552 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_13340 69609 70691 gene locus_tag LOCUS_13350 69609 70691 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_13350 70711 71832 gene locus_tag LOCUS_13360 70711 71832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 71829 72677 gene locus_tag LOCUS_13370 71829 72677 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868073.1 protein_id gnl|my_center|LOCUS_13370 72739 73494 gene locus_tag LOCUS_13380 gene legH 72739 73494 CDS product N-acetyltransferase LegH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856586.1 protein_id gnl|my_center|LOCUS_13380 73513 74829 gene locus_tag LOCUS_13390 73513 74829 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_13390 74826 75713 gene locus_tag LOCUS_13400 74826 75713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870576.1 protein_id gnl|my_center|LOCUS_13400 75718 76605 gene locus_tag LOCUS_13410 75718 76605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 76619 77497 gene locus_tag LOCUS_13420 76619 77497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 77512 78471 gene locus_tag LOCUS_13430 77512 78471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 78480 79907 gene locus_tag LOCUS_13440 78480 79907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 79912 80955 gene locus_tag LOCUS_13450 79912 80955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 80962 81963 gene locus_tag LOCUS_13460 80962 81963 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_13460 83552 81960 gene locus_tag LOCUS_13470 83552 81960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 83795 83610 gene locus_tag LOCUS_13480 83795 83610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 83863 84537 gene locus_tag LOCUS_13490 83863 84537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 84669 86393 gene locus_tag LOCUS_13500 84669 86393 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257979.1 protein_id gnl|my_center|LOCUS_13500 86402 87223 gene locus_tag LOCUS_13510 86402 87223 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_13510 87255 88040 gene locus_tag LOCUS_13520 gene pseF 87255 88040 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_13520 88121 90010 gene locus_tag LOCUS_13530 88121 90010 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088712.1 protein_id gnl|my_center|LOCUS_13530 90003 91676 gene locus_tag LOCUS_13540 90003 91676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 91721 92524 gene locus_tag LOCUS_13550 91721 92524 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390775.1 protein_id gnl|my_center|LOCUS_13550 92502 93464 gene locus_tag LOCUS_13560 92502 93464 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143763.1 protein_id gnl|my_center|LOCUS_13560 93493 94197 gene locus_tag LOCUS_13570 93493 94197 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_13570 94256 95218 gene locus_tag LOCUS_13580 94256 95218 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814047.1 protein_id gnl|my_center|LOCUS_13580 95222 95995 gene locus_tag LOCUS_13590 95222 95995 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086119.1 protein_id gnl|my_center|LOCUS_13590 96095 96919 gene locus_tag LOCUS_13600 96095 96919 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_13600 97018 98472 gene locus_tag LOCUS_13610 97018 98472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 98520 100031 gene locus_tag LOCUS_13620 98520 100031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 100046 101053 gene locus_tag LOCUS_13630 100046 101053 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_13630 101046 101822 gene locus_tag LOCUS_13640 101046 101822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 102196 105852 gene locus_tag LOCUS_13650 102196 105852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 105839 107962 gene locus_tag LOCUS_13660 105839 107962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 107973 108800 gene locus_tag LOCUS_13670 107973 108800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_13670 108809 109567 gene locus_tag LOCUS_13680 108809 109567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 109578 110717 gene locus_tag LOCUS_13690 109578 110717 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392195.1 protein_id gnl|my_center|LOCUS_13690 110765 111904 gene locus_tag LOCUS_13700 110765 111904 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_13700 112083 113141 gene locus_tag LOCUS_13710 112083 113141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 113141 114583 gene locus_tag LOCUS_13720 113141 114583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 114626 116257 gene locus_tag LOCUS_13730 114626 116257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 116469 118361 gene locus_tag LOCUS_13740 116469 118361 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257484.1 protein_id gnl|my_center|LOCUS_13740 118662 118453 gene locus_tag LOCUS_13750 118662 118453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 118782 120077 gene locus_tag LOCUS_13760 118782 120077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 120123 121523 gene locus_tag LOCUS_13770 120123 121523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 121739 122743 gene locus_tag LOCUS_13780 gene add 121739 122743 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478706.1 protein_id gnl|my_center|LOCUS_13780 122939 123817 gene locus_tag LOCUS_13790 gene panB 122939 123817 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_13790 123820 124737 gene locus_tag LOCUS_13800 123820 124737 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_13800 124760 125596 gene locus_tag LOCUS_13810 gene panC 124760 125596 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_13810 125610 126374 gene locus_tag LOCUS_13820 125610 126374 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_13820 126440 126868 gene locus_tag LOCUS_13830 126440 126868 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276952.1 protein_id gnl|my_center|LOCUS_13830 127003 127788 gene locus_tag LOCUS_13840 127003 127788 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_13840 127794 128129 gene locus_tag LOCUS_13850 127794 128129 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728561.1 protein_id gnl|my_center|LOCUS_13850 130168 128126 gene locus_tag LOCUS_13860 130168 128126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 130917 130165 gene locus_tag LOCUS_13870 130917 130165 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_13870 131291 133432 gene locus_tag LOCUS_13880 gene glgP 131291 133432 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_13880 133637 133389 gene locus_tag LOCUS_13890 133637 133389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 134334 133624 gene locus_tag LOCUS_13900 134334 133624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13900 134721 134356 gene locus_tag LOCUS_13910 134721 134356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13910 135245 134733 gene locus_tag LOCUS_13920 135245 134733 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902507.1 protein_id gnl|my_center|LOCUS_13920 136108 135485 gene locus_tag LOCUS_13930 136108 135485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 136967 136098 gene locus_tag LOCUS_13940 gene prmC 136967 136098 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_13940 138041 136971 gene locus_tag LOCUS_13950 gene prfA 138041 136971 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_13950 138135 138371 gene locus_tag LOCUS_13960 138135 138371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 138408 139679 gene locus_tag LOCUS_13970 gene rho 138408 139679 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_13970 139712 140782 gene locus_tag LOCUS_13980 139712 140782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 140813 141007 gene locus_tag LOCUS_13990 140813 141007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 141390 142274 gene locus_tag LOCUS_14000 141390 142274 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020849.1 protein_id gnl|my_center|LOCUS_14000 142624 144189 gene locus_tag LOCUS_14010 142624 144189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 144223 147015 gene locus_tag LOCUS_14020 gene polA 144223 147015 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_14020 147032 149344 gene locus_tag LOCUS_14030 147032 149344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 150852 149578 gene locus_tag LOCUS_14040 150852 149578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 151709 151026 gene locus_tag LOCUS_14050 151709 151026 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_14050 152205 151711 gene locus_tag LOCUS_14060 152205 151711 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_14060 152450 153667 gene locus_tag LOCUS_14070 152450 153667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 154051 155235 gene locus_tag LOCUS_14080 154051 155235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 155265 155822 gene locus_tag LOCUS_14090 155265 155822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 155882 156217 gene locus_tag LOCUS_14100 155882 156217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 157009 157332 gene locus_tag LOCUS_14110 157009 157332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 157375 158661 gene locus_tag LOCUS_14120 157375 158661 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_14120 158824 162153 gene locus_tag LOCUS_14130 158824 162153 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057180.1 protein_id gnl|my_center|LOCUS_14130 162352 163455 gene locus_tag LOCUS_14140 gene ilvC 162352 163455 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830020.1 protein_id gnl|my_center|LOCUS_14140 164952 163645 gene locus_tag LOCUS_14150 164952 163645 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228602.1 protein_id gnl|my_center|LOCUS_14150 165251 166510 gene locus_tag LOCUS_14160 165251 166510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 166510 168633 gene locus_tag LOCUS_14170 166510 168633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 169244 168831 gene locus_tag LOCUS_14180 169244 168831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 169577 169245 gene locus_tag LOCUS_14190 169577 169245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 169863 171014 gene locus_tag LOCUS_14200 169863 171014 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227919.1 protein_id gnl|my_center|LOCUS_14200 171037 171501 gene locus_tag LOCUS_14210 gene greA 171037 171501 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355133.1 protein_id gnl|my_center|LOCUS_14210 172671 171598 gene locus_tag LOCUS_14220 172671 171598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 175251 172924 gene locus_tag LOCUS_14230 gene topA 175251 172924 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_14230 176366 175278 gene locus_tag LOCUS_14240 176366 175278 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_14240 177583 176435 gene locus_tag LOCUS_14250 gene dprA 177583 176435 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_14250 178234 177662 gene locus_tag LOCUS_14260 gene rimM 178234 177662 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870156.1 protein_id gnl|my_center|LOCUS_14260 178467 178231 gene locus_tag LOCUS_14270 178467 178231 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_14270 179325 178513 gene locus_tag LOCUS_14280 179325 178513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 180757 179435 gene locus_tag LOCUS_14290 gene ffh 180757 179435 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257918.1 protein_id gnl|my_center|LOCUS_14290 180921 181008 gene locus_tag LOCUS_t00160 180921 181008 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 181036 181126 gene locus_tag LOCUS_t00170 181036 181126 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 181218 181293 gene locus_tag LOCUS_t00180 181218 181293 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 181500 182318 gene locus_tag LOCUS_14300 gene surE 181500 182318 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250088.1 protein_id gnl|my_center|LOCUS_14300 182965 182333 gene locus_tag LOCUS_14310 182965 182333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 183187 184005 gene locus_tag LOCUS_14320 183187 184005 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965862.1 protein_id gnl|my_center|LOCUS_14320 184352 184732 gene locus_tag LOCUS_14330 184352 184732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 185631 185068 gene locus_tag LOCUS_14340 185631 185068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 185740 186750 gene locus_tag LOCUS_14350 185740 186750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 186997 188220 gene locus_tag LOCUS_14360 186997 188220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 188432 188770 gene locus_tag LOCUS_14370 188432 188770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 189071 189661 gene locus_tag LOCUS_14380 189071 189661 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_14380 189858 190169 gene locus_tag LOCUS_14390 189858 190169 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_14390 190162 190449 gene locus_tag LOCUS_14400 190162 190449 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_14400 190632 190889 gene locus_tag LOCUS_14410 190632 190889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 190889 191158 gene locus_tag LOCUS_14420 190889 191158 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_14420 191217 191375 gene locus_tag LOCUS_14430 191217 191375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 191870 195439 gene locus_tag LOCUS_14440 gene nifJ 191870 195439 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_14440 195525 196514 gene locus_tag LOCUS_14450 195525 196514 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_14450 198626 196659 gene locus_tag LOCUS_14460 198626 196659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 199219 198848 gene locus_tag LOCUS_14470 199219 198848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 200752 199295 gene locus_tag LOCUS_14480 200752 199295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 201315 200860 gene locus_tag LOCUS_14490 201315 200860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 201705 201406 gene locus_tag LOCUS_14500 201705 201406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 202945 201737 gene locus_tag LOCUS_14510 202945 201737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 203368 203054 gene locus_tag LOCUS_14520 203368 203054 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_14520 203663 203379 gene locus_tag LOCUS_14530 203663 203379 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_14530 204607 203825 gene locus_tag LOCUS_14540 204607 203825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence007 2661 721 gene locus_tag LOCUS_14550 2661 721 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258101.1 protein_id gnl|my_center|LOCUS_14550 3043 2780 gene locus_tag LOCUS_14560 3043 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3611 3030 gene locus_tag LOCUS_14570 3611 3030 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_14570 4878 3973 gene locus_tag LOCUS_14580 gene rsgA 4878 3973 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_14580 7199 4917 gene locus_tag LOCUS_14590 7199 4917 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966944.1 protein_id gnl|my_center|LOCUS_14590 7858 7250 gene locus_tag LOCUS_14600 7858 7250 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_14600 8091 8663 gene locus_tag LOCUS_14610 8091 8663 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728269.1 protein_id gnl|my_center|LOCUS_14610 8690 10255 gene locus_tag LOCUS_14620 gene guaA 8690 10255 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256861.1 protein_id gnl|my_center|LOCUS_14620 10310 11287 gene locus_tag LOCUS_14630 10310 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 11364 13301 gene locus_tag LOCUS_14640 11364 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 13298 14407 gene locus_tag LOCUS_14650 13298 14407 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257018.1 protein_id gnl|my_center|LOCUS_14650 16716 14482 gene locus_tag LOCUS_14660 16716 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 16813 17835 gene locus_tag LOCUS_14670 16813 17835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 18922 17837 gene locus_tag LOCUS_14680 18922 17837 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_14680 20038 18926 gene locus_tag LOCUS_14690 gene amrS 20038 18926 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_14690 20060 20659 gene locus_tag LOCUS_14700 20060 20659 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_14700 21652 20969 gene locus_tag LOCUS_14710 21652 20969 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_14710 23153 21621 gene locus_tag LOCUS_14720 23153 21621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 23432 24601 gene locus_tag LOCUS_14730 23432 24601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 25946 24735 gene locus_tag LOCUS_14740 25946 24735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 26546 26037 gene locus_tag LOCUS_14750 26546 26037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 28258 26645 gene locus_tag LOCUS_14760 28258 26645 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705177.1 protein_id gnl|my_center|LOCUS_14760 29091 28270 gene locus_tag LOCUS_14770 29091 28270 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_14770 29347 30228 gene locus_tag LOCUS_14780 29347 30228 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479133.1 protein_id gnl|my_center|LOCUS_14780 30454 30380 gene locus_tag LOCUS_t00190 30454 30380 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 31578 30502 gene locus_tag LOCUS_14790 31578 30502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 32464 31763 gene locus_tag LOCUS_14800 32464 31763 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_14800 34269 32476 gene locus_tag LOCUS_14810 gene sdhA 34269 32476 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228694.1 protein_id gnl|my_center|LOCUS_14810 34711 34289 gene locus_tag LOCUS_14820 34711 34289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 35120 34731 gene locus_tag LOCUS_14830 gene sdhC 35120 34731 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173507.1 protein_id gnl|my_center|LOCUS_14830 35511 36005 gene locus_tag LOCUS_14840 35511 36005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 36008 36667 gene locus_tag LOCUS_14850 36008 36667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14850 36690 37895 gene locus_tag LOCUS_14860 36690 37895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 39103 37958 gene locus_tag LOCUS_14870 39103 37958 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_14870 39346 39116 gene locus_tag LOCUS_14880 39346 39116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 39632 40780 gene locus_tag LOCUS_14890 39632 40780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889538.1 protein_id gnl|my_center|LOCUS_14890 40837 41664 gene locus_tag LOCUS_14900 40837 41664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723280.1 protein_id gnl|my_center|LOCUS_14900 42346 41750 gene locus_tag LOCUS_14910 42346 41750 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_14910 42462 42980 gene locus_tag LOCUS_14920 42462 42980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 43388 45166 gene locus_tag LOCUS_14930 gene metG 43388 45166 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_14930 46033 45254 gene locus_tag LOCUS_14940 46033 45254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 47129 46647 gene locus_tag LOCUS_14950 47129 46647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 49514 47142 gene locus_tag LOCUS_14960 49514 47142 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_14960 50357 49593 gene locus_tag LOCUS_14970 gene recO 50357 49593 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_14970 51430 50369 gene locus_tag LOCUS_14980 51430 50369 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_14980 51589 51813 gene locus_tag LOCUS_14990 51589 51813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 51986 53677 gene locus_tag LOCUS_15000 51986 53677 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_15000 54456 53689 gene locus_tag LOCUS_15010 54456 53689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 55308 54517 gene locus_tag LOCUS_15020 55308 54517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 56029 55610 gene locus_tag LOCUS_15030 56029 55610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 57075 56314 gene locus_tag LOCUS_15040 57075 56314 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_15040 57826 57053 gene locus_tag LOCUS_15050 57826 57053 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291082.1 protein_id gnl|my_center|LOCUS_15050 57874 57949 gene locus_tag LOCUS_t00200 57874 57949 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 57970 58329 gene locus_tag LOCUS_15060 57970 58329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 58463 59266 gene locus_tag LOCUS_15070 58463 59266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 59291 60022 gene locus_tag LOCUS_15080 59291 60022 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_15080 60006 60653 gene locus_tag LOCUS_15090 60006 60653 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_15090 60804 62699 gene locus_tag LOCUS_15100 60804 62699 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172451083.1 protein_id gnl|my_center|LOCUS_15100 62797 63102 gene locus_tag LOCUS_15110 62797 63102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 65955 63142 gene locus_tag LOCUS_15120 65955 63142 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_15120 66085 65903 gene locus_tag LOCUS_15130 66085 65903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 66263 67669 gene locus_tag LOCUS_15140 gene icd 66263 67669 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_15140 67886 69265 gene locus_tag LOCUS_15150 67886 69265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 69262 69663 gene locus_tag LOCUS_15160 69262 69663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 69682 70476 gene locus_tag LOCUS_15170 69682 70476 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_15170 70530 71081 gene locus_tag LOCUS_15180 gene lspA 70530 71081 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_15180 71074 71994 gene locus_tag LOCUS_15190 71074 71994 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_15190 72047 73093 gene locus_tag LOCUS_15200 gene ltaE 72047 73093 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_15200 73311 74150 gene locus_tag LOCUS_15210 73311 74150 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_15210 74194 74886 gene locus_tag LOCUS_15220 74194 74886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 74939 75478 gene locus_tag LOCUS_15230 74939 75478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 75566 77503 gene locus_tag LOCUS_15240 75566 77503 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_15240 77570 78511 gene locus_tag LOCUS_15250 77570 78511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 78508 79086 gene locus_tag LOCUS_15260 78508 79086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 79228 79470 gene locus_tag LOCUS_15270 79228 79470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 80051 79572 gene locus_tag LOCUS_15280 gene ybaK 80051 79572 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206635.1 protein_id gnl|my_center|LOCUS_15280 80514 80044 gene locus_tag LOCUS_15290 80514 80044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 80908 80540 gene locus_tag LOCUS_15300 80908 80540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 81433 80927 gene locus_tag LOCUS_15310 81433 80927 CDS product glycine/sarcosine/betaine reductase selenoprotein B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_15310 82170 81538 gene locus_tag LOCUS_15320 82170 81538 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705021.1 protein_id gnl|my_center|LOCUS_15320 82560 82180 gene locus_tag LOCUS_15330 82560 82180 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_15330 83834 82608 gene locus_tag LOCUS_15340 83834 82608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_15340 84515 83838 gene locus_tag LOCUS_15350 84515 83838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_15350 86166 84595 gene locus_tag LOCUS_15360 86166 84595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 87880 86204 gene locus_tag LOCUS_15370 87880 86204 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257054.1 protein_id gnl|my_center|LOCUS_15370 88320 87877 gene locus_tag LOCUS_15380 88320 87877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 88602 90038 gene locus_tag LOCUS_15390 gene gltA 88602 90038 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_15390 90207 92687 gene locus_tag LOCUS_15400 gene gyrA 90207 92687 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_15400 92990 92772 gene locus_tag LOCUS_15410 92990 92772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 93858 93031 gene locus_tag LOCUS_15420 93858 93031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 95114 93960 gene locus_tag LOCUS_15430 gene moeB 95114 93960 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_15430 95426 95151 gene locus_tag LOCUS_15440 95426 95151 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404769.1 protein_id gnl|my_center|LOCUS_15440 95855 95442 gene locus_tag LOCUS_15450 95855 95442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 96342 95863 gene locus_tag LOCUS_15460 96342 95863 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258477.1 protein_id gnl|my_center|LOCUS_15460 96814 96380 gene locus_tag LOCUS_15470 96814 96380 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_15470 97817 96840 gene locus_tag LOCUS_15480 97817 96840 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_15480 99095 98223 gene locus_tag LOCUS_15490 99095 98223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 99633 99193 gene locus_tag LOCUS_15500 99633 99193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 101163 99661 gene locus_tag LOCUS_15510 101163 99661 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_15510 102204 101263 gene locus_tag LOCUS_15520 102204 101263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 103692 102277 gene locus_tag LOCUS_15530 103692 102277 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_15530 104395 103700 gene locus_tag LOCUS_15540 104395 103700 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_15540 105040 104519 gene locus_tag LOCUS_15550 105040 104519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 107282 105246 gene locus_tag LOCUS_15560 gene uvrB 107282 105246 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_15560 109812 107443 gene locus_tag LOCUS_15570 109812 107443 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_15570 110013 110243 gene locus_tag LOCUS_15580 110013 110243 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_15580 110240 110605 gene locus_tag LOCUS_15590 110240 110605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 110670 112241 gene locus_tag LOCUS_15600 110670 112241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 112241 113392 gene locus_tag LOCUS_15610 112241 113392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 113463 113651 gene locus_tag LOCUS_15620 113463 113651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 113557 115080 gene locus_tag LOCUS_15630 113557 115080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 115215 116453 gene locus_tag LOCUS_15640 115215 116453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 116600 117154 gene locus_tag LOCUS_15650 gene dcd 116600 117154 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_15650 117663 118712 gene locus_tag LOCUS_15660 117663 118712 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244659.1 protein_id gnl|my_center|LOCUS_15660 118789 119976 gene locus_tag LOCUS_15670 118789 119976 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_15670 119979 121196 gene locus_tag LOCUS_15680 119979 121196 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_15680 121208 121963 gene locus_tag LOCUS_15690 121208 121963 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_15690 122169 122627 gene locus_tag LOCUS_15700 122169 122627 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446103.1 protein_id gnl|my_center|LOCUS_15700 122689 124116 gene locus_tag LOCUS_15710 122689 124116 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_15710 125825 124206 gene locus_tag LOCUS_15720 125825 124206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 127287 125836 gene locus_tag LOCUS_15730 127287 125836 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_15730 127728 127318 gene locus_tag LOCUS_15740 127728 127318 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 protein_id gnl|my_center|LOCUS_15740 129853 128042 gene locus_tag LOCUS_15750 129853 128042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 130102 130905 gene locus_tag LOCUS_15760 130102 130905 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_15760 130938 131342 gene locus_tag LOCUS_15770 130938 131342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 131355 131798 gene locus_tag LOCUS_15780 131355 131798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 131795 132658 gene locus_tag LOCUS_15790 gene mtnP 131795 132658 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_15790 132684 133307 gene locus_tag LOCUS_15800 132684 133307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 134073 133396 gene locus_tag LOCUS_15810 134073 133396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 134744 134070 gene locus_tag LOCUS_15820 134744 134070 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257105.1 protein_id gnl|my_center|LOCUS_15820 134861 135706 gene locus_tag LOCUS_15830 134861 135706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 135848 136114 gene locus_tag LOCUS_15840 135848 136114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 136288 136722 gene locus_tag LOCUS_15850 136288 136722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 136826 137641 gene locus_tag LOCUS_15860 136826 137641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 138092 138727 gene locus_tag LOCUS_15870 138092 138727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 138930 140393 gene locus_tag LOCUS_15880 138930 140393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 140390 141286 gene locus_tag LOCUS_15890 140390 141286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 141363 142244 gene locus_tag LOCUS_15900 gene cyoE 141363 142244 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_15900 142234 142857 gene locus_tag LOCUS_15910 142234 142857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 142923 143600 gene locus_tag LOCUS_15920 142923 143600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 143807 144286 gene locus_tag LOCUS_15930 143807 144286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 144276 144665 gene locus_tag LOCUS_15940 144276 144665 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_15940 144718 145548 gene locus_tag LOCUS_15950 144718 145548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 145788 145621 gene locus_tag LOCUS_15960 145788 145621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 146523 145825 gene locus_tag LOCUS_15970 146523 145825 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_15970 147257 146565 gene locus_tag LOCUS_15980 147257 146565 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_15980 147964 147254 gene locus_tag LOCUS_15990 147964 147254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_15990 149970 148042 gene locus_tag LOCUS_16000 149970 148042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 150076 150432 gene locus_tag LOCUS_16010 150076 150432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 151200 150628 gene locus_tag LOCUS_16020 151200 150628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 151784 151251 gene locus_tag LOCUS_16030 151784 151251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 153894 151837 gene locus_tag LOCUS_16040 153894 151837 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_16040 154458 153988 gene locus_tag LOCUS_16050 154458 153988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 155658 154732 gene locus_tag LOCUS_16060 155658 154732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 156494 155703 gene locus_tag LOCUS_16070 156494 155703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_16070 157482 156469 gene locus_tag LOCUS_16080 157482 156469 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_16080 158382 157591 gene locus_tag LOCUS_16090 158382 157591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_16090 159985 158822 gene locus_tag LOCUS_16100 159985 158822 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256684.1 protein_id gnl|my_center|LOCUS_16100 160466 159996 gene locus_tag LOCUS_16110 160466 159996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 161310 160663 gene locus_tag LOCUS_16120 161310 160663 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896732.1 protein_id gnl|my_center|LOCUS_16120 162566 161307 gene locus_tag LOCUS_16130 162566 161307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 