>Feature sequence001 952 38 gene locus_tag LOCUS_00010 952 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1464 1084 gene locus_tag LOCUS_00020 1464 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2188 1811 gene locus_tag LOCUS_00030 2188 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2653 2471 gene locus_tag LOCUS_00040 2653 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3317 2826 gene locus_tag LOCUS_00050 3317 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3520 4107 gene locus_tag LOCUS_00060 3520 4107 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_00060 4228 4968 gene locus_tag LOCUS_00070 4228 4968 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 protein_id gnl|my_center|LOCUS_00070 6017 5154 gene locus_tag LOCUS_00080 6017 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7211 6108 gene locus_tag LOCUS_00090 7211 6108 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_00090 7944 7252 gene locus_tag LOCUS_00100 7944 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9248 8055 gene locus_tag LOCUS_00110 9248 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9393 9929 gene locus_tag LOCUS_00120 9393 9929 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_00120 9926 11227 gene locus_tag LOCUS_00130 9926 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13904 11304 gene locus_tag LOCUS_00140 13904 11304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_00140 15226 14123 gene locus_tag LOCUS_00150 15226 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17160 15613 gene locus_tag LOCUS_00160 17160 15613 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_00160 17290 18534 gene locus_tag LOCUS_00170 17290 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19928 18627 gene locus_tag LOCUS_00180 19928 18627 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728405.1 protein_id gnl|my_center|LOCUS_00180 21435 20140 gene locus_tag LOCUS_00190 21435 20140 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036232.1 protein_id gnl|my_center|LOCUS_00190 22390 21575 gene locus_tag LOCUS_00200 22390 21575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23459 22575 gene locus_tag LOCUS_00210 23459 22575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25910 23985 gene locus_tag LOCUS_00220 25910 23985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27795 25921 gene locus_tag LOCUS_00230 27795 25921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28039 28785 gene locus_tag LOCUS_00240 28039 28785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29222 30205 gene locus_tag LOCUS_00250 29222 30205 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_00250 30502 31350 gene locus_tag LOCUS_00260 30502 31350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31716 32546 gene locus_tag LOCUS_00270 31716 32546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32539 33354 gene locus_tag LOCUS_00280 32539 33354 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_00280 34010 34684 gene locus_tag LOCUS_00290 gene mnmD 34010 34684 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_00290 35239 34685 gene locus_tag LOCUS_00300 35239 34685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35429 36487 gene locus_tag LOCUS_00310 gene ribD 35429 36487 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_00310 36632 37156 gene locus_tag LOCUS_00320 36632 37156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38816 37248 gene locus_tag LOCUS_00330 38816 37248 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_00330 39734 38826 gene locus_tag LOCUS_00340 39734 38826 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_00340 39855 40457 gene locus_tag LOCUS_00350 gene coaE 39855 40457 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_00350 40447 41580 gene locus_tag LOCUS_00360 40447 41580 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_00360 42940 41582 gene locus_tag LOCUS_00370 42940 41582 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_00370 43075 43992 gene locus_tag LOCUS_00380 43075 43992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44463 43999 gene locus_tag LOCUS_00390 44463 43999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45039 44551 gene locus_tag LOCUS_00400 45039 44551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_00400 46109 45327 gene locus_tag LOCUS_00410 46109 45327 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_00410 47014 46172 gene locus_tag LOCUS_00420 47014 46172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 47775 48269 gene locus_tag LOCUS_00430 47775 48269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 49174 48371 gene locus_tag LOCUS_00440 49174 48371 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 protein_id gnl|my_center|LOCUS_00440 49561 52926 gene locus_tag LOCUS_00450 49561 52926 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_00450 53217 54152 gene locus_tag LOCUS_00460 53217 54152 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_00460 55156 54263 gene locus_tag LOCUS_00470 55156 54263 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_00470 57108 55321 gene locus_tag LOCUS_00480 57108 55321 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922210.1 protein_id gnl|my_center|LOCUS_00480 57416 57766 gene locus_tag LOCUS_00490 57416 57766 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_00490 58179 59483 gene locus_tag LOCUS_00500 58179 59483 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_00500 59550 61286 gene locus_tag LOCUS_00510 59550 61286 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533474.1 protein_id gnl|my_center|LOCUS_00510 61868 61539 gene locus_tag LOCUS_00520 61868 61539 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_00520 63080 62340 gene locus_tag LOCUS_00530 63080 62340 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_00530 64076 63150 gene locus_tag LOCUS_00540 64076 63150 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_00540 64503 64186 gene locus_tag LOCUS_00550 gene trxA 64503 64186 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932522.1 protein_id gnl|my_center|LOCUS_00550 65116 65892 gene locus_tag LOCUS_00560 65116 65892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 66074 66874 gene locus_tag LOCUS_00570 66074 66874 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_00570 67771 66884 gene locus_tag LOCUS_00580 67771 66884 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_00580 69209 67902 gene locus_tag LOCUS_00590 69209 67902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 71864 69351 gene locus_tag LOCUS_00600 gene gyrA 71864 69351 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_00600 72118 72846 gene locus_tag LOCUS_00610 gene ubiE 72118 72846 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_00610 72855 73586 gene locus_tag LOCUS_00620 72855 73586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 74238 73645 gene locus_tag LOCUS_00630 74238 73645 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_00630 74441 75538 gene locus_tag LOCUS_00640 gene ychF 74441 75538 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_00640 76299 75775 gene locus_tag LOCUS_00650 76299 75775 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315164.1 protein_id gnl|my_center|LOCUS_00650 77190 76411 gene locus_tag LOCUS_00660 77190 76411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 78898 77192 gene locus_tag LOCUS_00670 78898 77192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 79509 78895 gene locus_tag LOCUS_00680 gene yihA 79509 78895 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_00680 79784 80425 gene locus_tag LOCUS_00690 79784 80425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 82796 80721 gene locus_tag LOCUS_00700 82796 80721 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261753.1 protein_id gnl|my_center|LOCUS_00700 82996 83514 gene locus_tag LOCUS_00710 82996 83514 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_00710 83547 84179 gene locus_tag LOCUS_00720 83547 84179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 84206 85114 gene locus_tag LOCUS_00730 84206 85114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 85381 86976 gene locus_tag LOCUS_00740 gene bshC 85381 86976 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_00740 87731 86973 gene locus_tag LOCUS_00750 87731 86973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 88025 88207 gene locus_tag LOCUS_00760 88025 88207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 88170 88709 gene locus_tag LOCUS_00770 88170 88709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 89247 89858 gene locus_tag LOCUS_00780 89247 89858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 89996 91186 gene locus_tag LOCUS_00790 89996 91186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 91567 91238 gene locus_tag LOCUS_00800 91567 91238 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_00800 93214 91661 gene locus_tag LOCUS_00810 93214 91661 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665838.1 protein_id gnl|my_center|LOCUS_00810 94636 93257 gene locus_tag LOCUS_00820 94636 93257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 96127 94667 gene locus_tag LOCUS_00830 96127 94667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 97586 96201 gene locus_tag LOCUS_00840 97586 96201 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_00840 99988 97583 gene locus_tag LOCUS_00850 99988 97583 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_00850 100644 100060 gene locus_tag LOCUS_00860 100644 100060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 101706 100843 gene locus_tag LOCUS_00870 gene accD 101706 100843 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_00870 102858 101830 gene locus_tag LOCUS_00880 gene hemE 102858 101830 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404447.1 protein_id gnl|my_center|LOCUS_00880 103300 104505 gene locus_tag LOCUS_00890 103300 104505 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_00890 104620 105156 gene locus_tag LOCUS_00900 104620 105156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 105293 106654 gene locus_tag LOCUS_00910 105293 106654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 106738 109461 gene locus_tag LOCUS_00920 106738 109461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 109472 109969 gene locus_tag LOCUS_00930 109472 109969 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_00930 110156 110941 gene locus_tag LOCUS_00940 110156 110941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 110961 111560 gene locus_tag LOCUS_00950 110961 111560 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_00950 112434 111550 gene locus_tag LOCUS_00960 112434 111550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 113884 112454 gene locus_tag LOCUS_00970 113884 112454 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_00970 115380 113926 gene locus_tag LOCUS_00980 115380 113926 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_00980 116767 115475 gene locus_tag LOCUS_00990 116767 115475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 118665 116821 gene locus_tag LOCUS_01000 118665 116821 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_01000 122116 118667 gene locus_tag LOCUS_01010 122116 118667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 123074 122208 gene locus_tag LOCUS_01020 123074 122208 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_01020 126638 123120 gene locus_tag LOCUS_01030 126638 123120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 129653 126645 gene locus_tag LOCUS_01040 129653 126645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 130206 133067 gene locus_tag LOCUS_01050 130206 133067 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_01050 135029 133170 gene locus_tag LOCUS_01060 135029 133170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 137520 135133 gene locus_tag LOCUS_01070 137520 135133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 139169 137616 gene locus_tag LOCUS_01080 139169 137616 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_01080 142278 139192 gene locus_tag LOCUS_01090 142278 139192 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_01090 142666 145503 gene locus_tag LOCUS_01100 142666 145503 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_01100 145523 146131 gene locus_tag LOCUS_01110 145523 146131 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962861.1 protein_id gnl|my_center|LOCUS_01110 146610 147200 gene locus_tag LOCUS_01120 146610 147200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 148553 147288 gene locus_tag LOCUS_01130 gene icd 148553 147288 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_01130 148816 149856 gene locus_tag LOCUS_01140 gene ruvB 148816 149856 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_01140 150082 151203 gene locus_tag LOCUS_01150 150082 151203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 154456 151244 gene locus_tag LOCUS_01160 154456 151244 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839665.1 protein_id gnl|my_center|LOCUS_01160 154972 155541 gene locus_tag LOCUS_01170 154972 155541 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_01170 155674 157017 gene locus_tag LOCUS_01180 155674 157017 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_01180 157143 158462 gene locus_tag LOCUS_01190 157143 158462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 158469 159716 gene locus_tag LOCUS_01200 158469 159716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 159802 160887 gene locus_tag LOCUS_01210 159802 160887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 160969 163761 gene locus_tag LOCUS_01220 160969 163761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 165319 163841 gene locus_tag LOCUS_01230 165319 163841 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_01230 166931 165588 gene locus_tag LOCUS_01240 166931 165588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_01240 168490 167099 gene locus_tag LOCUS_01250 168490 167099 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_01250 169387 170820 gene locus_tag LOCUS_01260 gene dnaA 169387 170820 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_01260 170920 170997 gene locus_tag LOCUS_t00010 170920 170997 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 171034 171123 gene locus_tag LOCUS_t00020 171034 171123 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 176262 171313 gene locus_tag LOCUS_01270 176262 171313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 182000 176295 gene locus_tag LOCUS_01280 182000 176295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 182581 182778 gene locus_tag LOCUS_01290 182581 182778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 183642 183010 gene locus_tag LOCUS_01300 183642 183010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 184510 183656 gene locus_tag LOCUS_01310 184510 183656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 185298 184570 gene locus_tag LOCUS_01320 185298 184570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 185547 186983 gene locus_tag LOCUS_01330 185547 186983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 187234 187058 gene locus_tag LOCUS_01340 187234 187058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 187671 190826 gene locus_tag LOCUS_01350 187671 190826 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_01350 191785 190859 gene locus_tag LOCUS_01360 191785 190859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 192369 191782 gene locus_tag LOCUS_01370 192369 191782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 192804 195899 gene locus_tag LOCUS_01380 192804 195899 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_01380 196380 197447 gene locus_tag LOCUS_01390 196380 197447 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_01390 197539 199224 gene locus_tag LOCUS_01400 gene menD 197539 199224 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_01400 199232 200311 gene locus_tag LOCUS_01410 199232 200311 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_01410 200304 201401 gene locus_tag LOCUS_01420 200304 201401 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766781.1 protein_id gnl|my_center|LOCUS_01420 202176 201466 gene locus_tag LOCUS_01430 202176 201466 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_01430 203287 202178 gene locus_tag LOCUS_01440 203287 202178 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405558.1 protein_id gnl|my_center|LOCUS_01440 205107 203656 gene locus_tag LOCUS_01450 205107 203656 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963349.1 protein_id gnl|my_center|LOCUS_01450 205466 205236 gene locus_tag LOCUS_01460 205466 205236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 205642 212544 gene locus_tag LOCUS_01470 205642 212544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 212627 214378 gene locus_tag LOCUS_01480 212627 214378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 214378 215283 gene locus_tag LOCUS_01490 214378 215283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 215276 216910 gene locus_tag LOCUS_01500 215276 216910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 216981 218705 gene locus_tag LOCUS_01510 216981 218705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 218702 220807 gene locus_tag LOCUS_01520 218702 220807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 220835 221611 gene locus_tag LOCUS_01530 220835 221611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 223017 221626 gene locus_tag LOCUS_01540 223017 221626 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_01540 223292 224389 gene locus_tag LOCUS_01550 223292 224389 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963516.1 protein_id gnl|my_center|LOCUS_01550 224967 224458 gene locus_tag LOCUS_01560 224967 224458 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_01560 225113 227362 gene locus_tag LOCUS_01570 225113 227362 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_01570 227366 228883 gene locus_tag LOCUS_01580 227366 228883 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922613.1 protein_id gnl|my_center|LOCUS_01580 229026 231404 gene locus_tag LOCUS_01590 229026 231404 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_01590 231555 232775 gene locus_tag LOCUS_01600 gene alr 231555 232775 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_01600 233306 232983 gene locus_tag LOCUS_01610 233306 232983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 233305 233655 gene locus_tag LOCUS_01620 233305 233655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 233740 234588 gene locus_tag LOCUS_01630 233740 234588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 235376 234594 gene locus_tag LOCUS_01640 235376 234594 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776815.1 protein_id gnl|my_center|LOCUS_01640 235824 235387 gene locus_tag LOCUS_01650 235824 235387 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_01650 236383 235817 gene locus_tag LOCUS_01660 236383 235817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 237163 236546 gene locus_tag LOCUS_01670 237163 236546 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931020.1 protein_id gnl|my_center|LOCUS_01670 237564 237175 gene locus_tag LOCUS_01680 237564 237175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 237677 238951 gene locus_tag LOCUS_01690 237677 238951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 240147 239014 gene locus_tag LOCUS_01700 240147 239014 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889688.1 protein_id gnl|my_center|LOCUS_01700 240485 240709 gene locus_tag LOCUS_01710 240485 240709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 242056 240719 gene locus_tag LOCUS_01720 242056 240719 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_01720 242218 242880 gene locus_tag LOCUS_01730 242218 242880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 244503 242905 gene locus_tag LOCUS_01740 244503 242905 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626068.1 protein_id gnl|my_center|LOCUS_01740 245302 244625 gene locus_tag LOCUS_01750 245302 244625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 245877 246719 gene locus_tag LOCUS_01760 245877 246719 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_01760 247976 246804 gene locus_tag LOCUS_01770 247976 246804 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_01770 248260 248991 gene locus_tag LOCUS_01780 248260 248991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 250983 249088 gene locus_tag LOCUS_01790 250983 249088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 251128 251553 gene locus_tag LOCUS_01800 251128 251553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 251550 251993 gene locus_tag LOCUS_01810 251550 251993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 252623 252009 gene locus_tag LOCUS_01820 252623 252009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 254835 252808 gene locus_tag LOCUS_01830 254835 252808 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444445.1 protein_id gnl|my_center|LOCUS_01830 255693 254917 gene locus_tag LOCUS_01840 255693 254917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 256389 255820 gene locus_tag LOCUS_01850 256389 255820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 256795 256379 gene locus_tag LOCUS_01860 256795 256379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 258315 256801 gene locus_tag LOCUS_01870 258315 256801 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_01870 259060 258290 gene locus_tag LOCUS_01880 259060 258290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 260050 259076 gene locus_tag LOCUS_01890 260050 259076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 263155 260063 gene locus_tag LOCUS_01900 263155 260063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 264686 263430 gene locus_tag LOCUS_01910 264686 263430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 265362 264910 gene locus_tag LOCUS_01920 265362 264910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 266529 265525 gene locus_tag LOCUS_01930 266529 265525 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365244.1 protein_id gnl|my_center|LOCUS_01930 266926 267444 gene locus_tag LOCUS_01940 266926 267444 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_01940 270601 267449 gene locus_tag LOCUS_01950 270601 267449 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_01950 270742 272238 gene locus_tag LOCUS_01960 gene tcuA 270742 272238 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_01960 272235 273386 gene locus_tag LOCUS_01970 272235 273386 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399877.1 protein_id gnl|my_center|LOCUS_01970 273579 275525 gene locus_tag LOCUS_01980 273579 275525 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395919.1 protein_id gnl|my_center|LOCUS_01980 275593 276633 gene locus_tag LOCUS_01990 275593 276633 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723648.1 protein_id gnl|my_center|LOCUS_01990 276614 277477 gene locus_tag LOCUS_02000 276614 277477 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 protein_id gnl|my_center|LOCUS_02000 277573 278313 gene locus_tag LOCUS_02010 277573 278313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 278537 280150 gene locus_tag LOCUS_02020 278537 280150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 280425 280207 gene locus_tag LOCUS_02030 280425 280207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 280753 280427 gene locus_tag LOCUS_02040 280753 280427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 281902 280943 gene locus_tag LOCUS_02050 281902 280943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 282582 282073 gene locus_tag LOCUS_02060 282582 282073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 283160 282609 gene locus_tag LOCUS_02070 283160 282609 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_02070 283402 283223 gene locus_tag LOCUS_02080 283402 283223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 284250 283453 gene locus_tag LOCUS_02090 284250 283453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 285212 284370 gene locus_tag LOCUS_02100 285212 284370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 286497 285496 gene locus_tag LOCUS_02110 286497 285496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 287760 286873 gene locus_tag LOCUS_02120 287760 286873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 288130 289065 gene locus_tag LOCUS_02130 288130 289065 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_02130 289213 290283 gene locus_tag LOCUS_02140 289213 290283 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_02140 290495 291025 gene locus_tag LOCUS_02150 290495 291025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 291028 291438 gene locus_tag LOCUS_02160 291028 291438 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_02160 292385 291567 gene locus_tag LOCUS_02170 292385 291567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 292588 294228 gene locus_tag LOCUS_02180 gene pgm 292588 294228 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268077.1 protein_id gnl|my_center|LOCUS_02180 296593 294245 gene locus_tag LOCUS_02190 296593 294245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 297836 296724 gene locus_tag LOCUS_02200 297836 296724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 299080 297833 gene locus_tag LOCUS_02210 299080 297833 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461376.1 protein_id gnl|my_center|LOCUS_02210 300251 299259 gene locus_tag LOCUS_02220 300251 299259 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_02220 300460 301749 gene locus_tag LOCUS_02230 300460 301749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 301728 302690 gene locus_tag LOCUS_02240 301728 302690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 302691 303269 gene locus_tag LOCUS_02250 302691 303269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359842.1 protein_id gnl|my_center|LOCUS_02250 304402 303374 gene locus_tag LOCUS_02260 304402 303374 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_02260 304472 305365 gene locus_tag LOCUS_02270 304472 305365 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_02270 305901 305368 gene locus_tag LOCUS_02280 305901 305368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 306327 305911 gene locus_tag LOCUS_02290 306327 305911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 306699 306334 gene locus_tag LOCUS_02300 306699 306334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 307961 306774 gene locus_tag LOCUS_02310 307961 306774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 309640 308000 gene locus_tag LOCUS_02320 309640 308000 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399188.1 protein_id gnl|my_center|LOCUS_02320 311722 309650 gene locus_tag LOCUS_02330 311722 309650 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_02330 312557 311724 gene locus_tag LOCUS_02340 gene srlD 312557 311724 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048327.1 protein_id gnl|my_center|LOCUS_02340 312899 312588 gene locus_tag LOCUS_02350 312899 312588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 313723 312959 gene locus_tag LOCUS_02360 gene yfaU 313723 312959 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992992.1 protein_id gnl|my_center|LOCUS_02360 314250 313726 gene locus_tag LOCUS_02370 gene leuD 314250 313726 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_02370 315658 314267 gene locus_tag LOCUS_02380 315658 314267 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399325.1 protein_id gnl|my_center|LOCUS_02380 316932 315664 gene locus_tag LOCUS_02390 gene leuC 316932 315664 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583552.1 protein_id gnl|my_center|LOCUS_02390 317515 317000 gene locus_tag LOCUS_02400 317515 317000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 317835 320477 gene locus_tag LOCUS_02410 317835 320477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 320565 321467 gene locus_tag LOCUS_02420 320565 321467 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 protein_id gnl|my_center|LOCUS_02420 322927 321506 gene locus_tag LOCUS_02430 322927 321506 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_02430 324055 323090 gene locus_tag LOCUS_02440 324055 323090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 324276 325283 gene locus_tag LOCUS_02450 324276 325283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 325285 326187 gene locus_tag LOCUS_02460 325285 326187 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403998.1 protein_id gnl|my_center|LOCUS_02460 326189 327424 gene locus_tag LOCUS_02470 326189 327424 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_02470 327421 327912 gene locus_tag LOCUS_02480 gene leuD 327421 327912 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_02480 327954 328403 gene locus_tag LOCUS_02490 327954 328403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 328405 329064 gene locus_tag LOCUS_02500 328405 329064 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207528.1 protein_id gnl|my_center|LOCUS_02500 329202 330038 gene locus_tag LOCUS_02510 329202 330038 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055925.1 protein_id gnl|my_center|LOCUS_02510 330173 330937 gene locus_tag LOCUS_02520 330173 330937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 330940 331953 gene locus_tag LOCUS_02530 330940 331953 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_02530 332627 332097 gene locus_tag LOCUS_02540 332627 332097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 333483 332701 gene locus_tag LOCUS_02550 333483 332701 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435326.1 protein_id gnl|my_center|LOCUS_02550 334966 333755 gene locus_tag LOCUS_02560 334966 333755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 336031 335018 gene locus_tag LOCUS_02570 336031 335018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 336173 336649 gene locus_tag LOCUS_02580 336173 336649 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_02580 336649 338055 gene locus_tag LOCUS_02590 336649 338055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 338077 338637 gene locus_tag LOCUS_02600 338077 338637 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_02600 338630 340051 gene locus_tag LOCUS_02610 338630 340051 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356617.1 protein_id gnl|my_center|LOCUS_02610 340058 341230 gene locus_tag LOCUS_02620 340058 341230 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_02620 341187 341405 gene locus_tag LOCUS_02630 341187 341405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 341362 341601 gene locus_tag LOCUS_02640 341362 341601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 342001 342594 gene locus_tag LOCUS_02650 342001 342594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 343009 343902 gene locus_tag LOCUS_02660 343009 343902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 343928 345409 gene locus_tag LOCUS_02670 343928 345409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 345443 347221 gene locus_tag LOCUS_02680 345443 347221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 347268 347720 gene locus_tag LOCUS_02690 347268 347720 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_02690 347722 348186 gene locus_tag LOCUS_02700 347722 348186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 348197 348370 gene locus_tag LOCUS_02710 348197 348370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 348367 349080 gene locus_tag LOCUS_02720 348367 349080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 349109 350857 gene locus_tag LOCUS_02730 349109 350857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 350865 351152 gene locus_tag LOCUS_02740 350865 351152 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_02740 351155 351565 gene locus_tag LOCUS_02750 351155 351565 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_02750 351568 354855 gene locus_tag LOCUS_02760 351568 354855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 354852 357740 gene locus_tag LOCUS_02770 354852 357740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 357730 361836 gene locus_tag LOCUS_02780 357730 361836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 361840 363504 gene locus_tag LOCUS_02790 361840 363504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 363519 371414 gene locus_tag LOCUS_02800 363519 371414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 371443 373410 gene locus_tag LOCUS_02810 371443 373410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 373413 374747 gene locus_tag LOCUS_02820 373413 374747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 374880 374808 gene locus_tag LOCUS_t00030 374880 374808 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 375028 375516 gene locus_tag LOCUS_02830 375028 375516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 375538 376575 gene locus_tag LOCUS_02840 375538 376575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 376578 378320 gene locus_tag LOCUS_02850 376578 378320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 379007 378396 gene locus_tag LOCUS_02860 379007 378396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 379006 379194 gene locus_tag LOCUS_02870 379006 379194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 380881 379679 gene locus_tag LOCUS_02880 380881 379679 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence002 1895 117 gene locus_tag LOCUS_02890 gene aspS 1895 117 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962449.1 protein_id gnl|my_center|LOCUS_02890 2220 4631 gene locus_tag LOCUS_02900 2220 4631 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_02900 4845 6083 gene locus_tag LOCUS_02910 gene hemA 4845 6083 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_02910 7229 6069 gene locus_tag LOCUS_02920 7229 6069 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_02920 7435 8025 gene locus_tag LOCUS_02930 7435 8025 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_02930 9608 8109 gene locus_tag LOCUS_02940 9608 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 10365 10015 gene locus_tag LOCUS_02950 10365 10015 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_02950 11775 10552 gene locus_tag LOCUS_02960 11775 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 12099 13649 gene locus_tag LOCUS_02970 12099 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13697 15076 gene locus_tag LOCUS_02980 13697 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 15499 15122 gene locus_tag LOCUS_02990 15499 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_02990 16000 16074 gene locus_tag LOCUS_t00040 16000 16074 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16168 16545 gene locus_tag LOCUS_03000 16168 16545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 17964 16606 gene locus_tag LOCUS_03010 17964 16606 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 protein_id gnl|my_center|LOCUS_03010 19246 17966 gene locus_tag LOCUS_03020 19246 17966 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533426.1 protein_id gnl|my_center|LOCUS_03020 20572 19262 gene locus_tag LOCUS_03030 20572 19262 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 protein_id gnl|my_center|LOCUS_03030 21997 20666 gene locus_tag LOCUS_03040 21997 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 25069 22031 gene locus_tag LOCUS_03050 25069 22031 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_03050 26636 25233 gene locus_tag LOCUS_03060 26636 25233 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 protein_id gnl|my_center|LOCUS_03060 26975 27532 gene locus_tag LOCUS_03070 26975 27532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 27543 28778 gene locus_tag LOCUS_03080 27543 28778 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_03080 28810 30303 gene locus_tag LOCUS_03090 gene dhaS 28810 30303 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_03090 30330 31601 gene locus_tag LOCUS_03100 30330 31601 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_03100 32079 31642 gene locus_tag LOCUS_03110 32079 31642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 32434 32096 gene locus_tag LOCUS_03120 32434 32096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 33541 34692 gene locus_tag LOCUS_03130 33541 34692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896664.1 protein_id gnl|my_center|LOCUS_03130 34693 36366 gene locus_tag LOCUS_03140 34693 36366 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881096.1 protein_id gnl|my_center|LOCUS_03140 36359 37909 gene locus_tag LOCUS_03150 36359 37909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 37906 39270 gene locus_tag LOCUS_03160 37906 39270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 39272 40132 gene locus_tag LOCUS_03170 39272 40132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 40135 41673 gene locus_tag LOCUS_03180 40135 41673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 41677 43650 gene locus_tag LOCUS_03190 41677 43650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 44141 45175 gene locus_tag LOCUS_03200 44141 45175 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_03200 45205 45957 gene locus_tag LOCUS_03210 gene fabG 45205 45957 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_03210 45959 46498 gene locus_tag LOCUS_03220 45959 46498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 46521 47429 gene locus_tag LOCUS_03230 46521 47429 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_03230 47453 48388 gene locus_tag LOCUS_03240 47453 48388 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_03240 49395 48391 gene locus_tag LOCUS_03250 49395 48391 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709181.1 protein_id gnl|my_center|LOCUS_03250 49880 50794 gene locus_tag LOCUS_03260 49880 50794 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_03260 50795 51526 gene locus_tag LOCUS_03270 50795 51526 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_03270 51731 52861 gene locus_tag LOCUS_03280 51731 52861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 53010 54347 gene locus_tag LOCUS_03290 gene eefC 53010 54347 CDS product multidrug efflux RND transporter outer membrane subunit EefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703856.1 protein_id gnl|my_center|LOCUS_03290 54372 55421 gene locus_tag LOCUS_03300 54372 55421 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_03300 55488 58550 gene locus_tag LOCUS_03310 55488 58550 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_03310 59604 58687 gene locus_tag LOCUS_03320 59604 58687 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391305.1 protein_id gnl|my_center|LOCUS_03320 60355 59606 gene locus_tag LOCUS_03330 60355 59606 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_03330 63768 60715 gene locus_tag LOCUS_03340 63768 60715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 64601 63897 gene locus_tag LOCUS_03350 64601 63897 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_03350 65984 64617 gene locus_tag LOCUS_03360 65984 64617 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839765.1 protein_id gnl|my_center|LOCUS_03360 66335 66030 gene locus_tag LOCUS_03370 66335 66030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 68030 66456 gene locus_tag LOCUS_03380 68030 66456 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 protein_id gnl|my_center|LOCUS_03380 68318 68034 gene locus_tag LOCUS_03390 68318 68034 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764805.1 protein_id gnl|my_center|LOCUS_03390 68581 68315 gene locus_tag LOCUS_03400 68581 68315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 69083 68583 gene locus_tag LOCUS_03410 69083 68583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 69372 69695 gene locus_tag LOCUS_03420 gene trxA 69372 69695 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_03420 70591 69764 gene locus_tag LOCUS_03430 70591 69764 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 protein_id gnl|my_center|LOCUS_03430 71712 70603 gene locus_tag LOCUS_03440 71712 70603 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_03440 71903 73264 gene locus_tag LOCUS_03450 71903 73264 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_03450 75631 73322 gene locus_tag LOCUS_03460 75631 73322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 77788 75647 gene locus_tag LOCUS_03470 77788 75647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 78097 78639 gene locus_tag LOCUS_03480 78097 78639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 79563 78682 gene locus_tag LOCUS_03490 79563 78682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 80839 79685 gene locus_tag LOCUS_03500 80839 79685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 83637 80965 gene locus_tag LOCUS_03510 83637 80965 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_03510 84747 83869 gene locus_tag LOCUS_03520 84747 83869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 85726 84815 gene locus_tag LOCUS_03530 85726 84815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 86665 85772 gene locus_tag LOCUS_03540 86665 85772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 86940 90956 gene locus_tag LOCUS_03550 86940 90956 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_03550 91183 93789 gene locus_tag LOCUS_03560 91183 93789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 93867 94823 gene locus_tag LOCUS_03570 93867 94823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 95700 94948 gene locus_tag LOCUS_03580 95700 94948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 96318 95722 gene locus_tag LOCUS_03590 96318 95722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 96464 96745 gene locus_tag LOCUS_03600 96464 96745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 96848 97768 gene locus_tag LOCUS_03610 96848 97768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 98092 100101 gene locus_tag LOCUS_03620 98092 100101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 100381 103275 gene locus_tag LOCUS_03630 100381 103275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 103378 104169 gene locus_tag LOCUS_03640 103378 104169 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401384.1 protein_id gnl|my_center|LOCUS_03640 105233 104166 gene locus_tag LOCUS_03650 gene paaK 105233 104166 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965787.1 protein_id gnl|my_center|LOCUS_03650 106526 105357 gene locus_tag LOCUS_03660 106526 105357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 107192 106593 gene locus_tag LOCUS_03670 107192 106593 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_03670 107738 107313 gene locus_tag LOCUS_03680 107738 107313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 108941 107922 gene locus_tag LOCUS_03690 108941 107922 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_03690 109166 110326 gene locus_tag LOCUS_03700 109166 110326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 110491 112920 gene locus_tag LOCUS_03710 110491 112920 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_03710 113910 112978 gene locus_tag LOCUS_03720 113910 112978 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242776.1 protein_id gnl|my_center|LOCUS_03720 114125 114883 gene locus_tag LOCUS_03730 114125 114883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_03730 115080 115661 gene locus_tag LOCUS_03740 115080 115661 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_03740 115836 117242 gene locus_tag LOCUS_03750 115836 117242 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_03750 117490 118155 gene locus_tag LOCUS_03760 117490 118155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 118297 119391 gene locus_tag LOCUS_03770 118297 119391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 120648 119554 gene locus_tag LOCUS_03780 120648 119554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 120924 120742 gene locus_tag LOCUS_03790 120924 120742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 120932 121660 gene locus_tag LOCUS_03800 120932 121660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 121657 122349 gene locus_tag LOCUS_03810 121657 122349 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_03810 122519 122950 gene locus_tag LOCUS_03820 122519 122950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 123129 124934 gene locus_tag LOCUS_03830 123129 124934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 125718 124996 gene locus_tag LOCUS_03840 125718 124996 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_03840 126273 125725 gene locus_tag LOCUS_03850 126273 125725 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102727.1 protein_id gnl|my_center|LOCUS_03850 126490 127329 gene locus_tag LOCUS_03860 126490 127329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 127513 127677 gene locus_tag LOCUS_03870 127513 127677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 127784 128671 gene locus_tag LOCUS_03880 127784 128671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 128834 129388 gene locus_tag LOCUS_03890 128834 129388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 129452 129997 gene locus_tag LOCUS_03900 129452 129997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 130200 130574 gene locus_tag LOCUS_03910 130200 130574 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_03910 130567 131796 gene locus_tag LOCUS_03920 130567 131796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 132163 133302 gene locus_tag LOCUS_03930 132163 133302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 133315 133563 gene locus_tag LOCUS_03940 133315 133563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 133911 134672 gene locus_tag LOCUS_03950 133911 134672 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_03950 134677 135729 gene locus_tag LOCUS_03960 134677 135729 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728063.1 protein_id gnl|my_center|LOCUS_03960 135791 136477 gene locus_tag LOCUS_03970 135791 136477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 136544 136936 gene locus_tag LOCUS_03980 136544 136936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 137147 137710 gene locus_tag LOCUS_03990 137147 137710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 137791 138750 gene locus_tag LOCUS_04000 137791 138750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640628.1 protein_id gnl|my_center|LOCUS_04000 138981 139634 gene locus_tag LOCUS_04010 138981 139634 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_04010 139763 140986 gene locus_tag LOCUS_04020 139763 140986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 141290 141718 gene locus_tag LOCUS_04030 141290 141718 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_04030 141720 142061 gene locus_tag LOCUS_04040 141720 142061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 142118 142501 gene locus_tag LOCUS_04050 142118 142501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 142569 143708 gene locus_tag LOCUS_04060 142569 143708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 143836 144540 gene locus_tag LOCUS_04070 143836 144540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 144649 145737 gene locus_tag LOCUS_04080 144649 145737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 146618 145872 gene locus_tag LOCUS_04090 146618 145872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 148440 146665 gene locus_tag LOCUS_04100 148440 146665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 148800 148441 gene locus_tag LOCUS_04110 148800 148441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 150111 148870 gene locus_tag LOCUS_04120 150111 148870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 150557 150180 gene locus_tag LOCUS_04130 150557 150180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 154545 150775 gene locus_tag LOCUS_04140 154545 150775 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_04140 155093 154767 gene locus_tag LOCUS_04150 155093 154767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 156997 155501 gene locus_tag LOCUS_04160 156997 155501 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_04160 157880 158266 gene locus_tag LOCUS_04170 157880 158266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 159098 158322 gene locus_tag LOCUS_04180 159098 158322 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_04180 159684 159103 gene locus_tag LOCUS_04190 159684 159103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 162477 159691 gene locus_tag LOCUS_04200 162477 159691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 163343 162549 gene locus_tag LOCUS_04210 163343 162549 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_04210 163372 163578 gene locus_tag LOCUS_04220 163372 163578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 164411 163623 gene locus_tag LOCUS_04230 164411 163623 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_04230 165839 164622 gene locus_tag LOCUS_04240 165839 164622 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_04240 167321 165849 gene locus_tag LOCUS_04250 167321 165849 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932852.1 protein_id gnl|my_center|LOCUS_04250 168624 167533 gene locus_tag LOCUS_04260 168624 167533 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_04260 169118 170029 gene locus_tag LOCUS_04270 169118 170029 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_04270 170568 170080 gene locus_tag LOCUS_04280 170568 170080 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_04280 171267 170671 gene locus_tag LOCUS_04290 gene hisIE 171267 170671 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_04290 172052 171297 gene locus_tag LOCUS_04300 gene hisF 172052 171297 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_04300 172821 172108 gene locus_tag LOCUS_04310 gene hisA 172821 172108 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_04310 173221 173604 gene locus_tag LOCUS_04320 173221 173604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 173679 174479 gene locus_tag LOCUS_04330 173679 174479 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_04330 175962 174832 gene locus_tag LOCUS_04340 175962 174832 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764235.1 protein_id gnl|my_center|LOCUS_04340 176519 176764 gene locus_tag LOCUS_04350 gene moaD 176519 176764 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866971.1 protein_id gnl|my_center|LOCUS_04350 177305 176844 gene locus_tag LOCUS_04360 177305 176844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 178685 177519 gene locus_tag LOCUS_04370 178685 177519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 179166 178687 gene locus_tag LOCUS_04380 gene moaC 179166 178687 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_04380 180324 179419 gene locus_tag LOCUS_04390 gene moaA 180324 179419 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_04390 182386 180629 gene locus_tag LOCUS_04400 182386 180629 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328020.1 protein_id gnl|my_center|LOCUS_04400 182812 185040 gene locus_tag LOCUS_04410 182812 185040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 185490 186251 gene locus_tag LOCUS_04420 185490 186251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 186235 186957 gene locus_tag LOCUS_04430 186235 186957 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762319.1 protein_id gnl|my_center|LOCUS_04430 187099 187593 gene locus_tag LOCUS_04440 187099 187593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 187594 188913 gene locus_tag LOCUS_04450 187594 188913 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_04450 188988 190781 gene locus_tag LOCUS_04460 188988 190781 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_04460 190892 191869 gene locus_tag LOCUS_04470 190892 191869 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_04470 191876 192745 gene locus_tag LOCUS_04480 191876 192745 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016023.1 protein_id gnl|my_center|LOCUS_04480 192742 193494 gene locus_tag LOCUS_04490 192742 193494 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_04490 193669 194061 gene locus_tag LOCUS_04500 193669 194061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 197847 194074 gene locus_tag LOCUS_04510 197847 194074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 198935 197847 gene locus_tag LOCUS_04520 198935 197847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 199157 199810 gene locus_tag LOCUS_04530 199157 199810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 200480 199794 gene locus_tag LOCUS_04540 200480 199794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 200575 201912 gene locus_tag LOCUS_04550 200575 201912 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 protein_id gnl|my_center|LOCUS_04550 201979 202482 gene locus_tag LOCUS_04560 201979 202482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 203359 202586 gene locus_tag LOCUS_04570 203359 202586 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_04570 205287 203440 gene locus_tag LOCUS_04580 205287 203440 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_04580 206161 205307 gene locus_tag LOCUS_04590 206161 205307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_04590 207275 206397 gene locus_tag LOCUS_04600 207275 206397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 208119 208508 gene locus_tag LOCUS_04610 208119 208508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 209266 208808 gene locus_tag LOCUS_04620 209266 208808 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_04620 209804 209283 gene locus_tag LOCUS_04630 209804 209283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 210239 209808 gene locus_tag LOCUS_04640 210239 209808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 213216 210481 gene locus_tag LOCUS_04650 213216 210481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 214604 213324 gene locus_tag LOCUS_04660 214604 213324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 215866 214607 gene locus_tag LOCUS_04670 215866 214607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 216249 217199 gene locus_tag LOCUS_04680 216249 217199 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_04680 217444 220068 gene locus_tag LOCUS_04690 gene clpB 217444 220068 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_04690 220231 220536 gene locus_tag LOCUS_04700 gene trxA 220231 220536 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_04700 220579 221490 gene locus_tag LOCUS_04710 220579 221490 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_04710 222388 221513 gene locus_tag LOCUS_04720 222388 221513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 222997 222488 gene locus_tag LOCUS_04730 222997 222488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 223849 223670 gene locus_tag LOCUS_04740 223849 223670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 223917 224258 gene locus_tag LOCUS_04750 223917 224258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 226513 224378 gene locus_tag LOCUS_04760 226513 224378 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_04760 226590 226916 gene locus_tag LOCUS_04770 226590 226916 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_04770 226980 229619 gene locus_tag LOCUS_04780 226980 229619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_04780 229760 230725 gene locus_tag LOCUS_04790 229760 230725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 231403 230714 gene locus_tag LOCUS_04800 231403 230714 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_04800 231751 232458 gene locus_tag LOCUS_04810 231751 232458 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_04810 232543 233610 gene locus_tag LOCUS_04820 232543 233610 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_04820 235863 233986 gene locus_tag LOCUS_04830 235863 233986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 240095 236010 gene locus_tag LOCUS_04840 240095 236010 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_04840 240290 240583 gene locus_tag LOCUS_04850 240290 240583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 240738 241010 gene locus_tag LOCUS_04860 240738 241010 CDS product DUF2024 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086057.1 protein_id gnl|my_center|LOCUS_04860 241070 241804 gene locus_tag LOCUS_04870 241070 241804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 241949 242557 gene locus_tag LOCUS_04880 241949 242557 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204186.1 protein_id gnl|my_center|LOCUS_04880 242568 242927 gene locus_tag LOCUS_04890 242568 242927 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763131.1 protein_id gnl|my_center|LOCUS_04890 242936 243424 gene locus_tag LOCUS_04900 242936 243424 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_04900 244982 243447 gene locus_tag LOCUS_04910 244982 243447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 245575 249576 gene locus_tag LOCUS_04920 245575 249576 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_04920 252065 249645 gene locus_tag LOCUS_04930 252065 249645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_04930 252878 252381 gene locus_tag LOCUS_04940 252878 252381 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_04940 253609 253073 gene locus_tag LOCUS_04950 253609 253073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 253987 254409 gene locus_tag LOCUS_04960 253987 254409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 255278 254544 gene locus_tag LOCUS_04970 255278 254544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 255690 256634 gene locus_tag LOCUS_04980 255690 256634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 256631 257329 gene locus_tag LOCUS_04990 256631 257329 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_04990 257602 258396 gene locus_tag LOCUS_05000 257602 258396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 261509 258918 gene locus_tag LOCUS_05010 261509 258918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_05010 261890 261561 gene locus_tag LOCUS_05020 261890 261561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 261996 262304 gene locus_tag LOCUS_05030 261996 262304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 263515 263006 gene locus_tag LOCUS_05040 263515 263006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 264157 263738 gene locus_tag LOCUS_05050 264157 263738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 264790 265383 gene locus_tag LOCUS_05060 264790 265383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 265421 266176 gene locus_tag LOCUS_05070 265421 266176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 269068 266243 gene locus_tag LOCUS_05080 269068 266243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 271259 269178 gene locus_tag LOCUS_05090 271259 269178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 271471 272631 gene locus_tag LOCUS_05100 271471 272631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 276158 272757 gene locus_tag LOCUS_05110 276158 272757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 276828 276454 gene locus_tag LOCUS_05120 276828 276454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 278047 280203 gene locus_tag LOCUS_05130 278047 280203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 282865 280403 gene locus_tag LOCUS_05140 282865 280403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 283156 283082 gene locus_tag LOCUS_t00050 283156 283082 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 283697 284683 gene locus_tag LOCUS_05150 283697 284683 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_05150 284680 285231 gene locus_tag LOCUS_05160 284680 285231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 285212 286117 gene locus_tag LOCUS_05170 gene dapA 285212 286117 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_05170 289275 286162 gene locus_tag LOCUS_05180 289275 286162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 289916 290704 gene locus_tag LOCUS_05190 289916 290704 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_05190 290806 291228 gene locus_tag LOCUS_05200 290806 291228 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_05200 291232 292182 gene locus_tag LOCUS_05210 291232 292182 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 protein_id gnl|my_center|LOCUS_05210 292189 292662 gene locus_tag LOCUS_05220 292189 292662 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_05220 292953 293603 gene locus_tag LOCUS_05230 292953 293603 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_05230 293865 294794 gene locus_tag LOCUS_05240 293865 294794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 294953 296746 gene locus_tag LOCUS_05250 294953 296746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 296758 297243 gene locus_tag LOCUS_05260 296758 297243 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_05260 297433 298185 gene locus_tag LOCUS_05270 gene modA 297433 298185 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881043.1 protein_id gnl|my_center|LOCUS_05270 298231 298911 gene locus_tag LOCUS_05280 gene modB 298231 298911 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_05280 298908 299756 gene locus_tag LOCUS_05290 298908 299756 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_05290 302468 299787 gene locus_tag LOCUS_05300 gene clpB 302468 299787 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_05300 303052 302636 gene locus_tag LOCUS_05310 303052 302636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 303861 306998 gene locus_tag LOCUS_05320 303861 306998 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_05320 307751 307227 gene locus_tag LOCUS_05330 307751 307227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 309291 307963 gene locus_tag LOCUS_05340 gene odhB 309291 307963 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_05340 310390 309500 gene locus_tag LOCUS_05350 310390 309500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 311339 310530 gene locus_tag LOCUS_05360 gene lgt 311339 310530 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_05360 311594 312085 gene locus_tag LOCUS_05370 311594 312085 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_05370 312162 312797 gene locus_tag LOCUS_05380 312162 312797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 314469 312886 gene locus_tag LOCUS_05390 314469 312886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 315403 314606 gene locus_tag LOCUS_05400 315403 314606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 315852 316397 gene locus_tag LOCUS_05410 315852 316397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 316445 316816 gene locus_tag LOCUS_05420 316445 316816 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_05420 320108 316824 gene locus_tag LOCUS_05430 gene ileS 320108 316824 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_05430 320825 320376 gene locus_tag LOCUS_05440 320825 320376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 320940 320761 gene locus_tag LOCUS_05450 320940 320761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 321302 322180 gene locus_tag LOCUS_05460 321302 322180 CDS product DUF6089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_05460 322309 323943 gene locus_tag LOCUS_05470 322309 323943 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_05470 324134 324760 gene locus_tag LOCUS_05480 324134 324760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 324777 326051 gene locus_tag LOCUS_05490 324777 326051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_05490 326125 327129 gene locus_tag LOCUS_05500 326125 327129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 327437 327895 gene locus_tag LOCUS_05510 327437 327895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 328860 327946 gene locus_tag LOCUS_05520 328860 327946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 329211 328873 gene locus_tag LOCUS_05530 329211 328873 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_05530 329378 330376 gene locus_tag LOCUS_05540 329378 330376 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325827.1 protein_id gnl|my_center|LOCUS_05540 330461 331048 gene locus_tag LOCUS_05550 330461 331048 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_05550 331089 331370 gene locus_tag LOCUS_05560 331089 331370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 331412 331699 gene locus_tag LOCUS_05570 331412 331699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 333317 331710 gene locus_tag LOCUS_05580 333317 331710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 335641 333428 gene locus_tag LOCUS_05590 335641 333428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 336582 335749 gene locus_tag LOCUS_05600 336582 335749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 336815 336888 gene locus_tag LOCUS_t00060 336815 336888 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 337153 338013 gene locus_tag LOCUS_05610 gene hisG 337153 338013 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_05610 338061 339365 gene locus_tag LOCUS_05620 gene hisD 338061 339365 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_05620 339362 340408 gene locus_tag LOCUS_05630 gene hisC 339362 340408 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_05630 340519 341658 gene locus_tag LOCUS_05640 gene hisB 340519 341658 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_05640 341740 342327 gene locus_tag LOCUS_05650 gene hisH 341740 342327 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence003 487 146 gene locus_tag LOCUS_05660 487 146 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_05660 1262 480 gene locus_tag LOCUS_05670 gene bamD 1262 480 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_05670 1798 1616 gene locus_tag LOCUS_05680 1798 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1736 2407 gene locus_tag LOCUS_05690 1736 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2640 3572 gene locus_tag LOCUS_05700 2640 3572 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840062.1 protein_id gnl|my_center|LOCUS_05700 3985 4437 gene locus_tag LOCUS_05710 3985 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 4558 5040 gene locus_tag LOCUS_05720 4558 5040 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_05720 5129 5707 gene locus_tag LOCUS_05730 5129 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 6089 5715 gene locus_tag LOCUS_05740 6089 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6722 6303 gene locus_tag LOCUS_05750 6722 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 7280 6855 gene locus_tag LOCUS_05760 7280 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 7614 7273 gene locus_tag LOCUS_05770 7614 7273 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969808.1 protein_id gnl|my_center|LOCUS_05770 7935 7630 gene locus_tag LOCUS_05780 7935 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 8259 9020 gene locus_tag LOCUS_05790 8259 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 9123 10235 gene locus_tag LOCUS_05800 9123 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 10812 10279 gene locus_tag LOCUS_05810 10812 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 11501 10962 gene locus_tag LOCUS_05820 11501 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 12797 11562 gene locus_tag LOCUS_05830 12797 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 15990 13519 gene locus_tag LOCUS_05840 15990 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 16764 16000 gene locus_tag LOCUS_05850 16764 16000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 17371 16907 gene locus_tag LOCUS_05860 17371 16907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 19009 18170 gene locus_tag LOCUS_05870 19009 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 19793 19302 gene locus_tag LOCUS_05880 19793 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 23084 20241 gene locus_tag LOCUS_05890 23084 20241 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840190.1 protein_id gnl|my_center|LOCUS_05890 24391 23270 gene locus_tag LOCUS_05900 24391 23270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 25999 24644 gene locus_tag LOCUS_05910 25999 24644 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_05910 27340 26150 gene locus_tag LOCUS_05920 27340 26150 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173158.1 protein_id gnl|my_center|LOCUS_05920 27546 30467 gene locus_tag LOCUS_05930 27546 30467 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_05930 31038 30508 gene locus_tag LOCUS_05940 31038 30508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 31584 31042 gene locus_tag LOCUS_05950 31584 31042 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140095.1 protein_id gnl|my_center|LOCUS_05950 32632 31826 gene locus_tag LOCUS_05960 32632 31826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 33926 32886 gene locus_tag LOCUS_05970 33926 32886 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268732.1 protein_id gnl|my_center|LOCUS_05970 35369 33927 gene locus_tag LOCUS_05980 35369 33927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 35650 35510 gene locus_tag LOCUS_05990 35650 35510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 36307 36645 gene locus_tag LOCUS_06000 36307 36645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 36642 39305 gene locus_tag LOCUS_06010 36642 39305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_06010 40580 39546 gene locus_tag LOCUS_06020 40580 39546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 42586 41840 gene locus_tag LOCUS_06030 42586 41840 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_06030 43375 45135 gene locus_tag LOCUS_06040 43375 45135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 47081 46398 gene locus_tag LOCUS_06050 gene pdaA 47081 46398 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875972.1 protein_id gnl|my_center|LOCUS_06050 48601 47228 gene locus_tag LOCUS_06060 48601 47228 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_06060 49385 48867 gene locus_tag LOCUS_06070 49385 48867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 50164 49382 gene locus_tag LOCUS_06080 50164 49382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 50886 50161 gene locus_tag LOCUS_06090 50886 50161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 51615 50923 gene locus_tag LOCUS_06100 51615 50923 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_06100 52076 51612 gene locus_tag LOCUS_06110 52076 51612 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_06110 52627 52082 gene locus_tag LOCUS_06120 52627 52082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06120 52816 52631 gene locus_tag LOCUS_06130 52816 52631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 53816 52797 gene locus_tag LOCUS_06140 53816 52797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 54397 53948 gene locus_tag LOCUS_06150 54397 53948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 55275 54517 gene locus_tag LOCUS_06160 55275 54517 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_06160 56290 55523 gene locus_tag LOCUS_06170 56290 55523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 56899 56306 gene locus_tag LOCUS_06180 56899 56306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 58038 56947 gene locus_tag LOCUS_06190 58038 56947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 59471 58185 gene locus_tag LOCUS_06200 59471 58185 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929361.1 protein_id gnl|my_center|LOCUS_06200 61612 59969 gene locus_tag LOCUS_06210 61612 59969 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_06210 62833 61760 gene locus_tag LOCUS_06220 62833 61760 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_06220 64138 62882 gene locus_tag LOCUS_06230 64138 62882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 64752 64318 gene locus_tag LOCUS_06240 64752 64318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 65199 64753 gene locus_tag LOCUS_06250 65199 64753 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_06250 66273 65395 gene locus_tag LOCUS_06260 66273 65395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 66792 66280 gene locus_tag LOCUS_06270 66792 66280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 68587 67007 gene locus_tag LOCUS_06280 68587 67007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 69387 68785 gene locus_tag LOCUS_06290 69387 68785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 70352 69399 gene locus_tag LOCUS_06300 70352 69399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 71531 70617 gene locus_tag LOCUS_06310 71531 70617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 71973 71641 gene locus_tag LOCUS_06320 71973 71641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 72706 71993 gene locus_tag LOCUS_06330 72706 71993 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021949.1 protein_id gnl|my_center|LOCUS_06330 73333 72764 gene locus_tag LOCUS_06340 73333 72764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 74004 73345 gene locus_tag LOCUS_06350 74004 73345 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_06350 75193 74108 gene locus_tag LOCUS_06360 75193 74108 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785910.1 protein_id gnl|my_center|LOCUS_06360 75409 75206 gene locus_tag LOCUS_06370 75409 75206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 75854 75426 gene locus_tag LOCUS_06380 75854 75426 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075144.1 protein_id gnl|my_center|LOCUS_06380 76779 75883 gene locus_tag LOCUS_06390 76779 75883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 77009 76848 gene locus_tag LOCUS_06400 77009 76848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 77395 77015 gene locus_tag LOCUS_06410 77395 77015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 78025 77399 gene locus_tag LOCUS_06420 78025 77399 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078927652.1 protein_id gnl|my_center|LOCUS_06420 79001 78309 gene locus_tag LOCUS_06430 79001 78309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 80473 79190 gene locus_tag LOCUS_06440 80473 79190 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861436.1 protein_id gnl|my_center|LOCUS_06440 80516 80716 gene locus_tag LOCUS_06450 80516 80716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 81291 80758 gene locus_tag LOCUS_06460 81291 80758 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 protein_id gnl|my_center|LOCUS_06460 82056 81313 gene locus_tag LOCUS_06470 82056 81313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 82737 82138 gene locus_tag LOCUS_06480 82737 82138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 83256 82786 gene locus_tag LOCUS_06490 83256 82786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 83989 83318 gene locus_tag LOCUS_06500 83989 83318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 85075 84299 gene locus_tag LOCUS_06510 85075 84299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 86514 85096 gene locus_tag LOCUS_06520 86514 85096 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_06520 87629 86799 gene locus_tag LOCUS_06530 87629 86799 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_06530 87989 87633 gene locus_tag LOCUS_06540 87989 87633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 89019 88111 gene locus_tag LOCUS_06550 89019 88111 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_06550 89958 89050 gene locus_tag LOCUS_06560 89958 89050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079007.1 protein_id gnl|my_center|LOCUS_06560 90838 89984 gene locus_tag LOCUS_06570 90838 89984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 91447 90950 gene locus_tag LOCUS_06580 91447 90950 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723340.1 protein_id gnl|my_center|LOCUS_06580 92253 91459 gene locus_tag LOCUS_06590 92253 91459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 92962 92261 gene locus_tag LOCUS_06600 92962 92261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 93387 93073 gene locus_tag LOCUS_06610 93387 93073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 94619 93417 gene locus_tag LOCUS_06620 94619 93417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 95500 94898 gene locus_tag LOCUS_06630 95500 94898 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065582.1 protein_id gnl|my_center|LOCUS_06630 96439 95924 gene locus_tag LOCUS_06640 96439 95924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 97953 96997 gene locus_tag LOCUS_06650 97953 96997 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_06650 98859 98017 gene locus_tag LOCUS_06660 98859 98017 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962642.1 protein_id gnl|my_center|LOCUS_06660 99415 99134 gene locus_tag LOCUS_06670 99415 99134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 100781 99456 gene locus_tag LOCUS_06680 100781 99456 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_06680 102046 101174 gene locus_tag LOCUS_06690 gene sucD 102046 101174 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_06690 102491 102168 gene locus_tag LOCUS_06700 102491 102168 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_06700 104104 102818 gene locus_tag LOCUS_06710 gene eno 104104 102818 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_06710 105286 104186 gene locus_tag LOCUS_06720 gene carA 105286 104186 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_06720 106012 105452 gene locus_tag LOCUS_06730 106012 105452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 107128 106130 gene locus_tag LOCUS_06740 107128 106130 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_06740 107864 107253 gene locus_tag LOCUS_06750 gene rpsD 107864 107253 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_06750 108295 107909 gene locus_tag LOCUS_06760 gene rpsK 108295 107909 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_06760 108721 108344 gene locus_tag LOCUS_06770 gene rpsM 108721 108344 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963448.1 protein_id gnl|my_center|LOCUS_06770 109112 108894 gene locus_tag LOCUS_06780 gene infA 109112 108894 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_06780 110025 109195 gene locus_tag LOCUS_06790 gene map 110025 109195 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_06790 111667 110294 gene locus_tag LOCUS_06800 gene secY 111667 110294 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_06800 112123 111677 gene locus_tag LOCUS_06810 gene rplO 112123 111677 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_06810 112371 112192 gene locus_tag LOCUS_06820 gene rpmD 112371 112192 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_06820 112939 112415 gene locus_tag LOCUS_06830 gene rpsE 112939 112415 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_06830 113313 112960 gene locus_tag LOCUS_06840 gene rplR 113313 112960 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_06840 113963 113409 gene locus_tag LOCUS_06850 gene rplF 113963 113409 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_06850 114405 113995 gene locus_tag LOCUS_06860 gene rpsH 114405 113995 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_06860 114741 114472 gene locus_tag LOCUS_06870 gene rpsN 114741 114472 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_06870 115320 114766 gene locus_tag LOCUS_06880 gene rplE 115320 114766 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_06880 115673 115320 gene locus_tag LOCUS_06890 gene rplX 115673 115320 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596219.1 protein_id gnl|my_center|LOCUS_06890 116119 115751 gene locus_tag LOCUS_06900 gene rplN 116119 115751 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_06900 116456 116199 gene locus_tag LOCUS_06910 gene rpsQ 116456 116199 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_06910 116757 116497 gene locus_tag LOCUS_06920 116757 116497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 117178 116792 gene locus_tag LOCUS_06930 gene rplP 117178 116792 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_06930 118035 117307 gene locus_tag LOCUS_06940 gene rpsC 118035 117307 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963464.1 protein_id gnl|my_center|LOCUS_06940 118489 118052 gene locus_tag LOCUS_06950 gene rplV 118489 118052 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_06950 118813 118544 gene locus_tag LOCUS_06960 gene rpsS 118813 118544 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_06960 119656 118817 gene locus_tag LOCUS_06970 gene rplB 119656 118817 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_06970 120032 119736 gene locus_tag LOCUS_06980 gene rplW 120032 119736 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_06980 120687 120061 gene locus_tag LOCUS_06990 gene rplD 120687 120061 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_06990 121374 120754 gene locus_tag LOCUS_07000 gene rplC 121374 120754 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_07000 121844 121536 gene locus_tag LOCUS_07010 gene rpsJ 121844 121536 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_07010 124081 121946 gene locus_tag LOCUS_07020 gene fusA 124081 121946 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_07020 124607 124140 gene locus_tag LOCUS_07030 gene rpsG 124607 124140 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_07030 125010 124636 gene locus_tag LOCUS_07040 gene rpsL 125010 124636 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_07040 125329 126087 gene locus_tag LOCUS_07050 125329 126087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 126020 128815 gene locus_tag LOCUS_07060 126020 128815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 129594 128866 gene locus_tag LOCUS_07070 129594 128866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 130591 129650 gene locus_tag LOCUS_07080 130591 129650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_07080 133059 130597 gene locus_tag LOCUS_07090 133059 130597 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_07090 133165 133647 gene locus_tag LOCUS_07100 133165 133647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 135081 133660 gene locus_tag LOCUS_07110 135081 133660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 135354 136295 gene locus_tag LOCUS_07120 135354 136295 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_07120 138954 136306 gene locus_tag LOCUS_07130 138954 136306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 139395 146453 gene locus_tag LOCUS_07140 139395 146453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 146868 146506 gene locus_tag LOCUS_07150 gene rplS 146868 146506 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_07150 149236 147032 gene locus_tag LOCUS_07160 149236 147032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 149620 150222 gene locus_tag LOCUS_07170 149620 150222 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_07170 152024 150366 gene locus_tag LOCUS_07180 152024 150366 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_07180 152359 152850 gene locus_tag LOCUS_07190 152359 152850 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_07190 153882 153013 gene locus_tag LOCUS_07200 153882 153013 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_07200 154333 154710 gene locus_tag LOCUS_07210 154333 154710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 154729 157431 gene locus_tag LOCUS_07220 154729 157431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 157826 158461 gene locus_tag LOCUS_07230 157826 158461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 158643 159896 gene locus_tag LOCUS_07240 158643 159896 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_07240 160104 161183 gene locus_tag LOCUS_07250 160104 161183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 162559 161279 gene locus_tag LOCUS_07260 162559 161279 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_07260 164060 162624 gene locus_tag LOCUS_07270 gene glgA 164060 162624 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_07270 164580 166088 gene locus_tag LOCUS_07280 164580 166088 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_07280 166078 166845 gene locus_tag LOCUS_07290 166078 166845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 167837 166896 gene locus_tag LOCUS_07300 167837 166896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 168205 169650 gene locus_tag LOCUS_07310 168205 169650 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_07310 170856 169678 gene locus_tag LOCUS_07320 170856 169678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_07320 173040 170968 gene locus_tag LOCUS_07330 173040 170968 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_07330 174028 173261 gene locus_tag LOCUS_07340 174028 173261 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_07340 176070 174028 gene locus_tag LOCUS_07350 gene paaZ 176070 174028 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186481.1 protein_id gnl|my_center|LOCUS_07350 177345 176305 gene locus_tag LOCUS_07360 177345 176305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 177937 177335 gene locus_tag LOCUS_07370 gene caiE 177937 177335 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122874.1 protein_id gnl|my_center|LOCUS_07370 178185 179018 gene locus_tag LOCUS_07380 178185 179018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 179040 179687 gene locus_tag LOCUS_07390 gene scpB 179040 179687 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_07390 179825 180346 gene locus_tag LOCUS_07400 179825 180346 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_07400 180519 181454 gene locus_tag LOCUS_07410 180519 181454 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_07410 184482 181576 gene locus_tag LOCUS_07420 184482 181576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 184788 185678 gene locus_tag LOCUS_07430 184788 185678 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_07430 185866 186297 gene locus_tag LOCUS_07440 185866 186297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_07440 187215 186301 gene locus_tag LOCUS_07450 187215 186301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 187647 189440 gene locus_tag LOCUS_07460 187647 189440 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_07460 189540 190955 gene locus_tag LOCUS_07470 189540 190955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 191005 192729 gene locus_tag LOCUS_07480 191005 192729 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_07480 192767 194065 gene locus_tag LOCUS_07490 192767 194065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 194518 194790 gene locus_tag LOCUS_07500 gene hupB 194518 194790 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_07500 194899 195750 gene locus_tag LOCUS_07510 194899 195750 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_07510 195866 196822 gene locus_tag LOCUS_07520 195866 196822 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_07520 196915 198060 gene locus_tag LOCUS_07530 196915 198060 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839746.1 protein_id gnl|my_center|LOCUS_07530 198266 199822 gene locus_tag LOCUS_07540 198266 199822 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524295.1 protein_id gnl|my_center|LOCUS_07540 199899 200147 gene locus_tag LOCUS_07550 199899 