162732 164339 gene locus_tag LOCUS_16140 162732 164339 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259583.1 protein_id gnl|my_center|LOCUS_16140 164395 165117 gene locus_tag LOCUS_16150 164395 165117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_16150 165170 166402 gene locus_tag LOCUS_16160 165170 166402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_16160 166494 167144 gene locus_tag LOCUS_16170 166494 167144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 167353 169155 gene locus_tag LOCUS_16180 167353 169155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 169306 170097 gene locus_tag LOCUS_16190 169306 170097 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258881.1 protein_id gnl|my_center|LOCUS_16190 171525 170119 gene locus_tag LOCUS_16200 171525 170119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 172144 171458 gene locus_tag LOCUS_16210 172144 171458 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_16210 173523 172144 gene locus_tag LOCUS_16220 gene dnaB 173523 172144 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_16220 174251 173706 gene locus_tag LOCUS_16230 174251 173706 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_16230 174871 174374 gene locus_tag LOCUS_16240 174871 174374 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_16240 176409 174901 gene locus_tag LOCUS_16250 gene accC 176409 174901 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_16250 177194 176433 gene locus_tag LOCUS_16260 177194 176433 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390489.1 protein_id gnl|my_center|LOCUS_16260 178755 177205 gene locus_tag LOCUS_16270 178755 177205 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762326.1 protein_id gnl|my_center|LOCUS_16270 179270 178818 gene locus_tag LOCUS_16280 179270 178818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 182307 179389 gene locus_tag LOCUS_16290 182307 179389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 183498 182326 gene locus_tag LOCUS_16300 183498 182326 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_16300 183602 186367 gene locus_tag LOCUS_16310 183602 186367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 186364 186804 gene locus_tag LOCUS_16320 186364 186804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 188433 186817 gene locus_tag LOCUS_16330 188433 186817 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_16330 190456 188417 gene locus_tag LOCUS_16340 190456 188417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 191183 190755 gene locus_tag LOCUS_16350 191183 190755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 192450 191245 gene locus_tag LOCUS_16360 192450 191245 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_16360 192787 193512 gene locus_tag LOCUS_16370 192787 193512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 193533 194258 gene locus_tag LOCUS_16380 193533 194258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 195672 194275 gene locus_tag LOCUS_16390 195672 194275 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_16390 196352 195672 gene locus_tag LOCUS_16400 196352 195672 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_16400 196945 196562 gene locus_tag LOCUS_16410 gene rplL 196945 196562 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_16410 197574 197038 gene locus_tag LOCUS_16420 gene rplJ 197574 197038 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940186.1 protein_id gnl|my_center|LOCUS_16420 198657 197938 gene locus_tag LOCUS_16430 gene rplA 198657 197938 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_16430 199132 198707 gene locus_tag LOCUS_16440 gene rplK 199132 198707 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_16440 200032 199229 gene locus_tag LOCUS_16450 200032 199229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 200294 200082 gene locus_tag LOCUS_16460 gene secE 200294 200082 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931843.1 protein_id gnl|my_center|LOCUS_16460 200459 200384 gene locus_tag LOCUS_t00210 200459 200384 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 <201693 200701 gene locus_tag LOCUS_16470 <201693 200701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545401.1:elongation factor Tu >Feature sequence008 476 1435 gene locus_tag LOCUS_16480 476 1435 CDS product dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086612.1 protein_id gnl|my_center|LOCUS_16480 1446 1796 gene locus_tag LOCUS_16490 1446 1796 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_16490 1885 3408 gene locus_tag LOCUS_16500 gene hutH 1885 3408 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_16500 3582 4922 gene locus_tag LOCUS_16510 3582 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 5192 5983 gene locus_tag LOCUS_16520 5192 5983 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617863.1 protein_id gnl|my_center|LOCUS_16520 6010 6819 gene locus_tag LOCUS_16530 6010 6819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_16530 6822 7808 gene locus_tag LOCUS_16540 6822 7808 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350706.1 protein_id gnl|my_center|LOCUS_16540 7820 8515 gene locus_tag LOCUS_16550 7820 8515 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_16550 8597 9355 gene locus_tag LOCUS_16560 8597 9355 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_16560 9435 9944 gene locus_tag LOCUS_16570 9435 9944 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_16570 11309 9966 gene locus_tag LOCUS_16580 gene lat 11309 9966 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869888.1 protein_id gnl|my_center|LOCUS_16580 11556 12440 gene locus_tag LOCUS_16590 11556 12440 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583289.1 protein_id gnl|my_center|LOCUS_16590 12514 13638 gene locus_tag LOCUS_16600 12514 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_16600 13663 14061 gene locus_tag LOCUS_16610 13663 14061 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_16610 19774 14141 gene locus_tag LOCUS_16620 19774 14141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 20067 21338 gene locus_tag LOCUS_16630 20067 21338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 21316 21963 gene locus_tag LOCUS_16640 21316 21963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_16640 22114 23232 gene locus_tag LOCUS_16650 22114 23232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16650 23238 23528 gene locus_tag LOCUS_16660 23238 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16660 24404 23511 gene locus_tag LOCUS_16670 24404 23511 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_16670 24467 25285 gene locus_tag LOCUS_16680 24467 25285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 25491 25829 gene locus_tag LOCUS_16690 25491 25829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 27342 25897 gene locus_tag LOCUS_16700 27342 25897 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 protein_id gnl|my_center|LOCUS_16700 27948 28334 gene locus_tag LOCUS_16710 gene gcvH 27948 28334 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_16710 28432 29775 gene locus_tag LOCUS_16720 gene gcvPA 28432 29775 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_16720 29768 31237 gene locus_tag LOCUS_16730 gene gcvPB 29768 31237 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259338.1 protein_id gnl|my_center|LOCUS_16730 31392 33149 gene locus_tag LOCUS_16740 31392 33149 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_16740 34374 33130 gene locus_tag LOCUS_16750 34374 33130 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211249054.1 protein_id gnl|my_center|LOCUS_16750 37590 34480 gene locus_tag LOCUS_16760 37590 34480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 39882 37687 gene locus_tag LOCUS_16770 gene pucD 39882 37687 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_16770 41627 39915 gene locus_tag LOCUS_16780 41627 39915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_16780 42550 41627 gene locus_tag LOCUS_16790 42550 41627 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814758.1 protein_id gnl|my_center|LOCUS_16790 42974 42582 gene locus_tag LOCUS_16800 42974 42582 CDS product cytochrome B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119406804.1 protein_id gnl|my_center|LOCUS_16800 43364 42987 gene locus_tag LOCUS_16810 43364 42987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 44784 43357 gene locus_tag LOCUS_16820 44784 43357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 45708 44914 gene locus_tag LOCUS_16830 45708 44914 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870123.1 protein_id gnl|my_center|LOCUS_16830 47089 45743 gene locus_tag LOCUS_16840 47089 45743 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393891.1 protein_id gnl|my_center|LOCUS_16840 50102 47106 gene locus_tag LOCUS_16850 50102 47106 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_16850 50866 50099 gene locus_tag LOCUS_16860 50866 50099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 51288 50881 gene locus_tag LOCUS_16870 51288 50881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 52340 51342 gene locus_tag LOCUS_16880 gene mer 52340 51342 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_16880 54929 52437 gene locus_tag LOCUS_16890 54929 52437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 55553 54939 gene locus_tag LOCUS_16900 gene cofC 55553 54939 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496647.1 protein_id gnl|my_center|LOCUS_16900 56534 55590 gene locus_tag LOCUS_16910 gene cofD 56534 55590 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_16910 56916 56536 gene locus_tag LOCUS_16920 56916 56536 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_16920 57729 56926 gene locus_tag LOCUS_16930 gene cofE 57729 56926 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_16930 58402 57746 gene locus_tag LOCUS_16940 gene npdG 58402 57746 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_16940 59783 58431 gene locus_tag LOCUS_16950 gene ssnA 59783 58431 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_16950 60329 59814 gene locus_tag LOCUS_16960 60329 59814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 60874 60326 gene locus_tag LOCUS_16970 60874 60326 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153584.1 protein_id gnl|my_center|LOCUS_16970 63829 60995 gene locus_tag LOCUS_16980 gene xdh 63829 60995 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_16980 64713 63826 gene locus_tag LOCUS_16990 64713 63826 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393454.1 protein_id gnl|my_center|LOCUS_16990 64937 65695 gene locus_tag LOCUS_17000 64937 65695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 65736 67112 gene locus_tag LOCUS_17010 65736 67112 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404619.1 protein_id gnl|my_center|LOCUS_17010 67113 67994 gene locus_tag LOCUS_17020 67113 67994 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_17020 68478 69146 gene locus_tag LOCUS_17030 68478 69146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 69258 70136 gene locus_tag LOCUS_17040 69258 70136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 70577 70158 gene locus_tag LOCUS_17050 70577 70158 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022301.1 protein_id gnl|my_center|LOCUS_17050 70680 70874 gene locus_tag LOCUS_17060 70680 70874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 71009 71809 gene locus_tag LOCUS_17070 71009 71809 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_17070 73202 71865 gene locus_tag LOCUS_17080 gene glnA 73202 71865 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_17080 73845 73657 gene locus_tag LOCUS_17090 73845 73657 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390530.1 protein_id gnl|my_center|LOCUS_17090 74030 74125 gene locus_tag LOCUS_t00220 74030 74125 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 74163 75380 gene locus_tag LOCUS_17100 74163 75380 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_17100 75418 76275 gene locus_tag LOCUS_17110 75418 76275 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_17110 76278 77393 gene locus_tag LOCUS_17120 76278 77393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 77492 78802 gene locus_tag LOCUS_17130 77492 78802 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_17130 78980 79606 gene locus_tag LOCUS_17140 78980 79606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 79649 79894 gene locus_tag LOCUS_17150 79649 79894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 79946 80497 gene locus_tag LOCUS_17160 79946 80497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17160 80921 80736 gene locus_tag LOCUS_17170 80921 80736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 81566 81150 gene locus_tag LOCUS_17180 81566 81150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 82970 81891 gene locus_tag LOCUS_17190 82970 81891 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 protein_id gnl|my_center|LOCUS_17190 83657 83484 gene locus_tag LOCUS_17200 83657 83484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 83611 84780 gene locus_tag LOCUS_17210 83611 84780 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256200.1 protein_id gnl|my_center|LOCUS_17210 85292 84897 gene locus_tag LOCUS_17220 85292 84897 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250966.1 protein_id gnl|my_center|LOCUS_17220 85741 86088 gene locus_tag LOCUS_17230 gene hypA 85741 86088 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_17230 86091 86744 gene locus_tag LOCUS_17240 gene hypB 86091 86744 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_17240 86741 89134 gene locus_tag LOCUS_17250 gene hypF 86741 89134 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_17250 89247 89516 gene locus_tag LOCUS_17260 89247 89516 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_17260 89522 90619 gene locus_tag LOCUS_17270 gene hypD 89522 90619 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_17270 90619 91704 gene locus_tag LOCUS_17280 gene hypE 90619 91704 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_17280 92681 91791 gene locus_tag LOCUS_17290 92681 91791 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963493.1 protein_id gnl|my_center|LOCUS_17290 92997 92800 gene locus_tag LOCUS_17300 92997 92800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 93130 93684 gene locus_tag LOCUS_17310 93130 93684 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112755.1 protein_id gnl|my_center|LOCUS_17310 93685 94437 gene locus_tag LOCUS_17320 93685 94437 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_17320 95312 94596 gene locus_tag LOCUS_17330 95312 94596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 96210 95500 gene locus_tag LOCUS_17340 96210 95500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 97179 96343 gene locus_tag LOCUS_17350 97179 96343 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_17350 98048 97176 gene locus_tag LOCUS_17360 98048 97176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 98619 98068 gene locus_tag LOCUS_17370 98619 98068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 99309 98635 gene locus_tag LOCUS_17380 99309 98635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 100703 99357 gene locus_tag LOCUS_17390 100703 99357 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258273.1 protein_id gnl|my_center|LOCUS_17390 101005 100721 gene locus_tag LOCUS_17400 101005 100721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 101758 101063 gene locus_tag LOCUS_17410 101758 101063 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_17410 103014 101755 gene locus_tag LOCUS_17420 103014 101755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 104098 103031 gene locus_tag LOCUS_17430 104098 103031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 104396 104821 gene locus_tag LOCUS_17440 104396 104821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 105009 105248 gene locus_tag LOCUS_17450 105009 105248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 106972 105263 gene locus_tag LOCUS_17460 106972 105263 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929142.1 protein_id gnl|my_center|LOCUS_17460 107545 106982 gene locus_tag LOCUS_17470 gene hpt 107545 106982 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_17470 108128 107559 gene locus_tag LOCUS_17480 108128 107559 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 protein_id gnl|my_center|LOCUS_17480 108768 108295 gene locus_tag LOCUS_17490 108768 108295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 109038 108781 gene locus_tag LOCUS_17500 gene rpmA 109038 108781 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940600.1 protein_id gnl|my_center|LOCUS_17500 109367 109050 gene locus_tag LOCUS_17510 gene rplU 109367 109050 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669481.1 protein_id gnl|my_center|LOCUS_17510 111283 109598 gene locus_tag LOCUS_17520 111283 109598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 111522 111773 gene locus_tag LOCUS_17530 111522 111773 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082295.1 protein_id gnl|my_center|LOCUS_17530 111787 112911 gene locus_tag LOCUS_17540 111787 112911 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_17540 112911 113693 gene locus_tag LOCUS_17550 112911 113693 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_17550 113704 114267 gene locus_tag LOCUS_17560 113704 114267 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_17560 114298 115494 gene locus_tag LOCUS_17570 114298 115494 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_17570 115517 116470 gene locus_tag LOCUS_17580 115517 116470 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_17580 120973 116552 gene locus_tag LOCUS_17590 120973 116552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 121593 121144 gene locus_tag LOCUS_17600 gene tnpA 121593 121144 CDS product IS200/IS605-like element ISDha13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816675.1 protein_id gnl|my_center|LOCUS_17600 124523 121794 gene locus_tag LOCUS_17610 gene ppdK 124523 121794 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_17610 126293 124902 gene locus_tag LOCUS_17620 126293 124902 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_17620 126529 127503 gene locus_tag LOCUS_17630 126529 127503 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243632.1 protein_id gnl|my_center|LOCUS_17630 127500 128330 gene locus_tag LOCUS_17640 gene lipM 127500 128330 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_17640 128374 129162 gene locus_tag LOCUS_17650 128374 129162 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_17650 129966 129283 gene locus_tag LOCUS_17660 129966 129283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 130021 130305 gene locus_tag LOCUS_17670 130021 130305 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_17670 130318 130659 gene locus_tag LOCUS_17680 130318 130659 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_17680 131045 130701 gene locus_tag LOCUS_17690 gene rsfS 131045 130701 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_17690 131699 131112 gene locus_tag LOCUS_17700 gene thpR 131699 131112 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_17700 132123 131740 gene locus_tag LOCUS_17710 132123 131740 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942859.1 protein_id gnl|my_center|LOCUS_17710 133564 132224 gene locus_tag LOCUS_17720 gene mocA 133564 132224 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393499.1 protein_id gnl|my_center|LOCUS_17720 134379 133555 gene locus_tag LOCUS_17730 gene yqeB 134379 133555 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459388.1 protein_id gnl|my_center|LOCUS_17730 134960 134778 gene locus_tag LOCUS_17740 134960 134778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 135012 135617 gene locus_tag LOCUS_17750 135012 135617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 135635 137725 gene locus_tag LOCUS_17760 135635 137725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 138003 138941 gene locus_tag LOCUS_17770 138003 138941 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_17770 138938 140635 gene locus_tag LOCUS_17780 gene recJ 138938 140635 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_17780 141315 140632 gene locus_tag LOCUS_17790 141315 140632 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_17790 141427 142767 gene locus_tag LOCUS_17800 141427 142767 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_17800 142784 143560 gene locus_tag LOCUS_17810 142784 143560 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868825.1 protein_id gnl|my_center|LOCUS_17810 143557 144522 gene locus_tag LOCUS_17820 gene ilvA 143557 144522 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_17820 144512 145330 gene locus_tag LOCUS_17830 144512 145330 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085471.1 protein_id gnl|my_center|LOCUS_17830 145393 148161 gene locus_tag LOCUS_17840 145393 148161 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900457.1 protein_id gnl|my_center|LOCUS_17840 149180 148191 gene locus_tag LOCUS_17850 149180 148191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 149354 150028 gene locus_tag LOCUS_17860 149354 150028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 150122 151222 gene locus_tag LOCUS_17870 gene ychF 150122 151222 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 protein_id gnl|my_center|LOCUS_17870 152588 151212 gene locus_tag LOCUS_17880 152588 151212 CDS product CpXC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257830.1 protein_id gnl|my_center|LOCUS_17880 154340 152790 gene locus_tag LOCUS_17890 154340 152790 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_17890 154463 155581 gene locus_tag LOCUS_17900 gene tgt 154463 155581 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_17900 155586 156404 gene locus_tag LOCUS_17910 155586 156404 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_17910 156538 157125 gene locus_tag LOCUS_17920 156538 157125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 157748 157170 gene locus_tag LOCUS_17930 157748 157170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 158143 157745 gene locus_tag LOCUS_17940 158143 157745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 158269 158985 gene locus_tag LOCUS_17950 158269 158985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 159004 159669 gene locus_tag LOCUS_17960 159004 159669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 159669 160379 gene locus_tag LOCUS_17970 159669 160379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 161703 160456 gene locus_tag LOCUS_17980 161703 160456 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_17980 162683 161703 gene locus_tag LOCUS_17990 162683 161703 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_17990 163652 162696 gene locus_tag LOCUS_18000 gene pdhA 163652 162696 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719639.1 protein_id gnl|my_center|LOCUS_18000 163909 164538 gene locus_tag LOCUS_18010 163909 164538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 164544 166106 gene locus_tag LOCUS_18020 164544 166106 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_18020 166119 167003 gene locus_tag LOCUS_18030 gene lgt 166119 167003 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_18030 167029 168645 gene locus_tag LOCUS_18040 167029 168645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 168659 168922 gene locus_tag LOCUS_18050 168659 168922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 168925 169416 gene locus_tag LOCUS_18060 168925 169416 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090395.1 protein_id gnl|my_center|LOCUS_18060 169433 169996 gene locus_tag LOCUS_18070 169433 169996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 170093 170368 gene locus_tag LOCUS_18080 170093 170368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 171538 170450 gene locus_tag LOCUS_18090 171538 170450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 173632 171620 gene locus_tag LOCUS_18100 173632 171620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 179562 173812 gene locus_tag LOCUS_18110 179562 173812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 180062 179604 gene locus_tag LOCUS_18120 180062 179604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 183586 180080 gene locus_tag LOCUS_18130 183586 180080 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057180.1 protein_id gnl|my_center|LOCUS_18130 183826 184146 gene locus_tag LOCUS_18140 183826 184146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 184221 185273 gene locus_tag LOCUS_18150 gene thrC 184221 185273 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865143.1 protein_id gnl|my_center|LOCUS_18150 185283 186206 gene locus_tag LOCUS_18160 gene thrB 185283 186206 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_18160 186372 187085 gene locus_tag LOCUS_18170 186372 187085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 187358 188092 gene locus_tag LOCUS_18180 187358 188092 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084305.1 protein_id gnl|my_center|LOCUS_18180 188092 189135 gene locus_tag LOCUS_18190 188092 189135 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266349.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence009 739 1941 gene locus_tag LOCUS_18200 739 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4147 1895 gene locus_tag LOCUS_18210 4147 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6002 4476 gene locus_tag LOCUS_18220 6002 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 7995 6007 gene locus_tag LOCUS_18230 7995 6007 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_18230 8934 8092 gene locus_tag LOCUS_18240 8934 8092 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_18240 9814 8936 gene locus_tag LOCUS_18250 9814 8936 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524828.1 protein_id gnl|my_center|LOCUS_18250 11252 9885 gene locus_tag LOCUS_18260 11252 9885 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_18260 12342 11326 gene locus_tag LOCUS_18270 12342 11326 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_18270 14528 12522 gene locus_tag LOCUS_18280 14528 12522 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_18280 15959 14580 gene locus_tag LOCUS_18290 15959 14580 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_18290 16155 16796 gene locus_tag LOCUS_18300 16155 16796 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_18300 18447 16924 gene locus_tag LOCUS_18310 gene rny 18447 16924 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_18310 19186 18569 gene locus_tag LOCUS_18320 19186 18569 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_18320 20593 19583 gene locus_tag LOCUS_18330 gene recA 20593 19583 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_18330 20871 23129 gene locus_tag LOCUS_18340 20871 23129 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_18340 23300 23794 gene locus_tag LOCUS_18350 23300 23794 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_18350 23918 24718 gene locus_tag LOCUS_18360 23918 24718 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 protein_id gnl|my_center|LOCUS_18360 24779 25966 gene locus_tag LOCUS_18370 24779 25966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 26135 27166 gene locus_tag LOCUS_18380 26135 27166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 27333 28376 gene locus_tag LOCUS_18390 gene hemH 27333 28376 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 protein_id gnl|my_center|LOCUS_18390 28643 29071 gene locus_tag LOCUS_18400 gene mraZ 28643 29071 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256658.1 protein_id gnl|my_center|LOCUS_18400 29127 30038 gene locus_tag LOCUS_18410 gene rsmH 29127 30038 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_18410 30136 30615 gene locus_tag LOCUS_18420 30136 30615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 30612 32369 gene locus_tag LOCUS_18430 30612 32369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 32381 33802 gene locus_tag LOCUS_18440 32381 33802 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_18440 33799 34809 gene locus_tag LOCUS_18450 gene mraY 33799 34809 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_18450 34818 36209 gene locus_tag LOCUS_18460 gene murD 34818 36209 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_18460 36188 37459 gene locus_tag LOCUS_18470 gene spoVE 36188 37459 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_18470 37377 38480 gene locus_tag LOCUS_18480 37377 38480 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_18480 38491 39141 gene locus_tag LOCUS_18490 38491 39141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 39150 40520 gene locus_tag LOCUS_18500 gene murC 39150 40520 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_18500 40547 40729 gene locus_tag LOCUS_18510 40547 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 40739 41683 gene locus_tag LOCUS_18520 gene murB 40739 41683 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256646.1 protein_id gnl|my_center|LOCUS_18520 41760 42806 gene locus_tag LOCUS_18530 41760 42806 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_18530 43047 43808 gene locus_tag LOCUS_18540 43047 43808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 43808 45055 gene locus_tag LOCUS_18550 gene ftsA 43808 45055 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_18550 45200 46303 gene locus_tag LOCUS_18560 gene ftsZ 45200 46303 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_18560 46627 47079 gene locus_tag LOCUS_18570 gene nrdR 46627 47079 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_18570 47146 49719 gene locus_tag LOCUS_18580 47146 49719 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257621.1 protein_id gnl|my_center|LOCUS_18580 49991 51805 gene locus_tag LOCUS_18590 49991 51805 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256698.1 protein_id gnl|my_center|LOCUS_18590 52011 52772 gene locus_tag LOCUS_18600 52011 52772 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267863.1 protein_id gnl|my_center|LOCUS_18600 52784 52942 gene locus_tag LOCUS_18610 52784 52942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 52939 54162 gene locus_tag LOCUS_18620 52939 54162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259142.1 protein_id gnl|my_center|LOCUS_18620 54243 54890 gene locus_tag LOCUS_18630 54243 54890 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_18630 55044 56129 gene locus_tag LOCUS_18640 55044 56129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 57252 56254 gene locus_tag LOCUS_18650 57252 56254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 58557 57349 gene locus_tag LOCUS_18660 58557 57349 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256834.1 protein_id gnl|my_center|LOCUS_18660 58693 59307 gene locus_tag LOCUS_18670 58693 59307 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_18670 59390 60286 gene locus_tag LOCUS_18680 59390 60286 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_18680 60332 62275 gene locus_tag LOCUS_18690 60332 62275 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943646.1 protein_id gnl|my_center|LOCUS_18690 62376 63509 gene locus_tag LOCUS_18700 62376 63509 CDS product NeuD/PglB/VioB family sugar acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943647.1 protein_id gnl|my_center|LOCUS_18700 63678 63950 gene locus_tag LOCUS_18710 gene rpsO 63678 63950 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_18710 64190 66388 gene locus_tag LOCUS_18720 gene pnp 64190 66388 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_18720 66727 67659 gene locus_tag LOCUS_18730 gene trxB 66727 67659 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_18730 67781 68713 gene locus_tag LOCUS_18740 gene mdh 67781 68713 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_18740 68741 70045 gene locus_tag LOCUS_18750 68741 70045 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_18750 71109 70111 gene locus_tag LOCUS_18760 71109 70111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 72450 71437 gene locus_tag LOCUS_18770 72450 71437 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_18770 73493 72459 gene locus_tag LOCUS_18780 gene fni 73493 72459 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_18780 73656 73892 gene locus_tag LOCUS_18790 gene acpP 73656 73892 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_18790 74269 74778 gene locus_tag LOCUS_18800 gene rfaH 74269 74778 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760598.1 protein_id gnl|my_center|LOCUS_18800 74789 75487 gene locus_tag LOCUS_18810 74789 75487 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_18810 75484 76533 gene locus_tag LOCUS_18820 gene neuB 75484 76533 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_18820 76530 77441 gene locus_tag LOCUS_18830 76530 77441 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_18830 77438 78142 gene locus_tag LOCUS_18840 77438 78142 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392275.1 protein_id gnl|my_center|LOCUS_18840 78129 79292 gene locus_tag LOCUS_18850 gene neuC 78129 79292 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392276.1 protein_id