200147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 201170 200208 gene locus_tag LOCUS_07560 201170 200208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 201338 201724 gene locus_tag LOCUS_07570 201338 201724 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265636.1 protein_id gnl|my_center|LOCUS_07570 203672 201837 gene locus_tag LOCUS_07580 203672 201837 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_07580 204798 203752 gene locus_tag LOCUS_07590 204798 203752 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_07590 205315 206592 gene locus_tag LOCUS_07600 205315 206592 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_07600 206921 207595 gene locus_tag LOCUS_07610 206921 207595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 208226 207663 gene locus_tag LOCUS_07620 208226 207663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 208401 209447 gene locus_tag LOCUS_07630 gene dprA 208401 209447 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_07630 209745 210728 gene locus_tag LOCUS_07640 209745 210728 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_07640 211639 210767 gene locus_tag LOCUS_07650 gene lipA 211639 210767 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_07650 212546 211767 gene locus_tag LOCUS_07660 212546 211767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 212735 214069 gene locus_tag LOCUS_07670 212735 214069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 214091 214741 gene locus_tag LOCUS_07680 gene upp 214091 214741 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_07680 214942 215331 gene locus_tag LOCUS_07690 214942 215331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 215380 215772 gene locus_tag LOCUS_07700 215380 215772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 215759 218374 gene locus_tag LOCUS_07710 215759 218374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_07710 219971 218418 gene locus_tag LOCUS_07720 219971 218418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 221724 220366 gene locus_tag LOCUS_07730 221724 220366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 222800 221967 gene locus_tag LOCUS_07740 222800 221967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 223579 222836 gene locus_tag LOCUS_07750 223579 222836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 224174 223587 gene locus_tag LOCUS_07760 224174 223587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 224481 225578 gene locus_tag LOCUS_07770 224481 225578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 225664 226575 gene locus_tag LOCUS_07780 225664 226575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 227671 226625 gene locus_tag LOCUS_07790 227671 226625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 228172 227690 gene locus_tag LOCUS_07800 228172 227690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 231197 228288 gene locus_tag LOCUS_07810 231197 228288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 231618 234788 gene locus_tag LOCUS_07820 231618 234788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 236278 234839 gene locus_tag LOCUS_07830 236278 234839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 237904 236486 gene locus_tag LOCUS_07840 237904 236486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760038.1 protein_id gnl|my_center|LOCUS_07840 239202 237907 gene locus_tag LOCUS_07850 239202 237907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 239980 239246 gene locus_tag LOCUS_07860 239980 239246 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_07860 241521 239998 gene locus_tag LOCUS_07870 gene purH 241521 239998 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_07870 241717 242943 gene locus_tag LOCUS_07880 241717 242943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 244356 243127 gene locus_tag LOCUS_07890 244356 243127 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_07890 244799 246355 gene locus_tag LOCUS_07900 244799 246355 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_07900 249098 246480 gene locus_tag LOCUS_07910 249098 246480 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_07910 249418 249095 gene locus_tag LOCUS_07920 249418 249095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 250015 249545 gene locus_tag LOCUS_07930 250015 249545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 250850 250008 gene locus_tag LOCUS_07940 gene tatC 250850 250008 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_07940 251356 252282 gene locus_tag LOCUS_07950 251356 252282 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_07950 252525 253319 gene locus_tag LOCUS_07960 252525 253319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 253397 253714 gene locus_tag LOCUS_07970 253397 253714 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256425.1 protein_id gnl|my_center|LOCUS_07970 253781 255022 gene locus_tag LOCUS_07980 253781 255022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 255862 255056 gene locus_tag LOCUS_07990 255862 255056 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_07990 258807 256234 gene locus_tag LOCUS_08000 258807 256234 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_08000 259030 259545 gene locus_tag LOCUS_08010 259030 259545 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_08010 259591 260088 gene locus_tag LOCUS_08020 259591 260088 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_08020 260868 260200 gene locus_tag LOCUS_08030 260868 260200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 261343 260855 gene locus_tag LOCUS_08040 261343 260855 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_08040 262615 261698 gene locus_tag LOCUS_08050 262615 261698 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774253.1 protein_id gnl|my_center|LOCUS_08050 264028 262874 gene locus_tag LOCUS_08060 264028 262874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 264605 264012 gene locus_tag LOCUS_08070 264605 264012 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_08070 264916 266853 gene locus_tag LOCUS_08080 264916 266853 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_08080 267019 268239 gene locus_tag LOCUS_08090 267019 268239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 268343 275896 gene locus_tag LOCUS_08100 268343 275896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 278129 276177 gene locus_tag LOCUS_08110 gene glgB 278129 276177 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_08110 278977 278279 gene locus_tag LOCUS_08120 278977 278279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 279911 279255 gene locus_tag LOCUS_08130 279911 279255 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387519.1 protein_id gnl|my_center|LOCUS_08130 280300 279923 gene locus_tag LOCUS_08140 280300 279923 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_08140 280391 280969 gene locus_tag LOCUS_08150 280391 280969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 281851 281033 gene locus_tag LOCUS_08160 gene mscS 281851 281033 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_08160 282423 281968 gene locus_tag LOCUS_08170 282423 281968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 282990 282424 gene locus_tag LOCUS_08180 282990 282424 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_08180 284015 283128 gene locus_tag LOCUS_08190 284015 283128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 286063 284135 gene locus_tag LOCUS_08200 286063 284135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 286393 289584 gene locus_tag LOCUS_08210 286393 289584 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_08210 290185 289661 gene locus_tag LOCUS_08220 290185 289661 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_08220 290460 290960 gene locus_tag LOCUS_08230 290460 290960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 291143 291976 gene locus_tag LOCUS_08240 291143 291976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 292210 292025 gene locus_tag LOCUS_08250 292210 292025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 292408 297066 gene locus_tag LOCUS_08260 292408 297066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 298131 297268 gene locus_tag LOCUS_08270 298131 297268 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_08270 298355 298819 gene locus_tag LOCUS_08280 298355 298819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 298820 299938 gene locus_tag LOCUS_08290 gene mtnA 298820 299938 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 protein_id gnl|my_center|LOCUS_08290 300173 303202 gene locus_tag LOCUS_08300 300173 303202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_08300 303855 303256 gene locus_tag LOCUS_08310 303855 303256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 304173 305444 gene locus_tag LOCUS_08320 304173 305444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020227.1 protein_id gnl|my_center|LOCUS_08320 306389 305472 gene locus_tag LOCUS_08330 306389 305472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 306400 306633 gene locus_tag LOCUS_08340 306400 306633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 307088 306630 gene locus_tag LOCUS_08350 307088 306630 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_08350 307313 307861 gene locus_tag LOCUS_08360 307313 307861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 308821 308174 gene locus_tag LOCUS_08370 308821 308174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 309165 310193 gene locus_tag LOCUS_08380 309165 310193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence004 1473 118 gene locus_tag LOCUS_08390 gene gdhA 1473 118 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_08390 1703 2365 gene locus_tag LOCUS_08400 1703 2365 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_08400 3547 2402 gene locus_tag LOCUS_08410 3547 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 3767 4789 gene locus_tag LOCUS_08420 3767 4789 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_08420 4786 5499 gene locus_tag LOCUS_08430 4786 5499 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_08430 6391 5501 gene locus_tag LOCUS_08440 6391 5501 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_08440 7697 6447 gene locus_tag LOCUS_08450 gene nqrF 7697 6447 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_08450 8445 7840 gene locus_tag LOCUS_08460 gene nqrE 8445 7840 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418136.1 protein_id gnl|my_center|LOCUS_08460 9209 8484 gene locus_tag LOCUS_08470 9209 8484 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 protein_id gnl|my_center|LOCUS_08470 9947 9249 gene locus_tag LOCUS_08480 9947 9249 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333689.1 protein_id gnl|my_center|LOCUS_08480 11317 10049 gene locus_tag LOCUS_08490 11317 10049 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_08490 12981 11347 gene locus_tag LOCUS_08500 12981 11347 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_08500 13913 13311 gene locus_tag LOCUS_08510 gene pnuC 13913 13311 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206028.1 protein_id gnl|my_center|LOCUS_08510 16701 14182 gene locus_tag LOCUS_08520 16701 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 17791 16793 gene locus_tag LOCUS_08530 17791 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 18910 17891 gene locus_tag LOCUS_08540 18910 17891 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_08540 19997 19182 gene locus_tag LOCUS_08550 19997 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771186.1 protein_id gnl|my_center|LOCUS_08550 20837 20151 gene locus_tag LOCUS_08560 20837 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 21092 22132 gene locus_tag LOCUS_08570 21092 22132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 22676 23236 gene locus_tag LOCUS_08580 22676 23236 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_08580 23243 23932 gene locus_tag LOCUS_08590 23243 23932 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_08590 24234 26093 gene locus_tag LOCUS_08600 24234 26093 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_08600 26556 26134 gene locus_tag LOCUS_08610 gene paaI 26556 26134 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_08610 26877 27326 gene locus_tag LOCUS_08620 26877 27326 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_08620 27323 28750 gene locus_tag LOCUS_08630 27323 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 30104 28854 gene locus_tag LOCUS_08640 30104 28854 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143163.1 protein_id gnl|my_center|LOCUS_08640 32818 30659 gene locus_tag LOCUS_08650 gene rnr 32818 30659 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_08650 33388 32891 gene locus_tag LOCUS_08660 33388 32891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 33639 34358 gene locus_tag LOCUS_08670 33639 34358 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_08670 34394 36403 gene locus_tag LOCUS_08680 34394 36403 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_08680 36490 37245 gene locus_tag LOCUS_08690 36490 37245 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_08690 37573 38172 gene locus_tag LOCUS_08700 37573 38172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 38340 38984 gene locus_tag LOCUS_08710 38340 38984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 39190 39852 gene locus_tag LOCUS_08720 39190 39852 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_08720 41116 39923 gene locus_tag LOCUS_08730 41116 39923 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_08730 41372 42061 gene locus_tag LOCUS_08740 41372 42061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 42173 43372 gene locus_tag LOCUS_08750 42173 43372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 43382 44425 gene locus_tag LOCUS_08760 43382 44425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 44412 45170 gene locus_tag LOCUS_08770 44412 45170 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_08770 45515 45195 gene locus_tag LOCUS_08780 45515 45195 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_08780 45884 45618 gene locus_tag LOCUS_08790 45884 45618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 46376 45885 gene locus_tag LOCUS_08800 46376 45885 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_08800 46855 46373 gene locus_tag LOCUS_08810 46855 46373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615583.1 protein_id gnl|my_center|LOCUS_08810 49373 46968 gene locus_tag LOCUS_08820 49373 46968 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_08820 49695 49546 gene locus_tag LOCUS_08830 49695 49546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 49676 50050 gene locus_tag LOCUS_08840 49676 50050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 50219 51883 gene locus_tag LOCUS_08850 50219 51883 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090948.1 protein_id gnl|my_center|LOCUS_08850 51947 52627 gene locus_tag LOCUS_08860 51947 52627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 52743 53867 gene locus_tag LOCUS_08870 52743 53867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 53889 56159 gene locus_tag LOCUS_08880 53889 56159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 56170 56811 gene locus_tag LOCUS_08890 56170 56811 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_08890 57107 56910 gene locus_tag LOCUS_08900 57107 56910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 57737 57489 gene locus_tag LOCUS_08910 57737 57489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 58610 59788 gene locus_tag LOCUS_08920 58610 59788 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_08920 60201 63083 gene locus_tag LOCUS_08930 gene gcvP 60201 63083 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_08930 63361 64338 gene locus_tag LOCUS_08940 gene rfaD 63361 64338 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_08940 64767 64354 gene locus_tag LOCUS_08950 64767 64354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 65482 64781 gene locus_tag LOCUS_08960 65482 64781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 66425 65493 gene locus_tag LOCUS_08970 gene hemC 66425 65493 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_08970 66468 67508 gene locus_tag LOCUS_08980 gene lpxD 66468 67508 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_08980 67650 69038 gene locus_tag LOCUS_08990 67650 69038 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_08990 69035 69850 gene locus_tag LOCUS_09000 gene lpxA 69035 69850 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_09000 69825 70457 gene locus_tag LOCUS_09010 gene ccmA 69825 70457 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_09010 70785 70459 gene locus_tag LOCUS_09020 70785 70459 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_09020 72418 70967 gene locus_tag LOCUS_09030 gene gatB 72418 70967 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404637.1 protein_id gnl|my_center|LOCUS_09030 73477 72434 gene locus_tag LOCUS_09040 73477 72434 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928862.1 protein_id gnl|my_center|LOCUS_09040 74569 73565 gene locus_tag LOCUS_09050 74569 73565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 75871 74702 gene locus_tag LOCUS_09060 75871 74702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 76874 75885 gene locus_tag LOCUS_09070 76874 75885 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_09070 77377 79998 gene locus_tag LOCUS_09080 gene alaS 77377 79998 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_09080 81503 80031 gene locus_tag LOCUS_09090 81503 80031 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_09090 81704 83059 gene locus_tag LOCUS_09100 81704 83059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 83950 83123 gene locus_tag LOCUS_09110 83950 83123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 84155 85498 gene locus_tag LOCUS_09120 84155 85498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 87207 85546 gene locus_tag LOCUS_09130 87207 85546 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373408.1 protein_id gnl|my_center|LOCUS_09130 87313 87849 gene locus_tag LOCUS_09140 87313 87849 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_09140 88589 87906 gene locus_tag LOCUS_09150 88589 87906 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_09150 89732 88683 gene locus_tag LOCUS_09160 89732 88683 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_09160 91094 89766 gene locus_tag LOCUS_09170 gene hemL 91094 89766 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071513.1 protein_id gnl|my_center|LOCUS_09170 91284 92291 gene locus_tag LOCUS_09180 91284 92291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 92338 93123 gene locus_tag LOCUS_09190 92338 93123 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_09190 97653 93208 gene locus_tag LOCUS_09200 97653 93208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 98020 98553 gene locus_tag LOCUS_09210 98020 98553 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_09210 98627 98827 gene locus_tag LOCUS_09220 gene rpmF 98627 98827 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_09220 99076 99459 gene locus_tag LOCUS_09230 99076 99459 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_09230 99472 100485 gene locus_tag LOCUS_09240 gene trpS 99472 100485 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_09240 100491 101111 gene locus_tag LOCUS_09250 100491 101111 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_09250 101236 102492 gene locus_tag LOCUS_09260 gene metK 101236 102492 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_09260 103283 102681 gene locus_tag LOCUS_09270 103283 102681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 103978 103286 gene locus_tag LOCUS_09280 103978 103286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 107589 103993 gene locus_tag LOCUS_09290 107589 103993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 107838 109310 gene locus_tag LOCUS_09300 107838 109310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 111190 109373 gene locus_tag LOCUS_09310 111190 109373 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_09310 111916 111281 gene locus_tag LOCUS_09320 111916 111281 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_09320 112648 112055 gene locus_tag LOCUS_09330 112648 112055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 113346 112765 gene locus_tag LOCUS_09340 113346 112765 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454679.1 protein_id gnl|my_center|LOCUS_09340 115643 113358 gene locus_tag LOCUS_09350 115643 113358 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_09350 118715 116076 gene locus_tag LOCUS_09360 118715 116076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_09360 119068 118739 gene locus_tag LOCUS_09370 119068 118739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 120213 119467 gene locus_tag LOCUS_09380 120213 119467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 121132 120239 gene locus_tag LOCUS_09390 gene alkA 121132 120239 CDS product DNA-3-methyladenine glycosidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234926.1 protein_id gnl|my_center|LOCUS_09390 121422 121129 gene locus_tag LOCUS_09400 121422 121129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 121616 121476 gene locus_tag LOCUS_09410 121616 121476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 122605 121748 gene locus_tag LOCUS_09420 122605 121748 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444347.1 protein_id gnl|my_center|LOCUS_09420 122886 122728 gene locus_tag LOCUS_09430 122886 122728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 124374 122893 gene locus_tag LOCUS_09440 124374 122893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 125201 124341 gene locus_tag LOCUS_09450 125201 124341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 126419 125430 gene locus_tag LOCUS_09460 126419 125430 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_09460 127192 127365 gene locus_tag LOCUS_09470 127192 127365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 128957 127881 gene locus_tag LOCUS_09480 128957 127881 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130602656.1 protein_id gnl|my_center|LOCUS_09480 129343 129044 gene locus_tag LOCUS_09490 129343 129044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 129775 129479 gene locus_tag LOCUS_09500 129775 129479 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_09500 129943 132519 gene locus_tag LOCUS_09510 129943 132519 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_09510 132645 133151 gene locus_tag LOCUS_09520 132645 133151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 133579 133148 gene locus_tag LOCUS_09530 133579 133148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 135082 133646 gene locus_tag LOCUS_09540 135082 133646 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928419.1 protein_id gnl|my_center|LOCUS_09540 137142 135253 gene locus_tag LOCUS_09550 137142 135253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 137623 137264 gene locus_tag LOCUS_09560 137623 137264 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370120.1 protein_id gnl|my_center|LOCUS_09560 138100 137720 gene locus_tag LOCUS_09570 138100 137720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 138345 139367 gene locus_tag LOCUS_09580 138345 139367 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027223809.1 protein_id gnl|my_center|LOCUS_09580 140050 139400 gene locus_tag LOCUS_09590 140050 139400 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_09590 141171 140077 gene locus_tag LOCUS_09600 141171 140077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 141751 142227 gene locus_tag LOCUS_09610 141751 142227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 142489 145665 gene locus_tag LOCUS_09620 142489 145665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 145797 146237 gene locus_tag LOCUS_09630 145797 146237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 146382 147242 gene locus_tag LOCUS_09640 146382 147242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 149613 147997 gene locus_tag LOCUS_09650 gene lepB 149613 147997 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963265.1 protein_id gnl|my_center|LOCUS_09650 150095 149742 gene locus_tag LOCUS_09660 150095 149742 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_09660 150548 150099 gene locus_tag LOCUS_09670 150548 150099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 151772 150753 gene locus_tag LOCUS_09680 151772 150753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 152080 152841 gene locus_tag LOCUS_09690 152080 152841 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_09690 154444 152894 gene locus_tag LOCUS_09700 154444 152894 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098999755.1 protein_id gnl|my_center|LOCUS_09700 155914 154451 gene locus_tag LOCUS_09710 155914 154451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 156830 157507 gene locus_tag LOCUS_09720 gene rpe 156830 157507 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_09720 157661 160219 gene locus_tag LOCUS_09730 157661 160219 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_09730 165571 160568 gene locus_tag LOCUS_09740 165571 160568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 166086 166745 gene locus_tag LOCUS_09750 166086 166745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 166908 168302 gene locus_tag LOCUS_09760 166908 168302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 168447 169196 gene locus_tag LOCUS_09770 168447 169196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 169251 170393 gene locus_tag LOCUS_09780 169251 170393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 171329 170604 gene locus_tag LOCUS_09790 171329 170604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 171580 171813 gene locus_tag LOCUS_09800 171580 171813 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_09800 171825 172319 gene locus_tag LOCUS_09810 171825 172319 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141969.1 protein_id gnl|my_center|LOCUS_09810 174558 172339 gene locus_tag LOCUS_09820 174558 172339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 178068 174565 gene locus_tag LOCUS_09830 178068 174565 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_09830 179066 178185 gene locus_tag LOCUS_09840 179066 178185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_09840 179699 179139 gene locus_tag LOCUS_09850 179699 179139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 180360 181913 gene locus_tag LOCUS_09860 180360 181913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 181910 182611 gene locus_tag LOCUS_09870 181910 182611 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_09870 182599 182988 gene locus_tag LOCUS_09880 182599 182988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 184024 183212 gene locus_tag LOCUS_09890 184024 183212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 184458 185936 gene locus_tag LOCUS_09900 184458 185936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 186288 187490 gene locus_tag LOCUS_09910 186288 187490 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816129.1 protein_id gnl|my_center|LOCUS_09910 187666 189255 gene locus_tag LOCUS_09920 187666 189255 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_09920 189339 191861 gene locus_tag LOCUS_09930 189339 191861 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_09930 191910 192461 gene locus_tag LOCUS_09940 191910 192461 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925627.1 protein_id gnl|my_center|LOCUS_09940 192635 193066 gene locus_tag LOCUS_09950 192635 193066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 193182 193955 gene locus_tag LOCUS_09960 193182 193955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 195853 194141 gene locus_tag LOCUS_09970 195853 194141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 198798 196264 gene locus_tag LOCUS_09980 198798 196264 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_09980 199109 201538 gene locus_tag LOCUS_09990 199109 201538 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_09990 202433 201561 gene locus_tag LOCUS_10000 202433 201561 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_10000 202753 203151 gene locus_tag LOCUS_10010 202753 203151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 203672 204895 gene locus_tag LOCUS_10020 203672 204895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 204988 207141 gene locus_tag LOCUS_10030 204988 207141 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_10030 207291 208079 gene locus_tag LOCUS_10040 207291 208079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 208359 210761 gene locus_tag LOCUS_10050 208359 210761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_10050 212203 210812 gene locus_tag LOCUS_10060 gene fumC 212203 210812 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_10060 212477 213106 gene locus_tag LOCUS_10070 212477 213106 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_10070 214066 213662 gene locus_tag LOCUS_10080 214066 213662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 214404 216062 gene locus_tag LOCUS_10090 gene recN 214404 216062 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_10090 216106 216906 gene locus_tag LOCUS_10100 216106 216906 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_10100 217085 219019 gene locus_tag LOCUS_10110 217085 219019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 219108 219671 gene locus_tag LOCUS_10120 219108 219671 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921906.1 protein_id gnl|my_center|LOCUS_10120 219904 220770 gene locus_tag LOCUS_10130 219904 220770 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_10130 220899 223301 gene locus_tag LOCUS_10140 gene pbpC 220899 223301 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_10140 225942 224023 gene locus_tag LOCUS_10150 225942 224023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 226185 226036 gene locus_tag LOCUS_10160 226185 226036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 227218 226454 gene locus_tag LOCUS_10170 227218 226454 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_10170 227322 228167 gene locus_tag LOCUS_10180 227322 228167 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_10180 228616 228185 gene locus_tag LOCUS_10190 228616 228185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 230274 228709 gene locus_tag LOCUS_10200 230274 228709 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_10200 230730 230281 gene locus_tag LOCUS_10210 230730 230281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 231620 230808 gene locus_tag LOCUS_10220 gene kdsA 231620 230808 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_10220 232292 233107 gene locus_tag LOCUS_10230 232292 233107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 233680 233159 gene locus_tag LOCUS_10240 233680 233159 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_10240 233870 234472 gene locus_tag LOCUS_10250 gene sigK 233870 234472 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466900.1 protein_id gnl|my_center|LOCUS_10250 234509 235276 gene locus_tag LOCUS_10260 234509 235276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 237863 236073 gene locus_tag LOCUS_10270 gene lepA 237863 236073 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_10270 238341 239123 gene locus_tag LOCUS_10280 238341 239123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 239929 239180 gene locus_tag LOCUS_10290 239929 239180 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_10290 241078 240113 gene locus_tag LOCUS_10300 241078 240113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 241773 241258 gene locus_tag LOCUS_10310 241773 241258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 242776 241979 gene locus_tag LOCUS_10320 242776 241979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 244623 242860 gene locus_tag LOCUS_10330 244623 242860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 246328 245189 gene locus_tag LOCUS_10340 246328 245189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 246482 246294 gene locus_tag LOCUS_10350 246482 246294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 246666 247241 gene locus_tag LOCUS_10360 246666 247241 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962220.1 protein_id gnl|my_center|LOCUS_10360 247294 250635 gene locus_tag LOCUS_10370 247294 250635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 250653 251597 gene locus_tag LOCUS_10380 250653 251597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 251974 251606 gene locus_tag LOCUS_10390 251974 251606 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_10390 256060 252149 gene locus_tag LOCUS_10400 256060 252149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 258910 257981 gene locus_tag LOCUS_10410 258910 257981 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_10410 264044 259008 gene locus_tag LOCUS_10420 264044 259008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence005 1259 153 gene locus_tag LOCUS_10430 1259 153 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107326.1 protein_id gnl|my_center|LOCUS_10430 1996 1259 gene locus_tag LOCUS_10440 1996 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2929 2006 gene locus_tag LOCUS_10450 2929 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10450 3882 2941 gene locus_tag LOCUS_10460 3882 2941 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_10460 5310 3994 gene locus_tag LOCUS_10470 5310 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5951 5307 gene locus_tag LOCUS_10480 5951 5307 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_10480 6125 6964 gene locus_tag LOCUS_10490 6125 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6992 8101 gene locus_tag LOCUS_10500 6992 8101 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_10500 8085 8861 gene locus_tag LOCUS_10510 8085 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 8963 10030 gene locus_tag LOCUS_10520 8963 10030 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_10520 10048 10926 gene locus_tag LOCUS_10530 10048 10926 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_10530 10929 11363 gene locus_tag LOCUS_10540 10929 11363 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_10540 11506 12801 gene locus_tag LOCUS_10550 11506 12801 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_10550 12808 13059 gene locus_tag LOCUS_10560 12808 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 13056 13646 gene locus_tag LOCUS_10570 13056 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 13658 15910 gene locus_tag LOCUS_10580 13658 15910 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_10580 16054 16518 gene locus_tag LOCUS_10590 16054 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 16751 17161 gene locus_tag LOCUS_10600 16751 17161 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_10600 17536 18408 gene locus_tag LOCUS_10610 17536 18408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 18459 18908 gene locus_tag LOCUS_10620 18459 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 19003 19296 gene locus_tag LOCUS_10630 19003 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 19516 20055 gene locus_tag LOCUS_10640 19516 20055 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065852.1 protein_id gnl|my_center|LOCUS_10640 20311 21171 gene locus_tag LOCUS_10650 20311 21171 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_10650 21479 22732 gene locus_tag LOCUS_10660 21479 22732 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_10660 22799 23548 gene locus_tag LOCUS_10670 22799 23548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 23553 24125 gene locus_tag LOCUS_10680 23553 24125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 24189 24683 gene locus_tag LOCUS_10690 24189 24683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 24685 25803 gene locus_tag LOCUS_10700 24685 25803 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113032.1 protein_id gnl|my_center|LOCUS_10700 25989 25840 gene locus_tag LOCUS_10710 25989 25840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 25952 26821 gene locus_tag LOCUS_10720 25952 26821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 28053 26884 gene locus_tag LOCUS_10730 gene argE 28053 26884 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_10730 29514 28111 gene locus_tag LOCUS_10740 29514 28111 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_10740 29637 30038 gene locus_tag LOCUS_10750 29637 30038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 30124 31818 gene locus_tag LOCUS_10760 30124 31818 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405517.1 protein_id gnl|my_center|LOCUS_10760 31927 32394 gene locus_tag LOCUS_10770 31927 32394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 33900 32401 gene locus_tag LOCUS_10780 33900 32401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 35371 34481 gene locus_tag LOCUS_10790 35371 34481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 35802 35368 gene locus_tag LOCUS_10800 35802 35368 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122034607.1 protein_id gnl|my_center|LOCUS_10800 36577 35807 gene locus_tag LOCUS_10810 36577 35807 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_10810 36773 37351 gene locus_tag LOCUS_10820 36773 37351 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_10820 37344 38636 gene locus_tag LOCUS_10830 37344 38636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 38811 39005 gene locus_tag LOCUS_10840 38811 39005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 39697 39161 gene locus_tag LOCUS_10850 39697 39161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 41476 40265 gene locus_tag LOCUS_10860 41476 40265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 41954 41481 gene locus_tag LOCUS_10870 41954 41481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 42451 41975 gene locus_tag LOCUS_10880 42451 41975 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_10880 42625 44610 gene locus_tag LOCUS_10890 gene nosZ 42625 44610 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_10890 44774 45280 gene locus_tag LOCUS_10900 44774 45280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_10900 45277 45732 gene locus_tag LOCUS_10910 45277 45732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 45744 46994 gene locus_tag LOCUS_10920 45744 46994 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_10920 46991 47776 gene locus_tag LOCUS_10930 46991 47776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_10930 47781 48563 gene locus_tag LOCUS_10940 47781 48563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 48622 49002 gene locus_tag LOCUS_10950 48622 49002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 49139 51409 gene locus_tag LOCUS_10960 49139 51409 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_10960 52358 51651 gene locus_tag LOCUS_10970 52358 51651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 53230 52526 gene locus_tag LOCUS_10980 53230 52526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 54343 53399 gene locus_tag LOCUS_10990 54343 53399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 55827 54400 gene locus_tag LOCUS_11000 55827 54400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 57168 55867 gene locus_tag LOCUS_11010 57168 55867 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926050.1 protein_id gnl|my_center|LOCUS_11010 57508 58965 gene locus_tag LOCUS_11020 57508 58965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 58971 59606 gene locus_tag LOCUS_11030 58971 59606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 60224 59715 gene locus_tag LOCUS_11040 60224 59715 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228535.1 protein_id gnl|my_center|LOCUS_11040 60382 61059 gene locus_tag LOCUS_11050 60382 61059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 61140 62063 gene locus_tag LOCUS_11060 61140 62063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 63960 62539 gene locus_tag LOCUS_11070 63960 62539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 64362 64658 gene locus_tag LOCUS_11080 64362 64658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 64679 65839 gene locus_tag LOCUS_11090 64679 65839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 66249 65842 gene locus_tag LOCUS_11100 66249 65842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 67521 66487 gene locus_tag LOCUS_11110 67521 66487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 68421 67558 gene locus_tag LOCUS_11120 68421 67558 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_11120 68522 68968 gene locus_tag LOCUS_11130 68522 68968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 70735 69086 gene locus_tag LOCUS_11140 70735 69086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 73255 70940 gene locus_tag LOCUS_11150 73255 70940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 74450 73656 gene locus_tag LOCUS_11160 74450 73656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 74988 74461 gene locus_tag LOCUS_11170 74988 74461 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_11170 75278 75871 gene locus_tag LOCUS_11180 75278 75871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 76648 75920 gene locus_tag LOCUS_11190 76648 75920 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_11190 76874 77803 gene locus_tag LOCUS_11200 76874 77803 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039893.1 protein_id gnl|my_center|LOCUS_11200 78006 80819 gene locus_tag LOCUS_11210 78006 80819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 80950 83838 gene locus_tag LOCUS_11220 80950 83838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 84942 85580 gene locus_tag LOCUS_11230 84942 85580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 85796 85614 gene locus_tag LOCUS_11240 85796 85614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 86017 86409 gene locus_tag LOCUS_11250 86017 86409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 86579 86944 gene locus_tag LOCUS_11260 86579 86944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 87002 87706 gene locus_tag LOCUS_11270 87002 87706 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_11270 87703 88347 gene locus_tag LOCUS_11280 87703 88347 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_11280 88631 89329 gene locus_tag LOCUS_11290 88631 89329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 89478 90647 gene locus_tag LOCUS_11300 89478 90647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 91446 91054 gene locus_tag LOCUS_11310 gene cadR 91446 91054 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812014.1 protein_id gnl|my_center|LOCUS_11310 91542 91991 gene locus_tag LOCUS_11320 91542 91991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 92049 92603 gene locus_tag LOCUS_11330 92049 92603 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_11330 92767 93828 gene locus_tag LOCUS_11340 92767 93828 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_11340 94059 95420 gene locus_tag LOCUS_11350 94059 95420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 95417 95944 gene locus_tag LOCUS_11360 95417 95944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 95941 96486 gene locus_tag LOCUS_11370 95941 96486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 96636 97265 gene locus_tag LOCUS_11380 96636 97265 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_11380 97262 98752 gene locus_tag LOCUS_11390 97262 98752 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485823.1 protein_id gnl|my_center|LOCUS_11390 99008 99802 