gnl|my_center|LOCUS_18850 79297 79467 gene locus_tag LOCUS_18860 79297 79467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 79578 80246 gene locus_tag LOCUS_18870 79578 80246 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_18870 80248 80910 gene locus_tag LOCUS_18880 80248 80910 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_18880 80900 81973 gene locus_tag LOCUS_18890 80900 81973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 81960 82952 gene locus_tag LOCUS_18900 81960 82952 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_18900 83097 84467 gene locus_tag LOCUS_18910 83097 84467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 86572 84545 gene locus_tag LOCUS_18920 86572 84545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 88209 86728 gene locus_tag LOCUS_18930 88209 86728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 88844 88212 gene locus_tag LOCUS_18940 88844 88212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 92079 88927 gene locus_tag LOCUS_18950 92079 88927 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 protein_id gnl|my_center|LOCUS_18950 93731 92076 gene locus_tag LOCUS_18960 93731 92076 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_18960 94738 93728 gene locus_tag LOCUS_18970 94738 93728 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083082.1 protein_id gnl|my_center|LOCUS_18970 95210 94749 gene locus_tag LOCUS_18980 95210 94749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140189.1 protein_id gnl|my_center|LOCUS_18980 96467 95355 gene locus_tag LOCUS_18990 96467 95355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 97663 96467 gene locus_tag LOCUS_19000 97663 96467 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_19000 98807 97815 gene locus_tag LOCUS_19010 98807 97815 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815509.1 protein_id gnl|my_center|LOCUS_19010 99868 98861 gene locus_tag LOCUS_19020 99868 98861 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_19020 100084 100731 gene locus_tag LOCUS_19030 100084 100731 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_19030 102513 100774 gene locus_tag LOCUS_19040 102513 100774 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259439.1 protein_id gnl|my_center|LOCUS_19040 104342 102516 gene locus_tag LOCUS_19050 104342 102516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 104463 105959 gene locus_tag LOCUS_19060 104463 105959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 106895 105972 gene locus_tag LOCUS_19070 106895 105972 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_19070 108743 107004 gene locus_tag LOCUS_19080 108743 107004 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259439.1 protein_id gnl|my_center|LOCUS_19080 109188 108766 gene locus_tag LOCUS_19090 109188 108766 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233402.1 protein_id gnl|my_center|LOCUS_19090 109373 111193 gene locus_tag LOCUS_19100 109373 111193 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_19100 111233 112861 gene locus_tag LOCUS_19110 111233 112861 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_19110 113333 112953 gene locus_tag LOCUS_19120 113333 112953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 113831 113364 gene locus_tag LOCUS_19130 113831 113364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 116045 113943 gene locus_tag LOCUS_19140 gene fdhF 116045 113943 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_19140 116557 116195 gene locus_tag LOCUS_19150 116557 116195 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023370.1 protein_id gnl|my_center|LOCUS_19150 119076 116566 gene locus_tag LOCUS_19160 119076 116566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 119855 119073 gene locus_tag LOCUS_19170 119855 119073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 120895 119981 gene locus_tag LOCUS_19180 gene cysK 120895 119981 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_19180 121479 121015 gene locus_tag LOCUS_19190 121479 121015 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_19190 122014 121481 gene locus_tag LOCUS_19200 122014 121481 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 protein_id gnl|my_center|LOCUS_19200 123191 122025 gene locus_tag LOCUS_19210 123191 122025 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878467.1 protein_id gnl|my_center|LOCUS_19210 123632 123207 gene locus_tag LOCUS_19220 123632 123207 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_19220 124815 123664 gene locus_tag LOCUS_19230 124815 123664 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868529.1 protein_id gnl|my_center|LOCUS_19230 125885 124986 gene locus_tag LOCUS_19240 gene tatC 125885 124986 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227900.1 protein_id gnl|my_center|LOCUS_19240 126317 125889 gene locus_tag LOCUS_19250 126317 125889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 126775 126320 gene locus_tag LOCUS_19260 gene nusB 126775 126320 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_19260 127155 126772 gene locus_tag LOCUS_19270 127155 126772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 127999 127235 gene locus_tag LOCUS_19280 gene fabG 127999 127235 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_19280 129036 128098 gene locus_tag LOCUS_19290 gene fabD 129036 128098 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_19290 129434 129255 gene locus_tag LOCUS_19300 gene rpmF 129434 129255 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_19300 130458 129496 gene locus_tag LOCUS_19310 gene prfB 130458 129496 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_19310 131456 130707 gene locus_tag LOCUS_19320 131456 130707 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527709.1 protein_id gnl|my_center|LOCUS_19320 132389 131475 gene locus_tag LOCUS_19330 gene ftsY 132389 131475 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_19330 133405 132449 gene locus_tag LOCUS_19340 gene ilvA 133405 132449 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_19340 133493 133975 gene locus_tag LOCUS_19350 gene moaC 133493 133975 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_19350 134018 134266 gene locus_tag LOCUS_19360 134018 134266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 134273 134737 gene locus_tag LOCUS_19370 134273 134737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19370 134977 135882 gene locus_tag LOCUS_19380 134977 135882 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_19380 135945 137183 gene locus_tag LOCUS_19390 gene fabF 135945 137183 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 protein_id gnl|my_center|LOCUS_19390 137315 138037 gene locus_tag LOCUS_19400 gene rncS 137315 138037 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_19400 138105 141707 gene locus_tag LOCUS_19410 gene smc 138105 141707 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258775.1 protein_id gnl|my_center|LOCUS_19410 141751 142467 gene locus_tag LOCUS_19420 gene rph 141751 142467 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256154.1 protein_id gnl|my_center|LOCUS_19420 143909 142608 gene locus_tag LOCUS_19430 143909 142608 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256913.1 protein_id gnl|my_center|LOCUS_19430 144023 144340 gene locus_tag LOCUS_19440 144023 144340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 144676 144287 gene locus_tag LOCUS_19450 144676 144287 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256912.1 protein_id gnl|my_center|LOCUS_19450 144979 144692 gene locus_tag LOCUS_19460 gene rpsF 144979 144692 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_19460 145488 145141 gene locus_tag LOCUS_19470 145488 145141 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_19470 146123 145485 gene locus_tag LOCUS_19480 146123 145485 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259317.1 protein_id gnl|my_center|LOCUS_19480 146312 147085 gene locus_tag LOCUS_19490 gene sufC 146312 147085 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_19490 147162 148568 gene locus_tag LOCUS_19500 gene sufB 147162 148568 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_19500 148667 149935 gene locus_tag LOCUS_19510 gene sufD 148667 149935 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_19510 149989 150285 gene locus_tag LOCUS_19520 149989 150285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 150335 151591 gene locus_tag LOCUS_19530 150335 151591 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_19530 151642 152037 gene locus_tag LOCUS_19540 151642 152037 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_19540 152039 152386 gene locus_tag LOCUS_19550 152039 152386 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_19550 153275 152523 gene locus_tag LOCUS_19560 153275 152523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 154443 153292 gene locus_tag LOCUS_19570 154443 153292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 155070 154471 gene locus_tag LOCUS_19580 155070 154471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 155972 155067 gene locus_tag LOCUS_19590 155972 155067 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 protein_id gnl|my_center|LOCUS_19590 156825 155974 gene locus_tag LOCUS_19600 156825 155974 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_19600 157506 156895 gene locus_tag LOCUS_19610 157506 156895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 158949 157528 gene locus_tag LOCUS_19620 158949 157528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 159706 159155 gene locus_tag LOCUS_19630 159706 159155 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258745.1 protein_id gnl|my_center|LOCUS_19630 161403 159733 gene locus_tag LOCUS_19640 161403 159733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 161811 161440 gene locus_tag LOCUS_19650 161811 161440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 162769 162089 gene locus_tag LOCUS_19660 gene phoU 162769 162089 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_19660 163345 162887 gene locus_tag LOCUS_19670 163345 162887 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_19670 163973 163335 gene locus_tag LOCUS_19680 163973 163335 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714865.1 protein_id gnl|my_center|LOCUS_19680 164855 164076 gene locus_tag LOCUS_19690 gene pstB 164855 164076 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_19690 166155 164896 gene locus_tag LOCUS_19700 166155 164896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 167357 166152 gene locus_tag LOCUS_19710 167357 166152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence010 484 1350 gene locus_tag LOCUS_19720 484 1350 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_19720 1311 2405 gene locus_tag LOCUS_19730 1311 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4390 2534 gene locus_tag LOCUS_19740 4390 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 4595 6187 gene locus_tag LOCUS_19750 4595 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 6455 9256 gene locus_tag LOCUS_19760 6455 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 9269 9949 gene locus_tag LOCUS_19770 9269 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 10085 10615 gene locus_tag LOCUS_19780 10085 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 10980 11897 gene locus_tag LOCUS_19790 10980 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 11890 13230 gene locus_tag LOCUS_19800 11890 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 13234 14310 gene locus_tag LOCUS_19810 13234 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 14411 14998 gene locus_tag LOCUS_19820 14411 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 15023 17332 gene locus_tag LOCUS_19830 15023 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 18750 17527 gene locus_tag LOCUS_19840 18750 17527 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907968.1 protein_id gnl|my_center|LOCUS_19840 19243 18803 gene locus_tag LOCUS_19850 19243 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 19830 19270 gene locus_tag LOCUS_19860 gene rpoE 19830 19270 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209672.1 protein_id gnl|my_center|LOCUS_19860 21522 19915 gene locus_tag LOCUS_19870 21522 19915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 22154 21519 gene locus_tag LOCUS_19880 22154 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 22379 22164 gene locus_tag LOCUS_19890 22379 22164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257628.1 protein_id gnl|my_center|LOCUS_19890 23605 22556 gene locus_tag LOCUS_19900 23605 22556 CDS product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444602.1 protein_id gnl|my_center|LOCUS_19900 26514 23764 gene locus_tag LOCUS_19910 26514 23764 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889379.1 protein_id gnl|my_center|LOCUS_19910 26737 27069 gene locus_tag LOCUS_19920 26737 27069 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_19920 27059 27472 gene locus_tag LOCUS_19930 27059 27472 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_19930 27630 27557 gene locus_tag LOCUS_t00230 27630 27557 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 27705 28982 gene locus_tag LOCUS_19940 27705 28982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 29024 29878 gene locus_tag LOCUS_19950 29024 29878 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_19950 30023 30697 gene locus_tag LOCUS_19960 30023 30697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 30789 32042 gene locus_tag LOCUS_19970 30789 32042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 32066 33418 gene locus_tag LOCUS_19980 gene rimO 32066 33418 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_19980 33451 34416 gene locus_tag LOCUS_19990 33451 34416 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_19990 34420 35946 gene locus_tag LOCUS_20000 34420 35946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 37466 35955 gene locus_tag LOCUS_20010 37466 35955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 37982 37476 gene locus_tag LOCUS_20020 37982 37476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 39005 38004 gene locus_tag LOCUS_20030 39005 38004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 39076 39492 gene locus_tag LOCUS_20040 39076 39492 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_20040 39512 40564 gene locus_tag LOCUS_20050 39512 40564 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887591.1 protein_id gnl|my_center|LOCUS_20050 40566 41564 gene locus_tag LOCUS_20060 40566 41564 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_20060 41568 42257 gene locus_tag LOCUS_20070 41568 42257 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_20070 44053 42419 gene locus_tag LOCUS_20080 44053 42419 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_20080 46204 44573 gene locus_tag LOCUS_20090 gene groL 46204 44573 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_20090 46518 46249 gene locus_tag LOCUS_20100 gene groES 46518 46249 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393620.1 protein_id gnl|my_center|LOCUS_20100 48105 46765 gene locus_tag LOCUS_20110 48105 46765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 49317 48112 gene locus_tag LOCUS_20120 49317 48112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 52473 49456 gene locus_tag LOCUS_20130 52473 49456 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_20130 53444 52626 gene locus_tag LOCUS_20140 53444 52626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 53594 54004 gene locus_tag LOCUS_20150 53594 54004 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_20150 54001 54363 gene locus_tag LOCUS_20160 54001 54363 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812480.1 protein_id gnl|my_center|LOCUS_20160 55315 54305 gene locus_tag LOCUS_20170 gene dusB 55315 54305 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619224.1 protein_id gnl|my_center|LOCUS_20170 56203 55322 gene locus_tag LOCUS_20180 56203 55322 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_20180 57644 56238 gene locus_tag LOCUS_20190 gene radA 57644 56238 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_20190 60315 57781 gene locus_tag LOCUS_20200 60315 57781 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_20200 62281 60560 gene locus_tag LOCUS_20210 62281 60560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 62446 63486 gene locus_tag LOCUS_20220 62446 63486 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461434.1 protein_id gnl|my_center|LOCUS_20220 63819 64436 gene locus_tag LOCUS_20230 63819 64436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 64507 66015 gene locus_tag LOCUS_20240 64507 66015 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_20240 66046 66873 gene locus_tag LOCUS_20250 66046 66873 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_20250 67187 67597 gene locus_tag LOCUS_20260 67187 67597 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_20260 67616 68548 gene locus_tag LOCUS_20270 67616 68548 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_20270 68627 68851 gene locus_tag LOCUS_20280 68627 68851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 68876 69388 gene locus_tag LOCUS_20290 68876 69388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 69560 70423 gene locus_tag LOCUS_20300 69560 70423 CDS product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013710.1 protein_id gnl|my_center|LOCUS_20300 70432 71358 gene locus_tag LOCUS_20310 70432 71358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_20310 71368 72165 gene locus_tag LOCUS_20320 71368 72165 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660412.1 protein_id gnl|my_center|LOCUS_20320 72303 73043 gene locus_tag LOCUS_20330 72303 73043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 73054 74304 gene locus_tag LOCUS_20340 73054 74304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 75353 74349 gene locus_tag LOCUS_20350 75353 74349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 76044 75397 gene locus_tag LOCUS_20360 76044 75397 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_20360 76684 76166 gene locus_tag LOCUS_20370 76684 76166 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 protein_id gnl|my_center|LOCUS_20370 77643 76726 gene locus_tag LOCUS_20380 77643 76726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 78521 77655 gene locus_tag LOCUS_20390 78521 77655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_20390 79515 78511 gene locus_tag LOCUS_20400 79515 78511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285058.1 protein_id gnl|my_center|LOCUS_20400 80191 79697 gene locus_tag LOCUS_20410 80191 79697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 80898 80188 gene locus_tag LOCUS_20420 80898 80188 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_20420 80803 81000 gene locus_tag LOCUS_20430 80803 81000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 81110 85042 gene locus_tag LOCUS_20440 81110 85042 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_20440 85039 85308 gene locus_tag LOCUS_20450 85039 85308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 85351 85839 gene locus_tag LOCUS_20460 85351 85839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 85929 86147 gene locus_tag LOCUS_20470 85929 86147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 86193 86771 gene locus_tag LOCUS_20480 86193 86771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 87321 86824 gene locus_tag LOCUS_20490 87321 86824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 88702 87422 gene locus_tag LOCUS_20500 gene serS 88702 87422 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_20500 90704 89256 gene locus_tag LOCUS_20510 90704 89256 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_20510 91411 90707 gene locus_tag LOCUS_20520 91411 90707 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_20520 93027 91444 gene locus_tag LOCUS_20530 93027 91444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 93803 93252 gene locus_tag LOCUS_20540 93803 93252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 94822 93953 gene locus_tag LOCUS_20550 94822 93953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 96464 94842 gene locus_tag LOCUS_20560 96464 94842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 97216 96485 gene locus_tag LOCUS_20570 97216 96485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 97746 97270 gene locus_tag LOCUS_20580 97746 97270 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_20580 99976 97730 gene locus_tag LOCUS_20590 99976 97730 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542359.1 protein_id gnl|my_center|LOCUS_20590 101546 100263 gene locus_tag LOCUS_20600 101546 100263 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892302.1 protein_id gnl|my_center|LOCUS_20600 101581 101760 gene locus_tag LOCUS_20610 101581 101760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 101860 102504 gene locus_tag LOCUS_20620 101860 102504 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_20620 102521 102823 gene locus_tag LOCUS_20630 102521 102823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 102852 103949 gene locus_tag LOCUS_20640 gene mutY 102852 103949 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_20640 103958 105031 gene locus_tag LOCUS_20650 103958 105031 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_20650 105045 105500 gene locus_tag LOCUS_20660 105045 105500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 106846 105515 gene locus_tag LOCUS_20670 106846 105515 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015351.1 protein_id gnl|my_center|LOCUS_20670 107103 108392 gene locus_tag LOCUS_20680 107103 108392 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_20680 108389 109666 gene locus_tag LOCUS_20690 108389 109666 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857632.1 protein_id gnl|my_center|LOCUS_20690 109700 110104 gene locus_tag LOCUS_20700 109700 110104 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_20700 110858 110190 gene locus_tag LOCUS_20710 110858 110190 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_20710 111902 110964 gene locus_tag LOCUS_20720 111902 110964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 112277 111927 gene locus_tag LOCUS_20730 112277 111927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 113519 112287 gene locus_tag LOCUS_20740 113519 112287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 113784 114152 gene locus_tag LOCUS_20750 113784 114152 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944172.1 protein_id gnl|my_center|LOCUS_20750 114142 115035 gene locus_tag LOCUS_20760 114142 115035 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036544.1 protein_id gnl|my_center|LOCUS_20760 115192 116568 gene locus_tag LOCUS_20770 115192 116568 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_20770 116677 117381 gene locus_tag LOCUS_20780 gene ubiE 116677 117381 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259480.1 protein_id gnl|my_center|LOCUS_20780 117423 117971 gene locus_tag LOCUS_20790 gene ubiX 117423 117971 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825701.1 protein_id gnl|my_center|LOCUS_20790 117968 118450 gene locus_tag LOCUS_20800 117968 118450 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404877.1 protein_id gnl|my_center|LOCUS_20800 118455 119243 gene locus_tag LOCUS_20810 118455 119243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 120213 119302 gene locus_tag LOCUS_20820 120213 119302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 121568 120243 gene locus_tag LOCUS_20830 121568 120243 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_20830 121839 122258 gene locus_tag LOCUS_20840 121839 122258 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_20840 122480 124132 gene locus_tag LOCUS_20850 gene hutU 122480 124132 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_20850 124250 126475 gene locus_tag LOCUS_20860 124250 126475 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_20860 128366 126534 gene locus_tag LOCUS_20870 128366 126534 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256943.1 protein_id gnl|my_center|LOCUS_20870 128298 128468 gene locus_tag LOCUS_20880 128298 128468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 128545 128823 gene locus_tag LOCUS_20890 128545 128823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 128810 129121 gene locus_tag LOCUS_20900 128810 129121 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_20900 129096 129308 gene locus_tag LOCUS_20910 129096 129308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 129631 135576 gene locus_tag LOCUS_20920 129631 135576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 135676 136617 gene locus_tag LOCUS_20930 135676 136617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 137183 136731 gene locus_tag LOCUS_20940 137183 136731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 137304 138473 gene locus_tag LOCUS_20950 gene alr 137304 138473 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_20950 138557 139078 gene locus_tag LOCUS_20960 138557 139078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 139085 139588 gene locus_tag LOCUS_20970 139085 139588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 139669 140898 gene locus_tag LOCUS_20980 gene tyrS 139669 140898 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889364.1 protein_id gnl|my_center|LOCUS_20980 141462 140992 gene locus_tag LOCUS_20990 141462 140992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 142623 141862 gene locus_tag LOCUS_21000 gene mta 142623 141862 CDS product transcriptional activator Mta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242936.1 protein_id gnl|my_center|LOCUS_21000 145239 142753 gene locus_tag LOCUS_21010 145239 142753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 146218 145340 gene locus_tag LOCUS_21020 146218 145340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 146401 146952 gene locus_tag LOCUS_21030 146401 146952 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 protein_id gnl|my_center|LOCUS_21030 147021 147407 gene locus_tag LOCUS_21040 147021 147407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 147460 149394 gene locus_tag LOCUS_21050 147460 149394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 149405 150493 gene locus_tag LOCUS_21060 149405 150493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 151681 150665 gene locus_tag LOCUS_21070 151681 150665 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_21070 152724 152005 gene locus_tag LOCUS_21080 152724 152005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 152838 155246 gene locus_tag LOCUS_21090 152838 155246 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_21090 155370 155639 gene locus_tag LOCUS_21100 155370 155639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 155652 156092 gene locus_tag LOCUS_21110 155652 156092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 156089 157504 gene locus_tag LOCUS_21120 156089 157504 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_21120 158476 157505 gene locus_tag LOCUS_21130 158476 157505 CDS product fructose-bisphosphatase class II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257119.1 protein_id gnl|my_center|LOCUS_21130 160606 158486 gene locus_tag LOCUS_21140 160606 158486 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257118.1 protein_id gnl|my_center|LOCUS_21140 161534 160653 gene locus_tag LOCUS_21150 161534 160653 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_21150 161793 162944 gene locus_tag LOCUS_21160 161793 162944 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162734144.1 protein_id gnl|my_center|LOCUS_21160 162946 163902 gene locus_tag LOCUS_21170 162946 163902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_21170 163979 164710 gene locus_tag LOCUS_21180 163979 164710 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_21180 164782 165711 gene locus_tag LOCUS_21190 164782 165711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence011 358 1383 gene locus_tag LOCUS_21200 gene tgmB 358 1383 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228560.1 protein_id gnl|my_center|LOCUS_21200 1399 1569 gene locus_tag LOCUS_21210 1399 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2725 2225 gene locus_tag LOCUS_21220 2725 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3467 2799 gene locus_tag LOCUS_21230 3467 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 4049 3471 gene locus_tag LOCUS_21240 4049 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 5133 4171 gene locus_tag LOCUS_21250 5133 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 6020 5391 gene locus_tag LOCUS_21260 6020 5391 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257869.1 protein_id gnl|my_center|LOCUS_21260 7062 6085 gene locus_tag LOCUS_21270 gene msrP 7062 6085 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_21270 7433 7119 gene locus_tag LOCUS_21280 7433 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21280 7715 7449 gene locus_tag LOCUS_21290 7715 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 8995 7727 gene locus_tag LOCUS_21300 8995 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 9698 9000 gene locus_tag LOCUS_21310 9698 9000 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_21310 9992 10411 gene locus_tag LOCUS_21320 9992 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 14203 10847 gene locus_tag LOCUS_21330 14203 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 14585 14295 gene locus_tag LOCUS_21340 14585 14295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 15412 14705 gene locus_tag LOCUS_21350 15412 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 16078 16509 gene locus_tag LOCUS_21360 16078 16509 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729724.1 protein_id gnl|my_center|LOCUS_21360 17221 16595 gene locus_tag LOCUS_21370 17221 16595 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_21370 17277 17984 gene locus_tag LOCUS_21380 17277 17984 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_21380 18389 17988 gene locus_tag LOCUS_tm00010 18389 17988 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 18635 19240 gene locus_tag LOCUS_21390 18635 19240 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_21390 19263 20105 gene locus_tag LOCUS_21400 19263 20105 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_21400 20123 20440 gene locus_tag LOCUS_21410 20123 20440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 21244 20480 gene locus_tag LOCUS_21420 21244 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 22445 21309 gene locus_tag LOCUS_21430 22445 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 22440 22712 gene locus_tag LOCUS_21440 22440 22712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 23636 22602 gene locus_tag LOCUS_21450 23636 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 24108 24305 gene locus_tag LOCUS_21460 24108 24305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 25614 24406 gene locus_tag LOCUS_21470 25614 24406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 27240 25696 gene locus_tag LOCUS_21480 gene malQ 27240 25696 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_21480 28495 27230 gene locus_tag LOCUS_21490 28495 27230 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_21490 30765 28516 gene locus_tag LOCUS_21500 30765 28516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 31012 31917 gene locus_tag LOCUS_21510 31012 31917 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_21510 32599 31925 gene locus_tag LOCUS_21520 32599 31925 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_21520 33227 32625 gene locus_tag LOCUS_21530 33227 32625 CDS product VUT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479579.1 protein_id gnl|my_center|LOCUS_21530 34178 33246 gene locus_tag LOCUS_21540 34178 33246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 34531 34175 gene locus_tag LOCUS_21550 34531 34175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 35796 34678 gene locus_tag LOCUS_21560 35796 34678 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892385.1 protein_id gnl|my_center|LOCUS_21560 36456 36746 gene locus_tag LOCUS_21570 36456 36746 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548757.1 protein_id gnl|my_center|LOCUS_21570 36908 37795 gene locus_tag LOCUS_21580 gene pdxS 36908 37795 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_21580 37864 38448 gene locus_tag LOCUS_21590 gene pdxT 37864 38448 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258094.1 protein_id gnl|my_center|LOCUS_21590 38454 39419 gene locus_tag LOCUS_21600 38454 39419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 39394 40983 gene locus_tag LOCUS_21610 39394 40983 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_21610 41158 42306 gene locus_tag LOCUS_21620 41158 42306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 42328 42954 gene locus_tag LOCUS_21630 gene tmk 42328 42954 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_21630 43396 42992 gene locus_tag LOCUS_21640 43396 42992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 43453 44082 gene locus_tag LOCUS_21650 43453 44082 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_21650 