gene locus_tag LOCUS_11400 99008 99802 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_11400 99892 100707 gene locus_tag LOCUS_11410 99892 100707 CDS product aspartyl protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074724765.1 protein_id gnl|my_center|LOCUS_11410 101369 100977 gene locus_tag LOCUS_11420 101369 100977 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083170.1 protein_id gnl|my_center|LOCUS_11420 101593 103353 gene locus_tag LOCUS_11430 101593 103353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 103489 104505 gene locus_tag LOCUS_11440 103489 104505 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791938.1 protein_id gnl|my_center|LOCUS_11440 104583 105443 gene locus_tag LOCUS_11450 104583 105443 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_11450 105955 105746 gene locus_tag LOCUS_11460 105955 105746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 105932 106300 gene locus_tag LOCUS_11470 105932 106300 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_11470 106306 106515 gene locus_tag LOCUS_11480 106306 106515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 106588 107307 gene locus_tag LOCUS_11490 106588 107307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 107380 108285 gene locus_tag LOCUS_11500 107380 108285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 108290 109432 gene locus_tag LOCUS_11510 108290 109432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 109816 111330 gene locus_tag LOCUS_11520 109816 111330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 111482 112279 gene locus_tag LOCUS_11530 111482 112279 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665481.1 protein_id gnl|my_center|LOCUS_11530 112400 112951 gene locus_tag LOCUS_11540 112400 112951 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464126.1 protein_id gnl|my_center|LOCUS_11540 113822 112956 gene locus_tag LOCUS_11550 113822 112956 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_11550 114725 113868 gene locus_tag LOCUS_11560 114725 113868 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_11560 115571 114990 gene locus_tag LOCUS_11570 gene rsxA 115571 114990 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_11570 116315 115674 gene locus_tag LOCUS_11580 116315 115674 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_11580 117047 116352 gene locus_tag LOCUS_11590 117047 116352 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_11590 118063 117044 gene locus_tag LOCUS_11600 118063 117044 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_11600 119414 118053 gene locus_tag LOCUS_11610 gene rsxC 119414 118053 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_11610 124351 119495 gene locus_tag LOCUS_11620 124351 119495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 124883 124503 gene locus_tag LOCUS_11630 124883 124503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 125389 125955 gene locus_tag LOCUS_11640 125389 125955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073723.1 protein_id gnl|my_center|LOCUS_11640 126145 126516 gene locus_tag LOCUS_11650 126145 126516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 126544 127464 gene locus_tag LOCUS_11660 126544 127464 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_11660 127606 128046 gene locus_tag LOCUS_11670 127606 128046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 128053 128586 gene locus_tag LOCUS_11680 128053 128586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 128588 129607 gene locus_tag LOCUS_11690 128588 129607 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300523.1 protein_id gnl|my_center|LOCUS_11690 129759 130358 gene locus_tag LOCUS_11700 129759 130358 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072768.1 protein_id gnl|my_center|LOCUS_11700 130496 131617 gene locus_tag LOCUS_11710 130496 131617 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_11710 131787 132512 gene locus_tag LOCUS_11720 131787 132512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 133924 132665 gene locus_tag LOCUS_11730 133924 132665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 134036 134929 gene locus_tag LOCUS_11740 134036 134929 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_11740 135436 134954 gene locus_tag LOCUS_11750 135436 134954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 135966 135439 gene locus_tag LOCUS_11760 135966 135439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 136747 135989 gene locus_tag LOCUS_11770 136747 135989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 136881 137786 gene locus_tag LOCUS_11780 gene mmuM 136881 137786 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966620.1 protein_id gnl|my_center|LOCUS_11780 137900 138595 gene locus_tag LOCUS_11790 137900 138595 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868122.1 protein_id gnl|my_center|LOCUS_11790 139720 138686 gene locus_tag LOCUS_11800 139720 138686 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974518.1 protein_id gnl|my_center|LOCUS_11800 141140 140103 gene locus_tag LOCUS_11810 141140 140103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 142303 141317 gene locus_tag LOCUS_11820 142303 141317 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_11820 144782 142440 gene locus_tag LOCUS_11830 144782 142440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 144998 145981 gene locus_tag LOCUS_11840 144998 145981 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827578.1 protein_id gnl|my_center|LOCUS_11840 146122 148536 gene locus_tag LOCUS_11850 146122 148536 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_11850 148696 150009 gene locus_tag LOCUS_11860 148696 150009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 150897 150154 gene locus_tag LOCUS_11870 150897 150154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 151032 151958 gene locus_tag LOCUS_11880 151032 151958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 152355 151948 gene locus_tag LOCUS_11890 152355 151948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 153271 152675 gene locus_tag LOCUS_11900 153271 152675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 153682 153305 gene locus_tag LOCUS_11910 153682 153305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 154152 153799 gene locus_tag LOCUS_11920 154152 153799 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_11920 154435 154124 gene locus_tag LOCUS_11930 154435 154124 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869619.1 protein_id gnl|my_center|LOCUS_11930 155151 154801 gene locus_tag LOCUS_11940 155151 154801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 155570 155163 gene locus_tag LOCUS_11950 155570 155163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 156496 155633 gene locus_tag LOCUS_11960 156496 155633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 157346 156633 gene locus_tag LOCUS_11970 157346 156633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 158362 157454 gene locus_tag LOCUS_11980 158362 157454 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_11980 159525 158749 gene locus_tag LOCUS_11990 159525 158749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 160982 159552 gene locus_tag LOCUS_12000 160982 159552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 162280 161108 gene locus_tag LOCUS_12010 162280 161108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 163250 162438 gene locus_tag LOCUS_12020 163250 162438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 164179 163277 gene locus_tag LOCUS_12030 164179 163277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 165074 164223 gene locus_tag LOCUS_12040 165074 164223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 166279 165380 gene locus_tag LOCUS_12050 166279 165380 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958087.1 protein_id gnl|my_center|LOCUS_12050 167201 166323 gene locus_tag LOCUS_12060 167201 166323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 167748 168590 gene locus_tag LOCUS_12070 167748 168590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 168727 169896 gene locus_tag LOCUS_12080 168727 169896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 171910 169955 gene locus_tag LOCUS_12090 171910 169955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 173190 172174 gene locus_tag LOCUS_12100 173190 172174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 173445 173645 gene locus_tag LOCUS_12110 173445 173645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 174779 173751 gene locus_tag LOCUS_12120 174779 173751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 176969 174801 gene locus_tag LOCUS_12130 176969 174801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 178214 177243 gene locus_tag LOCUS_12140 178214 177243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 185457 178285 gene locus_tag LOCUS_12150 185457 178285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 186009 185791 gene locus_tag LOCUS_12160 186009 185791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 187554 186019 gene locus_tag LOCUS_12170 gene gltX 187554 186019 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765418.1 protein_id gnl|my_center|LOCUS_12170 188012 188668 gene locus_tag LOCUS_12180 188012 188668 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_12180 188896 189375 gene locus_tag LOCUS_12190 188896 189375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 189394 190695 gene locus_tag LOCUS_12200 189394 190695 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_12200 191104 190760 gene locus_tag LOCUS_12210 191104 190760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933888.1 protein_id gnl|my_center|LOCUS_12210 192653 191142 gene locus_tag LOCUS_12220 gene atpD 192653 191142 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_12220 193019 194017 gene locus_tag LOCUS_12230 193019 194017 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_12230 194107 195639 gene locus_tag LOCUS_12240 194107 195639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 195636 196718 gene locus_tag LOCUS_12250 195636 196718 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_12250 197006 199204 gene locus_tag LOCUS_12260 197006 199204 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_12260 200072 199320 gene locus_tag LOCUS_12270 200072 199320 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404513.1 protein_id gnl|my_center|LOCUS_12270 200470 201180 gene locus_tag LOCUS_12280 200470 201180 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_12280 201527 201270 gene locus_tag LOCUS_12290 201527 201270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 201543 202391 gene locus_tag LOCUS_12300 201543 202391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 203020 202583 gene locus_tag LOCUS_12310 203020 202583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 203815 203027 gene locus_tag LOCUS_12320 203815 203027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 203863 205323 gene locus_tag LOCUS_12330 203863 205323 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_12330 205503 205820 gene locus_tag LOCUS_12340 205503 205820 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_12340 205983 206054 gene locus_tag LOCUS_t00070 205983 206054 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 206284 206105 gene locus_tag LOCUS_12350 206284 206105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 206478 207047 gene locus_tag LOCUS_12360 206478 207047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 207257 207078 gene locus_tag LOCUS_12370 207257 207078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 209934 207703 gene locus_tag LOCUS_12380 209934 207703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 211658 209976 gene locus_tag LOCUS_12390 211658 209976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 212002 211739 gene locus_tag LOCUS_12400 212002 211739 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108573.1 protein_id gnl|my_center|LOCUS_12400 212179 212436 gene locus_tag LOCUS_12410 212179 212436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 213121 212684 gene locus_tag LOCUS_12420 gene dut 213121 212684 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_12420 213326 213108 gene locus_tag LOCUS_12430 213326 213108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 213492 213316 gene locus_tag LOCUS_12440 213492 213316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 214017 213688 gene locus_tag LOCUS_12450 214017 213688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 215275 213992 gene locus_tag LOCUS_12460 215275 213992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 215616 215272 gene locus_tag LOCUS_12470 215616 215272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 215899 215609 gene locus_tag LOCUS_12480 215899 215609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 216674 216000 gene locus_tag LOCUS_12490 216674 216000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 218061 216706 gene locus_tag LOCUS_12500 218061 216706 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_12500 218557 222576 gene locus_tag LOCUS_12510 218557 222576 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_12510 222672 223139 gene locus_tag LOCUS_12520 222672 223139 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528017.1 protein_id gnl|my_center|LOCUS_12520 226214 223461 gene locus_tag LOCUS_12530 226214 223461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 227929 226202 gene locus_tag LOCUS_12540 227929 226202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 228402 228701 gene locus_tag LOCUS_12550 228402 228701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 228714 228929 gene locus_tag LOCUS_12560 228714 228929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 229336 230115 gene locus_tag LOCUS_12570 229336 230115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 230287 231234 gene locus_tag LOCUS_12580 230287 231234 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836209.1 protein_id gnl|my_center|LOCUS_12580 231369 231875 gene locus_tag LOCUS_12590 231369 231875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 231963 233039 gene locus_tag LOCUS_12600 231963 233039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 233036 233734 gene locus_tag LOCUS_12610 233036 233734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 233884 234651 gene locus_tag LOCUS_12620 233884 234651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 234868 235632 gene locus_tag LOCUS_12630 234868 235632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 236096 239785 gene locus_tag LOCUS_12640 236096 239785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 240755 239838 gene locus_tag LOCUS_12650 240755 239838 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_12650 242939 240840 gene locus_tag LOCUS_12660 gene rpsA 242939 240840 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_12660 243164 244837 gene locus_tag LOCUS_12670 gene fadD 243164 244837 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360594.1 protein_id gnl|my_center|LOCUS_12670 246403 244910 gene locus_tag LOCUS_12680 246403 244910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 247167 246400 gene locus_tag LOCUS_12690 247167 246400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 248435 247194 gene locus_tag LOCUS_12700 248435 247194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence006 119 592 gene locus_tag LOCUS_12710 119 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 657 1709 gene locus_tag LOCUS_12720 657 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1879 2094 gene locus_tag LOCUS_12730 1879 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2087 3523 gene locus_tag LOCUS_12740 2087 3523 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_12740 3752 4225 gene locus_tag LOCUS_12750 gene lrp 3752 4225 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664572.1 protein_id gnl|my_center|LOCUS_12750 4305 5117 gene locus_tag LOCUS_12760 4305 5117 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970375.1 protein_id gnl|my_center|LOCUS_12760 5872 5339 gene locus_tag LOCUS_12770 gene yjjX 5872 5339 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 protein_id gnl|my_center|LOCUS_12770 6171 7727 gene locus_tag LOCUS_12780 6171 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 7889 9115 gene locus_tag LOCUS_12790 7889 9115 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_12790 10049 9132 gene locus_tag LOCUS_12800 10049 9132 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_12800 10856 10092 gene locus_tag LOCUS_12810 10856 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 11116 11204 gene locus_tag LOCUS_t00080 11116 11204 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12636 11278 gene locus_tag LOCUS_12820 12636 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 16018 13151 gene locus_tag LOCUS_12830 16018 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 17329 16142 gene locus_tag LOCUS_12840 17329 16142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 17604 17326 gene locus_tag LOCUS_12850 17604 17326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 18849 17722 gene locus_tag LOCUS_12860 18849 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 19432 19986 gene locus_tag LOCUS_12870 19432 19986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 21357 20179 gene locus_tag LOCUS_12880 21357 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 22149 24638 gene locus_tag LOCUS_12890 22149 24638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 24981 26393 gene locus_tag LOCUS_12900 24981 26393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 27208 29535 gene locus_tag LOCUS_12910 27208 29535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 29554 31053 gene locus_tag LOCUS_12920 29554 31053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 31202 33250 gene locus_tag LOCUS_12930 gene hreP 31202 33250 CDS product subtilisin/kexin-like serine protease HreP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816615.1 protein_id gnl|my_center|LOCUS_12930 33406 34335 gene locus_tag LOCUS_12940 33406 34335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 40396 34535 gene locus_tag LOCUS_12950 40396 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 41581 40580 gene locus_tag LOCUS_12960 gene tsaD 41581 40580 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_12960 41832 42215 gene locus_tag LOCUS_12970 41832 42215 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120826.1 protein_id gnl|my_center|LOCUS_12970 42356 42937 gene locus_tag LOCUS_12980 42356 42937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_12980 42934 43794 gene locus_tag LOCUS_12990 42934 43794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 43879 44415 gene locus_tag LOCUS_13000 43879 44415 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_13000 44612 46462 gene locus_tag LOCUS_13010 gene argS 44612 46462 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_13010 46528 48204 gene locus_tag LOCUS_13020 46528 48204 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_13020 52344 48415 gene locus_tag LOCUS_13030 52344 48415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 53377 52529 gene locus_tag LOCUS_13040 53377 52529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964178.1 protein_id gnl|my_center|LOCUS_13040 53758 54315 gene locus_tag LOCUS_13050 gene pyrR 53758 54315 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_13050 54319 55275 gene locus_tag LOCUS_13060 54319 55275 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_13060 55671 58451 gene locus_tag LOCUS_13070 55671 58451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 58718 60154 gene locus_tag LOCUS_13080 58718 60154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 61255 60377 gene locus_tag LOCUS_13090 61255 60377 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_13090 61470 61967 gene locus_tag LOCUS_13100 gene sixA 61470 61967 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_13100 61968 62300 gene locus_tag LOCUS_13110 61968 62300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 62598 63023 gene locus_tag LOCUS_13120 62598 63023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 63097 63981 gene locus_tag LOCUS_13130 63097 63981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 64705 64007 gene locus_tag LOCUS_13140 64705 64007 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_13140 66249 64729 gene locus_tag LOCUS_13150 66249 64729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 66319 67098 gene locus_tag LOCUS_13160 66319 67098 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109413831.1 protein_id gnl|my_center|LOCUS_13160 67246 68415 gene locus_tag LOCUS_13170 67246 68415 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_13170 69110 68460 gene locus_tag LOCUS_13180 69110 68460 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257401.1 protein_id gnl|my_center|LOCUS_13180 69450 69190 gene locus_tag LOCUS_13190 69450 69190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 69979 69431 gene locus_tag LOCUS_13200 69979 69431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 70310 73357 gene locus_tag LOCUS_13210 70310 73357 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_13210 73547 74821 gene locus_tag LOCUS_13220 73547 74821 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_13220 77768 74925 gene locus_tag LOCUS_13230 77768 74925 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_13230 77966 78775 gene locus_tag LOCUS_13240 77966 78775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 79698 78772 gene locus_tag LOCUS_13250 79698 78772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 81745 79685 gene locus_tag LOCUS_13260 81745 79685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 83929 81827 gene locus_tag LOCUS_13270 83929 81827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 85680 83926 gene locus_tag LOCUS_13280 85680 83926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 86483 85920 gene locus_tag LOCUS_13290 86483 85920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 87513 86725 gene locus_tag LOCUS_13300 87513 86725 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_13300 88296 87619 gene locus_tag LOCUS_13310 gene nreC 88296 87619 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706315.1 protein_id gnl|my_center|LOCUS_13310 90090 88309 gene locus_tag LOCUS_13320 90090 88309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 91132 90131 gene locus_tag LOCUS_13330 91132 90131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 92116 93408 gene locus_tag LOCUS_13340 92116 93408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_13340 93421 94599 gene locus_tag LOCUS_13350 93421 94599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 94732 96642 gene locus_tag LOCUS_13360 94732 96642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 96891 100550 gene locus_tag LOCUS_13370 96891 100550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 101283 100648 gene locus_tag LOCUS_13380 101283 100648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 101816 102598 gene locus_tag LOCUS_13390 101816 102598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 102591 103379 gene locus_tag LOCUS_13400 102591 103379 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_13400 103502 104467 gene locus_tag LOCUS_13410 103502 104467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 104471 105103 gene locus_tag LOCUS_13420 104471 105103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 105115 106542 gene locus_tag LOCUS_13430 105115 106542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 108031 106703 gene locus_tag LOCUS_13440 108031 106703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 117848 108102 gene locus_tag LOCUS_13450 117848 108102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 120195 117886 gene locus_tag LOCUS_13460 120195 117886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 120636 122858 gene locus_tag LOCUS_13470 120636 122858 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_13470 124189 122882 gene locus_tag LOCUS_13480 124189 122882 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158904.1 protein_id gnl|my_center|LOCUS_13480 124749 124297 gene locus_tag LOCUS_13490 124749 124297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 124842 125303 gene locus_tag LOCUS_13500 124842 125303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 125317 128145 gene locus_tag LOCUS_13510 125317 128145 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_13510 128341 128814 gene locus_tag LOCUS_13520 128341 128814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_13520 129517 129041 gene locus_tag LOCUS_13530 129517 129041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 129709 130767 gene locus_tag LOCUS_13540 129709 130767 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071748.1 protein_id gnl|my_center|LOCUS_13540 130891 131274 gene locus_tag LOCUS_13550 130891 131274 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336246.1 protein_id gnl|my_center|LOCUS_13550 131405 133075 gene locus_tag LOCUS_13560 131405 133075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 133108 135282 gene locus_tag LOCUS_13570 133108 135282 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_13570 135560 137101 gene locus_tag LOCUS_13580 135560 137101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 137186 140002 gene locus_tag LOCUS_13590 137186 140002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 141181 140024 gene locus_tag LOCUS_13600 141181 140024 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533426.1 protein_id gnl|my_center|LOCUS_13600 143075 141360 gene locus_tag LOCUS_13610 143075 141360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_13610 143273 143785 gene locus_tag LOCUS_13620 143273 143785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 144275 143799 gene locus_tag LOCUS_13630 144275 143799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 145652 144612 gene locus_tag LOCUS_13640 145652 144612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 146835 145741 gene locus_tag LOCUS_13650 146835 145741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 147098 148786 gene locus_tag LOCUS_13660 147098 148786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 149894 148971 gene locus_tag LOCUS_13670 149894 148971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 150901 149927 gene locus_tag LOCUS_13680 150901 149927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 151763 150903 gene locus_tag LOCUS_13690 151763 150903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 153386 152427 gene locus_tag LOCUS_13700 153386 152427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 156682 153590 gene locus_tag LOCUS_13710 156682 153590 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094146567.1 protein_id gnl|my_center|LOCUS_13710 157690 156767 gene locus_tag LOCUS_13720 157690 156767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 157804 159834 gene locus_tag LOCUS_13730 157804 159834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 160631 159831 gene locus_tag LOCUS_13740 160631 159831 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_13740 166613 160737 gene locus_tag LOCUS_13750 166613 160737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 167859 166687 gene locus_tag LOCUS_13760 167859 166687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 168177 168860 gene locus_tag LOCUS_13770 168177 168860 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_13770 168860 169915 gene locus_tag LOCUS_13780 168860 169915 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_13780 170025 171932 gene locus_tag LOCUS_13790 170025 171932 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_13790 173350 172448 gene locus_tag LOCUS_13800 173350 172448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 173506 173694 gene locus_tag LOCUS_13810 173506 173694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 173785 174549 gene locus_tag LOCUS_13820 173785 174549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 174634 176262 gene locus_tag LOCUS_13830 174634 176262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 178226 176595 gene locus_tag LOCUS_13840 178226 176595 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_13840 178973 178257 gene locus_tag LOCUS_13850 178973 178257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 179878 178970 gene locus_tag LOCUS_13860 179878 178970 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_13860 180258 180749 gene locus_tag LOCUS_13870 180258 180749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 182084 180837 gene locus_tag LOCUS_13880 182084 180837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 182882 182244 gene locus_tag LOCUS_13890 182882 182244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 183242 184336 gene locus_tag LOCUS_13900 gene mnmA 183242 184336 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_13900 184441 185208 gene locus_tag LOCUS_13910 184441 185208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 185219 185734 gene locus_tag LOCUS_13920 gene rimM 185219 185734 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 protein_id gnl|my_center|LOCUS_13920 185913 187307 gene locus_tag LOCUS_13930 185913 187307 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107794.1 protein_id gnl|my_center|LOCUS_13930 188654 187323 gene locus_tag LOCUS_13940 gene purB 188654 187323 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_13940 189925 188801 gene locus_tag LOCUS_13950 189925 188801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 190458 193019 gene locus_tag LOCUS_13960 gene topA 190458 193019 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964077.1 protein_id gnl|my_center|LOCUS_13960 193174 193491 gene locus_tag LOCUS_13970 193174 193491 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_13970 194004 193540 gene locus_tag LOCUS_13980 194004 193540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 194214 194855 gene locus_tag LOCUS_13990 194214 194855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 194973 196583 gene locus_tag LOCUS_14000 194973 196583 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839088.1 protein_id gnl|my_center|LOCUS_14000 196986 198785 gene locus_tag LOCUS_14010 196986 198785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 198834 200537 gene locus_tag LOCUS_14020 198834 200537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 200549 201244 gene locus_tag LOCUS_14030 200549 201244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 201247 201999 gene locus_tag LOCUS_14040 201247 201999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 202022 203968 gene locus_tag LOCUS_14050 202022 203968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 204212 205993 gene locus_tag LOCUS_14060 204212 205993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 206088 208010 gene locus_tag LOCUS_14070 206088 208010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 208067 208612 gene locus_tag LOCUS_14080 208067 208612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 208717 210096 gene locus_tag LOCUS_14090 208717 210096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 210103 210762 gene locus_tag LOCUS_14100 210103 210762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 210851 211378 gene locus_tag LOCUS_14110 210851 211378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 211391 212821 gene locus_tag LOCUS_14120 211391 212821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 212907 214217 gene locus_tag LOCUS_14130 212907 214217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 214371 216644 gene locus_tag LOCUS_14140 214371 216644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 216709 218139 gene locus_tag LOCUS_14150 216709 218139 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_14150 218233 219558 gene locus_tag LOCUS_14160 218233 219558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 219579 221144 gene locus_tag LOCUS_14170 219579 221144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 221145 221981 gene locus_tag LOCUS_14180 221145 221981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 221986 222579 gene locus_tag LOCUS_14190 221986 222579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 222636 224075 gene locus_tag LOCUS_14200 222636 224075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 224106 225278 gene locus_tag LOCUS_14210 224106 225278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 225779 226306 gene locus_tag LOCUS_14220 225779 226306 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_14220 226506 227276 gene locus_tag LOCUS_14230 226506 227276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 227375 229735 gene locus_tag LOCUS_14240 227375 229735 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671701.1 protein_id gnl|my_center|LOCUS_14240 229924 232338 gene locus_tag LOCUS_14250 229924 232338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 233506 232394 gene locus_tag LOCUS_14260 gene ald 233506 232394 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_14260 233826 234521 gene locus_tag LOCUS_14270 233826 234521 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_14270 235562 234525 gene locus_tag LOCUS_14280 235562 234525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 237456 235723 gene locus_tag LOCUS_14290 237456 235723 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_14290 238118 237468 gene locus_tag LOCUS_14300 238118 237468 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_14300 238395 239429 gene locus_tag LOCUS_14310 238395 239429 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_14310 239765 240580 gene locus_tag LOCUS_14320 239765 240580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 240694 241587 gene locus_tag LOCUS_14330 240694 241587 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030042.1 protein_id gnl|my_center|LOCUS_14330 241756 241947 gene locus_tag LOCUS_14340 gene rpsU 241756 241947 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_14340 243028 242021 gene locus_tag LOCUS_14350 243028 242021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 243344 244747 gene locus_tag LOCUS_14360 243344 244747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence007 809 303 gene locus_tag LOCUS_14370 809 303 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926824.1 protein_id gnl|my_center|LOCUS_14370 1365 985 gene locus_tag LOCUS_14380 1365 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1604 2509 gene locus_tag LOCUS_14390 1604 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4422 2767 gene locus_tag LOCUS_14400 4422 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4474 5475 gene locus_tag LOCUS_14410 4474 5475 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_14410 5575 6150 gene locus_tag LOCUS_14420 5575 6150 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_14420 6137 6685 gene locus_tag LOCUS_14430 6137 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6705 7793 gene locus_tag LOCUS_14440 6705 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 8050 9453 gene locus_tag LOCUS_14450 8050 9453 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_14450 10639 9689 gene locus_tag LOCUS_14460 10639 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 13426 10757 gene locus_tag LOCUS_14470 13426 10757 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_14470 14388 13417 gene locus_tag LOCUS_14480 14388 13417 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785429.1 protein_id gnl|my_center|LOCUS_14480 15014 14400 gene locus_tag LOCUS_14490 15014 14400 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_14490 16209 15481 gene locus_tag LOCUS_14500 16209 15481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 17499 16402 gene locus_tag LOCUS_14510 17499 16402 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_14510 18731 17514 gene locus_tag LOCUS_14520 gene hflX 18731 17514 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_14520 19936 18761 gene locus_tag LOCUS_14530 19936 18761 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_14530 20741 19962 gene locus_tag LOCUS_14540 20741 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 22431 20785 gene locus_tag LOCUS_14550 22431 20785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 24444 22948 gene locus_tag LOCUS_14560 gene pyk 24444 22948 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_14560 24791 25027 gene locus_tag LOCUS_14570 24791 25027 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007137004.1 protein_id gnl|my_center|LOCUS_14570 25167 26420 gene locus_tag LOCUS_14580 gene fabF 25167 26420 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_14580 26839 27576 gene locus_tag LOCUS_14590 26839 27576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 27583 28524 gene locus_tag LOCUS_14600 27583 28524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029874.1 protein_id gnl|my_center|LOCUS_14600 28830 29255 gene locus_tag LOCUS_14610 28830 29255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 29355 29822 gene locus_tag LOCUS_14620 29355 29822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 30196 29798 gene locus_tag LOCUS_14630 30196 29798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 30701 30267 gene locus_tag LOCUS_14640 30701 30267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 30979 31389 gene locus_tag LOCUS_14650 30979 31389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 34318 31583 gene locus_tag LOCUS_14660 34318 31583 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_14660 34848 35933 gene locus_tag LOCUS_14670 34848 35933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 36205 38133 gene locus_tag LOCUS_14680 36205 38133 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782358.1 protein_id gnl|my_center|LOCUS_14680 38890 38165 gene locus_tag LOCUS_14690 38890 38165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 39584 38874 gene locus_tag LOCUS_14700 39584 38874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 39708 40520 gene locus_tag LOCUS_14710 39708 40520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 40999 40556 gene locus_tag LOCUS_14720 40999 40556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 42078 41302 gene locus_tag LOCUS_14730 42078 41302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 42174 43052 gene locus_tag LOCUS_14740 42174 43052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 43284 44441 gene locus_tag LOCUS_14750 43284 44441 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728434.1 protein_id gnl|my_center|LOCUS_14750 44553 44861 gene locus_tag LOCUS_14760 44553 44861 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_14760 44862 46133 gene locus_tag LOCUS_14770 44862 46133 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_14770 47116 46214 gene locus_tag LOCUS_14780 47116 46214 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_14780 47279 48397 gene locus_tag LOCUS_14790 47279 48397 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189192.1 protein_id gnl|my_center|LOCUS_14790 48461 49285 gene locus_tag LOCUS_14800 48461 49285 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_14800 49915 49319 gene locus_tag LOCUS_14810 49915 49319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 50104 50802 gene locus_tag LOCUS_14820 50104 50802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 52169 50913 gene locus_tag LOCUS_14830 gene pfp 52169 50913 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_14830 52513 53574 gene locus_tag LOCUS_14840 52513 53574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 53552 55768 gene locus_tag LOCUS_14850 53552 55768 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791176.1 protein_id gnl|my_center|LOCUS_14850 55768 57882 gene locus_tag LOCUS_14860 55768 57882 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791176.1 protein_id gnl|my_center|LOCUS_14860 57885 63182 gene locus_tag LOCUS_14870 57885 63182 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_14870 64358 63258 gene locus_tag LOCUS_14880 64358 63258 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_14880 65376 64351 gene locus_tag LOCUS_14890 65376 64351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 65747 67807 gene locus_tag LOCUS_14900 65747 67807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 67908 69107 gene locus_tag LOCUS_14910 67908 69107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 69933 71108 gene locus_tag LOCUS_14920 69933 71108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 71108 71752 gene locus_tag LOCUS_14930 71108 71752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 71761 72651 gene locus_tag LOCUS_14940 71761 72651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 72663 73835 gene locus_tag LOCUS_14950 72663 73835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 73832 76435 gene locus_tag LOCUS_14960 73832 76435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 79256 76671 gene locus_tag LOCUS_14970 79256 76671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_14970 79703 79347 gene locus_tag LOCUS_14980 79703 79347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 81082 80210 gene locus_tag LOCUS_14990 81082 80210 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268112.1 protein_id gnl|my_center|LOCUS_14990 82217 81060 gene locus_tag LOCUS_15000 gene alr 82217 81060 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_15000 83324 82311 gene locus_tag LOCUS_15010 83324 82311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_15010 85748 83328 gene locus_tag LOCUS_15020 85748 83328 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_15020 86853 85762 gene locus_tag LOCUS_15030 86853 85762 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_15030 88090 86864 gene locus_tag LOCUS_15040 88090 86864 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_15040 89295 88087 gene locus_tag LOCUS_15050 89295 88087 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_15050 90637 89543 gene locus_tag LOCUS_15060 90637 89543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 91980 90634 gene locus_tag LOCUS_15070 91980 90634 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_15070 92704 92093 gene locus_tag LOCUS_15080 92704 92093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 94400 93039 gene locus_tag LOCUS_15090 94400 93039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261129.1 protein_id gnl|my_center|LOCUS_15090 95023 94397 gene locus_tag LOCUS_15100 95023 94397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103641.1 protein_id gnl|my_center|LOCUS_15100 95745 95338 gene locus_tag LOCUS_15110 95745 95338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 95966 96421 gene locus_tag LOCUS_15120 95966 96421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 98884 96518 gene locus_tag LOCUS_15130 98884 96518 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928501.1 protein_id gnl|my_center|LOCUS_15130 100348 98897 gene locus_tag LOCUS_15140 100348 98897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 101763 100351 gene locus_tag LOCUS_15150 101763 100351 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_15150 103088 101775 gene locus_tag LOCUS_15160 103088 101775 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 protein_id gnl|my_center|LOCUS_15160 104503 103085 gene locus_tag LOCUS_15170 104503 103085 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_15170 105209 104484 gene locus_tag LOCUS_15180 105209 104484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_15180 106736 105519 gene locus_tag LOCUS_15190 gene zinU 106736 105519 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_15190 107175 106756 gene locus_tag