44079 44873 gene locus_tag LOCUS_21660 44079 44873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 45338 44958 gene locus_tag LOCUS_21670 45338 44958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 46132 45494 gene locus_tag LOCUS_21680 46132 45494 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259017.1 protein_id gnl|my_center|LOCUS_21680 47466 46156 gene locus_tag LOCUS_21690 47466 46156 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258451.1 protein_id gnl|my_center|LOCUS_21690 47862 48800 gene locus_tag LOCUS_21700 47862 48800 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113113.1 protein_id gnl|my_center|LOCUS_21700 49023 49820 gene locus_tag LOCUS_21710 49023 49820 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258763.1 protein_id gnl|my_center|LOCUS_21710 49897 50226 gene locus_tag LOCUS_21720 49897 50226 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393184.1 protein_id gnl|my_center|LOCUS_21720 50285 50809 gene locus_tag LOCUS_21730 50285 50809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 50806 51747 gene locus_tag LOCUS_21740 50806 51747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 51774 52061 gene locus_tag LOCUS_21750 gene gatC 51774 52061 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_21750 52067 53563 gene locus_tag LOCUS_21760 gene gatA 52067 53563 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_21760 53557 55227 gene locus_tag LOCUS_21770 53557 55227 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257600.1 protein_id gnl|my_center|LOCUS_21770 55286 56161 gene locus_tag LOCUS_21780 55286 56161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 56396 57355 gene locus_tag LOCUS_21790 gene lysX 56396 57355 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_21790 57648 58916 gene locus_tag LOCUS_21800 57648 58916 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_21800 58938 60317 gene locus_tag LOCUS_21810 gene argH 58938 60317 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259187.1 protein_id gnl|my_center|LOCUS_21810 60386 60556 gene locus_tag LOCUS_21820 gene lysW 60386 60556 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_21820 60544 61434 gene locus_tag LOCUS_21830 gene lysX 60544 61434 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_21830 61481 62515 gene locus_tag LOCUS_21840 gene argC 61481 62515 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_21840 62535 63377 gene locus_tag LOCUS_21850 62535 63377 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256974.1 protein_id gnl|my_center|LOCUS_21850 63737 63378 gene locus_tag LOCUS_21860 63737 63378 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_21860 63967 63734 gene locus_tag LOCUS_21870 63967 63734 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_21870 64031 65188 gene locus_tag LOCUS_21880 64031 65188 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909458.1 protein_id gnl|my_center|LOCUS_21880 65185 66243 gene locus_tag LOCUS_21890 65185 66243 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_21890 66330 67310 gene locus_tag LOCUS_21900 66330 67310 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_21900 67312 67932 gene locus_tag LOCUS_21910 67312 67932 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990841.1 protein_id gnl|my_center|LOCUS_21910 68128 69138 gene locus_tag LOCUS_21920 68128 69138 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_21920 69135 69398 gene locus_tag LOCUS_21930 69135 69398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 69399 70850 gene locus_tag LOCUS_21940 gene gatB 69399 70850 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_21940 71069 72352 gene locus_tag LOCUS_21950 gene gluD 71069 72352 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420866.1 protein_id gnl|my_center|LOCUS_21950 72498 72698 gene locus_tag LOCUS_21960 72498 72698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 72773 73222 gene locus_tag LOCUS_21970 72773 73222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 73244 75175 gene locus_tag LOCUS_21980 73244 75175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 75939 75187 gene locus_tag LOCUS_21990 75939 75187 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_21990 76292 77263 gene locus_tag LOCUS_22000 76292 77263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 79073 77430 gene locus_tag LOCUS_22010 79073 77430 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_22010 79099 79830 gene locus_tag LOCUS_22020 79099 79830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 81539 79866 gene locus_tag LOCUS_22030 81539 79866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 82477 81560 gene locus_tag LOCUS_22040 82477 81560 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_22040 83298 82585 gene locus_tag LOCUS_22050 83298 82585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 83672 86614 gene locus_tag LOCUS_22060 gene uvrA 83672 86614 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_22060 87311 86733 gene locus_tag LOCUS_22070 87311 86733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 88163 87345 gene locus_tag LOCUS_22080 88163 87345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 89599 88349 gene locus_tag LOCUS_22090 89599 88349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 90719 89631 gene locus_tag LOCUS_22100 90719 89631 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722128.1 protein_id gnl|my_center|LOCUS_22100 91550 90744 gene locus_tag LOCUS_22110 91550 90744 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_22110 92234 91584 gene locus_tag LOCUS_22120 92234 91584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 92625 92272 gene locus_tag LOCUS_22130 gene rplT 92625 92272 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_22130 92985 92713 gene locus_tag LOCUS_22140 92985 92713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 93607 93140 gene locus_tag LOCUS_22150 gene infC 93607 93140 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_22150 96152 93756 gene locus_tag LOCUS_22160 96152 93756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 97012 96278 gene locus_tag LOCUS_22170 97012 96278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 97546 97136 gene locus_tag LOCUS_22180 gene mce 97546 97136 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_22180 98041 97715 gene locus_tag LOCUS_22190 98041 97715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 98400 98008 gene locus_tag LOCUS_22200 98400 98008 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545820.1 protein_id gnl|my_center|LOCUS_22200 100101 98446 gene locus_tag LOCUS_22210 100101 98446 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_22210 100282 100091 gene locus_tag LOCUS_22220 100282 100091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 100275 101480 gene locus_tag LOCUS_22230 100275 101480 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020242.1 protein_id gnl|my_center|LOCUS_22230 101539 102243 gene locus_tag LOCUS_22240 101539 102243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 102309 102863 gene locus_tag LOCUS_22250 102309 102863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence012 <1 1107 gene locus_tag LOCUS_22260 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_139457041.1:ATP-binding protein 1183 1980 gene locus_tag LOCUS_22270 1183 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2058 2996 gene locus_tag LOCUS_22280 2058 2996 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_22280 2999 3889 gene locus_tag LOCUS_22290 2999 3889 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_22290 4007 4447 gene locus_tag LOCUS_22300 4007 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 5549 4833 gene locus_tag LOCUS_22310 5549 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 5666 6979 gene locus_tag LOCUS_22320 5666 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 7056 7883 gene locus_tag LOCUS_22330 7056 7883 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617045.1 protein_id gnl|my_center|LOCUS_22330 8149 9942 gene locus_tag LOCUS_22340 8149 9942 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_22340 10098 11468 gene locus_tag LOCUS_22350 10098 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 11711 11553 gene locus_tag LOCUS_22360 11711 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 12176 11727 gene locus_tag LOCUS_22370 12176 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 12620 12198 gene locus_tag LOCUS_22380 12620 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 13097 12768 gene locus_tag LOCUS_22390 13097 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 14387 13188 gene locus_tag LOCUS_22400 14387 13188 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_22400 16982 14553 gene locus_tag LOCUS_22410 16982 14553 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259065.1 protein_id gnl|my_center|LOCUS_22410 18061 17114 gene locus_tag LOCUS_22420 18061 17114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 19243 18074 gene locus_tag LOCUS_22430 19243 18074 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_22430 20766 19513 gene locus_tag LOCUS_22440 20766 19513 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_22440 21919 20825 gene locus_tag LOCUS_22450 21919 20825 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877291.1 protein_id gnl|my_center|LOCUS_22450 23021 21969 gene locus_tag LOCUS_22460 23021 21969 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240578.1 protein_id gnl|my_center|LOCUS_22460 23607 23011 gene locus_tag LOCUS_22470 23607 23011 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_22470 23917 24483 gene locus_tag LOCUS_22480 23917 24483 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143451.1 protein_id gnl|my_center|LOCUS_22480 24784 24617 gene locus_tag LOCUS_22490 24784 24617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 25893 24802 gene locus_tag LOCUS_22500 25893 24802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 26732 26184 gene locus_tag LOCUS_22510 gene hpt 26732 26184 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_22510 27590 26793 gene locus_tag LOCUS_22520 gene etfB 27590 26793 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 protein_id gnl|my_center|LOCUS_22520 28614 27583 gene locus_tag LOCUS_22530 28614 27583 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_22530 28808 28626 gene locus_tag LOCUS_22540 28808 28626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 29899 28808 gene locus_tag LOCUS_22550 29899 28808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 31158 30013 gene locus_tag LOCUS_22560 31158 30013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 34567 31145 gene locus_tag LOCUS_22570 34567 31145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 34774 34580 gene locus_tag LOCUS_22580 34774 34580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 35306 34776 gene locus_tag LOCUS_22590 35306 34776 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_22590 35890 35390 gene locus_tag LOCUS_22600 35890 35390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 36761 35931 gene locus_tag LOCUS_22610 36761 35931 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867632.1 protein_id gnl|my_center|LOCUS_22610 38084 36912 gene locus_tag LOCUS_22620 38084 36912 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869774.1 protein_id gnl|my_center|LOCUS_22620 38350 38081 gene locus_tag LOCUS_22630 38350 38081 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_22630 38787 40520 gene locus_tag LOCUS_22640 38787 40520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 40634 40831 gene locus_tag LOCUS_22650 40634 40831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 40858 41295 gene locus_tag LOCUS_22660 40858 41295 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_22660 42107 41493 gene locus_tag LOCUS_22670 42107 41493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 43950 42376 gene locus_tag LOCUS_22680 43950 42376 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928419.1 protein_id gnl|my_center|LOCUS_22680 45835 44024 gene locus_tag LOCUS_22690 45835 44024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 46098 45832 gene locus_tag LOCUS_22700 46098 45832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 46302 47822 gene locus_tag LOCUS_22710 gene crtI 46302 47822 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 protein_id gnl|my_center|LOCUS_22710 47844 48800 gene locus_tag LOCUS_22720 47844 48800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 49506 48922 gene locus_tag LOCUS_22730 49506 48922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 50105 49683 gene locus_tag LOCUS_22740 50105 49683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 51091 50141 gene locus_tag LOCUS_22750 51091 50141 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228449.1 protein_id gnl|my_center|LOCUS_22750 51476 51135 gene locus_tag LOCUS_22760 51476 51135 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082088.1 protein_id gnl|my_center|LOCUS_22760 52703 51540 gene locus_tag LOCUS_22770 52703 51540 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_22770 53246 52893 gene locus_tag LOCUS_22780 53246 52893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 53919 53404 gene locus_tag LOCUS_22790 53919 53404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 54074 56131 gene locus_tag LOCUS_22800 gene ligA 54074 56131 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_22800 56210 57418 gene locus_tag LOCUS_22810 56210 57418 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_22810 57550 58740 gene locus_tag LOCUS_22820 57550 58740 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071381.1 protein_id gnl|my_center|LOCUS_22820 59074 58772 gene locus_tag LOCUS_22830 59074 58772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 59303 60478 gene locus_tag LOCUS_22840 59303 60478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 60533 60832 gene locus_tag LOCUS_22850 60533 60832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 60847 61617 gene locus_tag LOCUS_22860 60847 61617 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 protein_id gnl|my_center|LOCUS_22860 61657 62511 gene locus_tag LOCUS_22870 61657 62511 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_22870 62667 62867 gene locus_tag LOCUS_22880 62667 62867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 62974 63459 gene locus_tag LOCUS_22890 62974 63459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 64384 63719 gene locus_tag LOCUS_22900 64384 63719 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_22900 64536 66353 gene locus_tag LOCUS_22910 64536 66353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 66472 67821 gene locus_tag LOCUS_22920 66472 67821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 68996 67935 gene locus_tag LOCUS_22930 68996 67935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 69264 69830 gene locus_tag LOCUS_22940 gene plsY 69264 69830 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888654.1 protein_id gnl|my_center|LOCUS_22940 69886 71751 gene locus_tag LOCUS_22950 69886 71751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 71769 72161 gene locus_tag LOCUS_22960 71769 72161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 72257 72580 gene locus_tag LOCUS_22970 72257 72580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 72687 73310 gene locus_tag LOCUS_22980 72687 73310 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877104.1 protein_id gnl|my_center|LOCUS_22980 73479 73838 gene locus_tag LOCUS_22990 73479 73838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 75366 73951 gene locus_tag LOCUS_23000 75366 73951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 76570 75383 gene locus_tag LOCUS_23010 76570 75383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 77273 76686 gene locus_tag LOCUS_23020 gene scpB 77273 76686 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_23020 77327 78931 gene locus_tag LOCUS_23030 77327 78931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 79113 79982 gene locus_tag LOCUS_23040 79113 79982 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_23040 79979 80452 gene locus_tag LOCUS_23050 79979 80452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 80533 80892 gene locus_tag LOCUS_23060 80533 80892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 80920 81402 gene locus_tag LOCUS_23070 80920 81402 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958447.1 protein_id gnl|my_center|LOCUS_23070 81478 82680 gene locus_tag LOCUS_23080 81478 82680 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257139.1 protein_id gnl|my_center|LOCUS_23080 82701 83702 gene locus_tag LOCUS_23090 82701 83702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 83718 84278 gene locus_tag LOCUS_23100 gene rsmD 83718 84278 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_23100 84817 84314 gene locus_tag LOCUS_23110 84817 84314 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_23110 85787 84837 gene locus_tag LOCUS_23120 gene fba 85787 84837 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_23120 86055 86570 gene locus_tag LOCUS_23130 86055 86570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761769.1 protein_id gnl|my_center|LOCUS_23130 86608 87654 gene locus_tag LOCUS_23140 86608 87654 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_23140 88418 87720 gene locus_tag LOCUS_23150 88418 87720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 89709 88462 gene locus_tag LOCUS_23160 gene fabF 89709 88462 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_23160 90722 89706 gene locus_tag LOCUS_23170 gene plsX 90722 89706 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_23170 90782 90864 gene locus_tag LOCUS_t00240 90782 90864 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 90996 91364 gene locus_tag LOCUS_23180 90996 91364 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383771.1 protein_id gnl|my_center|LOCUS_23180 91520 91783 gene locus_tag LOCUS_23190 91520 91783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 92842 91964 gene locus_tag LOCUS_23200 92842 91964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 94065 92842 gene locus_tag LOCUS_23210 94065 92842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 94511 95338 gene locus_tag LOCUS_23220 94511 95338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327253.1 protein_id gnl|my_center|LOCUS_23220 95394 96572 gene locus_tag LOCUS_23230 95394 96572 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_23230 96672 97037 gene locus_tag LOCUS_23240 96672 97037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 97893 97144 gene locus_tag LOCUS_23250 97893 97144 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316326.1 protein_id gnl|my_center|LOCUS_23250 98758 97886 gene locus_tag LOCUS_23260 98758 97886 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067310.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence013 1200 547 gene locus_tag LOCUS_23270 1200 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1987 1211 gene locus_tag LOCUS_23280 1987 1211 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_23280 2296 2003 gene locus_tag LOCUS_23290 2296 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3278 2949 gene locus_tag LOCUS_23300 3278 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3480 3265 gene locus_tag LOCUS_23310 3480 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 4127 3585 gene locus_tag LOCUS_23320 4127 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 4952 5158 gene locus_tag LOCUS_23330 4952 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 5252 6877 gene locus_tag LOCUS_23340 gene tndX 5252 6877 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_23340 7691 6819 gene locus_tag LOCUS_23350 7691 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 8370 7750 gene locus_tag LOCUS_23360 8370 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 8673 8461 gene locus_tag LOCUS_23370 8673 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 9082 8840 gene locus_tag LOCUS_23380 9082 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 9393 9079 gene locus_tag LOCUS_23390 9393 9079 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_23390 10734 9673 gene locus_tag LOCUS_23400 gene glmD 10734 9673 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250706.1 protein_id gnl|my_center|LOCUS_23400 11737 10748 gene locus_tag LOCUS_23410 11737 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 12668 11721 gene locus_tag LOCUS_23420 12668 11721 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_23420 13197 12670 gene locus_tag LOCUS_23430 13197 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 13882 13214 gene locus_tag LOCUS_23440 13882 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 14232 13897 gene locus_tag LOCUS_23450 14232 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 15108 14254 gene locus_tag LOCUS_23460 15108 14254 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 protein_id gnl|my_center|LOCUS_23460 16052 15156 gene locus_tag LOCUS_23470 16052 15156 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331879.1 protein_id gnl|my_center|LOCUS_23470 17941 16268 gene locus_tag LOCUS_23480 17941 16268 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391605.1 protein_id gnl|my_center|LOCUS_23480 18832 18080 gene locus_tag LOCUS_23490 18832 18080 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437811.1 protein_id gnl|my_center|LOCUS_23490 19196 19495 gene locus_tag LOCUS_23500 19196 19495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 19492 19815 gene locus_tag LOCUS_23510 19492 19815 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_23510 20239 21258 gene locus_tag LOCUS_23520 20239 21258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 22169 21360 gene locus_tag LOCUS_23530 22169 21360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 22513 22166 gene locus_tag LOCUS_23540 22513 22166 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537237.1 protein_id gnl|my_center|LOCUS_23540 23373 22621 gene locus_tag LOCUS_23550 23373 22621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 24324 23404 gene locus_tag LOCUS_23560 24324 23404 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 protein_id gnl|my_center|LOCUS_23560 24449 25057 gene locus_tag LOCUS_23570 24449 25057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 25201 26304 gene locus_tag LOCUS_23580 25201 26304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 26322 29390 gene locus_tag LOCUS_23590 26322 29390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 29901 30962 gene locus_tag LOCUS_23600 gene pheS 29901 30962 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_23600 31045 31410 gene locus_tag LOCUS_23610 31045 31410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 31488 34046 gene locus_tag LOCUS_23620 gene pheT 31488 34046 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_23620 34140 34451 gene locus_tag LOCUS_23630 34140 34451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 35471 34509 gene locus_tag LOCUS_23640 35471 34509 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_23640 36138 35839 gene locus_tag LOCUS_23650 36138 35839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 36159 37217 gene locus_tag LOCUS_23660 36159 37217 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_23660 37270 38340 gene locus_tag LOCUS_23670 37270 38340 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060820.1 protein_id gnl|my_center|LOCUS_23670 38381 39379 gene locus_tag LOCUS_23680 38381 39379 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_23680 39388 40686 gene locus_tag LOCUS_23690 39388 40686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 40997 40695 gene locus_tag LOCUS_23700 40997 40695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 40878 41513 gene locus_tag LOCUS_23710 40878 41513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 41515 42852 gene locus_tag LOCUS_23720 41515 42852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 43902 42976 gene locus_tag LOCUS_23730 43902 42976 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_23730 44706 44065 gene locus_tag LOCUS_23740 44706 44065 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_23740 44920 49401 gene locus_tag LOCUS_23750 44920 49401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 49854 53285 gene locus_tag LOCUS_23760 gene ileS 49854 53285 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_23760 53548 53880 gene locus_tag LOCUS_23770 53548 53880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 53870 54898 gene locus_tag LOCUS_23780 53870 54898 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_23780 54972 55178 gene locus_tag LOCUS_23790 54972 55178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 55421 56668 gene locus_tag LOCUS_23800 55421 56668 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_23800 56743 57414 gene locus_tag LOCUS_23810 56743 57414 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_23810 57734 57495 gene locus_tag LOCUS_23820 57734 57495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 58403 58026 gene locus_tag LOCUS_23830 58403 58026 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_23830 59134 58448 gene locus_tag LOCUS_23840 gene nfi 59134 58448 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405504.1 protein_id gnl|my_center|LOCUS_23840 60073 59159 gene locus_tag LOCUS_23850 60073 59159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 60386 61834 gene locus_tag LOCUS_23860 60386 61834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 62347 61853 gene locus_tag LOCUS_23870 62347 61853 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405106.1 protein_id gnl|my_center|LOCUS_23870 62462 62974 gene locus_tag LOCUS_23880 62462 62974 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_23880 63794 63039 gene locus_tag LOCUS_23890 63794 63039 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421595.1 protein_id gnl|my_center|LOCUS_23890 65332 63899 gene locus_tag LOCUS_23900 65332 63899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 66263 65322 gene locus_tag LOCUS_23910 66263 65322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257461.1 protein_id gnl|my_center|LOCUS_23910 67215 66412 gene locus_tag LOCUS_23920 gene lgt 67215 66412 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_23920 67902 67273 gene locus_tag LOCUS_23930 67902 67273 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_23930 70175 67980 gene locus_tag LOCUS_23940 70175 67980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 71243 70302 gene locus_tag LOCUS_23950 71243 70302 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_23950 71627 71301 gene locus_tag LOCUS_23960 71627 71301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 72210 71722 gene locus_tag LOCUS_23970 72210 71722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 72385 72179 gene locus_tag LOCUS_23980 72385 72179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 72359 73081 gene locus_tag LOCUS_23990 72359 73081 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_23990 73279 73746 gene locus_tag LOCUS_24000 gene greA 73279 73746 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257112.1 protein_id gnl|my_center|LOCUS_24000 73895 75415 gene locus_tag LOCUS_24010 gene lysS 73895 75415 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_24010 76140 75469 gene locus_tag LOCUS_24020 76140 75469 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_24020 78577 76292 gene locus_tag LOCUS_24030 78577 76292 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_24030 79832 78675 gene locus_tag LOCUS_24040 gene dnaN 79832 78675 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_24040 80187 79930 gene locus_tag LOCUS_24050 80187 79930 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257693.1 protein_id gnl|my_center|LOCUS_24050 80777 80400 gene locus_tag LOCUS_24060 80777 80400 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788296.1 protein_id gnl|my_center|LOCUS_24060 82672 80807 gene locus_tag LOCUS_24070 gene uvrC 82672 80807 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_24070 82882 84438 gene locus_tag LOCUS_24080 82882 84438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 84482 86155 gene locus_tag LOCUS_24090 84482 86155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 86225 87508 gene locus_tag LOCUS_24100 86225 87508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 87537 89012 gene locus_tag LOCUS_24110 87537 89012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 89215 89403 gene locus_tag LOCUS_24120 89215 89403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 89433 89816 gene locus_tag LOCUS_24130 89433 89816 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_24130 89820 91079 gene locus_tag LOCUS_24140 89820 91079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 91082 91732 gene locus_tag LOCUS_24150 91082 91732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 91850 92230 gene locus_tag LOCUS_24160 91850 92230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 92477 93481 gene locus_tag LOCUS_24170 92477 93481 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079997.1 protein_id gnl|my_center|LOCUS_24170 93526 94896 gene locus_tag LOCUS_24180 93526 94896 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_24180 95354 94893 gene locus_tag LOCUS_24190 95354 94893 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_24190 96080 95445 gene locus_tag LOCUS_24200 96080 95445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence014 528 1865 gene locus_tag LOCUS_24210 528 1865 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_24210 2012 3034 gene locus_tag LOCUS_24220 gene gap 2012 3034 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_24220 3118 4314 gene locus_tag LOCUS_24230 3118 4314 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_24230 4605 6425 gene locus_tag LOCUS_24240 4605 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 6434 7195 gene locus_tag LOCUS_24250 gene tpiA 6434 7195 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_24250 7233 7994 gene locus_tag LOCUS_24260 7233 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 8646 8020 gene locus_tag LOCUS_24270 gene upp 8646 8020 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_24270 8768 9793 gene locus_tag LOCUS_24280 gene ruvB 8768 9793 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258937.1 protein_id gnl|my_center|LOCUS_24280 9905 10933 gene locus_tag LOCUS_24290 gene queA 9905 10933 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_24290 11193 13760 gene locus_tag LOCUS_24300 11193 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 13818 14264 gene locus_tag LOCUS_24310 13818 14264 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_24310 14257 15747 gene locus_tag LOCUS_24320 14257 15747 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188253.1 protein_id gnl|my_center|LOCUS_24320 16074 16625 gene locus_tag LOCUS_24330 16074 16625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 16636 18219 gene locus_tag LOCUS_24340 16636 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 18232 19038 gene locus_tag LOCUS_24350 18232 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 19073 19906 gene locus_tag LOCUS_24360 19073 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 19924 20937 gene locus_tag LOCUS_24370 gene coxB 19924 20937 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220059.1 protein_id gnl|my_center|LOCUS_24370 21068 22927 gene locus_tag LOCUS_24380 gene ctaD 21068 22927 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_24380 22992 23192 gene locus_tag LOCUS_24390 22992 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 23213 23791 gene locus_tag LOCUS_24400 23213 23791 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_24400 23824 24264 gene locus_tag LOCUS_24410 23824 24264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 24261 24869 gene locus_tag LOCUS_24420 24261 24869 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_24420 24866 25396 gene locus_tag LOCUS_24430 24866 25396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 25422 26162 gene locus_tag LOCUS_24440 25422 26162 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256115.1 protein_id gnl|my_center|LOCUS_24440 26159 27535 gene locus_tag LOCUS_24450 26159 27535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 28019 27618 gene locus_tag LOCUS_24460 gene msrB 28019 27618 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_24460 28240 28830 gene locus_tag LOCUS_24470 28240 28830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 28863 30629 gene locus_tag LOCUS_24480 28863 30629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_24480 30626 32479 gene locus_tag LOCUS_24490 30626 32479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257581.1 protein_id gnl|my_center|LOCUS_24490 32658 33518 gene locus_tag LOCUS_24500 32658 33518 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175852.1 protein_id gnl|my_center|LOCUS_24500 34277 33621 gene locus_tag LOCUS_24510 34277 33621 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877520.1 protein_id gnl|my_center|LOCUS_24510 35041 34292 gene locus_tag LOCUS_24520 35041 34292 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392825.1 protein_id gnl|my_center|LOCUS_24520 35310 35936 gene locus_tag LOCUS_24530 35310 35936 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811852.1 protein_id gnl|my_center|LOCUS_24530 35933 36733 gene locus_tag LOCUS_24540 35933 36733 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393605.1 protein_id gnl|my_center|LOCUS_24540 36856 37479 gene locus_tag LOCUS_24550 36856 37479 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877520.1 protein_id gnl|my_center|LOCUS_24550 37490 38758 gene locus_tag LOCUS_24560 37490 38758 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461347.1 protein_id gnl|my_center|LOCUS_24560 38855 40681 gene locus_tag LOCUS_24570 38855 40681 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393602.1 protein_id gnl|my_center|LOCUS_24570 41392 40772 gene locus_tag LOCUS_24580 41392 40772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 41639 41866 gene locus_tag LOCUS_24590 41639 41866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 41870 42532 gene locus_tag LOCUS_24600 41870 42532 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257634.1 protein_id gnl|my_center|LOCUS_24600 43625 42615 gene locus_tag LOCUS_24610 43625 42615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 45630 43735 gene locus_tag LOCUS_24620 45630 43735 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_24620 46067 45627 gene locus_tag LOCUS_24630 46067 45627 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_24630 46471 46070 gene locus_tag LOCUS_24640 46471 46070 CDS product cytochrome b subunit of the bc complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942627.1 protein_id gnl|my_center|LOCUS_24640 47533 46520 gene locus_tag LOCUS_24650 47533 46520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 48463 47813 gene locus_tag LOCUS_24660 48463 47813 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_24660 49049 48555 gene locus_tag LOCUS_24670 49049 48555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 49589 49113 gene locus_tag LOCUS_24680 49589 49113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 51164 49674 gene locus_tag LOCUS_24690 51164 49674 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_24690 52189 51164 gene locus_tag LOCUS_24700 52189 51164 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_24700 52665 52192 gene locus_tag LOCUS_24710 52665 52192 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_24710 54802 52766 gene locus_tag LOCUS_24720 gene hdrA 54802 52766 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_24720 55733 54867 gene locus_tag LOCUS_24730 55733 54867 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_24730 56026 55730 gene locus_tag LOCUS_24740 56026 55730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 56716 56303 gene locus_tag LOCUS_24750 56716 56303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 57863 56766 gene locus_tag LOCUS_24760 57863 56766 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_24760 59865 57856 gene locus_tag LOCUS_24770 59865 57856 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941439.1 protein_id gnl|my_center|LOCUS_24770 61887 59884 gene locus_tag LOCUS_24780 61887 59884 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_24780 62849 61902 gene locus_tag LOCUS_24790 62849 61902 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_24790 63630 62863 gene locus_tag LOCUS_24800 63630 62863 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_24800 64954 63749 gene locus_tag LOCUS_24810 64954 63749 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_24810 65572 66693 gene locus_tag LOCUS_24820 65572 66693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 69470 66792 gene locus_tag LOCUS_24830 69470 66792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 70883 70602 gene locus_tag LOCUS_24840 70883 70602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 71607 70996 gene locus_tag LOCUS_24850 71607 70996 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_24850 72577 71663 gene locus_tag LOCUS_24860 72577 71663 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_24860 74345 72609 gene locus_tag LOCUS_24870 74345 72609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 75163 74396 gene locus_tag LOCUS_24880 75163 74396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_24880 75998 75174 gene locus_tag LOCUS_24890 75998 75174 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098166.1 protein_id gnl|my_center|LOCUS_24890 77741 76059 gene locus_tag LOCUS_24900 77741 76059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 78191 77766 gene locus_tag LOCUS_24910 78191 77766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 78348 79025 gene locus_tag LOCUS_24920 78348 79025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 79653 79069 gene locus_tag LOCUS_24930 79653 79069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 79738 80373 gene locus_tag LOCUS_24940 79738 80373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 80847 80437 gene locus_tag LOCUS_24950 80847 80437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 81670 80963 gene locus_tag LOCUS_24960 81670 80963 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933646.1 protein_id gnl|my_center|LOCUS_24960 82529 81741 gene locus_tag LOCUS_24970 82529 81741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941880.1 protein_id gnl|my_center|LOCUS_24970 83015 82560 gene locus_tag LOCUS_24980 gene smpB 83015 82560 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence015 1518 199 gene locus_tag LOCUS_24990 1518 199 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259130.1 protein_id gnl|my_center|LOCUS_24990 4532 1518 gene locus_tag LOCUS_25000 4532 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 7529 4551 gene locus_tag LOCUS_25010 7529 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 8009 8932 gene locus_tag LOCUS_25020 gene nadC 8009 8932 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840153.1 protein_id gnl|my_center|LOCUS_25020 8999 10030 gene locus_tag LOCUS_25030 gene nadA 8999 10030 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_25030 10034 11662 gene locus_tag LOCUS_25040 gene nadB 10034 11662 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_25040 13228 11711 gene locus_tag LOCUS_25050 gene glpK 13228 11711 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_25050 14497 13262 gene locus_tag LOCUS_25060 14497 13262 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385781.1 protein_id gnl|my_center|LOCUS_25060 15298 14534 gene locus_tag LOCUS_25070 15298 14534 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_25070 16533 15295 gene locus_tag LOCUS_25080 gene mrfB 16533 15295 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_25080 20019 16555 gene locus_tag LOCUS_25090 20019 16555 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957290.1 protein_id gnl|my_center|LOCUS_25090 20194 20955 gene locus_tag LOCUS_25100 gene xth 20194 20955 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_25100 22997 20952 gene locus_tag LOCUS_25110 22997 20952 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_25110 23197 23742 gene locus_tag LOCUS_25120 23197 23742 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_25120 23820 25073 gene locus_tag LOCUS_25130 23820 25073 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_25130 25128 25634 gene locus_tag LOCUS_25140 25128 25634 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_25140 25668 27041 gene locus_tag LOCUS_25150 25668 27041 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529380.1 protein_id gnl|my_center|LOCUS_25150 27660 27043 gene locus_tag LOCUS_25160 27660 27043 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_25160 29375 27657 gene locus_tag LOCUS_25170 29375 27657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 29749 30105 gene locus_tag LOCUS_25180 gene ndhC 29749 30105 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_25180 30193 31398 gene locus_tag LOCUS_25190 gene nuoH 30193 31398 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_25190 31435 31941 gene locus_tag LOCUS_25200 31435 31941 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_25200 32033 32341 gene locus_tag LOCUS_25210 gene nuoK 32033 32341 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_25210 32473 34653 gene locus_tag LOCUS_25220 gene nuoL 32473 34653 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257848.1 protein_id gnl|my_center|LOCUS_25220 34669 36237 gene locus_tag LOCUS_25230 34669 36237 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_25230 36288 37778 gene locus_tag LOCUS_25240 36288 37778 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_25240 37778 39232 gene locus_tag LOCUS_25250 37778 39232 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_25250 39360 39674 gene locus_tag LOCUS_25260 39360 39674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 39667 40743 gene locus_tag LOCUS_25270 gene atpB 39667 40743 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_25270 40781 41023 gene locus_tag LOCUS_25280 40781 41023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 41037 41774 gene locus_tag LOCUS_25290 41037 41774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 42073 43503 gene locus_tag LOCUS_25300 42073 43503 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_25300 43611 44207 gene locus_tag LOCUS_25310 43611 44207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 44465 44390 gene locus_tag LOCUS_t00250 44465 44390 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44641 45393 gene locus_tag LOCUS_25320 44641 45393 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113651.1 protein_id gnl|my_center|LOCUS_25320 45403 45894 gene locus_tag LOCUS_25330 gene ruvC 45403 45894 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_25330 45904 47160 gene locus_tag LOCUS_25340 45904 47160 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_25340 47178 47753 gene locus_tag LOCUS_25350 gene ruvA 47178 47753 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_25350 47806 48657 gene locus_tag LOCUS_25360 gene proC 47806 48657 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_25360 48858 49139 gene locus_tag LOCUS_25370 48858 49139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 49225 50886 gene locus_tag LOCUS_25380 gene atpA 49225 50886 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082064.1 protein_id gnl|my_center|LOCUS_25380 50971 51864 gene locus_tag LOCUS_25390 50971 51864 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_25390 51914 53308 gene locus_tag LOCUS_25400 gene atpD 51914 53308 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_25400 53310 53765 gene locus_tag LOCUS_25410 53310 53765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 53772 54785 gene locus_tag LOCUS_25420 53772 54785 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575569.1 protein_id gnl|my_center|LOCUS_25420 55514 54894 gene locus_tag LOCUS_25430 55514 54894 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_25430 55768 57033 gene locus_tag LOCUS_25440 gene obgE 55768 57033 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257169.1 protein_id gnl|my_center|LOCUS_25440 57035 57640 gene locus_tag LOCUS_25450 gene nadD 57035 57640 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_25450 59910 57619 gene locus_tag LOCUS_25460 59910 57619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 60035 60304 gene locus_tag LOCUS_25470 60035 60304 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967020.1 protein_id gnl|my_center|LOCUS_25470 60354 60818 gene locus_tag LOCUS_25480 60354 60818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 62090 60828 gene locus_tag LOCUS_25490 62090 60828 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 protein_id gnl|my_center|LOCUS_25490 63165 62194 gene locus_tag LOCUS_25500 63165 62194 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861644.1 protein_id gnl|my_center|LOCUS_25500 64309 63176 gene locus_tag LOCUS_25510 64309 63176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 65761 64394 gene locus_tag LOCUS_25520 65761 64394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 66620 65871 gene locus_tag LOCUS_25530 66620 65871 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256946.1 protein_id gnl|my_center|LOCUS_25530 67742 66621 gene locus_tag LOCUS_25540 67742 66621 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259193.1 protein_id gnl|my_center|LOCUS_25540 67965 68039 gene locus_tag LOCUS_t00260 67965 68039 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 68706 68395 gene locus_tag LOCUS_25550 68706 68395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 69221 70384 gene locus_tag LOCUS_25560 69221 70384 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_25560 70986 71351 gene locus_tag LOCUS_25570 70986 71351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 71429 74158 gene locus_tag LOCUS_25580 71429 74158 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_25580 74390 74641 gene locus_tag LOCUS_25590 74390 74641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 74694 75626 gene locus_tag LOCUS_25600 74694 75626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 75769 76035 gene locus_tag LOCUS_25610 75769 76035 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_25610 76108 76320 gene locus_tag LOCUS_25620 76108 76320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence016 <1 1579 gene locus_tag LOCUS_25630 <1 1579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064307.1:BMP family ABC transporter substrate-binding protein 1738 3285 gene locus_tag LOCUS_25640 1738 3285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_25640 3282 4403 gene locus_tag LOCUS_25650 3282 4403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_25650 4396 5271 gene locus_tag LOCUS_25660 4396 5271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_25660 5423 5872 gene locus_tag LOCUS_25670 5423 5872 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_25670 6157 7713 gene locus_tag LOCUS_25680 6157 7713 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_25680 7740 8057 gene locus_tag LOCUS_25690 7740 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 8145 8591 gene locus_tag LOCUS_25700 8145 8591 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868008.1 protein_id gnl|my_center|LOCUS_25700 8599 9726 gene locus_tag LOCUS_25710 8599 9726 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_25710 9760 10641 gene locus_tag LOCUS_25720 9760 10641 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_25720 10704 11429 gene locus_tag LOCUS_25730 10704 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 11602 12858 gene locus_tag LOCUS_25740 11602 12858 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_25740 12922 15687 gene locus_tag LOCUS_25750 12922 15687 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_25750 15970 16404 gene locus_tag LOCUS_25760 15970 16404 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598099.1 protein_id gnl|my_center|LOCUS_25760 16408 17448 gene locus_tag LOCUS_25770 16408 17448 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_25770 19429 17474 gene locus_tag LOCUS_25780 19429 17474 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_25780 20756 19533 gene locus_tag LOCUS_25790 20756 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 21749 20781 gene locus_tag LOCUS_25800 21749 20781 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 protein_id gnl|my_center|LOCUS_25800 23253 21898 gene locus_tag LOCUS_25810 23253 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 24470 23250 gene locus_tag LOCUS_25820 24470 23250 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227876.1 protein_id gnl|my_center|LOCUS_25820 25124 24747 gene locus_tag LOCUS_25830 25124 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 26027 25131 gene locus_tag LOCUS_25840 26027 25131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 26860 26360 gene locus_tag LOCUS_25850 26860 26360 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_25850 27577 26894 gene locus_tag LOCUS_25860 27577 26894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 27781 29565 gene locus_tag LOCUS_25870 27781 29565 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_25870 30022 29573 gene locus_tag LOCUS_25880 30022 29573 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729724.1 protein_id gnl|my_center|LOCUS_25880 30330 31460 gene locus_tag LOCUS_25890 30330 31460 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 protein_id gnl|my_center|LOCUS_25890 31890 31504 gene locus_tag LOCUS_25900 31890 31504 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_25900 32120 31887 gene locus_tag LOCUS_25910 32120 31887 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_25910 32479 32285 gene locus_tag LOCUS_25920 32479 32285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 33852 32506 gene locus_tag LOCUS_25930 33852 32506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 36498 33940 gene locus_tag LOCUS_25940 36498 33940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 37871 36573 gene locus_tag LOCUS_25950 37871 36573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 39400 37952 gene locus_tag LOCUS_25960 39400 37952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 39873 39397 gene locus_tag LOCUS_25970 39873 39397 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_25970 41271 40336 gene locus_tag LOCUS_25980 41271 40336 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_25980 41892 41308 gene locus_tag LOCUS_25990 41892 41308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 43198 41957 gene locus_tag LOCUS_26000 43198 41957 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 protein_id gnl|my_center|LOCUS_26000 43281 44129 gene locus_tag LOCUS_26010 43281 44129 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_26010 44227 45000 gene locus_tag LOCUS_26020 44227 45000 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703481.1 protein_id gnl|my_center|LOCUS_26020 45184 45870 gene locus_tag LOCUS_26030 gene sfsA 45184 45870 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391969.1 protein_id gnl|my_center|LOCUS_26030 45908 48010 gene locus_tag LOCUS_26040 45908 48010 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_26040 48128 49195 gene locus_tag LOCUS_26050 48128 49195 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259751.1 protein_id gnl|my_center|LOCUS_26050 49264 49773 gene locus_tag LOCUS_26060 49264 49773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 49905 51596 gene locus_tag LOCUS_26070 49905 51596 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530062.1 protein_id gnl|my_center|LOCUS_26070 51990 51784 gene locus_tag LOCUS_26080 51990 51784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 53458 52094 gene locus_tag LOCUS_26090 53458 52094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 54416 53472 gene locus_tag LOCUS_26100 54416 53472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_26100 55473 54424 gene locus_tag LOCUS_26110 55473 54424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966542.1 protein_id gnl|my_center|LOCUS_26110 56706 55573 gene locus_tag LOCUS_26120 56706 55573 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_26120 57659 56715 gene locus_tag LOCUS_26130 57659 56715 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393401.1 protein_id gnl|my_center|LOCUS_26130 57996 57724 gene locus_tag LOCUS_26140 57996 57724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 58521 58081 gene locus_tag LOCUS_26150 58521 58081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 59446 58508 gene locus_tag LOCUS_26160 gene nadE 59446 58508 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081153.1 protein_id gnl|my_center|LOCUS_26160 60067 59468 gene locus_tag LOCUS_26170 60067 59468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence017 925 392 gene locus_tag LOCUS_26180 925 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2827 1040 gene locus_tag LOCUS_26190 gene cydC 2827 1040 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_26190 4625 2880 gene locus_tag LOCUS_26200 4625 2880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_26200 5382 4615 gene locus_tag LOCUS_26210 5382 4615 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728387.1 protein_id gnl|my_center|LOCUS_26210 6223 5360 gene locus_tag LOCUS_26220 6223 5360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_26220 7205 6195 gene locus_tag LOCUS_26230 7205 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 7807 7481 gene locus_tag LOCUS_26240 7807 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 9147 7843 gene locus_tag LOCUS_26250 9147 7843 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258451.1 protein_id gnl|my_center|LOCUS_26250 10391 9201 gene locus_tag LOCUS_26260 10391 9201 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_26260 10810 10388 gene locus_tag LOCUS_26270 10810 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 11650 10832 gene locus_tag LOCUS_26280 gene thiX 11650 10832 CDS product HMP/thiamine ABC transporter permease ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245037.1 protein_id gnl|my_center|LOCUS_26280 13377 11650 gene locus_tag LOCUS_26290 13377 11650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_26290 14089 13379 gene locus_tag LOCUS_26300 14089 13379 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171729.1 protein_id gnl|my_center|LOCUS_26300 17934 14209 gene locus_tag LOCUS_26310 17934 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 18553 17948 gene locus_tag LOCUS_26320 18553 17948 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804793.1 protein_id gnl|my_center|LOCUS_26320 19098 18568 gene locus_tag LOCUS_26330 19098 18568 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 protein_id gnl|my_center|LOCUS_26330 19536 19165 gene locus_tag LOCUS_26340 19536 19165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 20306 19602 gene locus_tag LOCUS_26350 20306 19602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 22496 20430 gene locus_tag LOCUS_26360 gene feoB 22496 20430 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583918.1 protein_id gnl|my_center|LOCUS_26360 22723 22493 gene locus_tag LOCUS_26370 22723 22493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 23474 22752 gene locus_tag LOCUS_26380 23474 22752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 23919 23497 gene locus_tag LOCUS_26390 23919 23497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 24755 23937 gene locus_tag LOCUS_26400 24755 23937 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 protein_id gnl|my_center|LOCUS_26400 25194 24784 gene locus_tag LOCUS_26410 25194 24784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 25506 25198 gene locus_tag LOCUS_26420 25506 25198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 25847 25503 gene locus_tag LOCUS_26430 25847 25503 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258341.1 protein_id gnl|my_center|LOCUS_26430 25987 25844 gene locus_tag LOCUS_26440 25987 25844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 26495 26136 gene locus_tag LOCUS_26450 26495 26136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 27354 26695 gene locus_tag LOCUS_26460 27354 26695 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286616.1 protein_id gnl|my_center|LOCUS_26460 27857 27630 gene locus_tag LOCUS_26470 27857 27630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 28776 28087 gene locus_tag LOCUS_26480 28776 28087 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286616.1 protein_id gnl|my_center|LOCUS_26480 29259 29068 gene locus_tag LOCUS_26490 29259 29068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 29517 30074 gene locus_tag LOCUS_26500 29517 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 30130 30933 gene locus_tag LOCUS_26510 30130 30933 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813120.1 protein_id gnl|my_center|LOCUS_26510 32470 31076 gene locus_tag LOCUS_26520 32470 31076 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_26520 33703 32489 gene locus_tag LOCUS_26530 33703 32489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 34830 33703 gene locus_tag LOCUS_26540 34830 33703 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258428.1 protein_id gnl|my_center|LOCUS_26540 35520 34882 gene locus_tag LOCUS_26550 35520 34882 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_26550 36295 35549 gene locus_tag LOCUS_26560 gene cobJ 36295 35549 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461546.1 protein_id gnl|my_center|LOCUS_26560 38142 36292 gene locus_tag LOCUS_26570 38142 36292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 39233 38439 gene locus_tag LOCUS_26580 39233 38439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 40077 41672 gene locus_tag LOCUS_26590 40077 41672 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_26590 41756 42730 gene locus_tag LOCUS_26600 gene nikB 41756 42730 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389931.1 protein_id gnl|my_center|LOCUS_26600 42727 43629 gene locus_tag LOCUS_26610 42727 43629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_26610 43622 45331 gene locus_tag LOCUS_26620 43622 45331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_26620 47375 45507 gene locus_tag LOCUS_26630 47375 45507 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812409.1 protein_id gnl|my_center|LOCUS_26630 48345 47368 gene locus_tag LOCUS_26640 48345 47368 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461434.1 protein_id gnl|my_center|LOCUS_26640 48950 48459 gene locus_tag LOCUS_26650 48950 48459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 52733 48993 gene locus_tag LOCUS_26660 gene bchH 52733 48993 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272597.1 protein_id gnl|my_center|LOCUS_26660 53539 52730 gene locus_tag LOCUS_26670 53539 52730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020502619.1 protein_id gnl|my_center|LOCUS_26670 54553 53543 gene locus_tag LOCUS_26680 54553 53543 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 protein_id gnl|my_center|LOCUS_26680 55586 54546 gene locus_tag LOCUS_26690 55586 54546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156774516.1 protein_id gnl|my_center|LOCUS_26690 56705 55914 gene locus_tag LOCUS_26700 56705 55914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 protein_id gnl|my_center|LOCUS_26700 57747 56698 gene locus_tag LOCUS_26710 57747 56698 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 protein_id gnl|my_center|LOCUS_26710 58789 57749 gene locus_tag LOCUS_26720 58789 57749 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723333.1 protein_id gnl|my_center|LOCUS_26720 <59925 59244 gene locus_tag LOCUS_26730 <59925 59244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258143.1:MBL fold metallo-hydrolase >Feature sequence018 2282 1224 gene locus_tag LOCUS_26740 2282 1224 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_26740 3839 2301 gene locus_tag LOCUS_26750 3839 2301 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_26750 4762 3965 gene locus_tag LOCUS_26760 gene pcaD 4762 3965 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976279.1 protein_id gnl|my_center|LOCUS_26760 5165 4830 gene locus_tag LOCUS_26770 5165 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 5995 5579 gene locus_tag LOCUS_26780 5995 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 7260 5998 gene locus_tag LOCUS_26790 7260 5998 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_26790 8852 7302 gene locus_tag LOCUS_26800 8852 7302 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_26800 9833 8955 gene locus_tag LOCUS_26810 9833 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 10924 9920 gene locus_tag LOCUS_26820 10924 9920 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_26820 11707 10946 gene locus_tag LOCUS_26830 11707 10946 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_26830 11921 11712 gene locus_tag LOCUS_26840 11921 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 15252 12019 gene locus_tag LOCUS_26850 15252 12019 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015902.1 protein_id gnl|my_center|LOCUS_26850 15861 15424 gene locus_tag LOCUS_26860 15861 15424 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_26860 16038 22169 gene locus_tag LOCUS_26870 16038 22169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 22411 24045 gene locus_tag LOCUS_26880 22411 24045 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_26880 25374 24046 gene locus_tag LOCUS_26890 25374 24046 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259659.1 protein_id gnl|my_center|LOCUS_26890 26113 25487 gene locus_tag LOCUS_26900 26113 25487 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142403.1 protein_id gnl|my_center|LOCUS_26900 27230 26181 gene locus_tag LOCUS_26910 27230 26181 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678705.1 protein_id gnl|my_center|LOCUS_26910 28565 27429 gene locus_tag LOCUS_26920 28565 27429 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887673.1 protein_id gnl|my_center|LOCUS_26920 28735 30453 gene locus_tag LOCUS_26930 28735 30453 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_26930 30596 31738 gene locus_tag LOCUS_26940 30596 31738 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_26940 31895 33112 gene locus_tag LOCUS_26950 31895 33112 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_26950 33183 34835 gene locus_tag LOCUS_26960 gene pckA 33183 34835 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_26960 36299 34968 gene locus_tag LOCUS_26970 gene hflX 36299 34968 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_26970 37477 36284 gene locus_tag LOCUS_26980 37477 36284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 38569 37625 gene locus_tag LOCUS_26990 38569 37625 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_26990 39993 38647 gene locus_tag LOCUS_27000 gene trmFO 39993 38647 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213003.1 protein_id gnl|my_center|LOCUS_27000 40145 41566 gene locus_tag LOCUS_27010 gene rpoN 40145 41566 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809059.1 protein_id gnl|my_center|LOCUS_27010 41568 43565 gene locus_tag LOCUS_27020 41568 43565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 43562 44725 gene locus_tag LOCUS_27030 43562 44725 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 protein_id gnl|my_center|LOCUS_27030 44892 45071 gene locus_tag LOCUS_27040 44892 45071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 45382 47808 gene locus_tag LOCUS_27050 gene mrfA 45382 47808 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_27050 48139 47918 gene locus_tag LOCUS_27060 48139 47918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 48624 48160 gene locus_tag LOCUS_27070 48624 48160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 49880 48621 gene locus_tag LOCUS_27080 49880 48621 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_27080 52086 49915 gene locus_tag LOCUS_27090 52086 49915 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_27090 52705 52223 gene locus_tag LOCUS_27100 52705 52223 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_27100 52945 53943 gene locus_tag LOCUS_27110 52945 53943 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_27110 54877 53954 gene locus_tag LOCUS_27120 54877 53954 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_27120 56211 54895 gene locus_tag LOCUS_27130 56211 54895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 56501 57169 gene locus_tag LOCUS_27140 56501 57169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 57333 57770 gene locus_tag LOCUS_27150 57333 57770 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922319.1 protein_id gnl|my_center|LOCUS_27150 57781 58188 gene locus_tag LOCUS_27160 57781 58188 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922983.