LOCUS_15200 107175 106756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 108210 107182 gene locus_tag LOCUS_15210 108210 107182 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_15210 108856 108215 gene locus_tag LOCUS_15220 108856 108215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 109427 108942 gene locus_tag LOCUS_15230 109427 108942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 110808 109492 gene locus_tag LOCUS_15240 110808 109492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 112214 110805 gene locus_tag LOCUS_15250 112214 110805 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_15250 112922 112221 gene locus_tag LOCUS_15260 112922 112221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_15260 114501 113146 gene locus_tag LOCUS_15270 114501 113146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 115944 114505 gene locus_tag LOCUS_15280 115944 114505 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_15280 116658 115966 gene locus_tag LOCUS_15290 116658 115966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_15290 117526 117317 gene locus_tag LOCUS_15300 117526 117317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 118507 118226 gene locus_tag LOCUS_15310 118507 118226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 119114 118632 gene locus_tag LOCUS_15320 119114 118632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 122518 120212 gene locus_tag LOCUS_15330 122518 120212 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_15330 123421 122825 gene locus_tag LOCUS_15340 123421 122825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 123767 126820 gene locus_tag LOCUS_15350 123767 126820 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202099.1 protein_id gnl|my_center|LOCUS_15350 126857 128233 gene locus_tag LOCUS_15360 126857 128233 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_15360 129178 128318 gene locus_tag LOCUS_15370 129178 128318 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_15370 129445 130413 gene locus_tag LOCUS_15380 129445 130413 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 protein_id gnl|my_center|LOCUS_15380 130417 131010 gene locus_tag LOCUS_15390 130417 131010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 133736 131124 gene locus_tag LOCUS_15400 133736 131124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 135816 133759 gene locus_tag LOCUS_15410 135816 133759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 136934 135813 gene locus_tag LOCUS_15420 136934 135813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 138131 137307 gene locus_tag LOCUS_15430 138131 137307 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108679.1 protein_id gnl|my_center|LOCUS_15430 139514 138168 gene locus_tag LOCUS_15440 139514 138168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 144705 140167 gene locus_tag LOCUS_15450 144705 140167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 145851 144883 gene locus_tag LOCUS_15460 145851 144883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 146667 145870 gene locus_tag LOCUS_15470 146667 145870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660645.1 protein_id gnl|my_center|LOCUS_15470 147775 146756 gene locus_tag LOCUS_15480 147775 146756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 149125 147866 gene locus_tag LOCUS_15490 149125 147866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 150822 149491 gene locus_tag LOCUS_15500 150822 149491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 151527 150973 gene locus_tag LOCUS_15510 151527 150973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 151697 154033 gene locus_tag LOCUS_15520 151697 154033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_15520 155342 154050 gene locus_tag LOCUS_15530 155342 154050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 156923 155376 gene locus_tag LOCUS_15540 156923 155376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 157216 156977 gene locus_tag LOCUS_15550 157216 156977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 157559 159361 gene locus_tag LOCUS_15560 157559 159361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 159901 159365 gene locus_tag LOCUS_15570 159901 159365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 160097 161254 gene locus_tag LOCUS_15580 160097 161254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 162436 161342 gene locus_tag LOCUS_15590 gene ugpC 162436 161342 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_15590 163727 162447 gene locus_tag LOCUS_15600 163727 162447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210193.1 protein_id gnl|my_center|LOCUS_15600 165153 163711 gene locus_tag LOCUS_15610 165153 163711 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_15610 165909 165169 gene locus_tag LOCUS_15620 165909 165169 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_15620 166837 165980 gene locus_tag LOCUS_15630 166837 165980 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_15630 167984 166872 gene locus_tag LOCUS_15640 167984 166872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 169243 167981 gene locus_tag LOCUS_15650 169243 167981 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804138.1 protein_id gnl|my_center|LOCUS_15650 170401 169343 gene locus_tag LOCUS_15660 170401 169343 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 protein_id gnl|my_center|LOCUS_15660 174608 170487 gene locus_tag LOCUS_15670 174608 170487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 177651 174658 gene locus_tag LOCUS_15680 177651 174658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 179190 177763 gene locus_tag LOCUS_15690 179190 177763 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_15690 182378 179247 gene locus_tag LOCUS_15700 182378 179247 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_15700 182559 183536 gene locus_tag LOCUS_15710 182559 183536 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_15710 183556 184029 gene locus_tag LOCUS_15720 183556 184029 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_15720 184098 186380 gene locus_tag LOCUS_15730 184098 186380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 186867 189689 gene locus_tag LOCUS_15740 186867 189689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 190639 189728 gene locus_tag LOCUS_15750 190639 189728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 191210 190647 gene locus_tag LOCUS_15760 191210 190647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 192327 191608 gene locus_tag LOCUS_15770 192327 191608 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_15770 194381 192324 gene locus_tag LOCUS_15780 194381 192324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 194689 194378 gene locus_tag LOCUS_15790 194689 194378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 194923 196902 gene locus_tag LOCUS_15800 194923 196902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 196899 197810 gene locus_tag LOCUS_15810 196899 197810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 197813 199153 gene locus_tag LOCUS_15820 197813 199153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 199163 200902 gene locus_tag LOCUS_15830 199163 200902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 201021 203333 gene locus_tag LOCUS_15840 201021 203333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 203534 205411 gene locus_tag LOCUS_15850 203534 205411 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069710.1 protein_id gnl|my_center|LOCUS_15850 205852 208065 gene locus_tag LOCUS_15860 205852 208065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 208633 208208 gene locus_tag LOCUS_15870 208633 208208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 209173 208646 gene locus_tag LOCUS_15880 209173 208646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 209601 210161 gene locus_tag LOCUS_15890 209601 210161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 210304 211341 gene locus_tag LOCUS_15900 210304 211341 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898981.1 protein_id gnl|my_center|LOCUS_15900 211469 213118 gene locus_tag LOCUS_15910 211469 213118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 213120 213824 gene locus_tag LOCUS_15920 213120 213824 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_15920 216121 213845 gene locus_tag LOCUS_15930 216121 213845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 216396 216851 gene locus_tag LOCUS_15940 216396 216851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 217343 219733 gene locus_tag LOCUS_15950 217343 219733 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_15950 221467 219821 gene locus_tag LOCUS_15960 gene ade 221467 219821 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_15960 222153 222788 gene locus_tag LOCUS_15970 222153 222788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 223043 223468 gene locus_tag LOCUS_15980 223043 223468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15980 223660 223588 gene locus_tag LOCUS_t00090 223660 223588 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 224803 223955 gene locus_tag LOCUS_15990 224803 223955 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_15990 225036 225620 gene locus_tag LOCUS_16000 225036 225620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 226178 225669 gene locus_tag LOCUS_16010 226178 225669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 226515 227303 gene locus_tag LOCUS_16020 226515 227303 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839609.1 protein_id gnl|my_center|LOCUS_16020 228086 227346 gene locus_tag LOCUS_16030 228086 227346 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_16030 229344 228301 gene locus_tag LOCUS_16040 229344 228301 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_16040 231465 229378 gene locus_tag LOCUS_16050 231465 229378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 231677 232813 gene locus_tag LOCUS_16060 231677 232813 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_16060 232953 233753 gene locus_tag LOCUS_16070 232953 233753 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_16070 233878 234627 gene locus_tag LOCUS_16080 233878 234627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 234614 235120 gene locus_tag LOCUS_16090 234614 235120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 235140 235577 gene locus_tag LOCUS_16100 235140 235577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 236088 235735 gene locus_tag LOCUS_16110 236088 235735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 237427 236114 gene locus_tag LOCUS_16120 237427 236114 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478185.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence008 120 578 gene locus_tag LOCUS_16130 120 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1968 610 gene locus_tag LOCUS_16140 1968 610 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_16140 2916 2029 gene locus_tag LOCUS_16150 2916 2029 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760774.1 protein_id gnl|my_center|LOCUS_16150 4891 2921 gene locus_tag LOCUS_16160 4891 2921 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_16160 6225 4954 gene locus_tag LOCUS_16170 gene purD 6225 4954 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_16170 6586 6780 gene locus_tag LOCUS_16180 6586 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 7152 9899 gene locus_tag LOCUS_16190 7152 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 10165 10755 gene locus_tag LOCUS_16200 gene ruvA 10165 10755 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_16200 11020 18408 gene locus_tag LOCUS_16210 gene sprA 11020 18408 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_16210 18696 20207 gene locus_tag LOCUS_16220 18696 20207 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_16220 20438 21160 gene locus_tag LOCUS_16230 20438 21160 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_16230 21368 22411 gene locus_tag LOCUS_16240 21368 22411 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_16240 23820 22960 gene locus_tag LOCUS_16250 gene nadC 23820 22960 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_16250 24883 24149 gene locus_tag LOCUS_16260 24883 24149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 25050 26096 gene locus_tag LOCUS_16270 25050 26096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 26179 27114 gene locus_tag LOCUS_16280 26179 27114 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_16280 27347 27568 gene locus_tag LOCUS_16290 27347 27568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 28245 27616 gene locus_tag LOCUS_16300 28245 27616 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_16300 29822 28407 gene locus_tag LOCUS_16310 29822 28407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 31508 30081 gene locus_tag LOCUS_16320 gene gatA 31508 30081 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931960.1 protein_id gnl|my_center|LOCUS_16320 32855 31515 gene locus_tag LOCUS_16330 gene hisS 32855 31515 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_16330 34154 33117 gene locus_tag LOCUS_16340 gene pheS 34154 33117 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_16340 34979 34311 gene locus_tag LOCUS_16350 34979 34311 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_16350 35258 40267 gene locus_tag LOCUS_16360 35258 40267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 41457 40300 gene locus_tag LOCUS_16370 41457 40300 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208048.1 protein_id gnl|my_center|LOCUS_16370 41499 42764 gene locus_tag LOCUS_16380 41499 42764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 43436 44074 gene locus_tag LOCUS_16390 43436 44074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 44031 44990 gene locus_tag LOCUS_16400 44031 44990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 45003 46586 gene locus_tag LOCUS_16410 45003 46586 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144228.1 protein_id gnl|my_center|LOCUS_16410 47376 47158 gene locus_tag LOCUS_16420 47376 47158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 47375 48004 gene locus_tag LOCUS_16430 47375 48004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 49395 48022 gene locus_tag LOCUS_16440 49395 48022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 50158 49364 gene locus_tag LOCUS_16450 50158 49364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 50261 50731 gene locus_tag LOCUS_16460 50261 50731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 51778 50747 gene locus_tag LOCUS_16470 51778 50747 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_16470 52947 51871 gene locus_tag LOCUS_16480 52947 51871 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_16480 53350 52961 gene locus_tag LOCUS_16490 53350 52961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 55551 54619 gene locus_tag LOCUS_16500 55551 54619 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_16500 56415 55594 gene locus_tag LOCUS_16510 56415 55594 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_16510 57690 56575 gene locus_tag LOCUS_16520 gene gmd 57690 56575 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 protein_id gnl|my_center|LOCUS_16520 58521 57742 gene locus_tag LOCUS_16530 58521 57742 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_16530 59747 58518 gene locus_tag LOCUS_16540 59747 58518 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_16540 61138 59993 gene locus_tag LOCUS_16550 61138 59993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 62870 61128 gene locus_tag LOCUS_16560 62870 61128 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_16560 64013 62877 gene locus_tag LOCUS_16570 64013 62877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 65395 64010 gene locus_tag LOCUS_16580 65395 64010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 66546 65413 gene locus_tag LOCUS_16590 66546 65413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 67529 66543 gene locus_tag LOCUS_16600 67529 66543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 68063 67533 gene locus_tag LOCUS_16610 68063 67533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 69848 68664 gene locus_tag LOCUS_16620 69848 68664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 70514 69852 gene locus_tag LOCUS_16630 70514 69852 CDS product LPS biosynthesis O-acetyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965640.1 protein_id gnl|my_center|LOCUS_16630 71681 70539 gene locus_tag LOCUS_16640 71681 70539 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_16640 72617 71730 gene locus_tag LOCUS_16650 72617 71730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 73999 72866 gene locus_tag LOCUS_16660 73999 72866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 75099 73996 gene locus_tag LOCUS_16670 75099 73996 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_16670 75567 75103 gene locus_tag LOCUS_16680 75567 75103 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558152.1 protein_id gnl|my_center|LOCUS_16680 76570 75545 gene locus_tag LOCUS_16690 76570 75545 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_16690 77751 76600 gene locus_tag LOCUS_16700 77751 76600 CDS product glycosyltransferase family 61 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190897490.1 protein_id gnl|my_center|LOCUS_16700 78932 77748 gene locus_tag LOCUS_16710 78932 77748 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_16710 79705 78935 gene locus_tag LOCUS_16720 79705 78935 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_16720 80333 79698 gene locus_tag LOCUS_16730 gene hisH 80333 79698 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 protein_id gnl|my_center|LOCUS_16730 81581 80349 gene locus_tag LOCUS_16740 81581 80349 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057959.1 protein_id gnl|my_center|LOCUS_16740 82524 81574 gene locus_tag LOCUS_16750 82524 81574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 83479 82559 gene locus_tag LOCUS_16760 83479 82559 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963504.1 protein_id gnl|my_center|LOCUS_16760 84465 83476 gene locus_tag LOCUS_16770 84465 83476 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202930.1 protein_id gnl|my_center|LOCUS_16770 85133 84462 gene locus_tag LOCUS_16780 85133 84462 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086430.1 protein_id gnl|my_center|LOCUS_16780 86208 85126 gene locus_tag LOCUS_16790 86208 85126 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407602.1 protein_id gnl|my_center|LOCUS_16790 86858 86205 gene locus_tag LOCUS_16800 86858 86205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 88144 86858 gene locus_tag LOCUS_16810 88144 86858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_16810 89044 88175 gene locus_tag LOCUS_16820 89044 88175 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_16820 90031 89045 gene locus_tag LOCUS_16830 90031 89045 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_16830 90612 90028 gene locus_tag LOCUS_16840 90612 90028 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_16840 91461 90685 gene locus_tag LOCUS_16850 91461 90685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 93930 91546 gene locus_tag LOCUS_16860 93930 91546 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_16860 94682 93942 gene locus_tag LOCUS_16870 94682 93942 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_16870 95511 94765 gene locus_tag LOCUS_16880 95511 94765 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_16880 96711 95632 gene locus_tag LOCUS_16890 96711 95632 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_16890 97632 96772 gene locus_tag LOCUS_16900 gene rfbA 97632 96772 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097851.1 protein_id gnl|my_center|LOCUS_16900 98610 98065 gene locus_tag LOCUS_16910 98610 98065 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202523.1 protein_id gnl|my_center|LOCUS_16910 99946 98645 gene locus_tag LOCUS_16920 99946 98645 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_16920 101116 99953 gene locus_tag LOCUS_16930 101116 99953 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_16930 102311 101094 gene locus_tag LOCUS_16940 gene lhgO 102311 101094 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839995.1 protein_id gnl|my_center|LOCUS_16940 102854 102321 gene locus_tag LOCUS_16950 102854 102321 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_16950 105135 104011 gene locus_tag LOCUS_16960 105135 104011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 109060 105380 gene locus_tag LOCUS_16970 gene metH 109060 105380 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_16970 109548 109739 gene locus_tag LOCUS_16980 109548 109739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 109772 110368 gene locus_tag LOCUS_16990 gene cysC 109772 110368 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_16990 110382 111284 gene locus_tag LOCUS_17000 gene cysD 110382 111284 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_17000 111369 112622 gene locus_tag LOCUS_17010 111369 112622 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_17010 113691 112666 gene locus_tag LOCUS_17020 113691 112666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 113950 115359 gene locus_tag LOCUS_17030 113950 115359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 116819 115473 gene locus_tag LOCUS_17040 116819 115473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 120022 116846 gene locus_tag LOCUS_17050 120022 116846 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176521608.1 protein_id gnl|my_center|LOCUS_17050 121928 120618 gene locus_tag LOCUS_17060 121928 120618 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764026.1 protein_id gnl|my_center|LOCUS_17060 124965 121990 gene locus_tag LOCUS_17070 124965 121990 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_17070 125658 126758 gene locus_tag LOCUS_17080 125658 126758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 128366 126795 gene locus_tag LOCUS_17090 gene glgP 128366 126795 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964175.1 protein_id gnl|my_center|LOCUS_17090 130546 128801 gene locus_tag LOCUS_17100 130546 128801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 132864 130648 gene locus_tag LOCUS_17110 132864 130648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767376.1 protein_id gnl|my_center|LOCUS_17110 133957 132938 gene locus_tag LOCUS_17120 133957 132938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_17120 135055 134084 gene locus_tag LOCUS_17130 135055 134084 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_17130 135235 137433 gene locus_tag LOCUS_17140 gene recQ 135235 137433 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_17140 137626 138054 gene locus_tag LOCUS_17150 gene aroQ 137626 138054 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_17150 138552 138040 gene locus_tag LOCUS_17160 138552 138040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 139042 138629 gene locus_tag LOCUS_17170 139042 138629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 139143 139862 gene locus_tag LOCUS_17180 gene radC 139143 139862 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_17180 139947 140195 gene locus_tag LOCUS_17190 139947 140195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 143332 140276 gene locus_tag LOCUS_17200 143332 140276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 148157 143877 gene locus_tag LOCUS_17210 148157 143877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 152796 148909 gene locus_tag LOCUS_17220 152796 148909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 153695 153324 gene locus_tag LOCUS_17230 153695 153324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 154568 156337 gene locus_tag LOCUS_17240 154568 156337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_17240 157334 156390 gene locus_tag LOCUS_17250 157334 156390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 158033 157569 gene locus_tag LOCUS_17260 158033 157569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 158388 160169 gene locus_tag LOCUS_17270 158388 160169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 160319 161365 gene locus_tag LOCUS_17280 160319 161365 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211854.1 protein_id gnl|my_center|LOCUS_17280 161670 162548 gene locus_tag LOCUS_17290 161670 162548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 162572 163171 gene locus_tag LOCUS_17300 162572 163171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 163305 163532 gene locus_tag LOCUS_17310 163305 163532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 163715 164338 gene locus_tag LOCUS_17320 163715 164338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 164382 164831 gene locus_tag LOCUS_17330 164382 164831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 164982 166982 gene locus_tag LOCUS_17340 164982 166982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 167267 170191 gene locus_tag LOCUS_17350 167267 170191 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_17350 170544 171773 gene locus_tag LOCUS_17360 170544 171773 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_17360 171784 172155 gene locus_tag LOCUS_17370 171784 172155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_17370 172176 172817 gene locus_tag LOCUS_17380 172176 172817 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_17380 172817 173728 gene locus_tag LOCUS_17390 172817 173728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 173778 174539 gene locus_tag LOCUS_17400 173778 174539 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_17400 175136 174528 gene locus_tag LOCUS_17410 175136 174528 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_17410 175548 175138 gene locus_tag LOCUS_17420 175548 175138 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_17420 177597 176206 gene locus_tag LOCUS_17430 177597 176206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 179090 178176 gene locus_tag LOCUS_17440 179090 178176 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_17440 179721 179212 gene locus_tag LOCUS_17450 179721 179212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 180247 179693 gene locus_tag LOCUS_17460 180247 179693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 180740 180264 gene locus_tag LOCUS_17470 180740 180264 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_17470 181896 180949 gene locus_tag LOCUS_17480 181896 180949 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_17480 184197 181927 gene locus_tag LOCUS_17490 184197 181927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 184335 184880 gene locus_tag LOCUS_17500 184335 184880 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_17500 185323 186162 gene locus_tag LOCUS_17510 185323 186162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 186370 187215 gene locus_tag LOCUS_17520 186370 187215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 187318 187632 gene locus_tag LOCUS_17530 187318 187632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 188484 187651 gene locus_tag LOCUS_17540 188484 187651 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292843.1 protein_id gnl|my_center|LOCUS_17540 189517 188531 gene locus_tag LOCUS_17550 189517 188531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 189635 191770 gene locus_tag LOCUS_17560 gene ligA 189635 191770 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880378.1 protein_id gnl|my_center|LOCUS_17560 191815 192564 gene locus_tag LOCUS_17570 191815 192564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_17570 192787 193584 gene locus_tag LOCUS_17580 192787 193584 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 protein_id gnl|my_center|LOCUS_17580 193675 194043 gene locus_tag LOCUS_17590 193675 194043 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764156.1 protein_id gnl|my_center|LOCUS_17590 194036 195460 gene locus_tag LOCUS_17600 194036 195460 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_17600 195861 195487 gene locus_tag LOCUS_17610 195861 195487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 198327 196048 gene locus_tag LOCUS_17620 198327 196048 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_17620 200063 198666 gene locus_tag LOCUS_17630 200063 198666 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_17630 200633 202993 gene locus_tag LOCUS_17640 200633 202993 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_17640 204971 203028 gene locus_tag LOCUS_17650 204971 203028 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_17650 205192 205632 gene locus_tag LOCUS_17660 205192 205632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 207485 205695 gene locus_tag LOCUS_17670 207485 205695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 208402 207764 gene locus_tag LOCUS_17680 208402 207764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 208562 209416 gene locus_tag LOCUS_17690 208562 209416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 209585 209743 gene locus_tag LOCUS_17700 209585 209743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 209933 210232 gene locus_tag LOCUS_17710 209933 210232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 210609 211148 gene locus_tag LOCUS_17720 210609 211148 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468869.1 protein_id gnl|my_center|LOCUS_17720 211201 211653 gene locus_tag LOCUS_17730 211201 211653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 212370 211660 gene locus_tag LOCUS_17740 212370 211660 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_17740 213897 212380 gene locus_tag LOCUS_17750 gene dnaB 213897 212380 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_17750 215466 214447 gene locus_tag LOCUS_17760 215466 214447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 215827 216720 gene locus_tag LOCUS_17770 215827 216720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_17770 216733 218049 gene locus_tag LOCUS_17780 216733 218049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_17780 219911 218316 gene locus_tag LOCUS_17790 219911 218316 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_17790 220950 219916 gene locus_tag LOCUS_17800 220950 219916 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_17800 222582 221083 gene locus_tag LOCUS_17810 222582 221083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 223608 222649 gene locus_tag LOCUS_17820 223608 222649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 224007 225260 gene locus_tag LOCUS_17830 224007 225260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 226987 225329 gene locus_tag LOCUS_17840 226987 225329 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404351.1 protein_id gnl|my_center|LOCUS_17840 228085 227141 gene locus_tag LOCUS_17850 228085 227141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 228136 229185 gene locus_tag LOCUS_17860 228136 229185 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_17860 229232 230452 gene locus_tag LOCUS_17870 229232 230452 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_17870 230541 232994 gene locus_tag LOCUS_17880 230541 232994 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence009 294 160 gene locus_tag LOCUS_17890 294 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3385 263 gene locus_tag LOCUS_17900 3385 263 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_17900 4749 3811 gene locus_tag LOCUS_17910 4749 3811 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927833.1 protein_id gnl|my_center|LOCUS_17910 5780 4749 gene locus_tag LOCUS_17920 5780 4749 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 protein_id gnl|my_center|LOCUS_17920 7150 5939 gene locus_tag LOCUS_17930 gene menJ 7150 5939 CDS product menaquinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908802.1 protein_id gnl|my_center|LOCUS_17930 8427 7156 gene locus_tag LOCUS_17940 8427 7156 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895417.1 protein_id gnl|my_center|LOCUS_17940 9569 8430 gene locus_tag LOCUS_17950 9569 8430 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532464.1 protein_id gnl|my_center|LOCUS_17950 10947 9751 gene locus_tag LOCUS_17960 10947 9751 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_17960 11122 12330 gene locus_tag LOCUS_17970 11122 12330 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_17970 12454 12885 gene locus_tag LOCUS_17980 12454 12885 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958174.1 protein_id gnl|my_center|LOCUS_17980 13937 12903 gene locus_tag LOCUS_17990 13937 12903 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_17990 14207 14482 gene locus_tag LOCUS_18000 14207 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 14563 15645 gene locus_tag LOCUS_18010 14563 15645 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410434.1 protein_id gnl|my_center|LOCUS_18010 15880 16077 gene locus_tag LOCUS_18020 15880 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 17255 16071 gene locus_tag LOCUS_18030 17255 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 17458 17907 gene locus_tag LOCUS_18040 17458 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 18244 19245 gene locus_tag LOCUS_18050 18244 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 19229 20005 gene locus_tag LOCUS_18060 19229 20005 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_18060 20108 20785 gene locus_tag LOCUS_18070 20108 20785 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408270.1 protein_id gnl|my_center|LOCUS_18070 20797 21972 gene locus_tag LOCUS_18080 20797 21972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 22018 22602 gene locus_tag LOCUS_18090 22018 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 22745 23494 gene locus_tag LOCUS_18100 22745 23494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 23497 23967 gene locus_tag LOCUS_18110 23497 23967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 25129 23954 gene locus_tag LOCUS_18120 25129 23954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 26209 25337 gene locus_tag LOCUS_18130 26209 25337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 26474 27349 gene locus_tag LOCUS_18140 26474 27349 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 protein_id gnl|my_center|LOCUS_18140 27528 28751 gene locus_tag LOCUS_18150 27528 28751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 28977 29531 gene locus_tag LOCUS_18160 28977 29531 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369089.1 protein_id gnl|my_center|LOCUS_18160 30298 29672 gene locus_tag LOCUS_18170 30298 29672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 32767 30392 gene locus_tag LOCUS_18180 32767 30392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_18180 34547 33162 gene locus_tag LOCUS_18190 34547 33162 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921345.1 protein_id gnl|my_center|LOCUS_18190 35441 34572 gene locus_tag LOCUS_18200 35441 34572 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925938.1 protein_id gnl|my_center|LOCUS_18200 36372 35545 gene locus_tag LOCUS_18210 36372 35545 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_18210 36678 37586 gene locus_tag LOCUS_18220 36678 37586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 38317 37583 gene locus_tag LOCUS_18230 38317 37583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 38576 41554 gene locus_tag LOCUS_18240 38576 41554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 42053 41586 gene locus_tag LOCUS_18250 42053 41586 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_18250 42839 42255 gene locus_tag LOCUS_18260 42839 42255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 43340 42852 gene locus_tag LOCUS_18270 43340 42852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691822.1 protein_id gnl|my_center|LOCUS_18270 44544 43480 gene locus_tag LOCUS_18280 44544 43480 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091411521.1 protein_id gnl|my_center|LOCUS_18280 45734 44625 gene locus_tag LOCUS_18290 45734 44625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 46472 45828 gene locus_tag LOCUS_18300 46472 45828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 46948 48063 gene locus_tag LOCUS_18310 46948 48063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 48943 48080 gene locus_tag LOCUS_18320 48943 48080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 50059 49154 gene locus_tag LOCUS_18330 50059 49154 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_18330 50279 50037 gene locus_tag LOCUS_18340 50279 50037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 50173 50970 gene locus_tag LOCUS_18350 50173 50970 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_18350 51033 51581 gene locus_tag LOCUS_18360 51033 51581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 51850 53277 gene locus_tag LOCUS_18370 51850 53277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 53370 53972 gene locus_tag LOCUS_18380 53370 53972 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_18380 54857 54021 gene locus_tag LOCUS_18390 gene fdhD 54857 54021 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_18390 55109 55444 gene locus_tag LOCUS_18400 55109 55444 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_18400 55448 57316 gene locus_tag LOCUS_18410 55448 57316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 57557 58897 gene locus_tag LOCUS_18420 57557 58897 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_18420 60022 58937 gene locus_tag LOCUS_18430 60022 58937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_18430 60292 60999 gene locus_tag LOCUS_18440 gene truC 60292 60999 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063386.1 protein_id gnl|my_center|LOCUS_18440 61368 61042 gene locus_tag LOCUS_18450 61368 61042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 61896 62606 gene locus_tag LOCUS_18460 61896 62606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 62677 63318 gene locus_tag LOCUS_18470 62677 63318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 64462 63353 gene locus_tag LOCUS_18480 64462 63353 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 protein_id gnl|my_center|LOCUS_18480 65154 64462 gene locus_tag LOCUS_18490 65154 64462 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660650.1 protein_id gnl|my_center|LOCUS_18490 65806 65645 gene locus_tag LOCUS_18500 65806 65645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 66351 68705 gene locus_tag LOCUS_18510 66351 68705 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_18510 69078 70157 gene locus_tag LOCUS_18520 69078 70157 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_18520 70272 70556 gene locus_tag LOCUS_18530 70272 70556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 70631 71962 gene locus_tag LOCUS_18540 70631 71962 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228803.1 protein_id gnl|my_center|LOCUS_18540 72207 76187 gene locus_tag LOCUS_18550 72207 76187 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_18550 76746 76435 gene locus_tag LOCUS_18560 76746 76435 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_18560 77171 76752 gene locus_tag LOCUS_18570 77171 76752 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_18570 78421 77177 gene locus_tag LOCUS_18580 78421 77177 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964478.1 protein_id gnl|my_center|LOCUS_18580 80031 78691 gene locus_tag LOCUS_18590 gene sufD 80031 78691 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_18590 80812 80054 gene locus_tag LOCUS_18600 gene sufC 80812 80054 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_18600 82315 80867 gene locus_tag LOCUS_18610 gene sufB 82315 80867 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_18610 83172 85175 gene locus_tag LOCUS_18620 83172 85175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 85618 86715 gene locus_tag LOCUS_18630 85618 86715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 87612 86929 gene locus_tag LOCUS_18640 87612 86929 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_18640 87711 89009 gene locus_tag LOCUS_18650 87711 89009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 89017 90165 gene locus_tag LOCUS_18660 89017 90165 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_18660 90400 91143 gene locus_tag LOCUS_18670 gene pgeF 90400 91143 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_18670 91995 91342 gene locus_tag LOCUS_18680 91995 91342 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 protein_id gnl|my_center|LOCUS_18680 92656 92928 gene locus_tag LOCUS_18690 92656 92928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 94784 93033 gene locus_tag LOCUS_18700 94784 93033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867421.1 protein_id gnl|my_center|LOCUS_18700 96401 95121 gene locus_tag LOCUS_18710 96401 95121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 96757 97389 gene locus_tag LOCUS_18720 96757 97389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 99225 97564 gene locus_tag LOCUS_18730 99225 97564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 100265 99675 gene locus_tag LOCUS_18740 100265 99675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 100774 100262 gene locus_tag LOCUS_18750 100774 100262 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405237.1 protein_id gnl|my_center|LOCUS_18750 101643 100771 gene locus_tag LOCUS_18760 101643 100771 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 protein_id gnl|my_center|LOCUS_18760 101815 104286 gene locus_tag LOCUS_18770 101815 104286 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_18770 104706 106100 gene locus_tag LOCUS_18780 104706 106100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 106925 106203 gene locus_tag LOCUS_18790 gene pgl 106925 106203 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 protein_id gnl|my_center|LOCUS_18790 108531 107014 gene locus_tag LOCUS_18800 gene zwf 108531 107014 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477796.1 protein_id gnl|my_center|LOCUS_18800 108720 109172 gene locus_tag LOCUS_18810 108720 109172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 109195 110604 gene locus_tag LOCUS_18820 gene gndA 109195 110604 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129534.1 protein_id gnl|my_center|LOCUS_18820 110758 111888 gene locus_tag LOCUS_18830 110758 111888 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747155.1 protein_id gnl|my_center|LOCUS_18830 112014 112775 gene locus_tag LOCUS_18840 112014 112775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 113110 115059 gene locus_tag LOCUS_18850 113110 115059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 116512 115100 gene locus_tag LOCUS_18860 116512 115100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 116892 117653 gene locus_tag LOCUS_18870 116892 117653 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_18870 117750 118700 gene locus_tag LOCUS_18880 gene rsgA 117750 118700 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_18880 121477 118922 gene locus_tag LOCUS_18890 121477 118922 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_18890 122404 121661 gene locus_tag LOCUS_18900 122404 121661 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_18900 122751 123815 gene locus_tag LOCUS_18910 122751 123815 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_18910 123817 124176 gene locus_tag LOCUS_18920 gene crcB 123817 124176 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405171.1 protein_id gnl|my_center|LOCUS_18920 124899 124144 gene locus_tag LOCUS_18930 124899 124144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 126753 125644 gene locus_tag LOCUS_18940 126753 