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence019 103 915 gene locus_tag LOCUS_27170 103 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 976 1215 gene locus_tag LOCUS_27180 976 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1437 1730 gene locus_tag LOCUS_27190 1437 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1810 2652 gene locus_tag LOCUS_27200 1810 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2816 3547 gene locus_tag LOCUS_27210 2816 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3673 3981 gene locus_tag LOCUS_27220 3673 3981 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_27220 3992 4348 gene locus_tag LOCUS_27230 3992 4348 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_27230 4399 5193 gene locus_tag LOCUS_27240 4399 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 5190 5702 gene locus_tag LOCUS_27250 5190 5702 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221050.1 protein_id gnl|my_center|LOCUS_27250 7531 7355 gene locus_tag LOCUS_27260 7531 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 7584 7778 gene locus_tag LOCUS_27270 7584 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 7867 9216 gene locus_tag LOCUS_27280 7867 9216 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903324.1 protein_id gnl|my_center|LOCUS_27280 9237 10415 gene locus_tag LOCUS_27290 9237 10415 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337746.1 protein_id gnl|my_center|LOCUS_27290 10525 10863 gene locus_tag LOCUS_27300 10525 10863 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390829.1 protein_id gnl|my_center|LOCUS_27300 10856 11173 gene locus_tag LOCUS_27310 10856 11173 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994576.1 protein_id gnl|my_center|LOCUS_27310 11443 11691 gene locus_tag LOCUS_27320 11443 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 11735 12634 gene locus_tag LOCUS_27330 gene eamA 11735 12634 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987753.1 protein_id gnl|my_center|LOCUS_27330 12682 12963 gene locus_tag LOCUS_27340 12682 12963 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_27340 12981 13286 gene locus_tag LOCUS_27350 12981 13286 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_27350 13447 14073 gene locus_tag LOCUS_27360 13447 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 14640 15266 gene locus_tag LOCUS_27370 14640 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 15276 15497 gene locus_tag LOCUS_27380 15276 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 15674 17041 gene locus_tag LOCUS_27390 15674 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 17998 18306 gene locus_tag LOCUS_27400 17998 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 18328 18624 gene locus_tag LOCUS_27410 18328 18624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 18706 18903 gene locus_tag LOCUS_27420 18706 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 18896 19120 gene locus_tag LOCUS_27430 18896 19120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 19149 19526 gene locus_tag LOCUS_27440 19149 19526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 19507 20739 gene locus_tag LOCUS_27450 19507 20739 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169948.1 protein_id gnl|my_center|LOCUS_27450 21013 22473 gene locus_tag LOCUS_27460 21013 22473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 22477 22926 gene locus_tag LOCUS_27470 22477 22926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 22923 23123 gene locus_tag LOCUS_27480 22923 23123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 23634 23846 gene locus_tag LOCUS_27490 23634 23846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 23883 24170 gene locus_tag LOCUS_27500 23883 24170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 25179 24706 gene locus_tag LOCUS_27510 25179 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 25438 25184 gene locus_tag LOCUS_27520 25438 25184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 26011 27852 gene locus_tag LOCUS_27530 26011 27852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 27865 28332 gene locus_tag LOCUS_27540 27865 28332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 28401 29249 gene locus_tag LOCUS_27550 28401 29249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 29246 29704 gene locus_tag LOCUS_27560 29246 29704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 29714 29911 gene locus_tag LOCUS_27570 29714 29911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 29898 30668 gene locus_tag LOCUS_27580 29898 30668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 30906 31373 gene locus_tag LOCUS_27590 30906 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 31380 31715 gene locus_tag LOCUS_27600 31380 31715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 31715 32008 gene locus_tag LOCUS_27610 31715 32008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 32008 34668 gene locus_tag LOCUS_27620 32008 34668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 34695 36236 gene locus_tag LOCUS_27630 34695 36236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 36238 36630 gene locus_tag LOCUS_27640 36238 36630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 36631 37122 gene locus_tag LOCUS_27650 36631 37122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 37138 37677 gene locus_tag LOCUS_27660 37138 37677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 37688 38206 gene locus_tag LOCUS_27670 37688 38206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 38208 40832 gene locus_tag LOCUS_27680 38208 40832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 40845 41168 gene locus_tag LOCUS_27690 40845 41168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 43311 42733 gene locus_tag LOCUS_27700 43311 42733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 43831 43325 gene locus_tag LOCUS_27710 43831 43325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 44051 43818 gene locus_tag LOCUS_27720 44051 43818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 44257 44051 gene locus_tag LOCUS_27730 44257 44051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 44720 44250 gene locus_tag LOCUS_27740 44720 44250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 45715 44759 gene locus_tag LOCUS_27750 45715 44759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 46228 45935 gene locus_tag LOCUS_27760 46228 45935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 46392 46225 gene locus_tag LOCUS_27770 46392 46225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 46852 46658 gene locus_tag LOCUS_27780 46852 46658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 47244 47429 gene locus_tag LOCUS_27790 47244 47429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 47592 47401 gene locus_tag LOCUS_27800 47592 47401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 47692 47868 gene locus_tag LOCUS_27810 47692 47868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 47900 48724 gene locus_tag LOCUS_27820 47900 48724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 49007 51925 gene locus_tag LOCUS_27830 49007 51925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 52263 52152 gene locus_tag LOCUS_r00010 52263 52152 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence020 1962 514 gene locus_tag LOCUS_27840 gene mtgB 1962 514 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_27840 3691 2276 gene locus_tag LOCUS_27850 gene mtgB 3691 2276 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_27850 5165 3714 gene locus_tag LOCUS_27860 gene mttB 5165 3714 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_27860 5343 6128 gene locus_tag LOCUS_27870 5343 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 6140 7585 gene locus_tag LOCUS_27880 6140 7585 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461267.1 protein_id gnl|my_center|LOCUS_27880 7636 8622 gene locus_tag LOCUS_27890 7636 8622 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_27890 8835 9179 gene locus_tag LOCUS_27900 8835 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 10500 9220 gene locus_tag LOCUS_27910 10500 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 12256 10460 gene locus_tag LOCUS_27920 12256 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 12374 13402 gene locus_tag LOCUS_27930 12374 13402 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762008.1 protein_id gnl|my_center|LOCUS_27930 13850 13392 gene locus_tag LOCUS_27940 13850 13392 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481229.1 protein_id gnl|my_center|LOCUS_27940 14353 16038 gene locus_tag LOCUS_27950 14353 16038 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 protein_id gnl|my_center|LOCUS_27950 16113 17411 gene locus_tag LOCUS_27960 16113 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 17422 18345 gene locus_tag LOCUS_27970 17422 18345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967159.1 protein_id gnl|my_center|LOCUS_27970 18356 20461 gene locus_tag LOCUS_27980 18356 20461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_27980 20464 21120 gene locus_tag LOCUS_27990 20464 21120 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583302.1 protein_id gnl|my_center|LOCUS_27990 21241 22692 gene locus_tag LOCUS_28000 gene mttB 21241 22692 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_28000 22889 24352 gene locus_tag LOCUS_28010 22889 24352 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461267.1 protein_id gnl|my_center|LOCUS_28010 24384 25028 gene locus_tag LOCUS_28020 24384 25028 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020969.1 protein_id gnl|my_center|LOCUS_28020 26044 25115 gene locus_tag LOCUS_28030 26044 25115 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_28030 27534 26086 gene locus_tag LOCUS_28040 gene mttB 27534 26086 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P0C0W7 protein_id gnl|my_center|LOCUS_28040 28374 27601 gene locus_tag LOCUS_28050 28374 27601 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_28050 30995 28725 gene locus_tag LOCUS_28060 30995 28725 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_28060 32434 30992 gene locus_tag LOCUS_28070 gene mttB 32434 30992 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_28070 33113 32457 gene locus_tag LOCUS_28080 33113 32457 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089549.1 protein_id gnl|my_center|LOCUS_28080 33232 34473 gene locus_tag LOCUS_28090 33232 34473 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_28090 35757 34555 gene locus_tag LOCUS_28100 35757 34555 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_28100 36744 35827 gene locus_tag LOCUS_28110 36744 35827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 36962 38692 gene locus_tag LOCUS_28120 gene fdrA 36962 38692 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_28120 38791 40032 gene locus_tag LOCUS_28130 38791 40032 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869166.1 protein_id gnl|my_center|LOCUS_28130 40119 40484 gene locus_tag LOCUS_28140 40119 40484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 40555 42228 gene locus_tag LOCUS_28150 40555 42228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 42279 43130 gene locus_tag LOCUS_28160 42279 43130 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_28160 43221 44099 gene locus_tag LOCUS_28170 43221 44099 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_28170 44111 44587 gene locus_tag LOCUS_28180 44111 44587 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242999.1 protein_id gnl|my_center|LOCUS_28180 44599 46944 gene locus_tag LOCUS_28190 44599 46944 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929962.1 protein_id gnl|my_center|LOCUS_28190 46947 47405 gene locus_tag LOCUS_28200 46947 47405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence021 2007 202 gene locus_tag LOCUS_28210 2007 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3057 2011 gene locus_tag LOCUS_28220 3057 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 3770 3060 gene locus_tag LOCUS_28230 3770 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 4335 3826 gene locus_tag LOCUS_28240 4335 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 4588 4325 gene locus_tag LOCUS_28250 4588 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 5263 4631 gene locus_tag LOCUS_28260 5263 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 5769 5263 gene locus_tag LOCUS_28270 5769 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 6713 5790 gene locus_tag LOCUS_28280 6713 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 7575 6787 gene locus_tag LOCUS_28290 7575 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 7861 7568 gene locus_tag LOCUS_28300 7861 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 9719 7872 gene locus_tag LOCUS_28310 9719 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 10076 9723 gene locus_tag LOCUS_28320 10076 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 11501 10077 gene locus_tag LOCUS_28330 11501 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 12015 11833 gene locus_tag LOCUS_28340 12015 11833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 12185 12012 gene locus_tag LOCUS_28350 12185 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 13032 12343 gene locus_tag LOCUS_28360 13032 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 14023 13019 gene locus_tag LOCUS_28370 14023 13019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 14337 14125 gene locus_tag LOCUS_28380 14337 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 14591 14340 gene locus_tag LOCUS_28390 14591 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 15026 15226 gene locus_tag LOCUS_28400 15026 15226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 15795 15379 gene locus_tag LOCUS_28410 15795 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 16051 15830 gene locus_tag LOCUS_28420 16051 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 16245 16048 gene locus_tag LOCUS_28430 16245 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 16623 16249 gene locus_tag LOCUS_28440 16623 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 16960 16712 gene locus_tag LOCUS_28450 16960 16712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 16874 17116 gene locus_tag LOCUS_28460 16874 17116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 17384 17163 gene locus_tag LOCUS_28470 17384 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 17554 17381 gene locus_tag LOCUS_28480 17554 17381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 17895 17557 gene locus_tag LOCUS_28490 17895 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 18429 17989 gene locus_tag LOCUS_28500 18429 17989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 18577 20541 gene locus_tag LOCUS_28510 18577 20541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 20570 21268 gene locus_tag LOCUS_28520 20570 21268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 21631 22029 gene locus_tag LOCUS_28530 21631 22029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 22065 22322 gene locus_tag LOCUS_28540 22065 22322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 22322 22735 gene locus_tag LOCUS_28550 22322 22735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 22739 22948 gene locus_tag LOCUS_28560 22739 22948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 22938 23114 gene locus_tag LOCUS_28570 22938 23114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 23111 24217 gene locus_tag LOCUS_28580 23111 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 24304 24648 gene locus_tag LOCUS_28590 24304 24648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 24760 25554 gene locus_tag LOCUS_28600 24760 25554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 25626 26096 gene locus_tag LOCUS_28610 25626 26096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 26253 26726 gene locus_tag LOCUS_28620 26253 26726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 26723 26968 gene locus_tag LOCUS_28630 26723 26968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 26965 27249 gene locus_tag LOCUS_28640 26965 27249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 27249 27509 gene locus_tag LOCUS_28650 27249 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 27506 27988 gene locus_tag LOCUS_28660 27506 27988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 27988 28176 gene locus_tag LOCUS_28670 27988 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 28177 28323 gene locus_tag LOCUS_28680 28177 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 28320 29408 gene locus_tag LOCUS_28690 28320 29408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 29504 31072 gene locus_tag LOCUS_28700 29504 31072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 31072 32019 gene locus_tag LOCUS_28710 31072 32019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 32020 32418 gene locus_tag LOCUS_28720 32020 32418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 32415 32687 gene locus_tag LOCUS_28730 32415 32687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 32680 32913 gene locus_tag LOCUS_28740 32680 32913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 32910 33143 gene locus_tag LOCUS_28750 32910 33143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 33124 33645 gene locus_tag LOCUS_28760 33124 33645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 33850 34782 gene locus_tag LOCUS_28770 33850 34782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 34779 35885 gene locus_tag LOCUS_28780 34779 35885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 35882 36136 gene locus_tag LOCUS_28790 35882 36136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 36711 36241 gene locus_tag LOCUS_28800 36711 36241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 37426 36830 gene locus_tag LOCUS_28810 37426 36830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 37967 37551 gene locus_tag LOCUS_28820 37967 37551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 40606 38012 gene locus_tag LOCUS_28830 40606 38012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 42413 40593 gene locus_tag LOCUS_28840 42413 40593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 43267 42413 gene locus_tag LOCUS_28850 43267 42413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 43707 43264 gene locus_tag LOCUS_28860 43707 43264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 44006 43830 gene locus_tag LOCUS_28870 44006 43830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 44236 44006 gene locus_tag LOCUS_28880 44236 44006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 44667 44236 gene locus_tag LOCUS_28890 44667 44236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 46613 44667 gene locus_tag LOCUS_28900 46613 44667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 47053 46613 gene locus_tag LOCUS_28910 47053 46613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence022 1272 76 gene locus_tag LOCUS_28920 1272 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1626 2804 gene locus_tag LOCUS_28930 1626 2804 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258551.1 protein_id gnl|my_center|LOCUS_28930 5203 2993 gene locus_tag LOCUS_28940 5203 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 6030 6266 gene locus_tag LOCUS_28950 gene infA 6030 6266 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_28950 6292 7533 gene locus_tag LOCUS_28960 gene rpoD 6292 7533 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_28960 7701 8798 gene locus_tag LOCUS_28970 7701 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 8795 9652 gene locus_tag LOCUS_28980 8795 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 9795 10238 gene locus_tag LOCUS_28990 9795 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 10248 11942 gene locus_tag LOCUS_29000 10248 11942 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546477.1 protein_id gnl|my_center|LOCUS_29000 11962 12918 gene locus_tag LOCUS_29010 11962 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 12944 14368 gene locus_tag LOCUS_29020 12944 14368 CDS product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966677.1 protein_id gnl|my_center|LOCUS_29020 14491 15543 gene locus_tag LOCUS_29030 gene mtnA 14491 15543 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_29030 15567 16523 gene locus_tag LOCUS_29040 15567 16523 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_29040 16602 17858 gene locus_tag LOCUS_29050 gene ahcY 16602 17858 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_29050 18087 19409 gene locus_tag LOCUS_29060 18087 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 19541 20017 gene locus_tag LOCUS_29070 19541 20017 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 protein_id gnl|my_center|LOCUS_29070 20123 22075 gene locus_tag LOCUS_29080 20123 22075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_29080 22331 22137 gene locus_tag LOCUS_29090 22331 22137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 23515 22592 gene locus_tag LOCUS_29100 23515 22592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 24389 23508 gene locus_tag LOCUS_29110 24389 23508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 24885 24409 gene locus_tag LOCUS_29120 24885 24409 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_29120 25462 24932 gene locus_tag LOCUS_29130 25462 24932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 26509 25469 gene locus_tag LOCUS_29140 gene recA 26509 25469 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_29140 26986 26558 gene locus_tag LOCUS_29150 26986 26558 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444459.1 protein_id gnl|my_center|LOCUS_29150 28227 27046 gene locus_tag LOCUS_29160 28227 27046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 30218 28224 gene locus_tag LOCUS_29170 30218 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 31716 30337 gene locus_tag LOCUS_29180 gene rsmF 31716 30337 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_29180 32209 31817 gene locus_tag LOCUS_29190 32209 31817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 33168 32212 gene locus_tag LOCUS_29200 33168 32212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 34020 33178 gene locus_tag LOCUS_29210 34020 33178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 35027 34176 gene locus_tag LOCUS_29220 35027 34176 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_29220 36272 35196 gene locus_tag LOCUS_29230 36272 35196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 37156 36308 gene locus_tag LOCUS_29240 37156 36308 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_29240 37345 38886 gene locus_tag LOCUS_29250 gene murJ 37345 38886 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403539.1 protein_id gnl|my_center|LOCUS_29250 38912 39154 gene locus_tag LOCUS_29260 38912 39154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 39170 40333 gene locus_tag LOCUS_29270 39170 40333 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_29270 41677 40415 gene locus_tag LOCUS_29280 41677 40415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_29280 42927 41680 gene locus_tag LOCUS_29290 42927 41680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_29290 44482 42956 gene locus_tag LOCUS_29300 44482 42956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence023 446 1291 gene locus_tag LOCUS_29310 446 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1558 4254 gene locus_tag LOCUS_29320 1558 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 5161 4415 gene locus_tag LOCUS_29330 5161 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 5886 5179 gene locus_tag LOCUS_29340 5886 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 7319 6912 gene locus_tag LOCUS_29350 7319 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 10170 7303 gene locus_tag LOCUS_29360 gene mobF 10170 7303 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_29360 11062 10370 gene locus_tag LOCUS_29370 11062 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 12198 11005 gene locus_tag LOCUS_29380 12198 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 15516 13972 gene locus_tag LOCUS_29390 15516 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 16371 17909 gene locus_tag LOCUS_29400 16371 17909 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_29400 18097 19461 gene locus_tag LOCUS_29410 18097 19461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 19607 19987 gene locus_tag LOCUS_29420 19607 19987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 19996 20907 gene locus_tag LOCUS_29430 19996 20907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 20910 21557 gene locus_tag LOCUS_29440 20910 21557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 21712 22320 gene locus_tag LOCUS_29450 21712 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 22544 22317 gene locus_tag LOCUS_29460 22544 22317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 23748 23915 gene locus_tag LOCUS_29470 23748 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 24234 23845 gene locus_tag LOCUS_29480 24234 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 24419 25882 gene locus_tag LOCUS_29490 24419 25882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 26403 27758 gene locus_tag LOCUS_29500 26403 27758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 28241 28459 gene locus_tag LOCUS_29510 28241 28459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 28474 28866 gene locus_tag LOCUS_29520 28474 28866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 28987 29325 gene locus_tag LOCUS_29530 28987 29325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 29807 30973 gene locus_tag LOCUS_29540 29807 30973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29540 30979 32724 gene locus_tag LOCUS_29550 30979 32724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 32735 33562 gene locus_tag LOCUS_29560 32735 33562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 33660 34607 gene locus_tag LOCUS_29570 33660 34607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 34681 34989 gene locus_tag LOCUS_29580 34681 34989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 34989 35435 gene locus_tag LOCUS_29590 34989 35435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 35446 35925 gene locus_tag LOCUS_29600 35446 35925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 35922 36326 gene locus_tag LOCUS_29610 35922 36326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 36344 36778 gene locus_tag LOCUS_29620 36344 36778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 36797 37138 gene locus_tag LOCUS_29630 36797 37138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 37165 37476 gene locus_tag LOCUS_29640 37165 37476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 37445 38749 gene locus_tag LOCUS_29650 37445 38749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 38749 39591 gene locus_tag LOCUS_29660 38749 39591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 39597 40199 gene locus_tag LOCUS_29670 39597 40199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 40216 40683 gene locus_tag LOCUS_29680 40216 40683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 40965 40699 gene locus_tag LOCUS_29690 40965 40699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 41208 41017 gene locus_tag LOCUS_29700 41208 41017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 41365 41159 gene locus_tag LOCUS_29710 41365 41159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 41722 41649 gene locus_tag LOCUS_t00270 41722 41649 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41873 42046 gene locus_tag LOCUS_29720 41873 42046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 42161 43051 gene locus_tag LOCUS_29730 gene dapA 42161 43051 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_29730 <44034 43138 gene locus_tag LOCUS_29740 <44034 43138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246685.1:ATP-dependent RNA helicase CshA >Feature sequence024 138 365 gene locus_tag LOCUS_29750 138 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 436 1563 gene locus_tag LOCUS_29760 436 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 1644 2756 gene locus_tag LOCUS_29770 1644 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 4134 5333 gene locus_tag LOCUS_29780 4134 5333 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388691.1 protein_id gnl|my_center|LOCUS_29780 5359 6396 gene locus_tag LOCUS_29790 5359 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 6425 6850 gene locus_tag LOCUS_29800 6425 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 6834 7946 gene locus_tag LOCUS_29810 6834 7946 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_29810 7977 9173 gene locus_tag LOCUS_29820 7977 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 9175 10209 gene locus_tag LOCUS_29830 9175 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 10181 11365 gene locus_tag LOCUS_29840 10181 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 11369 12559 gene locus_tag LOCUS_29850 11369 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 13066 13683 gene locus_tag LOCUS_29860 13066 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 13670 15856 gene locus_tag LOCUS_29870 13670 15856 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_29870 15863 17095 gene locus_tag LOCUS_29880 15863 17095 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081170.1 protein_id gnl|my_center|LOCUS_29880 17288 18343 gene locus_tag LOCUS_29890 17288 18343 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041077419.1 protein_id gnl|my_center|LOCUS_29890 18385 19848 gene locus_tag LOCUS_29900 18385 19848 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_29900 19951 21078 gene locus_tag LOCUS_29910 19951 21078 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_29910 22465 21173 gene locus_tag LOCUS_29920 22465 21173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764944.1 protein_id gnl|my_center|LOCUS_29920 24310 22490 gene locus_tag LOCUS_29930 24310 22490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_29930 26134 24323 gene locus_tag LOCUS_29940 26134 24323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_29940 26774 26118 gene locus_tag LOCUS_29950 26774 26118 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255949.1 protein_id gnl|my_center|LOCUS_29950 26957 26885 gene locus_tag LOCUS_t00280 26957 26885 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 28266 26977 gene locus_tag LOCUS_29960 gene hisS 28266 26977 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_29960 28668 28321 gene locus_tag LOCUS_29970 28668 28321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 28878 29621 gene locus_tag LOCUS_29980 28878 29621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 29889 30452 gene locus_tag LOCUS_29990 29889 30452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 30501 31100 gene locus_tag LOCUS_30000 gene plsY 30501 31100 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258974.1 protein_id gnl|my_center|LOCUS_30000 31127 31612 gene locus_tag LOCUS_30010 31127 31612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 31612 32478 gene locus_tag LOCUS_30020 gene speB 31612 32478 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_30020 32550 33227 gene locus_tag LOCUS_30030 32550 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 33253 33756 gene locus_tag LOCUS_30040 33253 33756 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_30040 33774 34268 gene locus_tag LOCUS_30050 gene dinB 33774 34268 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234141.1 protein_id gnl|my_center|LOCUS_30050 34285 34746 gene locus_tag LOCUS_30060 34285 34746 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_30060 34783 35463 gene locus_tag LOCUS_30070 34783 35463 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30070 36916 35576 gene locus_tag LOCUS_30080 36916 35576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 38093 37005 gene locus_tag LOCUS_30090 38093 37005 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259474.1 protein_id gnl|my_center|LOCUS_30090 39706 38096 gene locus_tag LOCUS_30100 39706 38096 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259473.1 protein_id gnl|my_center|LOCUS_30100 40426 39716 gene locus_tag LOCUS_30110 40426 39716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_30110 41223 40438 gene locus_tag LOCUS_30120 41223 40438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_30120 <42820 41344 gene locus_tag LOCUS_30130 <42820 41344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259470.1:substrate-binding domain-containing protein >Feature sequence025 356 1816 gene locus_tag LOCUS_30140 gene mttB 356 1816 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_30140 1838 2476 gene locus_tag LOCUS_30150 1838 2476 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_30150 2494 3192 gene locus_tag LOCUS_30160 2494 3192 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_30160 3247 4749 gene locus_tag LOCUS_30170 gene mtgB 3247 4749 CDS product glycine betaine--corrinoid protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816521.1 protein_id gnl|my_center|LOCUS_30170 4929 6932 gene locus_tag LOCUS_30180 4929 6932 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271940.1 protein_id gnl|my_center|LOCUS_30180 7078 8661 gene locus_tag LOCUS_30190 7078 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 8677 9603 gene locus_tag LOCUS_30200 8677 9603 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964363.1 protein_id gnl|my_center|LOCUS_30200 10622 9762 gene locus_tag LOCUS_30210 10622 9762 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020913.1 protein_id gnl|my_center|LOCUS_30210 12345 10594 gene locus_tag LOCUS_30220 12345 10594 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460552.1 protein_id gnl|my_center|LOCUS_30220 12641 13651 gene locus_tag LOCUS_30230 12641 13651 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_30230 13877 15370 gene locus_tag LOCUS_30240 13877 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 15442 16335 gene locus_tag LOCUS_30250 15442 16335 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969762.1 protein_id gnl|my_center|LOCUS_30250 16355 17200 gene locus_tag LOCUS_30260 gene araQ 16355 17200 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_30260 17217 19670 gene locus_tag LOCUS_30270 17217 19670 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_30270 19680 21029 gene locus_tag LOCUS_30280 19680 21029 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_30280 21049 23367 gene locus_tag LOCUS_30290 21049 23367 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_30290 