125644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 128228 126870 gene locus_tag LOCUS_18950 128228 126870 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250663.1 protein_id gnl|my_center|LOCUS_18950 128867 128553 gene locus_tag LOCUS_18960 128867 128553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 130365 129127 gene locus_tag LOCUS_18970 130365 129127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_18970 131297 130491 gene locus_tag LOCUS_18980 131297 130491 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_18980 131860 131318 gene locus_tag LOCUS_18990 gene hpt 131860 131318 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_18990 133479 132079 gene locus_tag LOCUS_19000 133479 132079 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_19000 134455 133889 gene locus_tag LOCUS_19010 134455 133889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 136045 134516 gene locus_tag LOCUS_19020 gene gpmI 136045 134516 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_19020 136545 136889 gene locus_tag LOCUS_19030 136545 136889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 137696 136893 gene locus_tag LOCUS_19040 137696 136893 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_19040 138487 137726 gene locus_tag LOCUS_19050 138487 137726 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_19050 140323 138593 gene locus_tag LOCUS_19060 140323 138593 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_19060 140838 140419 gene locus_tag LOCUS_19070 140838 140419 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_19070 143036 141042 gene locus_tag LOCUS_19080 143036 141042 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_19080 143369 144214 gene locus_tag LOCUS_19090 143369 144214 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839117.1 protein_id gnl|my_center|LOCUS_19090 146771 144246 gene locus_tag LOCUS_19100 146771 144246 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_19100 147114 147584 gene locus_tag LOCUS_19110 147114 147584 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_19110 147649 148470 gene locus_tag LOCUS_19120 147649 148470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 150389 148524 gene locus_tag LOCUS_19130 gene mnmG 150389 148524 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_19130 150973 150539 gene locus_tag LOCUS_19140 150973 150539 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017285767.1 protein_id gnl|my_center|LOCUS_19140 151254 150973 gene locus_tag LOCUS_19150 151254 150973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 154113 151564 gene locus_tag LOCUS_19160 154113 151564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 158450 154269 gene locus_tag LOCUS_19170 158450 154269 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_19170 158973 159578 gene locus_tag LOCUS_19180 158973 159578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 159776 160525 gene locus_tag LOCUS_19190 159776 160525 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667090.1 protein_id gnl|my_center|LOCUS_19190 161183 160617 gene locus_tag LOCUS_19200 161183 160617 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_19200 161705 161286 gene locus_tag LOCUS_19210 161705 161286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 162074 163492 gene locus_tag LOCUS_19220 162074 163492 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_19220 163632 164417 gene locus_tag LOCUS_19230 163632 164417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 164424 164978 gene locus_tag LOCUS_19240 164424 164978 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_19240 166674 165034 gene locus_tag LOCUS_19250 166674 165034 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_19250 166901 168667 gene locus_tag LOCUS_19260 166901 168667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 169032 168673 gene locus_tag LOCUS_19270 169032 168673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 169250 169936 gene locus_tag LOCUS_19280 169250 169936 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050546848.1 protein_id gnl|my_center|LOCUS_19280 170057 173209 gene locus_tag LOCUS_19290 170057 173209 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120701253.1 protein_id gnl|my_center|LOCUS_19290 173460 174740 gene locus_tag LOCUS_19300 173460 174740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 174816 175016 gene locus_tag LOCUS_19310 174816 175016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 175232 175753 gene locus_tag LOCUS_19320 175232 175753 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931713.1 protein_id gnl|my_center|LOCUS_19320 175798 176367 gene locus_tag LOCUS_19330 175798 176367 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921279.1 protein_id gnl|my_center|LOCUS_19330 176449 178053 gene locus_tag LOCUS_19340 gene atpA 176449 178053 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_19340 178078 178974 gene locus_tag LOCUS_19350 gene atpG 178078 178974 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_19350 179106 179702 gene locus_tag LOCUS_19360 179106 179702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 179816 181186 gene locus_tag LOCUS_19370 179816 181186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 181279 182370 gene locus_tag LOCUS_19380 181279 182370 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897600.1 protein_id gnl|my_center|LOCUS_19380 182573 185608 gene locus_tag LOCUS_19390 182573 185608 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_19390 185814 186692 gene locus_tag LOCUS_19400 185814 186692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 186735 187754 gene locus_tag LOCUS_19410 186735 187754 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130541252.1 protein_id gnl|my_center|LOCUS_19410 188643 187759 gene locus_tag LOCUS_19420 188643 187759 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_19420 188760 189350 gene locus_tag LOCUS_19430 188760 189350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 189488 190066 gene locus_tag LOCUS_19440 189488 190066 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_19440 190083 191237 gene locus_tag LOCUS_19450 gene dnaJ 190083 191237 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_19450 191319 191795 gene locus_tag LOCUS_19460 191319 191795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 192963 191884 gene locus_tag LOCUS_19470 192963 191884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 193235 193474 gene locus_tag LOCUS_19480 193235 193474 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_19480 196350 193534 gene locus_tag LOCUS_19490 gene carB 196350 193534 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_19490 197310 196621 gene locus_tag LOCUS_19500 197310 196621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 197658 201305 gene locus_tag LOCUS_19510 197658 201305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 201416 205357 gene locus_tag LOCUS_19520 201416 205357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 205421 206461 gene locus_tag LOCUS_19530 205421 206461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 206735 207208 gene locus_tag LOCUS_19540 gene greA 206735 207208 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_19540 207260 207655 gene locus_tag LOCUS_19550 207260 207655 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_19550 208236 207652 gene locus_tag LOCUS_19560 gene ruvC 208236 207652 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_19560 208376 209407 gene locus_tag LOCUS_19570 208376 209407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 209442 210251 gene locus_tag LOCUS_19580 209442 210251 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_19580 210491 211105 gene locus_tag LOCUS_19590 210491 211105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 211181 211257 gene locus_tag LOCUS_t00100 211181 211257 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 213596 211347 gene locus_tag LOCUS_19600 213596 211347 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538435.1 protein_id gnl|my_center|LOCUS_19600 213873 214262 gene locus_tag LOCUS_19610 213873 214262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 214354 215274 gene locus_tag LOCUS_19620 214354 215274 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108261.1 protein_id gnl|my_center|LOCUS_19620 215432 215920 gene locus_tag LOCUS_19630 215432 215920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 216026 216943 gene locus_tag LOCUS_19640 216026 216943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 217147 219237 gene locus_tag LOCUS_19650 217147 219237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence010 <1 666 gene locus_tag LOCUS_19660 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108607.1:hybrid sensor histidine kinase/response regulator transcription factor 938 1867 gene locus_tag LOCUS_19670 938 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2083 4935 gene locus_tag LOCUS_19680 2083 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 6859 4979 gene locus_tag LOCUS_19690 6859 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 7481 11644 gene locus_tag LOCUS_19700 7481 11644 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_19700 11909 12838 gene locus_tag LOCUS_19710 11909 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 13847 12993 gene locus_tag LOCUS_19720 gene qqlR 13847 12993 CDS product N-acyl homoserine lactonase QqlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_19720 13962 14240 gene locus_tag LOCUS_19730 13962 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19730 14283 14612 gene locus_tag LOCUS_19740 14283 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19740 15227 14619 gene locus_tag LOCUS_19750 15227 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 15362 17032 gene locus_tag LOCUS_19760 15362 17032 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_19760 18261 17287 gene locus_tag LOCUS_19770 18261 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 19723 18368 gene locus_tag LOCUS_19780 19723 18368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 19865 20386 gene locus_tag LOCUS_19790 19865 20386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 21294 20461 gene locus_tag LOCUS_19800 21294 20461 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_19800 21544 22884 gene locus_tag LOCUS_19810 21544 22884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 23063 23449 gene locus_tag LOCUS_19820 23063 23449 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_19820 24602 24988 gene locus_tag LOCUS_19830 24602 24988 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_19830 25078 26277 gene locus_tag LOCUS_19840 25078 26277 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_19840 26363 27310 gene locus_tag LOCUS_19850 26363 27310 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963218.1 protein_id gnl|my_center|LOCUS_19850 27415 27918 gene locus_tag LOCUS_19860 27415 27918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 28352 27969 gene locus_tag LOCUS_19870 28352 27969 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_19870 29145 28330 gene locus_tag LOCUS_19880 29145 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766739.1 protein_id gnl|my_center|LOCUS_19880 29332 29748 gene locus_tag LOCUS_19890 29332 29748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 31354 29738 gene locus_tag LOCUS_19900 31354 29738 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_19900 31831 39177 gene locus_tag LOCUS_19910 31831 39177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 39337 48048 gene locus_tag LOCUS_19920 39337 48048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 48085 49389 gene locus_tag LOCUS_19930 48085 49389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 52077 49447 gene locus_tag LOCUS_19940 52077 49447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_19940 53742 52279 gene locus_tag LOCUS_19950 53742 52279 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262575.1 protein_id gnl|my_center|LOCUS_19950 58402 53873 gene locus_tag LOCUS_19960 gene gltB 58402 53873 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480840.1 protein_id gnl|my_center|LOCUS_19960 59889 58837 gene locus_tag LOCUS_19970 59889 58837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 60934 59945 gene locus_tag LOCUS_19980 60934 59945 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_19980 61162 62310 gene locus_tag LOCUS_19990 61162 62310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 62589 64742 gene locus_tag LOCUS_20000 62589 64742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 65283 64861 gene locus_tag LOCUS_20010 65283 64861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 65554 66072 gene locus_tag LOCUS_20020 65554 66072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 66145 68508 gene locus_tag LOCUS_20030 66145 68508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 68656 70071 gene locus_tag LOCUS_20040 68656 70071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 70139 72088 gene locus_tag LOCUS_20050 70139 72088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 73010 72129 gene locus_tag LOCUS_20060 73010 72129 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_20060 74180 73530 gene locus_tag LOCUS_20070 74180 73530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 74360 74698 gene locus_tag LOCUS_20080 74360 74698 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073636.1 protein_id gnl|my_center|LOCUS_20080 74915 75709 gene locus_tag LOCUS_20090 74915 75709 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_20090 75780 77420 gene locus_tag LOCUS_20100 75780 77420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 77830 77483 gene locus_tag LOCUS_20110 77830 77483 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261019.1 protein_id gnl|my_center|LOCUS_20110 78000 79613 gene locus_tag LOCUS_20120 78000 79613 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_20120 79640 82306 gene locus_tag LOCUS_20130 79640 82306 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_20130 82459 82716 gene locus_tag LOCUS_20140 82459 82716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 82694 82768 gene locus_tag LOCUS_t00110 82694 82768 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 82834 83082 gene locus_tag LOCUS_20150 gene rpmB 82834 83082 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771445.1 protein_id gnl|my_center|LOCUS_20150 83164 83352 gene locus_tag LOCUS_20160 gene rpmG 83164 83352 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_20160 83425 83601 gene locus_tag LOCUS_20170 83425 83601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 83769 84722 gene locus_tag LOCUS_20180 gene ftsY 83769 84722 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_20180 85798 84818 gene locus_tag LOCUS_20190 85798 84818 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_20190 88076 85992 gene locus_tag LOCUS_20200 88076 85992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 88321 88073 gene locus_tag LOCUS_20210 88321 88073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 89024 88359 gene locus_tag LOCUS_20220 89024 88359 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862987.1 protein_id gnl|my_center|LOCUS_20220 89858 89109 gene locus_tag LOCUS_20230 89858 89109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 91345 89855 gene locus_tag LOCUS_20240 91345 89855 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244146.1 protein_id gnl|my_center|LOCUS_20240 92384 91329 gene locus_tag LOCUS_20250 gene dmpG 92384 91329 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393276.1 protein_id gnl|my_center|LOCUS_20250 93043 93822 gene locus_tag LOCUS_20260 93043 93822 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679809.1 protein_id gnl|my_center|LOCUS_20260 94394 93864 gene locus_tag LOCUS_20270 94394 93864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 95968 94553 gene locus_tag LOCUS_20280 95968 94553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 97379 95988 gene locus_tag LOCUS_20290 97379 95988 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_20290 97657 97962 gene locus_tag LOCUS_20300 97657 97962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 99056 97980 gene locus_tag LOCUS_20310 99056 97980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 99240 100136 gene locus_tag LOCUS_20320 99240 100136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 101168 100188 gene locus_tag LOCUS_20330 101168 100188 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_20330 102009 101401 gene locus_tag LOCUS_20340 102009 101401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 102762 105731 gene locus_tag LOCUS_20350 102762 105731 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202056.1 protein_id gnl|my_center|LOCUS_20350 105897 107270 gene locus_tag LOCUS_20360 105897 107270 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_20360 108892 107345 gene locus_tag LOCUS_20370 108892 107345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 109168 110265 gene locus_tag LOCUS_20380 109168 110265 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_20380 111691 110309 gene locus_tag LOCUS_20390 111691 110309 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_20390 113233 111728 gene locus_tag LOCUS_20400 gene gldJ 113233 111728 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_20400 114684 113653 gene locus_tag LOCUS_20410 114684 113653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 114897 118775 gene locus_tag LOCUS_20420 gene porU 114897 118775 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_20420 118878 120080 gene locus_tag LOCUS_20430 gene porV 118878 120080 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_20430 121632 123590 gene locus_tag LOCUS_20440 121632 123590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 123718 125175 gene locus_tag LOCUS_20450 gene crtI 123718 125175 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_20450 125422 126123 gene locus_tag LOCUS_20460 125422 126123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 126206 127045 gene locus_tag LOCUS_20470 126206 127045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 127115 128305 gene locus_tag LOCUS_20480 127115 128305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 129672 128431 gene locus_tag LOCUS_20490 129672 128431 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103877.1 protein_id gnl|my_center|LOCUS_20490 132036 129820 gene locus_tag LOCUS_20500 132036 129820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 133078 132125 gene locus_tag LOCUS_20510 133078 132125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 133710 136523 gene locus_tag LOCUS_20520 133710 136523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 139897 136853 gene locus_tag LOCUS_20530 139897 136853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157307892.1 protein_id gnl|my_center|LOCUS_20530 140824 139994 gene locus_tag LOCUS_20540 140824 139994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 141568 142251 gene locus_tag LOCUS_20550 141568 142251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 142567 143037 gene locus_tag LOCUS_20560 142567 143037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 144534 143200 gene locus_tag LOCUS_20570 gene argH 144534 143200 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_20570 145814 144675 gene locus_tag LOCUS_20580 145814 144675 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_20580 146589 145807 gene locus_tag LOCUS_20590 gene argB 146589 145807 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_20590 147537 146593 gene locus_tag LOCUS_20600 147537 146593 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_20600 148784 147633 gene locus_tag LOCUS_20610 148784 147633 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_20610 149799 148843 gene locus_tag LOCUS_20620 gene argC 149799 148843 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_20620 151001 149796 gene locus_tag LOCUS_20630 151001 149796 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_20630 151569 150991 gene locus_tag LOCUS_20640 151569 150991 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_20640 155008 152195 gene locus_tag LOCUS_20650 155008 152195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 155619 155041 gene locus_tag LOCUS_20660 155619 155041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 155824 156396 gene locus_tag LOCUS_20670 155824 156396 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_20670 156469 157281 gene locus_tag LOCUS_20680 156469 157281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 157421 158608 gene locus_tag LOCUS_20690 157421 158608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 159828 158644 gene locus_tag LOCUS_20700 159828 158644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 160046 163006 gene locus_tag LOCUS_20710 160046 163006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 163313 164053 gene locus_tag LOCUS_20720 163313 164053 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172331.1 protein_id gnl|my_center|LOCUS_20720 164243 166690 gene locus_tag LOCUS_20730 164243 166690 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_20730 168019 166829 gene locus_tag LOCUS_20740 168019 166829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 168383 171532 gene locus_tag LOCUS_20750 168383 171532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_20750 172553 171591 gene locus_tag LOCUS_20760 172553 171591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 174184 172751 gene locus_tag LOCUS_20770 174184 172751 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928739.1 protein_id gnl|my_center|LOCUS_20770 175613 174177 gene locus_tag LOCUS_20780 175613 174177 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_20780 176321 175620 gene locus_tag LOCUS_20790 176321 175620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_20790 177548 176322 gene locus_tag LOCUS_20800 177548 176322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784605.1 protein_id gnl|my_center|LOCUS_20800 179919 177562 gene locus_tag LOCUS_20810 179919 177562 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_20810 180318 182522 gene locus_tag LOCUS_20820 180318 182522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 182772 183410 gene locus_tag LOCUS_20830 182772 183410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 183677 184474 gene locus_tag LOCUS_20840 183677 184474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 185292 184762 gene locus_tag LOCUS_20850 185292 184762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 186602 185304 gene locus_tag LOCUS_20860 186602 185304 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890728.1 protein_id gnl|my_center|LOCUS_20860 187405 186632 gene locus_tag LOCUS_20870 187405 186632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 188412 187654 gene locus_tag LOCUS_20880 188412 187654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 189617 189096 gene locus_tag LOCUS_20890 189617 189096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 190676 191413 gene locus_tag LOCUS_20900 190676 191413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 191641 193239 gene locus_tag LOCUS_20910 191641 193239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 194934 193228 gene locus_tag LOCUS_20920 194934 193228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 196052 195003 gene locus_tag LOCUS_20930 196052 195003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 197578 196175 gene locus_tag LOCUS_20940 197578 196175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 198545 197595 gene locus_tag LOCUS_20950 198545 197595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 198878 201742 gene locus_tag LOCUS_20960 198878 201742 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_20960 201723 202679 gene locus_tag LOCUS_20970 201723 202679 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_20970 204760 202721 gene locus_tag LOCUS_20980 204760 202721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 205553 204984 gene locus_tag LOCUS_20990 gene purN 205553 204984 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_20990 206685 205759 gene locus_tag LOCUS_21000 206685 205759 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_21000 207995 206799 gene locus_tag LOCUS_21010 gene coaBC 207995 206799 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence011 363 4586 gene locus_tag LOCUS_21020 363 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 4744 7974 gene locus_tag LOCUS_21030 4744 7974 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21030 8055 8435 gene locus_tag LOCUS_21040 8055 8435 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_21040 8432 11287 gene locus_tag LOCUS_21050 8432 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 11396 11890 gene locus_tag LOCUS_21060 11396 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 12070 12909 gene locus_tag LOCUS_21070 12070 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 13013 14518 gene locus_tag LOCUS_21080 13013 14518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 14566 15039 gene locus_tag LOCUS_21090 14566 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 15970 15050 gene locus_tag LOCUS_21100 15970 15050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 16888 16034 gene locus_tag LOCUS_21110 16888 16034 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_21110 17239 18969 gene locus_tag LOCUS_21120 17239 18969 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_21120 19108 20715 gene locus_tag LOCUS_21130 19108 20715 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_21130 21707 20949 gene locus_tag LOCUS_21140 gene map 21707 20949 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_21140 21937 22269 gene locus_tag LOCUS_21150 21937 22269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 22968 22528 gene locus_tag LOCUS_21160 22968 22528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 23226 24584 gene locus_tag LOCUS_21170 23226 24584 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_21170 24592 25488 gene locus_tag LOCUS_21180 24592 25488 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918150.1 protein_id gnl|my_center|LOCUS_21180 25492 26091 gene locus_tag LOCUS_21190 25492 26091 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_21190 26207 26374 gene locus_tag LOCUS_21200 26207 26374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 26677 27258 gene locus_tag LOCUS_21210 26677 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 28540 27281 gene locus_tag LOCUS_21220 28540 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 30368 28812 gene locus_tag LOCUS_21230 30368 28812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 32324 30768 gene locus_tag LOCUS_21240 32324 30768 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882938.1 protein_id gnl|my_center|LOCUS_21240 33817 32327 gene locus_tag LOCUS_21250 33817 32327 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922193.1 protein_id gnl|my_center|LOCUS_21250 34254 36743 gene locus_tag LOCUS_21260 34254 36743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 36861 37784 gene locus_tag LOCUS_21270 36861 37784 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383242.1 protein_id gnl|my_center|LOCUS_21270 37997 39526 gene locus_tag LOCUS_21280 37997 39526 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178932430.1 protein_id gnl|my_center|LOCUS_21280 39618 40619 gene locus_tag LOCUS_21290 39618 40619 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_21290 40633 41874 gene locus_tag LOCUS_21300 40633 41874 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_21300 42692 41889 gene locus_tag LOCUS_21310 42692 41889 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_21310 45793 42764 gene locus_tag LOCUS_21320 45793 42764 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256767.1 protein_id gnl|my_center|LOCUS_21320 46427 47467 gene locus_tag LOCUS_21330 46427 47467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 47472 48293 gene locus_tag LOCUS_21340 47472 48293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 48564 49091 gene locus_tag LOCUS_21350 48564 49091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 50036 49683 gene locus_tag LOCUS_21360 50036 49683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 50242 50577 gene locus_tag LOCUS_21370 50242 50577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 52372 50588 gene locus_tag LOCUS_21380 52372 50588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 52518 54236 gene locus_tag LOCUS_21390 52518 54236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 54233 54928 gene locus_tag LOCUS_21400 54233 54928 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_21400 55001 55765 gene locus_tag LOCUS_21410 55001 55765 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948600.1 protein_id gnl|my_center|LOCUS_21410 56461 55769 gene locus_tag LOCUS_21420 56461 55769 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921829.1 protein_id gnl|my_center|LOCUS_21420 58170 56461 gene locus_tag LOCUS_21430 58170 56461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 58280 59449 gene locus_tag LOCUS_21440 58280 59449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 61704 59497 gene locus_tag LOCUS_21450 61704 59497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 61928 62950 gene locus_tag LOCUS_21460 61928 62950 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_21460 62953 63669 gene locus_tag LOCUS_21470 62953 63669 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_21470 63827 65980 gene locus_tag LOCUS_21480 63827 65980 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_21480 67403 66024 gene locus_tag LOCUS_21490 67403 66024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918241.1 protein_id gnl|my_center|LOCUS_21490 68288 67464 gene locus_tag LOCUS_21500 68288 67464 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 protein_id gnl|my_center|LOCUS_21500 70142 68301 gene locus_tag LOCUS_21510 70142 68301 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_21510 70552 72081 gene locus_tag LOCUS_21520 70552 72081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 72583 75720 gene locus_tag LOCUS_21530 72583 75720 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_21530 75811 76260 gene locus_tag LOCUS_21540 75811 76260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 76388 77035 gene locus_tag LOCUS_21550 76388 77035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 78093 77071 gene locus_tag LOCUS_21560 78093 77071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 82877 78195 gene locus_tag LOCUS_21570 82877 78195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 83057 83248 gene locus_tag LOCUS_21580 83057 83248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 83239 84120 gene locus_tag LOCUS_21590 gene folD 83239 84120 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_21590 84113 84955 gene locus_tag LOCUS_21600 gene prmA 84113 84955 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_21600 85160 89632 gene locus_tag LOCUS_21610 85160 89632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 89812 90246 gene locus_tag LOCUS_21620 89812 90246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 90452 90973 gene locus_tag LOCUS_21630 90452 90973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 91082 91654 gene locus_tag LOCUS_21640 91082 91654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529193.1 protein_id gnl|my_center|LOCUS_21640 91753 92220 gene locus_tag LOCUS_21650 91753 92220 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174739.1 protein_id gnl|my_center|LOCUS_21650 92232 94427 gene locus_tag LOCUS_21660 92232 94427 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_21660 97691 94497 gene locus_tag LOCUS_21670 97691 94497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_21670 97824 99557 gene locus_tag LOCUS_21680 97824 99557 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_21680 99517 99807 gene locus_tag LOCUS_21690 99517 99807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 100903 100073 gene locus_tag LOCUS_21700 100903 100073 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_21700 102627 101044 gene locus_tag LOCUS_21710 102627 101044 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_21710 105942 102835 gene locus_tag LOCUS_21720 105942 102835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 106089 107711 gene locus_tag LOCUS_21730 106089 107711 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640267.1 protein_id gnl|my_center|LOCUS_21730 107821 109431 gene locus_tag LOCUS_21740 107821 109431 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640267.1 protein_id gnl|my_center|LOCUS_21740 110685 109453 gene locus_tag LOCUS_21750 110685 109453 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_21750 110830 111165 gene locus_tag LOCUS_21760 110830 111165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 111158 112948 gene locus_tag LOCUS_21770 111158 112948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 113250 115592 gene locus_tag LOCUS_21780 113250 115592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 115694 118159 gene locus_tag LOCUS_21790 115694 118159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 119907 118252 gene locus_tag LOCUS_21800 119907 118252 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_21800 120025 121317 gene locus_tag LOCUS_21810 120025 121317 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_21810 121461 122804 gene locus_tag LOCUS_21820 gene tilS 121461 122804 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_21820 122815 123879 gene locus_tag LOCUS_21830 122815 123879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 125281 123944 gene locus_tag LOCUS_21840 125281 123944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 125564 126523 gene locus_tag LOCUS_21850 125564 126523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 126513 126977 gene locus_tag LOCUS_21860 126513 126977 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_21860 127137 128105 gene locus_tag LOCUS_21870 127137 128105 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_21870 128163 129353 gene locus_tag LOCUS_21880 gene kbl 128163 129353 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_21880 130950 129388 gene locus_tag LOCUS_21890 130950 129388 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_21890 132648 130990 gene locus_tag LOCUS_21900 132648 130990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 132840 133376 gene locus_tag LOCUS_21910 132840 133376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 133535 134920 gene locus_tag LOCUS_21920 133535 134920 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_21920 135145 135915 gene locus_tag LOCUS_21930 135145 135915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 137168 136143 gene locus_tag LOCUS_21940 137168 136143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 137788 137180 gene locus_tag LOCUS_21950 137788 137180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 138186 139682 gene locus_tag LOCUS_21960 138186 139682 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_21960 139703 141652 gene locus_tag LOCUS_21970 139703 141652 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_21970 142300 142896 gene locus_tag LOCUS_21980 142300 142896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 143087 143890 gene locus_tag LOCUS_21990 143087 143890 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_21990 144004 144882 gene locus_tag LOCUS_22000 144004 144882 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_22000 146033 145029 gene locus_tag LOCUS_22010 gene mltG 146033 145029 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_22010 147104 146157 gene locus_tag LOCUS_22020 147104 146157 CDS product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016754.1 protein_id gnl|my_center|LOCUS_22020 147971 147156 gene locus_tag LOCUS_22030 gene panB 147971 147156 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_22030 148347 149339 gene locus_tag LOCUS_22040 148347 149339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 149507 150502 gene locus_tag LOCUS_22050 gene bla 149507 150502 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140598.1 protein_id gnl|my_center|LOCUS_22050 150773 152710 gene locus_tag LOCUS_22060 gene dnaK 150773 152710 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_22060 154486 152759 gene locus_tag LOCUS_22070 154486 152759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 155009 154584 gene locus_tag LOCUS_22080 155009 154584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 155247 156344 gene locus_tag LOCUS_22090 155247 156344 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839725.1 protein_id gnl|my_center|LOCUS_22090 156341 157111 gene locus_tag LOCUS_22100 156341 157111 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_22100 158498 157230 gene locus_tag LOCUS_22110 158498 157230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 159769 158588 gene locus_tag LOCUS_22120 159769 158588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 160687 160046 gene locus_tag LOCUS_22130 160687 160046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 161249 161028 gene locus_tag LOCUS_22140 161249 161028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 161583 162167 gene locus_tag LOCUS_22150 161583 162167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 162179 162946 gene locus_tag LOCUS_22160 162179 162946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 163073 166147 gene locus_tag LOCUS_22170 163073 166147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 166234 169251 gene locus_tag LOCUS_22180 166234 169251 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_22180 170752 169307 gene locus_tag LOCUS_22190 170752 169307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 171817 171089 gene locus_tag LOCUS_22200 171817 171089 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_22200 172780 171821 gene locus_tag LOCUS_22210 172780 171821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 173116 173688 gene locus_tag LOCUS_22220 173116 173688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 173787 174992 gene locus_tag LOCUS_22230 173787 174992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 175003 177351 gene locus_tag LOCUS_22240 175003 177351 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_22240 178471 177398 gene locus_tag LOCUS_22250 178471 177398 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_22250 179938 178820 gene locus_tag LOCUS_22260 179938 178820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 180758 180003 gene locus_tag LOCUS_22270 180758 180003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 181056 181436 gene locus_tag LOCUS_22280 181056 181436 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664252.1 protein_id gnl|my_center|LOCUS_22280 181433 183358 gene locus_tag LOCUS_22290 181433 183358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 183992 183411 gene locus_tag LOCUS_22300 183992 183411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 185200 184436 gene locus_tag LOCUS_22310 185200 184436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 187245 185536 gene locus_tag LOCUS_22320 187245 185536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 188453 187401 gene locus_tag LOCUS_22330 188453 187401 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490464.1 protein_id gnl|my_center|LOCUS_22330 188704 189135 gene locus_tag LOCUS_22340 188704 189135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 189641 189198 gene locus_tag LOCUS_22350 189641 189198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 190469 190005 gene locus_tag LOCUS_22360 gene mscL 190469 190005 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022450.1 protein_id gnl|my_center|LOCUS_22360 191043 191786 gene locus_tag LOCUS_22370 191043 191786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 192003 193121 gene locus_tag LOCUS_22380 192003 193121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 194438 193566 gene locus_tag LOCUS_22390 194438 193566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_22390 196010 194670 gene locus_tag LOCUS_22400 196010 194670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 196878 196003 gene locus_tag LOCUS_22410 196878 196003 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_22410 197180 198100 gene locus_tag LOCUS_22420 197180 198100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 199569 198163 gene locus_tag LOCUS_22430 199569 198163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence012 404 102 gene locus_tag LOCUS_22440 404 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1360 476 gene locus_tag LOCUS_22450 1360 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1575 1372 gene locus_tag LOCUS_22460 1575 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3296 1578 gene locus_tag LOCUS_22470 3296 1578 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250863.1 protein_id gnl|my_center|LOCUS_22470 3503 4435 gene locus_tag LOCUS_22480 3503 4435 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_22480 4793 4491 gene locus_tag LOCUS_22490 4793 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6957 5032 gene locus_tag LOCUS_22500 gene thrS 6957 5032 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_22500 7398 11570 gene locus_tag LOCUS_22510 7398 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 13644 11677 gene locus_tag LOCUS_22520 13644 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 13863 14345 gene locus_tag LOCUS_22530 13863 14345 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_22530 14389 15081 gene locus_tag LOCUS_22540 14389 15081 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_22540 16246 15107 gene locus_tag LOCUS_22550 16246 15107 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_22550 17379 16483 gene locus_tag LOCUS_22560 17379 16483 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_22560 18404 17550 gene locus_tag LOCUS_22570 18404 17550 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_22570 20945 18585 gene locus_tag LOCUS_22580 20945 18585 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_22580 21505 21035 gene locus_tag LOCUS_22590 21505 21035 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_22590 22168 21716 gene locus_tag LOCUS_22600 22168 21716 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528005.1 protein_id gnl|my_center|LOCUS_22600 22447 24504 gene locus_tag LOCUS_22610 gene pqqU 22447 24504 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_22610 24716 25510 gene locus_tag LOCUS_22620 24716 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 25879 26217 gene locus_tag LOCUS_22630 25879 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 30582 26353 gene locus_tag LOCUS_22640 30582 26353 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_22640 30939 31109 gene locus_tag LOCUS_22650 30939 31109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 34636 31250 gene locus_tag LOCUS_22660 34636 31250 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143960588.1 protein_id gnl|my_center|LOCUS_22660 35388 34759 gene locus_tag LOCUS_22670 35388 34759 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_22670 36296 35514 gene locus_tag LOCUS_22680 36296 35514 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_22680 36677 37105 gene locus_tag LOCUS_22690 36677 37105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 37421 38689 gene locus_tag LOCUS_22700 37421 38689 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100623.1 protein_id gnl|my_center|LOCUS_22700 38784 39488 gene locus_tag LOCUS_22710 38784 39488 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_22710 39819 41849 