23497 24663 gene locus_tag LOCUS_30300 gene xylA 23497 24663 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_30300 24703 25605 gene locus_tag LOCUS_30310 24703 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_30310 25602 27089 gene locus_tag LOCUS_30320 gene xylB 25602 27089 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_30320 27416 27577 gene locus_tag LOCUS_30330 27416 27577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 28272 28108 gene locus_tag LOCUS_30340 28272 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 28484 30070 gene locus_tag LOCUS_30350 28484 30070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_30350 30190 31119 gene locus_tag LOCUS_30360 30190 31119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_30360 31120 32007 gene locus_tag LOCUS_30370 31120 32007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_30370 32019 33368 gene locus_tag LOCUS_30380 32019 33368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 33369 34568 gene locus_tag LOCUS_30390 33369 34568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 34789 35487 gene locus_tag LOCUS_30400 34789 35487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 35480 37246 gene locus_tag LOCUS_30410 35480 37246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 37259 38011 gene locus_tag LOCUS_30420 37259 38011 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064405.1 protein_id gnl|my_center|LOCUS_30420 38025 39014 gene locus_tag LOCUS_30430 38025 39014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_30430 39011 40006 gene locus_tag LOCUS_30440 39011 40006 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence026 1409 1930 gene locus_tag LOCUS_30450 1409 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 2037 1964 gene locus_tag LOCUS_t00290 2037 1964 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2112 2040 gene locus_tag LOCUS_t00300 2112 2040 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2330 2728 gene locus_tag LOCUS_30460 2330 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 2841 4073 gene locus_tag LOCUS_30470 2841 4073 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_30470 4178 5122 gene locus_tag LOCUS_30480 gene lipA 4178 5122 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_30480 5196 6167 gene locus_tag LOCUS_30490 5196 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 6168 8054 gene locus_tag LOCUS_30500 6168 8054 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399994.1 protein_id gnl|my_center|LOCUS_30500 8629 8069 gene locus_tag LOCUS_30510 8629 8069 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064460030.1 protein_id gnl|my_center|LOCUS_30510 8716 9687 gene locus_tag LOCUS_30520 8716 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 11246 9804 gene locus_tag LOCUS_30530 11246 9804 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258761.1 protein_id gnl|my_center|LOCUS_30530 12812 11286 gene locus_tag LOCUS_30540 12812 11286 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_30540 14960 12840 gene locus_tag LOCUS_30550 gene nuoL 14960 12840 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_30550 15338 15036 gene locus_tag LOCUS_30560 gene nuoK 15338 15036 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_30560 15879 15358 gene locus_tag LOCUS_30570 15879 15358 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_30570 16440 15913 gene locus_tag LOCUS_30580 gene nuoI 16440 15913 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_30580 17457 16456 gene locus_tag LOCUS_30590 gene nuoH 17457 16456 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258755.1 protein_id gnl|my_center|LOCUS_30590 19907 17478 gene locus_tag LOCUS_30600 gene nuoG 19907 17478 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_30600 21198 19951 gene locus_tag LOCUS_30610 gene nuoF 21198 19951 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909320.1 protein_id gnl|my_center|LOCUS_30610 21698 21198 gene locus_tag LOCUS_30620 21698 21198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 22933 21695 gene locus_tag LOCUS_30630 gene nuoD 22933 21695 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_30630 23510 22998 gene locus_tag LOCUS_30640 23510 22998 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258750.1 protein_id gnl|my_center|LOCUS_30640 24012 23530 gene locus_tag LOCUS_30650 24012 23530 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_30650 24374 24003 gene locus_tag LOCUS_30660 gene ndhC 24374 24003 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_30660 24992 26287 gene locus_tag LOCUS_30670 24992 26287 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922385.1 protein_id gnl|my_center|LOCUS_30670 26943 26302 gene locus_tag LOCUS_30680 26943 26302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 28215 27616 gene locus_tag LOCUS_30690 28215 27616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 29110 28259 gene locus_tag LOCUS_30700 29110 28259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 29273 30073 gene locus_tag LOCUS_30710 29273 30073 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948600.1 protein_id gnl|my_center|LOCUS_30710 30070 31035 gene locus_tag LOCUS_30720 30070 31035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 32007 31288 gene locus_tag LOCUS_30730 32007 31288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 32720 32115 gene locus_tag LOCUS_30740 gene recR 32720 32115 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_30740 33055 32726 gene locus_tag LOCUS_30750 33055 32726 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_30750 34643 33075 gene locus_tag LOCUS_30760 gene dnaX 34643 33075 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660459.1 protein_id gnl|my_center|LOCUS_30760 35196 34744 gene locus_tag LOCUS_30770 35196 34744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 36035 35319 gene locus_tag LOCUS_30780 36035 35319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 36149 36622 gene locus_tag LOCUS_30790 36149 36622 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256064.1 protein_id gnl|my_center|LOCUS_30790 36898 37734 gene locus_tag LOCUS_30800 36898 37734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 38479 38165 gene locus_tag LOCUS_30810 38479 38165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 >Feature sequence027 63 233 gene locus_tag LOCUS_30820 63 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 161 808 gene locus_tag LOCUS_30830 161 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30830 896 1297 gene locus_tag LOCUS_30840 896 1297 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880558.1 protein_id gnl|my_center|LOCUS_30840 1709 1320 gene locus_tag LOCUS_30850 1709 1320 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_30850 2013 1690 gene locus_tag LOCUS_30860 2013 1690 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_30860 2571 4301 gene locus_tag LOCUS_30870 2571 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 5580 4423 gene locus_tag LOCUS_30880 5580 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 6998 5787 gene locus_tag LOCUS_30890 6998 5787 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_30890 7845 7018 gene locus_tag LOCUS_30900 7845 7018 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_30900 10832 8031 gene locus_tag LOCUS_30910 10832 8031 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_30910 12707 10980 gene locus_tag LOCUS_30920 gene recN 12707 10980 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_30920 13260 12724 gene locus_tag LOCUS_30930 13260 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 14129 13257 gene locus_tag LOCUS_30940 14129 13257 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_30940 14611 14198 gene locus_tag LOCUS_30950 14611 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 15041 14805 gene locus_tag LOCUS_30960 15041 14805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 15702 15052 gene locus_tag LOCUS_30970 15702 15052 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_30970 16026 15706 gene locus_tag LOCUS_30980 16026 15706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 16504 16091 gene locus_tag LOCUS_30990 16504 16091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 17656 16670 gene locus_tag LOCUS_31000 17656 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 18598 17765 gene locus_tag LOCUS_31010 18598 17765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 19408 18677 gene locus_tag LOCUS_31020 19408 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 20793 19504 gene locus_tag LOCUS_31030 20793 19504 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_31030 20978 21991 gene locus_tag LOCUS_31040 20978 21991 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_31040 22132 23031 gene locus_tag LOCUS_31050 22132 23031 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_31050 23237 23851 gene locus_tag LOCUS_31060 23237 23851 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_31060 23832 24380 gene locus_tag LOCUS_31070 23832 24380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 24384 25463 gene locus_tag LOCUS_31080 24384 25463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 26210 25539 gene locus_tag LOCUS_31090 26210 25539 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_31090 27238 26318 gene locus_tag LOCUS_31100 gene era 27238 26318 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392137.1 protein_id gnl|my_center|LOCUS_31100 27686 31591 gene locus_tag LOCUS_31110 27686 31591 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256763.1 protein_id gnl|my_center|LOCUS_31110 31768 32181 gene locus_tag LOCUS_31120 gene rpsL 31768 32181 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_31120 32262 32729 gene locus_tag LOCUS_31130 gene rpsG 32262 32729 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583341.1 protein_id gnl|my_center|LOCUS_31130 32759 34837 gene locus_tag LOCUS_31140 gene fusA 32759 34837 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258228.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence028 170 841 gene locus_tag LOCUS_31150 170 841 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 protein_id gnl|my_center|LOCUS_31150 838 1155 gene locus_tag LOCUS_31160 838 1155 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392756.1 protein_id gnl|my_center|LOCUS_31160 2400 1177 gene locus_tag LOCUS_31170 gene recF 2400 1177 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_31170 2987 2475 gene locus_tag LOCUS_31180 gene def 2987 2475 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527648.1 protein_id gnl|my_center|LOCUS_31180 4658 3015 gene locus_tag LOCUS_31190 4658 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 4758 6218 gene locus_tag LOCUS_31200 4758 6218 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_31200 6858 6295 gene locus_tag LOCUS_31210 6858 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 7962 6904 gene locus_tag LOCUS_31220 7962 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 9749 7995 gene locus_tag LOCUS_31230 9749 7995 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_31230 10439 9759 gene locus_tag LOCUS_31240 10439 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 12820 10436 gene locus_tag LOCUS_31250 12820 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 13489 12824 gene locus_tag LOCUS_31260 13489 12824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256163.1 protein_id gnl|my_center|LOCUS_31260 14277 13486 gene locus_tag LOCUS_31270 14277 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 14586 14308 gene locus_tag LOCUS_31280 14586 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 14955 14731 gene locus_tag LOCUS_31290 14955 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 15104 16231 gene locus_tag LOCUS_31300 15104 16231 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_31300 16224 19793 gene locus_tag LOCUS_31310 16224 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 20007 20693 gene locus_tag LOCUS_31320 20007 20693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 20701 21996 gene locus_tag LOCUS_31330 20701 21996 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_31330 22056 23891 gene locus_tag LOCUS_31340 22056 23891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_31340 24339 23935 gene locus_tag LOCUS_31350 24339 23935 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_31350 25697 24411 gene locus_tag LOCUS_31360 25697 24411 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_31360 25781 27442 gene locus_tag LOCUS_31370 25781 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 27435 28328 gene locus_tag LOCUS_31380 27435 28328 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence029 260 1375 gene locus_tag LOCUS_31390 260 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 1372 2199 gene locus_tag LOCUS_31400 1372 2199 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172776.1 protein_id gnl|my_center|LOCUS_31400 2368 3432 gene locus_tag LOCUS_31410 gene galT 2368 3432 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 protein_id gnl|my_center|LOCUS_31410 3453 4589 gene locus_tag LOCUS_31420 gene galK 3453 4589 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_31420 4694 5464 gene locus_tag LOCUS_31430 4694 5464 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_31430 6971 5514 gene locus_tag LOCUS_31440 gene mazG 6971 5514 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226718.1 protein_id gnl|my_center|LOCUS_31440 7449 7057 gene locus_tag LOCUS_31450 gene rpsI 7449 7057 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907685.1 protein_id gnl|my_center|LOCUS_31450 7904 7452 gene locus_tag LOCUS_31460 gene rplM 7904 7452 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258261.1 protein_id gnl|my_center|LOCUS_31460 8725 7982 gene locus_tag LOCUS_31470 gene truA 8725 7982 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258260.1 protein_id gnl|my_center|LOCUS_31470 9186 8809 gene locus_tag LOCUS_31480 gene rplQ 9186 8809 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545032.1 protein_id gnl|my_center|LOCUS_31480 10170 9193 gene locus_tag LOCUS_31490 gene rpoA 10170 9193 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_31490 10871 10230 gene locus_tag LOCUS_31500 gene rpsD 10871 10230 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_31500 11308 10907 gene locus_tag LOCUS_31510 gene rpsK 11308 10907 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_31510 11742 11353 gene locus_tag LOCUS_31520 gene rpsM 11742 11353 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_31520 12725 11934 gene locus_tag LOCUS_31530 gene map 12725 11934 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_31530 13393 12728 gene locus_tag LOCUS_31540 13393 12728 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_31540 14760 13405 gene locus_tag LOCUS_31550 gene secY 14760 13405 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_31550 15228 14779 gene locus_tag LOCUS_31560 gene rplO 15228 14779 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567527.1 protein_id gnl|my_center|LOCUS_31560 15434 15237 gene locus_tag LOCUS_31570 gene rpmD 15434 15237 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081798.1 protein_id gnl|my_center|LOCUS_31570 15951 15439 gene locus_tag LOCUS_31580 gene rpsE 15951 15439 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_31580 16340 15972 gene locus_tag LOCUS_31590 gene rplR 16340 15972 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 protein_id gnl|my_center|LOCUS_31590 16888 16343 gene locus_tag LOCUS_31600 gene rplF 16888 16343 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966397.1 protein_id gnl|my_center|LOCUS_31600 17315 16902 gene locus_tag LOCUS_31610 gene rpsH 17315 16902 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_31610 18088 17522 gene locus_tag LOCUS_31620 gene rplE 18088 17522 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_31620 18410 18081 gene locus_tag LOCUS_31630 gene rplX 18410 18081 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_31630 18811 18440 gene locus_tag LOCUS_31640 gene rplN 18811 18440 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_31640 19089 18814 gene locus_tag LOCUS_31650 gene rpsQ 19089 18814 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869920.1 protein_id gnl|my_center|LOCUS_31650 19298 19086 gene locus_tag LOCUS_31660 gene rpmC 19298 19086 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_31660 19725 19300 gene locus_tag LOCUS_31670 gene rplP 19725 19300 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_31670 20455 19778 gene locus_tag LOCUS_31680 gene rpsC 20455 19778 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258237.1 protein_id gnl|my_center|LOCUS_31680 20823 20476 gene locus_tag LOCUS_31690 gene rplV 20823 20476 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_31690 21104 20829 gene locus_tag LOCUS_31700 gene rpsS 21104 20829 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583349.1 protein_id gnl|my_center|LOCUS_31700 21964 21122 gene locus_tag LOCUS_31710 gene rplB 21964 21122 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_31710 22272 21967 gene locus_tag LOCUS_31720 gene rplW 22272 21967 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_31720 22909 22280 gene locus_tag LOCUS_31730 gene rplD 22909 22280 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258232.1 protein_id gnl|my_center|LOCUS_31730 23558 22929 gene locus_tag LOCUS_31740 gene rplC 23558 22929 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_31740 24086 23778 gene locus_tag LOCUS_31750 gene rpsJ 24086 23778 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_31750 <25042 24092 gene locus_tag LOCUS_31760 <25042 24092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545401.1:elongation factor Tu >Feature sequence030 208 606 gene locus_tag LOCUS_31770 208 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1578 1042 gene locus_tag LOCUS_31780 1578 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 2833 1943 gene locus_tag LOCUS_31790 2833 1943 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_31790 3458 2877 gene locus_tag LOCUS_31800 3458 2877 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070432.1 protein_id gnl|my_center|LOCUS_31800 4598 3504 gene locus_tag LOCUS_31810 4598 3504 CDS product agmatine/peptidylarginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618851.1 protein_id gnl|my_center|LOCUS_31810 4722 5930 gene locus_tag LOCUS_31820 4722 5930 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 protein_id gnl|my_center|LOCUS_31820 6529 6092 gene locus_tag LOCUS_31830 6529 6092 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_31830 7709 6678 gene locus_tag LOCUS_31840 7709 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 8412 7843 gene locus_tag LOCUS_31850 8412 7843 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_31850 10508 8472 gene locus_tag LOCUS_31860 10508 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 12147 10489 gene locus_tag LOCUS_31870 12147 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 12534 12208 gene locus_tag LOCUS_31880 12534 12208 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_31880 13661 12582 gene locus_tag LOCUS_31890 13661 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 14115 13693 gene locus_tag LOCUS_31900 14115 13693 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_31900 15229 14132 gene locus_tag LOCUS_31910 15229 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 15978 15226 gene locus_tag LOCUS_31920 15978 15226 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_31920 16414 17775 gene locus_tag LOCUS_31930 16414 17775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 18270 17818 gene locus_tag LOCUS_31940 18270 17818 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_31940 18541 18251 gene locus_tag LOCUS_31950 18541 18251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 18798 19412 gene locus_tag LOCUS_31960 18798 19412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 19558 20184 gene locus_tag LOCUS_31970 19558 20184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 20378 21025 gene locus_tag LOCUS_31980 20378 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 21382 22575 gene locus_tag LOCUS_31990 gene nhaA 21382 22575 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 protein_id gnl|my_center|LOCUS_31990 22737 23063 gene locus_tag LOCUS_32000 22737 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083794109.1 protein_id gnl|my_center|LOCUS_32000 23051 23263 gene locus_tag LOCUS_32010 23051 23263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence031 213 545 gene locus_tag LOCUS_32020 213 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 570 1682 gene locus_tag LOCUS_32030 570 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 1698 3071 gene locus_tag LOCUS_32040 1698 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 3138 4613 gene locus_tag LOCUS_32050 3138 4613 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705356.1 protein_id gnl|my_center|LOCUS_32050 4660 5190 gene locus_tag LOCUS_32060 4660 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 5205 6935 gene locus_tag LOCUS_32070 5205 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 7211 9544 gene locus_tag LOCUS_32080 7211 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 10732 9644 gene locus_tag LOCUS_32090 10732 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 11513 10755 gene locus_tag LOCUS_32100 11513 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 12451 11519 gene locus_tag LOCUS_32110 12451 11519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 12905 12462 gene locus_tag LOCUS_32120 12905 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 13269 12907 gene locus_tag LOCUS_32130 13269 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 13762 13280 gene locus_tag LOCUS_32140 13762 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 14432 13773 gene locus_tag LOCUS_32150 14432 13773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 15878 15144 gene locus_tag LOCUS_32160 15878 15144 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230331.1 protein_id gnl|my_center|LOCUS_32160 17355 16024 gene locus_tag LOCUS_32170 17355 16024 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257217.1 protein_id gnl|my_center|LOCUS_32170 18347 17355 gene locus_tag LOCUS_32180 18347 17355 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_32180 19306 18344 gene locus_tag LOCUS_32190 19306 18344 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257219.1 protein_id gnl|my_center|LOCUS_32190 20383 19451 gene locus_tag LOCUS_32200 20383 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence032 <1 2077 gene locus_tag LOCUS_32210 <1 2077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063171486.1:VCBS domain-containing protein 3698 2424 gene locus_tag LOCUS_32220 3698 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 4363 3704 gene locus_tag LOCUS_32230 4363 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 4624 4941 gene locus_tag LOCUS_32240 4624 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 5572 4982 gene locus_tag LOCUS_32250 5572 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 6991 5705 gene locus_tag LOCUS_32260 6991 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 7880 7377 gene locus_tag LOCUS_32270 7880 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 8185 7976 gene locus_tag LOCUS_32280 8185 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 9020 8454 gene locus_tag LOCUS_32290 9020 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 9834 9544 gene locus_tag LOCUS_32300 9834 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 10489 10079 gene locus_tag LOCUS_32310 10489 10079 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087637.1 protein_id gnl|my_center|LOCUS_32310 12106 10970 gene locus_tag LOCUS_32320 12106 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 12742 12392 gene locus_tag LOCUS_32330 12742 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 13221 12766 gene locus_tag LOCUS_32340 13221 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 16970 13722 gene locus_tag LOCUS_32350 16970 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 17834 17073 gene locus_tag LOCUS_32360 17834 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 18120 17941 gene locus_tag LOCUS_32370 18120 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 18488 18168 gene locus_tag LOCUS_32380 18488 18168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence033 210 542 gene locus_tag LOCUS_32390 210 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 567 1679 gene locus_tag LOCUS_32400 567 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 1695 3068 gene locus_tag LOCUS_32410 1695 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 3133 4608 gene locus_tag LOCUS_32420 3133 4608 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705356.1 protein_id gnl|my_center|LOCUS_32420 4651 5184 gene locus_tag LOCUS_32430 4651 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 5265 6971 gene locus_tag LOCUS_32440 5265 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 7169 9580 gene locus_tag LOCUS_32450 7169 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 10725 9637 gene locus_tag LOCUS_32460 10725 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 11505 10747 gene locus_tag LOCUS_32470 11505 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 12442 11510 gene locus_tag LOCUS_32480 12442 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 12896 12453 gene locus_tag LOCUS_32490 12896 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 13260 12898 gene locus_tag LOCUS_32500 13260 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 13753 13271 gene locus_tag LOCUS_32510 13753 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 14561 13764 gene locus_tag LOCUS_32520 14561 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 14736 >15131 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccgcttggacgcggcataggtcttggagg >Feature sequence034 2088 1015 gene locus_tag LOCUS_32530 2088 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 3675 2095 gene locus_tag LOCUS_32540 3675 2095 CDS product glycoside hydrolase family 66 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108626.1 protein_id gnl|my_center|LOCUS_32540 4518 3679 gene locus_tag LOCUS_32550 4518 3679 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582772.1 protein_id gnl|my_center|LOCUS_32550 5437 4520 gene locus_tag LOCUS_32560 5437 4520 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_32560 6841 5525 gene locus_tag LOCUS_32570 6841 5525 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975877.1 protein_id gnl|my_center|LOCUS_32570 8165 6981 gene locus_tag LOCUS_32580 8165 6981 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528101.1 protein_id gnl|my_center|LOCUS_32580 8509 10659 gene locus_tag LOCUS_32590 gene nosZ 8509 10659 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_32590 10722 11378 gene locus_tag LOCUS_32600 10722 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 >Feature sequence035 670 1899 gene locus_tag LOCUS_32610 670 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 1983 2645 gene locus_tag LOCUS_32620 1983 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 2676 3962 gene locus_tag LOCUS_32630 gene mtaB 2676 3962 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_32630 4071 4415 gene locus_tag LOCUS_32640 4071 4415 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_32640 4435 5082 gene locus_tag LOCUS_32650 4435 5082 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_32650 5075 6319 gene locus_tag LOCUS_32660 5075 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 6622 6816 gene locus_tag LOCUS_32670 6622 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 6895 7476 gene locus_tag LOCUS_32680 6895 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 7661 8104 gene locus_tag LOCUS_32690 7661 8104 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392728.1 protein_id gnl|my_center|LOCUS_32690 8252 10282 gene locus_tag LOCUS_32700 8252 10282 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909087.1 protein_id gnl|my_center|LOCUS_32700 10292 10750 gene locus_tag LOCUS_32710 gene ybeY 10292 10750 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_32710 10784 11173 gene locus_tag LOCUS_32720 10784 11173 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888724.1 protein_id gnl|my_center|LOCUS_32720 11221 12078 gene locus_tag LOCUS_32730 11221 12078 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249125.1 protein_id gnl|my_center|LOCUS_32730 12112 12738 gene locus_tag LOCUS_32740 12112 12738 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_32740 >Feature sequence036 1528 488 gene locus_tag LOCUS_32750 1528 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 1629 2099 gene locus_tag LOCUS_32760 1629 2099 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_32760 2215 3342 gene locus_tag LOCUS_32770 2215 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 3752 3348 gene locus_tag LOCUS_32780 gene cdd 3752 3348 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_32780 5016 3742 gene locus_tag LOCUS_32790 5016 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 6407 5064 gene locus_tag LOCUS_32800 gene glmU 6407 5064 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 protein_id gnl|my_center|LOCUS_32800 6717 6645 gene locus_tag LOCUS_t00310 6717 6645 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7836 6781 gene locus_tag LOCUS_32810 7836 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 9009 8014 gene locus_tag LOCUS_32820 9009 8014 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082545.1 protein_id gnl|my_center|LOCUS_32820 9986 9009 gene locus_tag LOCUS_32830 9986 9009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250752.1 protein_id gnl|my_center|LOCUS_32830 10964 10014 gene locus_tag LOCUS_32840 10964 10014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966458.1 protein_id gnl|my_center|LOCUS_32840 12158 10995 gene locus_tag LOCUS_32850 12158 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence037 628 245 gene locus_tag LOCUS_32860 628 245 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_32860 3422 675 gene locus_tag LOCUS_32870 3422 675 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461688.1 protein_id gnl|my_center|LOCUS_32870 3943 3659 gene locus_tag LOCUS_32880 3943 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 5187 4195 gene locus_tag LOCUS_32890 5187 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 5905 5249 gene locus_tag LOCUS_32900 5905 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255961.1 protein_id gnl|my_center|LOCUS_32900 6156 6752 gene locus_tag LOCUS_32910 6156 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 7916 7185 gene locus_tag LOCUS_32920 7916 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228944.1 protein_id gnl|my_center|LOCUS_32920 8096 7944 gene locus_tag LOCUS_32930 8096 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 9197 8247 gene locus_tag LOCUS_32940 9197 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 protein_id gnl|my_center|LOCUS_32940 10615 9407 gene locus_tag LOCUS_32950 10615 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 10883 11251 gene locus_tag LOCUS_32960 10883 11251 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_32960 11276 11467 gene locus_tag LOCUS_32970 11276 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence038 269 81 gene locus_tag LOCUS_32980 269 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 830 291 gene locus_tag LOCUS_32990 830 291 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252838.1 protein_id gnl|my_center|LOCUS_32990 1464 1030 gene locus_tag LOCUS_33000 1464 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 2944 1712 gene locus_tag LOCUS_33010 2944 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 3701 2949 gene locus_tag LOCUS_33020 3701 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 4653 3721 gene locus_tag LOCUS_33030 4653 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 5190 4750 gene locus_tag LOCUS_33040 5190 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 5533 5267 gene locus_tag LOCUS_33050 5533 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 6094 5621 gene locus_tag LOCUS_33060 6094 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 6875 6078 gene locus_tag LOCUS_33070 6875 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 7353 6877 gene locus_tag LOCUS_33080 7353 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 9052 7415 gene locus_tag LOCUS_33090 9052 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 9633 10034 gene locus_tag LOCUS_33100 gene higA 9633 10034 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_33100 11197 10364 gene locus_tag LOCUS_33110 11197 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 >Feature sequence039 <1 889 gene locus_tag LOCUS_33120 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257896.1:Fic family protein 1395 2909 gene locus_tag LOCUS_33130 1395 2909 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_33130 2902 4140 gene locus_tag LOCUS_33140 2902 4140 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101621619.1 protein_id gnl|my_center|LOCUS_33140 4153 4728 gene locus_tag LOCUS_33150 4153 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 