gene locus_tag LOCUS_22720 39819 41849 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_22720 43254 42217 gene locus_tag LOCUS_22730 43254 42217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 45035 43251 gene locus_tag LOCUS_22740 45035 43251 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_22740 45999 45115 gene locus_tag LOCUS_22750 45999 45115 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_22750 46232 49078 gene locus_tag LOCUS_22760 46232 49078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 49355 50497 gene locus_tag LOCUS_22770 gene bshA 49355 50497 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_22770 52328 50547 gene locus_tag LOCUS_22780 gene mrdA 52328 50547 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_22780 53795 52971 gene locus_tag LOCUS_22790 gene mreC 53795 52971 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_22790 54851 53814 gene locus_tag LOCUS_22800 54851 53814 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_22800 56305 55028 gene locus_tag LOCUS_22810 56305 55028 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_22810 56486 57601 gene locus_tag LOCUS_22820 gene dnaN 56486 57601 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_22820 57725 58165 gene locus_tag LOCUS_22830 57725 58165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 58162 58749 gene locus_tag LOCUS_22840 gene nadD 58162 58749 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_22840 58910 61252 gene locus_tag LOCUS_22850 58910 61252 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_22850 61610 62788 gene locus_tag LOCUS_22860 61610 62788 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_22860 62793 63305 gene locus_tag LOCUS_22870 gene folA 62793 63305 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_22870 63506 64738 gene locus_tag LOCUS_22880 63506 64738 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_22880 64770 64991 gene locus_tag LOCUS_22890 64770 64991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 65214 65732 gene locus_tag LOCUS_22900 65214 65732 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786485.1 protein_id gnl|my_center|LOCUS_22900 65713 66462 gene locus_tag LOCUS_22910 65713 66462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 66473 67270 gene locus_tag LOCUS_22920 66473 67270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 67312 68658 gene locus_tag LOCUS_22930 67312 68658 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_22930 69401 68673 gene locus_tag LOCUS_22940 69401 68673 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_22940 71833 69464 gene locus_tag LOCUS_22950 71833 69464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_22950 74058 72034 gene locus_tag LOCUS_22960 gene uvrB 74058 72034 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_22960 74156 74644 gene locus_tag LOCUS_22970 74156 74644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 74676 75896 gene locus_tag LOCUS_22980 74676 75896 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261016.1 protein_id gnl|my_center|LOCUS_22980 75996 76442 gene locus_tag LOCUS_22990 75996 76442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 77347 76481 gene locus_tag LOCUS_23000 77347 76481 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_23000 77603 78478 gene locus_tag LOCUS_23010 77603 78478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 79069 78470 gene locus_tag LOCUS_23020 79069 78470 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_23020 79385 80368 gene locus_tag LOCUS_23030 79385 80368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 81471 80704 gene locus_tag LOCUS_23040 81471 80704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 81751 85056 gene locus_tag LOCUS_23050 gene secA 81751 85056 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_23050 85399 86043 gene locus_tag LOCUS_23060 gene deoC 85399 86043 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130468.1 protein_id gnl|my_center|LOCUS_23060 86070 86468 gene locus_tag LOCUS_23070 86070 86468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 86493 87896 gene locus_tag LOCUS_23080 gene rodA 86493 87896 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_23080 88007 89044 gene locus_tag LOCUS_23090 gene tgt 88007 89044 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_23090 89158 90171 gene locus_tag LOCUS_23100 89158 90171 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_23100 90557 91078 gene locus_tag LOCUS_23110 90557 91078 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_23110 91241 92353 gene locus_tag LOCUS_23120 gene mutY 91241 92353 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_23120 92456 92920 gene locus_tag LOCUS_23130 92456 92920 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942796.1 protein_id gnl|my_center|LOCUS_23130 93107 94387 gene locus_tag LOCUS_23140 93107 94387 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_23140 94416 95009 gene locus_tag LOCUS_23150 gene gldD 94416 95009 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_23150 96224 95166 gene locus_tag LOCUS_23160 gene recA 96224 95166 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_23160 96681 96445 gene locus_tag LOCUS_23170 96681 96445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 97214 96780 gene locus_tag LOCUS_23180 97214 96780 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179084.1 protein_id gnl|my_center|LOCUS_23180 97650 97330 gene locus_tag LOCUS_23190 97650 97330 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_23190 98000 98641 gene locus_tag LOCUS_23200 98000 98641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 100899 98593 gene locus_tag LOCUS_23210 100899 98593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 101047 102135 gene locus_tag LOCUS_23220 101047 102135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 102174 102758 gene locus_tag LOCUS_23230 102174 102758 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_23230 105456 102985 gene locus_tag LOCUS_23240 105456 102985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 106353 105715 gene locus_tag LOCUS_23250 106353 105715 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_23250 106488 109991 gene locus_tag LOCUS_23260 106488 109991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 111107 110040 gene locus_tag LOCUS_23270 gene prfA 111107 110040 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289676.1 protein_id gnl|my_center|LOCUS_23270 111271 111957 gene locus_tag LOCUS_23280 gene tsaB 111271 111957 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_23280 112116 112454 gene locus_tag LOCUS_23290 112116 112454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 112620 112934 gene locus_tag LOCUS_23300 112620 112934 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 protein_id gnl|my_center|LOCUS_23300 113606 112992 gene locus_tag LOCUS_23310 113606 112992 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_23310 114368 113988 gene locus_tag LOCUS_23320 114368 113988 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_23320 115785 114709 gene locus_tag LOCUS_23330 gene pdxA 115785 114709 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964471.1 protein_id gnl|my_center|LOCUS_23330 115987 116772 gene locus_tag LOCUS_23340 gene rsmA 115987 116772 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_23340 116796 117245 gene locus_tag LOCUS_23350 116796 117245 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_23350 117431 118978 gene locus_tag LOCUS_23360 117431 118978 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_23360 119450 119019 gene locus_tag LOCUS_23370 119450 119019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 120213 119602 gene locus_tag LOCUS_23380 120213 119602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 120420 121760 gene locus_tag LOCUS_23390 120420 121760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 122662 121862 gene locus_tag LOCUS_23400 122662 121862 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 protein_id gnl|my_center|LOCUS_23400 123146 123676 gene locus_tag LOCUS_23410 123146 123676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 123795 124310 gene locus_tag LOCUS_23420 123795 124310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 124307 125116 gene locus_tag LOCUS_23430 gene murI 124307 125116 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_23430 126054 125362 gene locus_tag LOCUS_23440 gene trmB 126054 125362 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_23440 126281 128407 gene locus_tag LOCUS_23450 126281 128407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 129156 128341 gene locus_tag LOCUS_23460 129156 128341 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_23460 129480 130910 gene locus_tag LOCUS_23470 129480 130910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 130968 131912 gene locus_tag LOCUS_23480 130968 131912 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_23480 131999 132817 gene locus_tag LOCUS_23490 131999 132817 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_23490 132905 133519 gene locus_tag LOCUS_23500 gene pth 132905 133519 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_23500 134552 133581 gene locus_tag LOCUS_23510 134552 133581 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_23510 136370 134820 gene locus_tag LOCUS_23520 136370 134820 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_23520 137595 136792 gene locus_tag LOCUS_23530 137595 136792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 137966 137652 gene locus_tag LOCUS_23540 137966 137652 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_23540 138359 139222 gene locus_tag LOCUS_23550 138359 139222 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_23550 139227 139790 gene locus_tag LOCUS_23560 gene gmk 139227 139790 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_23560 139926 142280 gene locus_tag LOCUS_23570 139926 142280 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_23570 142284 143144 gene locus_tag LOCUS_23580 142284 143144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 143968 143201 gene locus_tag LOCUS_23590 143968 143201 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_23590 144647 145423 gene locus_tag LOCUS_23600 144647 145423 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_23600 145765 148329 gene locus_tag LOCUS_23610 145765 148329 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763369.1 protein_id gnl|my_center|LOCUS_23610 148689 152300 gene locus_tag LOCUS_23620 148689 152300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 152416 152820 gene locus_tag LOCUS_23630 152416 152820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 152817 153281 gene locus_tag LOCUS_23640 gene ybeY 152817 153281 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_23640 153476 155932 gene locus_tag LOCUS_23650 gene thrA 153476 155932 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_23650 155943 156875 gene locus_tag LOCUS_23660 155943 156875 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_23660 156886 158199 gene locus_tag LOCUS_23670 gene thrC 156886 158199 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_23670 158477 159571 gene locus_tag LOCUS_23680 gene mvaD 158477 159571 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_23680 159568 160104 gene locus_tag LOCUS_23690 159568 160104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 160132 161388 gene locus_tag LOCUS_23700 160132 161388 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_23700 161701 162369 gene locus_tag LOCUS_23710 161701 162369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 162504 162950 gene locus_tag LOCUS_23720 162504 162950 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_23720 164308 162995 gene locus_tag LOCUS_23730 164308 162995 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_23730 165261 164308 gene locus_tag LOCUS_23740 165261 164308 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_23740 165388 166098 gene locus_tag LOCUS_23750 165388 166098 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963735.1 protein_id gnl|my_center|LOCUS_23750 166215 167186 gene locus_tag LOCUS_23760 166215 167186 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_23760 167321 168421 gene locus_tag LOCUS_23770 167321 168421 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_23770 168568 169170 gene locus_tag LOCUS_23780 168568 169170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 171144 169276 gene locus_tag LOCUS_23790 gene htpG 171144 169276 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 protein_id gnl|my_center|LOCUS_23790 171722 174418 gene locus_tag LOCUS_23800 171722 174418 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_23800 174570 175415 gene locus_tag LOCUS_23810 174570 175415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 178543 175463 gene locus_tag LOCUS_23820 178543 175463 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_23820 178927 179052 gene locus_tag LOCUS_23830 178927 179052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 179069 179251 gene locus_tag LOCUS_23840 179069 179251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 179235 179933 gene locus_tag LOCUS_23850 179235 179933 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_23850 179964 180590 gene locus_tag LOCUS_23860 gene rsmG 179964 180590 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_23860 180693 181073 gene locus_tag LOCUS_23870 180693 181073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 181254 181655 gene locus_tag LOCUS_23880 181254 181655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 181775 182272 gene locus_tag LOCUS_23890 181775 182272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 182703 182308 gene locus_tag LOCUS_23900 182703 182308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 183242 182766 gene locus_tag LOCUS_23910 183242 182766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 187385 183384 gene locus_tag LOCUS_23920 187385 183384 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_23920 <188342 187715 gene locus_tag LOCUS_23930 <188342 187715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760349.1:thioredoxin-dependent thiol peroxidase >Feature sequence013 99 1589 gene locus_tag LOCUS_23940 99 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_23940 1808 4591 gene locus_tag LOCUS_23950 1808 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4605 8063 gene locus_tag LOCUS_23960 4605 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 10146 8074 gene locus_tag LOCUS_23970 10146 8074 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797477.1 protein_id gnl|my_center|LOCUS_23970 11560 10172 gene locus_tag LOCUS_23980 11560 10172 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_23980 12304 11642 gene locus_tag LOCUS_23990 12304 11642 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_23990 12867 12460 gene locus_tag LOCUS_24000 12867 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 14443 12953 gene locus_tag LOCUS_24010 14443 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 15560 14514 gene locus_tag LOCUS_24020 gene pseI 15560 14514 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_24020 17071 15566 gene locus_tag LOCUS_24030 17071 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 17753 17058 gene locus_tag LOCUS_24040 gene pseF 17753 17058 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_24040 18901 17750 gene locus_tag LOCUS_24050 gene pseC 18901 17750 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_24050 19935 18898 gene locus_tag LOCUS_24060 gene pseB 19935 18898 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_24060 20120 21061 gene locus_tag LOCUS_24070 20120 21061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 21123 22445 gene locus_tag LOCUS_24080 21123 22445 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_24080 24842 22455 gene locus_tag LOCUS_24090 24842 22455 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_24090 26099 25050 gene locus_tag LOCUS_24100 26099 25050 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831154.1 protein_id gnl|my_center|LOCUS_24100 28287 26185 gene locus_tag LOCUS_24110 gene ppk1 28287 26185 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460183.1 protein_id gnl|my_center|LOCUS_24110 29343 28420 gene locus_tag LOCUS_24120 29343 28420 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_24120 29606 30163 gene locus_tag LOCUS_24130 29606 30163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 30160 30927 gene locus_tag LOCUS_24140 gene tpiA 30160 30927 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_24140 31029 31862 gene locus_tag LOCUS_24150 31029 31862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 32060 32287 gene locus_tag LOCUS_24160 32060 32287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 33827 32358 gene locus_tag LOCUS_24170 gene accC 33827 32358 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_24170 34265 35056 gene locus_tag LOCUS_24180 34265 35056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 35943 35149 gene locus_tag LOCUS_24190 35943 35149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 36145 38265 gene locus_tag LOCUS_24200 36145 38265 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832365.1 protein_id gnl|my_center|LOCUS_24200 38376 39065 gene locus_tag LOCUS_24210 38376 39065 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_24210 39115 39459 gene locus_tag LOCUS_24220 gene gldC 39115 39459 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_24220 39729 40385 gene locus_tag LOCUS_24230 gene fsa 39729 40385 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789246.1 protein_id gnl|my_center|LOCUS_24230 41274 40387 gene locus_tag LOCUS_24240 41274 40387 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_24240 41363 41719 gene locus_tag LOCUS_24250 41363 41719 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014407341.1 protein_id gnl|my_center|LOCUS_24250 41736 42626 gene locus_tag LOCUS_24260 gene hemF 41736 42626 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_24260 43184 42789 gene locus_tag LOCUS_24270 43184 42789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 43407 44408 gene locus_tag LOCUS_24280 43407 44408 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_24280 45032 44397 gene locus_tag LOCUS_24290 45032 44397 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_24290 46699 45230 gene locus_tag LOCUS_24300 46699 45230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 48227 46686 gene locus_tag LOCUS_24310 gene guaA 48227 46686 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_24310 49756 48320 gene locus_tag LOCUS_24320 49756 48320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 50927 49992 gene locus_tag LOCUS_24330 gene nusB 50927 49992 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_24330 52588 51098 gene locus_tag LOCUS_24340 52588 51098 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_24340 53224 52667 gene locus_tag LOCUS_24350 53224 52667 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_24350 53429 54208 gene locus_tag LOCUS_24360 53429 54208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 54242 55264 gene locus_tag LOCUS_24370 54242 55264 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_24370 55370 56152 gene locus_tag LOCUS_24380 55370 56152 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_24380 57440 56532 gene locus_tag LOCUS_24390 57440 56532 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_24390 57591 57911 gene locus_tag LOCUS_24400 57591 57911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 58821 57982 gene locus_tag LOCUS_24410 58821 57982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 58985 60229 gene locus_tag LOCUS_24420 58985 60229 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_24420 62280 60370 gene locus_tag LOCUS_24430 62280 60370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 63483 62569 gene locus_tag LOCUS_24440 63483 62569 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184594.1 protein_id gnl|my_center|LOCUS_24440 64306 63620 gene locus_tag LOCUS_24450 64306 63620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 65119 64331 gene locus_tag LOCUS_24460 65119 64331 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015594.1 protein_id gnl|my_center|LOCUS_24460 65696 65238 gene locus_tag LOCUS_24470 65696 65238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 66038 67399 gene locus_tag LOCUS_24480 66038 67399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 68935 67466 gene locus_tag LOCUS_24490 68935 67466 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_24490 72375 69628 gene locus_tag LOCUS_24500 72375 69628 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840190.1 protein_id gnl|my_center|LOCUS_24500 73253 72630 gene locus_tag LOCUS_24510 73253 72630 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461136.1 protein_id gnl|my_center|LOCUS_24510 73540 74280 gene locus_tag LOCUS_24520 73540 74280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393975.1 protein_id gnl|my_center|LOCUS_24520 75876 74869 gene locus_tag LOCUS_24530 75876 74869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 77441 75984 gene locus_tag LOCUS_24540 77441 75984 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_24540 77772 79445 gene locus_tag LOCUS_24550 77772 79445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 79457 82153 gene locus_tag LOCUS_24560 gene fdhF 79457 82153 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 protein_id gnl|my_center|LOCUS_24560 82923 82192 gene locus_tag LOCUS_24570 82923 82192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839849.1 protein_id gnl|my_center|LOCUS_24570 85154 83079 gene locus_tag LOCUS_24580 85154 83079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 85810 85418 gene locus_tag LOCUS_24590 85810 85418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 87569 85983 gene locus_tag LOCUS_24600 87569 85983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 88254 87718 gene locus_tag LOCUS_24610 88254 87718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 91592 88332 gene locus_tag LOCUS_24620 91592 88332 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_24620 91867 94023 gene locus_tag LOCUS_24630 91867 94023 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_24630 94118 94660 gene locus_tag LOCUS_24640 94118 94660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 95958 94657 gene locus_tag LOCUS_24650 95958 94657 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_24650 96345 96983 gene locus_tag LOCUS_24660 gene udk 96345 96983 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_24660 97163 96987 gene locus_tag LOCUS_24670 97163 96987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 97244 98038 gene locus_tag LOCUS_24680 97244 98038 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_24680 98386 98105 gene locus_tag LOCUS_24690 98386 98105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 99194 98415 gene locus_tag LOCUS_24700 99194 98415 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_24700 102078 99208 gene locus_tag LOCUS_24710 102078 99208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 102477 102085 gene locus_tag LOCUS_24720 102477 102085 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_24720 103618 102668 gene locus_tag LOCUS_24730 103618 102668 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139584.1 protein_id gnl|my_center|LOCUS_24730 104415 103630 gene locus_tag LOCUS_24740 104415 103630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942253.1 protein_id gnl|my_center|LOCUS_24740 104592 105281 gene locus_tag LOCUS_24750 104592 105281 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_24750 107412 105319 gene locus_tag LOCUS_24760 107412 105319 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_24760 107743 108207 gene locus_tag LOCUS_24770 107743 108207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 108315 108785 gene locus_tag LOCUS_24780 108315 108785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 109150 110472 gene locus_tag LOCUS_24790 109150 110472 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_24790 110527 112605 gene locus_tag LOCUS_24800 110527 112605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24800 113018 113506 gene locus_tag LOCUS_24810 113018 113506 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_24810 113730 113951 gene locus_tag LOCUS_24820 113730 113951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 114090 115718 gene locus_tag LOCUS_24830 114090 115718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 115959 117551 gene locus_tag LOCUS_24840 115959 117551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 117568 118536 gene locus_tag LOCUS_24850 117568 118536 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_24850 118811 120043 gene locus_tag LOCUS_24860 118811 120043 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_24860 120046 123687 gene locus_tag LOCUS_24870 120046 123687 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261790.1 protein_id gnl|my_center|LOCUS_24870 123847 124401 gene locus_tag LOCUS_24880 123847 124401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 124497 125519 gene locus_tag LOCUS_24890 124497 125519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 125900 129178 gene locus_tag LOCUS_24900 125900 129178 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_24900 129500 131434 gene locus_tag LOCUS_24910 129500 131434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 131536 132333 gene locus_tag LOCUS_24920 131536 132333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 132360 132938 gene locus_tag LOCUS_24930 132360 132938 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108700.1 protein_id gnl|my_center|LOCUS_24930 132960 133601 gene locus_tag LOCUS_24940 132960 133601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 133962 135434 gene locus_tag LOCUS_24950 133962 135434 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_24950 135971 135468 gene locus_tag LOCUS_24960 gene purE 135971 135468 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_24960 137259 136075 gene locus_tag LOCUS_24970 137259 136075 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_24970 138129 137410 gene locus_tag LOCUS_24980 138129 137410 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_24980 139582 138170 gene locus_tag LOCUS_24990 139582 138170 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_24990 139892 140434 gene locus_tag LOCUS_25000 139892 140434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 140729 141193 gene locus_tag LOCUS_25010 gene coaD 140729 141193 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_25010 141324 142952 gene locus_tag LOCUS_25020 gene pruA 141324 142952 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_25020 144598 143006 gene locus_tag LOCUS_25030 gene ggt 144598 143006 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_25030 145446 146165 gene locus_tag LOCUS_25040 145446 146165 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_25040 146314 148416 gene locus_tag LOCUS_25050 146314 148416 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_25050 148454 149113 gene locus_tag LOCUS_25060 148454 149113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 149493 150416 gene locus_tag LOCUS_25070 149493 150416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 150426 151190 gene locus_tag LOCUS_25080 150426 151190 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_25080 151405 151812 gene locus_tag LOCUS_25090 151405 151812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 151927 153336 gene locus_tag LOCUS_25100 151927 153336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 153408 153779 gene locus_tag LOCUS_25110 153408 153779 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_25110 154181 155029 gene locus_tag LOCUS_25120 154181 155029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 155632 155078 gene locus_tag LOCUS_25130 155632 155078 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_25130 156714 155743 gene locus_tag LOCUS_25140 156714 155743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 157685 156777 gene locus_tag LOCUS_25150 157685 156777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 158751 157966 gene locus_tag LOCUS_25160 158751 157966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 159724 158858 gene locus_tag LOCUS_25170 159724 158858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 160888 159887 gene locus_tag LOCUS_25180 160888 159887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 162297 161308 gene locus_tag LOCUS_25190 162297 161308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922267.1 protein_id gnl|my_center|LOCUS_25190 162555 163211 gene locus_tag LOCUS_25200 162555 163211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 163556 163978 gene locus_tag LOCUS_25210 163556 163978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence014 910 164 gene locus_tag LOCUS_25220 910 164 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_25220 1878 928 gene locus_tag LOCUS_25230 1878 928 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403516.1 protein_id gnl|my_center|LOCUS_25230 2244 4694 gene locus_tag LOCUS_25240 2244 4694 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_25240 5069 6556 gene locus_tag LOCUS_25250 5069 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 6713 7075 gene locus_tag LOCUS_25260 6713 7075 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_25260 7072 9693 gene locus_tag LOCUS_25270 7072 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 10873 9761 gene locus_tag LOCUS_25280 10873 9761 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861701.1 protein_id gnl|my_center|LOCUS_25280 11516 12103 gene locus_tag LOCUS_25290 11516 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 13718 12174 gene locus_tag LOCUS_25300 13718 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 13980 14297 gene locus_tag LOCUS_25310 13980 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 15839 15093 gene locus_tag LOCUS_25320 gene fabG 15839 15093 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_25320 16113 16547 gene locus_tag LOCUS_25330 gene mscL 16113 16547 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399960.1 protein_id gnl|my_center|LOCUS_25330 17858 16644 gene locus_tag LOCUS_25340 17858 16644 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_25340 20223 17971 gene locus_tag LOCUS_25350 20223 17971 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990705.1 protein_id gnl|my_center|LOCUS_25350 21442 21834 gene locus_tag LOCUS_25360 21442 21834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 22107 25244 gene locus_tag LOCUS_25370 22107 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 25295 26491 gene locus_tag LOCUS_25380 25295 26491 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_25380 29411 26562 gene locus_tag LOCUS_25390 gene uvrA 29411 26562 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_25390 31295 29721 gene locus_tag LOCUS_25400 31295 29721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 32712 31516 gene locus_tag LOCUS_25410 32712 31516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730816.1 protein_id gnl|my_center|LOCUS_25410 33185 33769 gene locus_tag LOCUS_25420 33185 33769 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_25420 34768 33800 gene locus_tag LOCUS_25430 gene hemB 34768 33800 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_25430 35012 34746 gene locus_tag LOCUS_25440 gene yidD 35012 34746 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938375.1 protein_id gnl|my_center|LOCUS_25440 35757 35248 gene locus_tag LOCUS_25450 35757 35248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 36457 35837 gene locus_tag LOCUS_25460 36457 35837 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_25460 37980 36667 gene locus_tag LOCUS_25470 gene ahcY 37980 36667 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_25470 37937 38146 gene locus_tag LOCUS_25480 37937 38146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 38827 38126 gene locus_tag LOCUS_25490 38827 38126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 38938 42525 gene locus_tag LOCUS_25500 38938 42525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 42705 43436 gene locus_tag LOCUS_25510 42705 43436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 43439 45535 gene locus_tag LOCUS_25520 43439 45535 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_25520 45706 46575 gene locus_tag LOCUS_25530 45706 46575 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_25530 46568 47248 gene locus_tag LOCUS_25540 46568 47248 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_25540 48839 47262 gene locus_tag LOCUS_25550 48839 47262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 49856 49086 gene locus_tag LOCUS_25560 49856 49086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 50027 50878 gene locus_tag LOCUS_25570 50027 50878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 50942 51478 gene locus_tag LOCUS_25580 50942 51478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 52465 51662 gene locus_tag LOCUS_25590 52465 51662 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_25590 54007 52550 gene locus_tag LOCUS_25600 54007 52550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_25600 56371 54425 gene locus_tag LOCUS_25610 56371 54425 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_25610 56975 57673 gene locus_tag LOCUS_25620 56975 57673 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_25620 57722 59308 gene locus_tag LOCUS_25630 57722 59308 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_25630 59315 60682 gene locus_tag LOCUS_25640 59315 60682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 62937 60727 gene locus_tag LOCUS_25650 62937 60727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 63454 63621 gene locus_tag LOCUS_25660 63454 63621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 64649 63768 gene locus_tag LOCUS_25670 64649 63768 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691887.1 protein_id gnl|my_center|LOCUS_25670 65062 64979 gene locus_tag LOCUS_t00120 65062 64979 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 65144 65068 gene locus_tag LOCUS_t00130 65144 65068 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 65475 65406 gene locus_tag LOCUS_t00140 65475 65406 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 65555 65481 gene locus_tag LOCUS_t00150 65555 65481 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 65635 65563 gene locus_tag LOCUS_t00160 65635 65563 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 65716 65640 gene locus_tag LOCUS_t00170 65716 65640 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 65959 65883 gene locus_tag LOCUS_t00180 65959 65883 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 67265 66174 gene locus_tag LOCUS_25680 67265 66174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 68746 67307 gene locus_tag LOCUS_25690 68746 67307 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_25690 70863 68896 gene locus_tag LOCUS_25700 70863 68896 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868463.1 protein_id gnl|my_center|LOCUS_25700 70798 70980 gene locus_tag LOCUS_25710 70798 70980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 71526 71107 gene locus_tag LOCUS_25720 71526 71107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 72518 71523 gene locus_tag LOCUS_25730 72518 71523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 74398 72629 gene locus_tag LOCUS_25740 74398 72629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 75095 74556 gene locus_tag LOCUS_25750 75095 74556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 76535 75933 gene locus_tag LOCUS_25760 76535 75933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 78035 77205 gene locus_tag LOCUS_25770 78035 77205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 79014 78016 gene locus_tag LOCUS_25780 79014 78016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 80035 79184 gene locus_tag LOCUS_25790 80035 79184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 81183 80314 gene locus_tag LOCUS_25800 81183 80314 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790222.1 protein_id gnl|my_center|LOCUS_25800 82120 81206 gene locus_tag LOCUS_25810 82120 81206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 82737 82396 gene locus_tag LOCUS_25820 82737 82396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 83521 82775 gene locus_tag LOCUS_25830 83521 82775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 83955 83653 gene locus_tag LOCUS_25840 83955 83653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 85977 84175 gene locus_tag LOCUS_25850 85977 84175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_25850 86296 88203 gene locus_tag LOCUS_25860 86296 88203 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_25860 89112 88252 gene locus_tag LOCUS_25870 89112 88252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 90934 89318 gene locus_tag LOCUS_25880 gene gldM 90934 89318 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_25880 91627 91010 gene locus_tag LOCUS_25890 gene gldL 91627 91010 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_25890 93203 91956 gene locus_tag LOCUS_25900 gene gldK 93203 91956 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_25900 94516 93587 gene locus_tag LOCUS_25910 94516 93587 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_25910 96836 94776 gene locus_tag LOCUS_25920 96836 94776 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_25920 100257 97030 gene locus_tag LOCUS_25930 100257 97030 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_25930 101475 100756 gene locus_tag LOCUS_25940 101475 100756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 101613 102482 gene locus_tag LOCUS_25950 101613 102482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 102702 103808 gene locus_tag LOCUS_25960 102702 103808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 103916 104182 gene locus_tag LOCUS_25970 103916 104182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 104250 104666 gene locus_tag LOCUS_25980 gene ruvX 104250 104666 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_25980 104708 105268 gene locus_tag LOCUS_25990 gene def 104708 105268 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_25990 105913 105278 gene locus_tag LOCUS_26000 105913 105278 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_26000 106099 106863 gene locus_tag LOCUS_26010 106099 106863 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_26010 106991 107079 gene locus_tag LOCUS_t00190 106991 107079 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 107158 107985 gene locus_tag LOCUS_26020 107158 107985 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_26020 108002 108475 gene locus_tag LOCUS_26030 108002 108475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 108484 109038 gene locus_tag LOCUS_26040 108484 109038 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_26040 109230 109607 gene locus_tag LOCUS_26050 109230 109607 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_26050 110201 109767 gene locus_tag LOCUS_26060 110201 109767 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107333.1 protein_id gnl|my_center|LOCUS_26060 111840 110302 gene locus_tag LOCUS_26070 111840 110302 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846891.1 protein_id gnl|my_center|LOCUS_26070 113429 111837 gene locus_tag LOCUS_26080 113429 111837 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_26080 114642 113434 gene locus_tag LOCUS_26090 114642 113434 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_26090 115075 115701 gene locus_tag LOCUS_26100 115075 115701 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 protein_id gnl|my_center|LOCUS_26100 115730 116686 gene locus_tag LOCUS_26110 115730 116686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 116875 118926 gene locus_tag LOCUS_26120 116875 118926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 118923 119690 gene locus_tag LOCUS_26130 118923 119690 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_26130 120700 119921 gene locus_tag LOCUS_26140 120700 119921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 121058 120747 gene locus_tag LOCUS_26150 121058 120747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 122366 121137 gene locus_tag LOCUS_26160 122366 121137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 123593 122970 gene locus_tag LOCUS_26170 123593 122970 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_26170 124109 123639 gene locus_tag LOCUS_26180 124109 123639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 124976 127021 gene locus_tag LOCUS_26190 124976 127021 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_26190 127146 128612 gene locus_tag LOCUS_26200 127146 128612 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_26200 128660 129982 gene locus_tag LOCUS_26210 128660 129982 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948975.1 protein_id gnl|my_center|LOCUS_26210 129972 131162 gene locus_tag LOCUS_26220 129972 131162 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_26220 131389 132669 gene locus_tag LOCUS_26230 131389 132669 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_26230 132909 133610 gene locus_tag LOCUS_26240 132909 133610 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_26240 134128 134358 gene locus_tag LOCUS_26250 134128 134358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 134504 135112 gene locus_tag LOCUS_26260 134504 135112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 135458 136597 gene locus_tag LOCUS_26270 135458 136597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_26270 136694 137071 gene locus_tag LOCUS_26280 136694 137071 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 protein_id gnl|my_center|LOCUS_26280 137324 137836 gene locus_tag LOCUS_26290 137324 137836 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687340.1 protein_id gnl|my_center|LOCUS_26290 139530 137887 gene locus_tag LOCUS_26300 139530 137887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 139761 140378 gene locus_tag LOCUS_26310 139761 140378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 140828 144367 gene locus_tag LOCUS_26320 gene dnaE 140828 144367 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_26320 144646 145230 gene locus_tag LOCUS_26330 144646 145230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 145400 146047 gene locus_tag LOCUS_26340 145400 146047 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_26340 149616 146455 gene locus_tag LOCUS_26350 149616 146455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 150235 149894 gene locus_tag LOCUS_26360 150235 149894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 150462 151343 gene locus_tag LOCUS_26370 gene rimK 150462 151343 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_26370 151479 152321 gene locus_tag LOCUS_26380 151479 152321 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_26380 152833 153324 gene locus_tag LOCUS_26390 152833 153324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 153371 154498 gene locus_tag LOCUS_26400 153371 154498 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_26400 154508 155089 gene locus_tag LOCUS_26410 154508 155089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 155317 155937 gene locus_tag LOCUS_26420 155317 155937 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_26420 156104 157366 gene locus_tag LOCUS_26430 156104 157366 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_26430 157404 158585 gene locus_tag LOCUS_26440 157404 158585 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_26440 