4792 5079 gene locus_tag LOCUS_33160 4792 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 5093 5755 gene locus_tag LOCUS_33170 5093 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 5777 8980 gene locus_tag LOCUS_33180 5777 8980 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_33180 8977 9699 gene locus_tag LOCUS_33190 8977 9699 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_33190 10022 10450 gene locus_tag LOCUS_33200 10022 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33200 >Feature sequence040 759 4 gene locus_tag LOCUS_33210 759 4 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566099.1 protein_id gnl|my_center|LOCUS_33210 1661 3442 gene locus_tag LOCUS_33220 gene ade 1661 3442 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_33220 3561 4706 gene locus_tag LOCUS_33230 3561 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 4830 6356 gene locus_tag LOCUS_33240 4830 6356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529888.1 protein_id gnl|my_center|LOCUS_33240 6353 7420 gene locus_tag LOCUS_33250 6353 7420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528957.1 protein_id gnl|my_center|LOCUS_33250 7410 8351 gene locus_tag LOCUS_33260 7410 8351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529890.1 protein_id gnl|my_center|LOCUS_33260 8365 9411 gene locus_tag LOCUS_33270 8365 9411 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808171.1 protein_id gnl|my_center|LOCUS_33270 >Feature sequence041 3042 232 gene locus_tag LOCUS_33280 3042 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 4675 3200 gene locus_tag LOCUS_33290 4675 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 5785 5027 gene locus_tag LOCUS_33300 5785 5027 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_33300 6121 5798 gene locus_tag LOCUS_33310 6121 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 7990 6227 gene locus_tag LOCUS_33320 7990 6227 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256788.1 protein_id gnl|my_center|LOCUS_33320 8042 8599 gene locus_tag LOCUS_33330 8042 8599 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence042 1044 1937 gene locus_tag LOCUS_33340 1044 1937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398415.1 protein_id gnl|my_center|LOCUS_33340 1928 2734 gene locus_tag LOCUS_33350 1928 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 2858 4000 gene locus_tag LOCUS_33360 2858 4000 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398422.1 protein_id gnl|my_center|LOCUS_33360 4066 5142 gene locus_tag LOCUS_33370 4066 5142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_33370 5241 6344 gene locus_tag LOCUS_33380 gene gbsB 5241 6344 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243227.1 protein_id gnl|my_center|LOCUS_33380 6382 7872 gene locus_tag LOCUS_33390 gene mttB 6382 7872 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P0C0W7 protein_id gnl|my_center|LOCUS_33390 >Feature sequence043 458 147 gene locus_tag LOCUS_33400 458 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 940 455 gene locus_tag LOCUS_33410 940 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 1250 978 gene locus_tag LOCUS_33420 1250 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 1543 1247 gene locus_tag LOCUS_33430 1543 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 1822 1631 gene locus_tag LOCUS_33440 1822 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 1947 2177 gene locus_tag LOCUS_33450 1947 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 2180 2638 gene locus_tag LOCUS_33460 2180 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3305 3502 gene locus_tag LOCUS_33470 3305 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 3499 3762 gene locus_tag LOCUS_33480 3499 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3759 4571 gene locus_tag LOCUS_33490 3759 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 4568 5044 gene locus_tag LOCUS_33500 4568 5044 CDS product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929790.1 protein_id gnl|my_center|LOCUS_33500 5055 5318 gene locus_tag LOCUS_33510 5055 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877351.1 protein_id gnl|my_center|LOCUS_33510 5355 6092 gene locus_tag LOCUS_33520 5355 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 6120 6389 gene locus_tag LOCUS_33530 6120 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 6393 6803 gene locus_tag LOCUS_33540 6393 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 6803 7099 gene locus_tag LOCUS_33550 6803 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 7099 7302 gene locus_tag LOCUS_33560 7099 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 7289 7675 gene locus_tag LOCUS_33570 7289 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence044 <1 1675 gene locus_tag LOCUS_33580 <1 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081252.1:ABC transporter substrate-binding protein 1876 2337 gene locus_tag LOCUS_33590 gene rnhA 1876 2337 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_33590 2484 2413 gene locus_tag LOCUS_t00320 2484 2413 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2627 2555 gene locus_tag LOCUS_t00330 2627 2555 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2738 2665 gene locus_tag LOCUS_t00340 2738 2665 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3112 4176 gene locus_tag LOCUS_33600 3112 4176 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_33600 4173 5564 gene locus_tag LOCUS_33610 gene cysS 4173 5564 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257711.1 protein_id gnl|my_center|LOCUS_33610 5574 6386 gene locus_tag LOCUS_33620 gene rlmB 5574 6386 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_33620 6547 6621 gene locus_tag LOCUS_t00350 6547 6621 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6689 6773 gene locus_tag LOCUS_t00360 6689 6773 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6833 6906 gene locus_tag LOCUS_t00370 6833 6906 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 517 152 gene locus_tag LOCUS_33630 517 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 920 708 gene locus_tag LOCUS_33640 920 708 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_33640 1218 2657 gene locus_tag LOCUS_33650 1218 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 2865 4871 gene locus_tag LOCUS_33660 2865 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 4959 5594 gene locus_tag LOCUS_33670 4959 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 5801 7090 gene locus_tag LOCUS_33680 5801 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence046 392 859 gene locus_tag LOCUS_33690 392 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 1539 982 gene locus_tag LOCUS_33700 1539 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 2064 3125 gene locus_tag LOCUS_33710 2064 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 4372 3212 gene locus_tag LOCUS_33720 4372 3212 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_33720 4580 6079 gene locus_tag LOCUS_33730 4580 6079 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 protein_id gnl|my_center|LOCUS_33730 6523 6209 gene locus_tag LOCUS_33740 6523 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence047 1119 331 gene locus_tag LOCUS_33750 1119 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 1121 1306 gene locus_tag LOCUS_33760 1121 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 1318 3642 gene locus_tag LOCUS_33770 1318 3642 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_33770 3639 5318 gene locus_tag LOCUS_33780 3639 5318 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_33780 5788 5369 gene locus_tag LOCUS_33790 5788 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence048 1850 1515 gene locus_tag LOCUS_33800 1850 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 2609 2046 gene locus_tag LOCUS_33810 2609 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 3672 2872 gene locus_tag LOCUS_33820 3672 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 3946 3749 gene locus_tag LOCUS_33830 3946 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 5160 4258 gene locus_tag LOCUS_33840 5160 4258 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence049 3446 3198 gene locus_tag LOCUS_33850 3446 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 <4549 3662 gene locus_tag LOCUS_33860 <4549 3662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085110.1:tricarballylate utilization 4Fe-4S protein TcuB >Feature sequence050 3162 538 gene locus_tag LOCUS_33870 3162 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 3722 3126 gene locus_tag LOCUS_33880 3722 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 >Feature sequence051 2969 399 gene locus_tag LOCUS_33890 2969 399 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 protein_id gnl|my_center|LOCUS_33890 3883 3038 gene locus_tag LOCUS_33900 3883 3038 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067159.1 protein_id gnl|my_center|LOCUS_33900 >Feature sequence052 419 715 gene locus_tag LOCUS_33910 419 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 850 2568 gene locus_tag LOCUS_33920 850 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 2586 4169 gene locus_tag LOCUS_33930 2586 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence053 253 639 gene locus_tag LOCUS_33940 253 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 991 1416 gene locus_tag LOCUS_33950 991 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 1595 2266 gene locus_tag LOCUS_33960 1595 2266 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257758.1 protein_id gnl|my_center|LOCUS_33960 2859 3818 gene locus_tag LOCUS_33970 2859 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 >Feature sequence054 43 162 gene locus_tag LOCUS_33980 43 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 694 1380 gene locus_tag LOCUS_33990 694 1380 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_33990 2279 1479 gene locus_tag LOCUS_34000 2279 1479 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence055 1580 558 gene locus_tag LOCUS_34010 1580 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 2008 1586 gene locus_tag LOCUS_34020 2008 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 2915 2019 gene locus_tag LOCUS_34030 2915 2019 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920871.1 protein_id gnl|my_center|LOCUS_34030 3689 3210 gene locus_tag LOCUS_34040 3689 3210 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868487.1 protein_id gnl|my_center|LOCUS_34040 >Feature sequence056 142 1185 gene locus_tag LOCUS_34050 142 1185 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680926.1 protein_id gnl|my_center|LOCUS_34050 1207 1689 gene locus_tag LOCUS_34060 1207 1689 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476683.1 protein_id gnl|my_center|LOCUS_34060 1781 2683 gene locus_tag LOCUS_34070 1781 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence057 1079 96 gene locus_tag LOCUS_34080 1079 96 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223063.1 protein_id gnl|my_center|LOCUS_34080 2380 1085 gene locus_tag LOCUS_34090 2380 1085 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089165.1 protein_id gnl|my_center|LOCUS_34090 3500 2400 gene locus_tag LOCUS_34100 3500 2400 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_34100 >Feature sequence058 129 977 gene locus_tag LOCUS_34110 129 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 2391 1429 gene locus_tag LOCUS_34120 2391 1429 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085560.1 protein_id gnl|my_center|LOCUS_34120 3334 2495 gene locus_tag LOCUS_34130 3334 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence059 975 307 gene locus_tag LOCUS_34140 975 307 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_34140 1094 1423 gene locus_tag LOCUS_34150 1094 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 1492 2259 gene locus_tag LOCUS_34160 gene arsM 1492 2259 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869251.1 protein_id gnl|my_center|LOCUS_34160 2869 3519 gene locus_tag LOCUS_34170 2869 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence060 925 185 gene locus_tag LOCUS_34180 925 185 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_34180 1522 953 gene locus_tag LOCUS_34190 1522 953 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_34190 2221 1574 gene locus_tag LOCUS_34200 2221 1574 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_34200 <3479 2229 gene locus_tag LOCUS_34210 <3479 2229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403748.1:AAA family ATPase >Feature sequence061 843 2123 gene locus_tag LOCUS_34220 843 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 2308 2871 gene locus_tag LOCUS_34230 2308 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 2897 3016 gene locus_tag LOCUS_34240 2897 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence062 364 1725 gene locus_tag LOCUS_34250 364 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 3019 1901 gene locus_tag LOCUS_34260 3019 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 >Feature sequence063 2855 447 gene locus_tag LOCUS_34270 2855 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence064 533 1324 gene locus_tag LOCUS_34280 533 1324 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225473.1 protein_id gnl|my_center|LOCUS_34280 1411 2622 gene locus_tag LOCUS_34290 1411 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 >Feature sequence065 1882 869 gene locus_tag LOCUS_34300 1882 869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370098.1 protein_id gnl|my_center|LOCUS_34300 <3039 2003 gene locus_tag LOCUS_34310 <3039 2003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139954.1:ABC transporter substrate-binding protein >Feature sequence066 978 88 gene locus_tag LOCUS_34320 978 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 1075 1761 gene locus_tag LOCUS_34330 1075 1761 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_34330 2399 1842 gene locus_tag LOCUS_34340 2399 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 <3001 2492 gene locus_tag LOCUS_34350 <3001 2492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257774.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence067 412 2073 gene locus_tag LOCUS_34360 412 2073 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_34360 2180 2761 gene locus_tag LOCUS_34370 gene rfbC 2180 2761 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence068 878 315 gene locus_tag LOCUS_34380 878 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 1500 1658 gene locus_tag LOCUS_34390 1500 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 1688 1894 gene locus_tag LOCUS_34400 1688 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 2401 2556 gene locus_tag LOCUS_34410 2401 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34410 >Feature sequence069 1426 155 gene locus_tag LOCUS_34420 1426 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 1761 1447 gene locus_tag LOCUS_34430 1761 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34430 2046 1777 gene locus_tag LOCUS_34440 2046 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 <2726 2119 gene locus_tag LOCUS_34450 <2726 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971781.1:Si-specific NAD(P)(+) transhydrogenase >Feature sequence070 556 134 gene locus_tag LOCUS_34460 556 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 1692 1171 gene locus_tag LOCUS_34470 1692 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 2192 1689 gene locus_tag LOCUS_34480 2192 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence071 1035 271 gene locus_tag LOCUS_34490 1035 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 2055 1330 gene locus_tag LOCUS_34500 2055 1330 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531970.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence072 200 775 gene locus_tag LOCUS_34510 200 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 1114 863 gene locus_tag LOCUS_34520 1114 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 1218 1742 gene locus_tag LOCUS_34530 1218 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence073 <1 1105 gene locus_tag LOCUS_34540 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226657.1:sensor histidine kinase 1102 1740 gene locus_tag LOCUS_34550 1102 1740 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_34550 1780 1962 gene locus_tag LOCUS_34560 1780 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 >Feature sequence074 97 1425 gene locus_tag LOCUS_34570 97 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 1511 1903 gene locus_tag LOCUS_34580 1511 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence075 <1 505 gene locus_tag LOCUS_34590 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392257.1:trypsin-like peptidase domain-containing protein 961 539 gene locus_tag LOCUS_34600 961 539 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972106.1 protein_id gnl|my_center|LOCUS_34600 1171 1443 gene locus_tag LOCUS_34610 1171 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 1927 1409 gene locus_tag LOCUS_34620 1927 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2297 2085 gene locus_tag LOCUS_34630 2297 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence076 459 1334 gene locus_tag LOCUS_34640 459 1334 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_34640 1354 1983 gene locus_tag LOCUS_34650 1354 1983 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence077 483 1043 gene locus_tag LOCUS_34660 483 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence078 1314 55 gene locus_tag LOCUS_34670 1314 55 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312858.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence079 <1 544 gene locus_tag LOCUS_34680 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461976.1:response regulator transcription factor 785 907 gene locus_tag LOCUS_34690 785 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 912 1286 gene locus_tag LOCUS_34700 912 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 1279 2184 gene locus_tag LOCUS_34710 1279 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence080 553 1065 gene locus_tag LOCUS_34720 553 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 1050 1706 gene locus_tag LOCUS_34730 1050 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence081 346 29 gene locus_tag LOCUS_34740 346 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 1170 478 gene locus_tag LOCUS_34750 1170 478 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869303.1 protein_id gnl|my_center|LOCUS_34750 1473 1628 gene locus_tag LOCUS_34760 1473 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 1860 2078 gene locus_tag LOCUS_34770 1860 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 >Feature sequence082 573 154 gene locus_tag LOCUS_34780 573 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34780 1063 1329 gene locus_tag LOCUS_34790 1063 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34790 1353 2027 gene locus_tag LOCUS_34800 1353 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34800 >Feature sequence083 539 1144 gene locus_tag LOCUS_34810 539 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence084 620 297 gene locus_tag LOCUS_34820 620 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 1552 635 gene locus_tag LOCUS_34830 1552 635 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107120.1 protein_id gnl|my_center|LOCUS_34830 1922 1572 gene locus_tag LOCUS_34840 1922 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence085 1081 1007 gene locus_tag LOCUS_t00380 1081 1007 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2087 1122 gene locus_tag LOCUS_34850 2087 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence086 <1 2044 gene locus_tag LOCUS_34860 <1 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein >Feature sequence087 2 1957 gene locus_tag LOCUS_34870 2 1957 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_34870 >Feature sequence088 188 931 gene locus_tag LOCUS_34880 188 931 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089821.1 protein_id gnl|my_center|LOCUS_34880 1005 1223 gene locus_tag LOCUS_34890 1005 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 1742 1344 gene locus_tag LOCUS_34900 1742 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 >Feature sequence089 95 334 gene locus_tag LOCUS_34910 95 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 1659 553 gene locus_tag LOCUS_34920 1659 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 2090 1764 gene locus_tag LOCUS_34930 2090 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 >Feature sequence090 <1 660 gene locus_tag LOCUS_34940 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930636.1:radical SAM protein 623 856 gene locus_tag LOCUS_34950 623 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 1563 895 gene locus_tag LOCUS_34960 1563 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 2056 1601 gene locus_tag LOCUS_34970 2056 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence091 1596 148 gene locus_tag LOCUS_34980 1596 148 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417851.1 protein_id gnl|my_center|LOCUS_34980 2000 1593 gene locus_tag LOCUS_34990 2000 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 >Feature sequence092 >Feature sequence093 >Feature sequence094 69 533 gene locus_tag LOCUS_35000 69 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 530 931 gene locus_tag LOCUS_35010 530 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 944 1372 gene locus_tag LOCUS_35020 944 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 1384 1725 gene locus_tag LOCUS_35030 1384 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 2018 1722 gene locus_tag LOCUS_35040 2018 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 >Feature sequence095 9 1100 gene locus_tag LOCUS_35050 9 1100 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023548.1 protein_id gnl|my_center|LOCUS_35050 >Feature sequence096 318 429 gene locus_tag LOCUS_r00020 318 429 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1071 508 gene locus_tag LOCUS_35060 1071 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence097 >Feature sequence098 74 1024 gene locus_tag LOCUS_35070 74 1024 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816295.1 protein_id gnl|my_center|LOCUS_35070 1017 1340 gene locus_tag LOCUS_35080 1017 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35080 >Feature sequence099 1614 109 gene locus_tag LOCUS_35090 gene xylB 1614 109 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence100 <1 1219 gene locus_tag LOCUS_35100 <1 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024310853.1:extracellular solute-binding protein >Feature sequence101 >Feature sequence102 848 531 gene locus_tag LOCUS_35110 848 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 1830 1390 gene locus_tag LOCUS_35120 1830 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence103 >Feature sequence104 366 737 gene locus_tag LOCUS_35130 366 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 >Feature sequence105 >Feature sequence106 >Feature sequence107 1635 1279 gene locus_tag LOCUS_35140 gene ndhC 1635 1279 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence108 1477 16 gene locus_tag LOCUS_r00030 1477 16 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence109 1536 709 gene locus_tag LOCUS_35150 1536 709 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_35150 >Feature sequence110 1 876 gene locus_tag LOCUS_35160 1 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 1698 901 gene locus_tag LOCUS_35170 1698 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 >Feature sequence111 164 586 gene locus_tag LOCUS_35180 164 586 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_35180 630 1565 gene locus_tag LOCUS_35190 630 1565 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598716.1 protein_id gnl|my_center|LOCUS_35190 >Feature sequence112 1256 306 gene locus_tag LOCUS_35200 gene phnF 1256 306 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_35200 1566 1237 gene locus_tag LOCUS_35210 1566 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 >Feature sequence113 >Feature sequence114 >Feature sequence115 <1 972 gene locus_tag LOCUS_35220 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966434.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence116 1083 364 gene locus_tag LOCUS_35230 1083 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 <1654 1098 gene locus_tag LOCUS_35240 <1654 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261998.1:bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA >Feature sequence117 >Feature sequence118 <1633 559 gene locus_tag LOCUS_35250 <1633 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257763.1:carboxypeptidase M32 >Feature sequence119 >Feature sequence120 405 31 gene locus_tag LOCUS_35260 405 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence121 1161 40 gene locus_tag LOCUS_35270 1161 40 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_35270 >Feature sequence122 94 1596 gene locus_tag LOCUS_35280 94 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence123 728 210 gene locus_tag LOCUS_35290 728 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 1328 753 gene locus_tag LOCUS_35300 1328 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence124 >Feature sequence125 927 223 gene locus_tag LOCUS_35310 927 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence126 <1555 158 gene locus_tag LOCUS_35320 <1555 158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289081.1:IS66-like element ISH10B family transposase >Feature sequence127 >Feature sequence128 >Feature sequence129 633 145 gene locus_tag LOCUS_35330 633 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence130 <1 530 gene locus_tag LOCUS_35340 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259175.1:aldehyde dehydrogenase family protein 785 549 gene locus_tag LOCUS_35350 785 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 738 1313 gene locus_tag LOCUS_35360 738 1313 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_35360 >Feature sequence131 >Feature sequence132 1329 499 gene locus_tag LOCUS_35370 1329 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence133 <1472 701 gene locus_tag LOCUS_35380 <1472 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244087.1:sugar ABC transporter permease >Feature sequence134 494 570 gene locus_tag LOCUS_t00390 494 570 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 898 973 gene locus_tag LOCUS_t00400 898 973 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 101 1183 gene locus_tag LOCUS_35390 101 1183 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328108.1 protein_id gnl|my_center|LOCUS_35390 >Feature sequence136 <1428 918 gene locus_tag LOCUS_35400 <1428 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258638.1:ABC transporter permease >Feature sequence137 1053 307 gene locus_tag LOCUS_35410 1053 307 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312430.1 protein_id gnl|my_center|LOCUS_35410 >Feature sequence138 1390 527 gene locus_tag LOCUS_35420 1390 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence139 1118 417 gene locus_tag LOCUS_35430 1118 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 1397 1311 gene locus_tag LOCUS_t00410 1397 1311 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence140 <1399 386 gene locus_tag LOCUS_35440 <1399 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462916.1:MFS transporter >Feature sequence141 >Feature sequence142 >Feature sequence143 520 113 gene locus_tag LOCUS_35450 520 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 <1386 799 gene locus_tag LOCUS_35460 <1386 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881239.1:tetratricopeptide repeat protein >Feature sequence144 >Feature sequence145 <1 951 gene locus_tag LOCUS_35470 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003408035.1:adenylate cyclase >Feature sequence146 >Feature sequence147 62 718 gene locus_tag LOCUS_35480 62 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 715 1074 gene locus_tag LOCUS_35490 715 1074 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence148 >Feature sequence149 79 234 gene locus_tag LOCUS_35500 79 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 319 513 gene locus_tag LOCUS_35510 319 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 516 686 gene locus_tag LOCUS_35520 516 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 >Feature sequence150 1095 106 gene locus_tag LOCUS_35530 gene fabK 1095 106 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_35530 >Feature sequence151 >Feature sequence152 674 534 gene locus_tag LOCUS_35540 674 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 799 671 gene locus_tag LOCUS_35550 799 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 1014 814 gene locus_tag LOCUS_35560 1014 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence153 1 627 gene locus_tag LOCUS_35570 1 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 719 988 gene locus_tag LOCUS_35580 719 988 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257693.1 protein_id gnl|my_center|LOCUS_35580 >Feature sequence154 280 606 gene locus_tag LOCUS_35590 280 606 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083575.1 protein_id gnl|my_center|LOCUS_35590 765 1034 gene locus_tag LOCUS_35600 765 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence155 1045 206 gene locus_tag LOCUS_35610 1045 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 >Feature sequence156 <1291 416 gene locus_tag LOCUS_35620 <1291 416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038419670.1:ATP-grasp fold amidoligase family protein >Feature sequence157 1 168 gene locus_tag LOCUS_35630 1 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence158 664 876 gene locus_tag LOCUS_35640 gene iscX 664 876 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142213.1 protein_id gnl|my_center|LOCUS_35640 >Feature sequence159 >Feature sequence160 989 87 gene locus_tag LOCUS_35650 989 87 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224665.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence161 <1259 249 gene locus_tag LOCUS_35660 <1259 249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584091.1:LacI family DNA-binding transcriptional regulator >Feature sequence162 <1257 583 gene locus_tag LOCUS_35670 <1257 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210266672.1:DEAD/DEAH box helicase >Feature sequence163 <1 535 gene locus_tag LOCUS_35680 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256788.1:histidine kinase 525 932 gene locus_tag LOCUS_35690 525 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence164 267 1211 gene locus_tag LOCUS_35700 267 1211 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence165 2 574 gene locus_tag LOCUS_35710 2 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence166 >Feature sequence167 550 623 gene locus_tag LOCUS_t00420 550 623 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 660 733 gene locus_tag LOCUS_t00430 660 733 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence168 <1 559 gene locus_tag LOCUS_35720 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932009.1:glycosyltransferase family 2 protein >Feature sequence169 >Feature sequence170 616 14 gene locus_tag LOCUS_35730 616 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35730 1098 640 gene locus_tag LOCUS_35740 1098 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 >Feature sequence171 <1 947 gene locus_tag LOCUS_35750 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942368.1:mechanosensitive ion channel family protein >Feature sequence172 >Feature sequence173 >Feature sequence174 >Feature sequence175 >Feature sequence176 <1140 540 gene locus_tag LOCUS_35760 <1140 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002285916.1:leucine--tRNA ligase >Feature sequence177 <1 879 gene locus_tag LOCUS_35770 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257170.1:peptidase S10 >Feature sequence178 >Feature sequence179 <1133 432 gene locus_tag LOCUS_35780 <1133 432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887052.1:heme exporter protein CcmB >Feature sequence180 >Feature sequence181 >Feature sequence182 >Feature sequence183 >Feature sequence184 >Feature sequence185 849 181 gene locus_tag LOCUS_35790 849 181 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082723.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence186 >Feature sequence187 201 653 gene locus_tag LOCUS_35800 201 653 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence188 1047 580 gene locus_tag LOCUS_35810 1047 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence189 >Feature sequence190 86 754 gene locus_tag LOCUS_35820 86 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35820 767 1030 gene locus_tag LOCUS_35830 767 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35830 >Feature sequence191 445 86 gene locus_tag LOCUS_35840 445 86 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_35840 798 454 gene locus_tag LOCUS_35850 798 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35850 >Feature sequence192 >Feature sequence193 532 687 gene locus_tag LOCUS_35860 532 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860