158578 162039 gene locus_tag LOCUS_26450 158578 162039 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence015 2397 3710 gene locus_tag LOCUS_26460 2397 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3751 4527 gene locus_tag LOCUS_26470 3751 4527 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 protein_id gnl|my_center|LOCUS_26470 5805 4633 gene locus_tag LOCUS_26480 5805 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 6040 6543 gene locus_tag LOCUS_26490 6040 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 6649 8829 gene locus_tag LOCUS_26500 6649 8829 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_26500 10852 9140 gene locus_tag LOCUS_26510 10852 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 11441 11004 gene locus_tag LOCUS_26520 11441 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 12009 13496 gene locus_tag LOCUS_26530 12009 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 14316 13618 gene locus_tag LOCUS_26540 14316 13618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 15607 14525 gene locus_tag LOCUS_26550 gene fbaA 15607 14525 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_26550 16623 15679 gene locus_tag LOCUS_26560 gene trxB 16623 15679 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_26560 16942 18474 gene locus_tag LOCUS_26570 16942 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 22850 18519 gene locus_tag LOCUS_26580 22850 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 25713 22945 gene locus_tag LOCUS_26590 25713 22945 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_26590 27209 25842 gene locus_tag LOCUS_26600 gene ffh 27209 25842 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_26600 27502 28659 gene locus_tag LOCUS_26610 27502 28659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 28823 30400 gene locus_tag LOCUS_26620 28823 30400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 30481 31302 gene locus_tag LOCUS_26630 30481 31302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 31350 32576 gene locus_tag LOCUS_26640 31350 32576 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107809.1 protein_id gnl|my_center|LOCUS_26640 32731 34647 gene locus_tag LOCUS_26650 gene yidC 32731 34647 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_26650 34819 37068 gene locus_tag LOCUS_26660 34819 37068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 38366 37371 gene locus_tag LOCUS_26670 38366 37371 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_26670 38892 39266 gene locus_tag LOCUS_26680 38892 39266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 41172 39313 gene locus_tag LOCUS_26690 41172 39313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 42107 41436 gene locus_tag LOCUS_26700 gene nreC 42107 41436 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_26700 43471 42260 gene locus_tag LOCUS_26710 43471 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 43844 44686 gene locus_tag LOCUS_26720 gene folP 43844 44686 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_26720 44698 46107 gene locus_tag LOCUS_26730 44698 46107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147168554.1 protein_id gnl|my_center|LOCUS_26730 46288 47520 gene locus_tag LOCUS_26740 46288 47520 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_26740 47644 52590 gene locus_tag LOCUS_26750 47644 52590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 53774 52689 gene locus_tag LOCUS_26760 gene aroC 53774 52689 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962924.1 protein_id gnl|my_center|LOCUS_26760 53978 56368 gene locus_tag LOCUS_26770 53978 56368 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_26770 56831 56412 gene locus_tag LOCUS_26780 56831 56412 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_26780 57084 58094 gene locus_tag LOCUS_26790 57084 58094 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_26790 58114 59043 gene locus_tag LOCUS_26800 58114 59043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 59275 60204 gene locus_tag LOCUS_26810 gene prfB 59275 60204 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26810 61371 61120 gene locus_tag LOCUS_26820 61371 61120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 61437 62225 gene locus_tag LOCUS_26830 61437 62225 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083449.1 protein_id gnl|my_center|LOCUS_26830 63651 62296 gene locus_tag LOCUS_26840 63651 62296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 65411 63840 gene locus_tag LOCUS_26850 65411 63840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 66095 65541 gene locus_tag LOCUS_26860 66095 65541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 71989 66395 gene locus_tag LOCUS_26870 71989 66395 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_26870 72286 72921 gene locus_tag LOCUS_26880 72286 72921 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_26880 75273 73237 gene locus_tag LOCUS_26890 75273 73237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 76424 75345 gene locus_tag LOCUS_26900 76424 75345 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_26900 77430 76534 gene locus_tag LOCUS_26910 77430 76534 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_26910 77932 77507 gene locus_tag LOCUS_26920 77932 77507 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_26920 79203 77938 gene locus_tag LOCUS_26930 79203 77938 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_26930 80352 79210 gene locus_tag LOCUS_26940 80352 79210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 81292 80360 gene locus_tag LOCUS_26950 81292 80360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 82019 81285 gene locus_tag LOCUS_26960 82019 81285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 82183 83214 gene locus_tag LOCUS_26970 82183 83214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 83342 83893 gene locus_tag LOCUS_26980 83342 83893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 85890 84013 gene locus_tag LOCUS_26990 85890 84013 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 protein_id gnl|my_center|LOCUS_26990 87832 85931 gene locus_tag LOCUS_27000 gene acs 87832 85931 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010254752.1 protein_id gnl|my_center|LOCUS_27000 90069 88348 gene locus_tag LOCUS_27010 90069 88348 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_27010 90366 90109 gene locus_tag LOCUS_27020 90366 90109 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_27020 90809 90519 gene locus_tag LOCUS_27030 90809 90519 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081428.1 protein_id gnl|my_center|LOCUS_27030 91028 92962 gene locus_tag LOCUS_27040 91028 92962 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932716.1 protein_id gnl|my_center|LOCUS_27040 92976 93668 gene locus_tag LOCUS_27050 92976 93668 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_27050 93811 94629 gene locus_tag LOCUS_27060 93811 94629 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787233.1 protein_id gnl|my_center|LOCUS_27060 95759 96442 gene locus_tag LOCUS_27070 95759 96442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 97346 96504 gene locus_tag LOCUS_27080 97346 96504 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_27080 97568 99217 gene locus_tag LOCUS_27090 gene pgi 97568 99217 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_27090 100678 99239 gene locus_tag LOCUS_27100 100678 99239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 100868 101428 gene locus_tag LOCUS_27110 100868 101428 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_27110 101418 102848 gene locus_tag LOCUS_27120 101418 102848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 103131 104240 gene locus_tag LOCUS_27130 103131 104240 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_27130 105126 104233 gene locus_tag LOCUS_27140 105126 104233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 106162 105602 gene locus_tag LOCUS_27150 106162 105602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 protein_id gnl|my_center|LOCUS_27150 106638 106222 gene locus_tag LOCUS_27160 106638 106222 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759735.1 protein_id gnl|my_center|LOCUS_27160 108315 106645 gene locus_tag LOCUS_27170 108315 106645 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_27170 108780 108442 gene locus_tag LOCUS_27180 108780 108442 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_27180 109237 111891 gene locus_tag LOCUS_27190 gene mutS 109237 111891 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_27190 111888 112604 gene locus_tag LOCUS_27200 gene dapB 111888 112604 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_27200 112653 113738 gene locus_tag LOCUS_27210 112653 113738 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_27210 115162 113735 gene locus_tag LOCUS_27220 115162 113735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 115507 117993 gene locus_tag LOCUS_27230 115507 117993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 119329 118460 gene locus_tag LOCUS_27240 119329 118460 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 protein_id gnl|my_center|LOCUS_27240 119441 121114 gene locus_tag LOCUS_27250 119441 121114 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_27250 121976 121251 gene locus_tag LOCUS_27260 121976 121251 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_27260 123058 122099 gene locus_tag LOCUS_27270 123058 122099 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_27270 123356 123772 gene locus_tag LOCUS_27280 123356 123772 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_27280 123940 124536 gene locus_tag LOCUS_27290 gene folE 123940 124536 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_27290 124672 125550 gene locus_tag LOCUS_27300 gene fabD 124672 125550 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_27300 125687 126244 gene locus_tag LOCUS_27310 125687 126244 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_27310 127703 126456 gene locus_tag LOCUS_27320 127703 126456 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_27320 127651 127896 gene locus_tag LOCUS_27330 127651 127896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 127926 128138 gene locus_tag LOCUS_27340 127926 128138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 128135 129319 gene locus_tag LOCUS_27350 128135 129319 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_27350 129390 130055 gene locus_tag LOCUS_27360 129390 130055 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_27360 132499 130043 gene locus_tag LOCUS_27370 132499 130043 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_27370 132517 133263 gene locus_tag LOCUS_27380 132517 133263 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_27380 134448 133333 gene locus_tag LOCUS_27390 134448 133333 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_27390 136787 134610 gene locus_tag LOCUS_27400 gene purL 136787 134610 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405368.1 protein_id gnl|my_center|LOCUS_27400 137617 136970 gene locus_tag LOCUS_27410 137617 136970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 137887 138735 gene locus_tag LOCUS_27420 137887 138735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 141889 138770 gene locus_tag LOCUS_27430 141889 138770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 142056 143243 gene locus_tag LOCUS_27440 gene rnd 142056 143243 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971431.1 protein_id gnl|my_center|LOCUS_27440 143255 144988 gene locus_tag LOCUS_27450 143255 144988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_27450 145157 145396 gene locus_tag LOCUS_27460 145157 145396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 146349 145462 gene locus_tag LOCUS_27470 146349 145462 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_27470 147321 146398 gene locus_tag LOCUS_27480 gene fmt 147321 146398 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_27480 148378 147323 gene locus_tag LOCUS_27490 148378 147323 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_27490 148484 149695 gene locus_tag LOCUS_27500 148484 149695 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_27500 149706 150842 gene locus_tag LOCUS_27510 gene nspC 149706 150842 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_27510 150848 151693 gene locus_tag LOCUS_27520 gene prmC 150848 151693 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_27520 152503 151685 gene locus_tag LOCUS_27530 152503 151685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 152720 153457 gene locus_tag LOCUS_27540 gene lipB 152720 153457 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_27540 153454 153861 gene locus_tag LOCUS_27550 153454 153861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 153911 154447 gene locus_tag LOCUS_27560 153911 154447 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_27560 157752 154444 gene locus_tag LOCUS_27570 157752 154444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence016 5 1576 gene locus_tag LOCUS_27580 5 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1729 2190 gene locus_tag LOCUS_27590 1729 2190 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965172.1 protein_id gnl|my_center|LOCUS_27590 2193 4382 gene locus_tag LOCUS_27600 2193 4382 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_27600 4568 4828 gene locus_tag LOCUS_27610 4568 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4915 6771 gene locus_tag LOCUS_27620 4915 6771 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788675.1 protein_id gnl|my_center|LOCUS_27620 6776 7981 gene locus_tag LOCUS_27630 6776 7981 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763355.1 protein_id gnl|my_center|LOCUS_27630 10220 8031 gene locus_tag LOCUS_27640 10220 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 12142 10439 gene locus_tag LOCUS_27650 12142 10439 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839414.1 protein_id gnl|my_center|LOCUS_27650 12967 12260 gene locus_tag LOCUS_27660 12967 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 13656 12964 gene locus_tag LOCUS_27670 13656 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 14506 13658 gene locus_tag LOCUS_27680 14506 13658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130012.1 protein_id gnl|my_center|LOCUS_27680 14721 17027 gene locus_tag LOCUS_27690 14721 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 17333 20206 gene locus_tag LOCUS_27700 17333 20206 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_27700 20753 20259 gene locus_tag LOCUS_27710 20753 20259 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947779.1 protein_id gnl|my_center|LOCUS_27710 21677 20775 gene locus_tag LOCUS_27720 21677 20775 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_27720 22988 21810 gene locus_tag LOCUS_27730 22988 21810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 24111 23083 gene locus_tag LOCUS_27740 24111 23083 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_27740 25779 24772 gene locus_tag LOCUS_27750 25779 24772 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_27750 27363 26005 gene locus_tag LOCUS_27760 27363 26005 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_27760 27493 31029 gene locus_tag LOCUS_27770 27493 31029 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184173497.1 protein_id gnl|my_center|LOCUS_27770 32395 31061 gene locus_tag LOCUS_27780 32395 31061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 32682 33596 gene locus_tag LOCUS_27790 32682 33596 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_27790 33688 34845 gene locus_tag LOCUS_27800 33688 34845 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_27800 34925 36007 gene locus_tag LOCUS_27810 34925 36007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 36017 36547 gene locus_tag LOCUS_27820 36017 36547 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790634.1 protein_id gnl|my_center|LOCUS_27820 36544 36840 gene locus_tag LOCUS_27830 36544 36840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 36969 37649 gene locus_tag LOCUS_27840 36969 37649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 37836 40967 gene locus_tag LOCUS_27850 37836 40967 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_27850 41045 42502 gene locus_tag LOCUS_27860 41045 42502 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_27860 42511 43863 gene locus_tag LOCUS_27870 42511 43863 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_27870 43868 44716 gene locus_tag LOCUS_27880 43868 44716 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_27880 44749 45570 gene locus_tag LOCUS_27890 44749 45570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 45704 47785 gene locus_tag LOCUS_27900 45704 47785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 48975 47968 gene locus_tag LOCUS_27910 gene fbp 48975 47968 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_27910 50148 49018 gene locus_tag LOCUS_27920 50148 49018 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174293.1 protein_id gnl|my_center|LOCUS_27920 50325 52214 gene locus_tag LOCUS_27930 50325 52214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 52228 52842 gene locus_tag LOCUS_27940 52228 52842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 53006 53524 gene locus_tag LOCUS_27950 53006 53524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 53634 54164 gene locus_tag LOCUS_27960 53634 54164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 55188 54166 gene locus_tag LOCUS_27970 55188 54166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 55726 55199 gene locus_tag LOCUS_27980 55726 55199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 55850 56806 gene locus_tag LOCUS_27990 55850 56806 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 protein_id gnl|my_center|LOCUS_27990 56867 58081 gene locus_tag LOCUS_28000 56867 58081 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_28000 59000 58386 gene locus_tag LOCUS_28010 59000 58386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 61854 59146 gene locus_tag LOCUS_28020 61854 59146 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840190.1 protein_id gnl|my_center|LOCUS_28020 62573 63154 gene locus_tag LOCUS_28030 62573 63154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 63207 64202 gene locus_tag LOCUS_28040 63207 64202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 67108 64199 gene locus_tag LOCUS_28050 67108 64199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 67923 67300 gene locus_tag LOCUS_28060 67923 67300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 68593 69603 gene locus_tag LOCUS_28070 68593 69603 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549454.1 protein_id gnl|my_center|LOCUS_28070 69808 70554 gene locus_tag LOCUS_28080 69808 70554 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_28080 70579 71577 gene locus_tag LOCUS_28090 70579 71577 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_28090 71643 72887 gene locus_tag LOCUS_28100 71643 72887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 73058 74377 gene locus_tag LOCUS_28110 73058 74377 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207389.1 protein_id gnl|my_center|LOCUS_28110 74427 76277 gene locus_tag LOCUS_28120 74427 76277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 78470 76326 gene locus_tag LOCUS_28130 78470 76326 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_28130 81745 78710 gene locus_tag LOCUS_28140 81745 78710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 82725 83495 gene locus_tag LOCUS_28150 82725 83495 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_28150 83527 85854 gene locus_tag LOCUS_28160 83527 85854 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107290.1 protein_id gnl|my_center|LOCUS_28160 86142 87611 gene locus_tag LOCUS_28170 86142 87611 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766006.1 protein_id gnl|my_center|LOCUS_28170 87697 88857 gene locus_tag LOCUS_28180 87697 88857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 89664 88873 gene locus_tag LOCUS_28190 89664 88873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 89857 91236 gene locus_tag LOCUS_28200 89857 91236 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_28200 91290 91964 gene locus_tag LOCUS_28210 91290 91964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 91998 93005 gene locus_tag LOCUS_28220 91998 93005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 93085 94359 gene locus_tag LOCUS_28230 93085 94359 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767234.1 protein_id gnl|my_center|LOCUS_28230 94359 95642 gene locus_tag LOCUS_28240 94359 95642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 95668 97053 gene locus_tag LOCUS_28250 95668 97053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 97046 98098 gene locus_tag LOCUS_28260 97046 98098 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203721.1 protein_id gnl|my_center|LOCUS_28260 98099 99262 gene locus_tag LOCUS_28270 98099 99262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 99276 100427 gene locus_tag LOCUS_28280 99276 100427 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050765261.1 protein_id gnl|my_center|LOCUS_28280 100667 102613 gene locus_tag LOCUS_28290 gene asnB 100667 102613 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_28290 102664 103551 gene locus_tag LOCUS_28300 102664 103551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 103548 105707 gene locus_tag LOCUS_28310 103548 105707 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_28310 105741 106862 gene locus_tag LOCUS_28320 105741 106862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 106837 107988 gene locus_tag LOCUS_28330 106837 107988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 108049 109269 gene locus_tag LOCUS_28340 gene vpsj 108049 109269 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_28340 109337 110521 gene locus_tag LOCUS_28350 gene wecB 109337 110521 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_28350 110518 111273 gene locus_tag LOCUS_28360 gene vpsK 110518 111273 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_28360 111324 112409 gene locus_tag LOCUS_28370 111324 112409 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037177.1 protein_id gnl|my_center|LOCUS_28370 112366 112917 gene locus_tag LOCUS_28380 gene rfbC 112366 112917 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_28380 112928 114211 gene locus_tag LOCUS_28390 112928 114211 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_28390 114304 115128 gene locus_tag LOCUS_28400 114304 115128 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_28400 115109 115756 gene locus_tag LOCUS_28410 115109 115756 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142181.1 protein_id gnl|my_center|LOCUS_28410 115786 116706 gene locus_tag LOCUS_28420 115786 116706 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_28420 116748 118046 gene locus_tag LOCUS_28430 116748 118046 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_28430 119387 118206 gene locus_tag LOCUS_28440 119387 118206 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975518.1 protein_id gnl|my_center|LOCUS_28440 119574 119996 gene locus_tag LOCUS_28450 119574 119996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 121445 120009 gene locus_tag LOCUS_28460 121445 120009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 122299 121523 gene locus_tag LOCUS_28470 122299 121523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 123802 122519 gene locus_tag LOCUS_28480 123802 122519 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 protein_id gnl|my_center|LOCUS_28480 124462 124124 gene locus_tag LOCUS_28490 124462 124124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 124778 125788 gene locus_tag LOCUS_28500 124778 125788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 125842 127176 gene locus_tag LOCUS_28510 125842 127176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 128537 127272 gene locus_tag LOCUS_28520 128537 127272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 128617 128829 gene locus_tag LOCUS_28530 128617 128829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 128777 129754 gene locus_tag LOCUS_28540 128777 129754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 129751 130449 gene locus_tag LOCUS_28550 129751 130449 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_28550 130499 131755 gene locus_tag LOCUS_28560 130499 131755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 132072 132899 gene locus_tag LOCUS_28570 132072 132899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 134471 132918 gene locus_tag LOCUS_28580 134471 132918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 135759 134791 gene locus_tag LOCUS_28590 135759 134791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 137304 135850 gene locus_tag LOCUS_28600 137304 135850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 137705 138634 gene locus_tag LOCUS_28610 137705 138634 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207182.1 protein_id gnl|my_center|LOCUS_28610 140148 138643 gene locus_tag LOCUS_28620 140148 138643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 141086 140235 gene locus_tag LOCUS_28630 141086 140235 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548276.1 protein_id gnl|my_center|LOCUS_28630 142339 141086 gene locus_tag LOCUS_28640 142339 141086 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303135.1 protein_id gnl|my_center|LOCUS_28640 145080 142468 gene locus_tag LOCUS_28650 145080 142468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 146101 145208 gene locus_tag LOCUS_28660 146101 145208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 147578 146202 gene locus_tag LOCUS_28670 147578 146202 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_28670 151181 147660 gene locus_tag LOCUS_28680 151181 147660 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_28680 152278 151322 gene locus_tag LOCUS_28690 152278 151322 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785429.1 protein_id gnl|my_center|LOCUS_28690 153104 152520 gene locus_tag LOCUS_28700 153104 152520 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_28700 154218 153346 gene locus_tag LOCUS_28710 154218 153346 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_28710 154453 155490 gene locus_tag LOCUS_28720 154453 155490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence017 424 3951 gene locus_tag LOCUS_28730 424 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 4133 6151 gene locus_tag LOCUS_28740 4133 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 6739 10701 gene locus_tag LOCUS_28750 6739 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 10853 12397 gene locus_tag LOCUS_28760 10853 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 12594 15641 gene locus_tag LOCUS_28770 12594 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 15676 17271 gene locus_tag LOCUS_28780 15676 17271 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_28780 19843 17306 gene locus_tag LOCUS_28790 19843 17306 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_28790 21539 20175 gene locus_tag LOCUS_28800 21539 20175 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246404.1 protein_id gnl|my_center|LOCUS_28800 22220 21777 gene locus_tag LOCUS_28810 22220 21777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 22592 24013 gene locus_tag LOCUS_28820 22592 24013 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457408.1 protein_id gnl|my_center|LOCUS_28820 26489 24072 gene locus_tag LOCUS_28830 26489 24072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 26923 27990 gene locus_tag LOCUS_28840 26923 27990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 29219 27987 gene locus_tag LOCUS_28850 29219 27987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 32192 29541 gene locus_tag LOCUS_28860 32192 29541 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_28860 32527 32189 gene locus_tag LOCUS_28870 32527 32189 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_28870 32754 33083 gene locus_tag LOCUS_28880 32754 33083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 33098 35740 gene locus_tag LOCUS_28890 33098 35740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_28890 35817 38408 gene locus_tag LOCUS_28900 35817 38408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_28900 38462 38923 gene locus_tag LOCUS_28910 38462 38923 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_28910 38979 41156 gene locus_tag LOCUS_28920 38979 41156 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_28920 43235 41160 gene locus_tag LOCUS_28930 43235 41160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 44093 43344 gene locus_tag LOCUS_28940 44093 43344 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_28940 47188 44099 gene locus_tag LOCUS_28950 47188 44099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 47562 48347 gene locus_tag LOCUS_28960 47562 48347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 48460 49053 gene locus_tag LOCUS_28970 48460 49053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 49040 49522 gene locus_tag LOCUS_28980 49040 49522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 49824 50453 gene locus_tag LOCUS_28990 49824 50453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 51240 50488 gene locus_tag LOCUS_29000 51240 50488 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_29000 51446 52333 gene locus_tag LOCUS_29010 51446 52333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 54145 52541 gene locus_tag LOCUS_29020 54145 52541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 56988 54409 gene locus_tag LOCUS_29030 56988 54409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_29030 57327 56998 gene locus_tag LOCUS_29040 57327 56998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 60591 57463 gene locus_tag LOCUS_29050 gene ccsA 60591 57463 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_29050 61630 60854 gene locus_tag LOCUS_29060 61630 60854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_29060 63248 61650 gene locus_tag LOCUS_29070 63248 61650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 64994 63306 gene locus_tag LOCUS_29080 64994 63306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 66838 65009 gene locus_tag LOCUS_29090 66838 65009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 68177 66852 gene locus_tag LOCUS_29100 68177 66852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 69113 68244 gene locus_tag LOCUS_29110 69113 68244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 72320 69408 gene locus_tag LOCUS_29120 72320 69408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 72563 73705 gene locus_tag LOCUS_29130 72563 73705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963654.1 protein_id gnl|my_center|LOCUS_29130 73702 74184 gene locus_tag LOCUS_29140 73702 74184 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241839.1 protein_id gnl|my_center|LOCUS_29140 74972 74223 gene locus_tag LOCUS_29150 74972 74223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 75558 75157 gene locus_tag LOCUS_29160 75558 75157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 76626 75937 gene locus_tag LOCUS_29170 76626 75937 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081900.1 protein_id gnl|my_center|LOCUS_29170 77416 76691 gene locus_tag LOCUS_29180 77416 76691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 77730 79805 gene locus_tag LOCUS_29190 77730 79805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 79996 80622 gene locus_tag LOCUS_29200 79996 80622 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480654.1 protein_id gnl|my_center|LOCUS_29200 80708 81112 gene locus_tag LOCUS_29210 80708 81112 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551711.1 protein_id gnl|my_center|LOCUS_29210 81963 81181 gene locus_tag LOCUS_29220 81963 81181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 82912 81995 gene locus_tag LOCUS_29230 gene pycR 82912 81995 CDS product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_29230 83038 83301 gene locus_tag LOCUS_29240 83038 83301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 83404 84840 gene locus_tag LOCUS_29250 83404 84840 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_29250 86807 85185 gene locus_tag LOCUS_29260 gene iorA 86807 85185 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068577330.1 protein_id gnl|my_center|LOCUS_29260 87950 86964 gene locus_tag LOCUS_29270 87950 86964 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_29270 90924 88312 gene locus_tag LOCUS_29280 90924 88312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_29280 91265 90924 gene locus_tag LOCUS_29290 91265 90924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 91491 93854 gene locus_tag LOCUS_29300 91491 93854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_29300 95069 93897 gene locus_tag LOCUS_29310 95069 93897 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_29310 96436 95096 gene locus_tag LOCUS_29320 gene preA 96436 95096 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_29320 97831 96503 gene locus_tag LOCUS_29330 97831 96503 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_29330 98695 97862 gene locus_tag LOCUS_29340 98695 97862 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_29340 100135 98756 gene locus_tag LOCUS_29350 gene hydA 100135 98756 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_29350 101807 100119 gene locus_tag LOCUS_29360 101807 100119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 103150 101804 gene locus_tag LOCUS_29370 103150 101804 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_29370 104818 103382 gene locus_tag LOCUS_29380 104818 103382 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_29380 105699 104986 gene locus_tag LOCUS_29390 105699 104986 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_29390 106556 105696 gene locus_tag LOCUS_29400 106556 105696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 106934 108082 gene locus_tag LOCUS_29410 106934 108082 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104094.1 protein_id gnl|my_center|LOCUS_29410 108725 108087 gene locus_tag LOCUS_29420 108725 108087 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_29420 110628 108730 gene locus_tag LOCUS_29430 110628 108730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 111371 110862 gene locus_tag LOCUS_29440 111371 110862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 111496 111660 gene locus_tag LOCUS_29450 111496 111660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 111927 112289 gene locus_tag LOCUS_29460 111927 112289 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_29460 112295 114688 gene locus_tag LOCUS_29470 112295 114688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 115125 117467 gene locus_tag LOCUS_29480 115125 117467 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_29480 117982 118989 gene locus_tag LOCUS_29490 117982 118989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_29490 119041 120060 gene locus_tag LOCUS_29500 119041 120060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_29500 120181 120453 gene locus_tag LOCUS_29510 120181 120453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 120838 121605 gene locus_tag LOCUS_29520 120838 121605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 122694 121672 gene locus_tag LOCUS_29530 122694 121672 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_29530 123867 122740 gene locus_tag LOCUS_29540 gene galK 123867 122740 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_29540 124092 124796 gene locus_tag LOCUS_29550 124092 124796 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_29550 124998 126677 gene locus_tag LOCUS_29560 124998 126677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 127993 126737 gene locus_tag LOCUS_29570 127993 126737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 130026 128185 gene locus_tag LOCUS_29580 130026 128185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 130181 131899 gene locus_tag LOCUS_29590 130181 131899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 131892 132602 gene locus_tag LOCUS_29600 131892 132602 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_29600 133752 132709 gene locus_tag LOCUS_29610 133752 132709 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346255.1 protein_id gnl|my_center|LOCUS_29610 134055 135467 gene locus_tag LOCUS_29620 134055 135467 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 protein_id gnl|my_center|LOCUS_29620 135622 136188 gene locus_tag LOCUS_29630 135622 136188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 136223 136960 gene locus_tag LOCUS_29640 136223 136960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 137541 137026 gene locus_tag LOCUS_29650 137541 137026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 138107 138694 gene locus_tag LOCUS_29660 138107 138694 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_29660 141150 138904 gene locus_tag LOCUS_29670 141150 138904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 141221 141430 gene locus_tag LOCUS_29680 141221 141430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 141477 141986 gene locus_tag LOCUS_29690 141477 141986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 142048 142857 gene locus_tag LOCUS_29700 142048 142857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 142889 143254 gene locus_tag LOCUS_29710 142889 143254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 143335 144501 gene locus_tag LOCUS_29720 143335 144501 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_29720 146185 144557 gene locus_tag LOCUS_29730 146185 144557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 146569 149841 gene locus_tag LOCUS_29740 146569 149841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence018 1331 147 gene locus_tag LOCUS_29750 1331 147 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_29750 2406 1531 gene locus_tag LOCUS_29760 2406 1531 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_29760 2706 7112 gene locus_tag LOCUS_29770 2706 7112 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196955152.1 protein_id gnl|my_center|LOCUS_29770 7409 12073 gene locus_tag LOCUS_29780 7409 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 12894 12391 gene locus_tag LOCUS_29790 12894 12391 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_29790 13631 13065 gene locus_tag LOCUS_29800 13631 13065 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_29800 13878 14429 gene locus_tag LOCUS_29810 13878 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 14876 14442 gene locus_tag LOCUS_29820 14876 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 16139 14997 gene locus_tag LOCUS_29830 16139 14997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 16577 16248 gene locus_tag LOCUS_29840 16577 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 17359 16634 gene locus_tag LOCUS_29850 17359 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 17542 18816 gene locus_tag LOCUS_29860 17542 18816 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103018905.1 protein_id gnl|my_center|LOCUS_29860 19064 20146 gene locus_tag LOCUS_29870 19064 20146 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730009.1 protein_id gnl|my_center|LOCUS_29870 20844 20143 gene locus_tag LOCUS_29880 20844 20143 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531709.1 protein_id gnl|my_center|LOCUS_29880 22749 21079 gene locus_tag LOCUS_29890 22749 21079 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_29890 23060 22782 gene locus_tag LOCUS_29900 23060 22782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 23477 24703 gene locus_tag LOCUS_29910 23477 24703 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 protein_id gnl|my_center|LOCUS_29910 25589 24972 gene locus_tag LOCUS_29920 25589 24972 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099939.1 protein_id gnl|my_center|LOCUS_29920 26214 25615 gene locus_tag LOCUS_29930 26214 25615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 27079 26201 gene locus_tag LOCUS_29940 27079 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 27878 27183 gene locus_tag LOCUS_29950 27878 27183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 29631 27976 gene locus_tag LOCUS_29960 29631 27976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 30125 29643 gene locus_tag LOCUS_29970 30125 29643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 31147 30140 gene locus_tag LOCUS_29980 31147 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 32047 31241 gene locus_tag LOCUS_29990 32047 31241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 32170 34638 gene locus_tag LOCUS_30000 32170 34638 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_30000 35355 34792 gene locus_tag LOCUS_30010 35355 34792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 35843 35472 gene locus_tag LOCUS_30020 35843 35472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 37897 35903 gene locus_tag LOCUS_30030 37897 35903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 38647 37910 gene locus_tag LOCUS_30040 38647 37910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 39365 38907 gene locus_tag LOCUS_30050 39365 38907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 39898 39362 gene locus_tag LOCUS_30060 39898 39362 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108700.1 protein_id gnl|my_center|LOCUS_30060 40829 40026 gene locus_tag LOCUS_30070 40829 40026 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_30070 42194 40899 gene locus_tag LOCUS_30080 42194 40899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 43032 42568 gene locus_tag LOCUS_30090 43032 42568 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872160.1 protein_id gnl|my_center|LOCUS_30090 43588 43109 gene locus_tag LOCUS_30100 43588 43109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 44612 43701 gene locus_tag LOCUS_30110 44612 43701 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920780.1 protein_id gnl|my_center|LOCUS_30110 44903 46747 gene locus_tag LOCUS_30120 44903 46747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 46749 47447 gene locus_tag LOCUS_30130 46749 47447 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_30130 48478 47498 gene locus_tag LOCUS_30140 48478 47498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 49628 48546 gene locus_tag LOCUS_30150 49628 48546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 50142 52607 gene locus_tag LOCUS_30160 50142 52607 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036948.1 protein_id gnl|my_center|LOCUS_30160 52668 54080 gene locus_tag LOCUS_30170 52668 54080 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108966.1 protein_id gnl|my_center|LOCUS_30170 54645 54082 gene locus_tag LOCUS_30180 54645 54082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 56115 54718 gene locus_tag LOCUS_30190 56115 54718 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_30190 56337 56798 gene locus_tag LOCUS_30200 56337 56798 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_30200 56808 57950 gene locus_tag LOCUS_30210 56808 57950 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965162.1 protein_id gnl|my_center|LOCUS_30210 57962 59062 gene locus_tag LOCUS_30220 57962 59062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 59173 60666 gene locus_tag LOCUS_30230 59173 60666 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265906.1 protein_id gnl|my_center|LOCUS_30230 61522 60698 gene locus_tag LOCUS_30240 61522 60698 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941847.1 protein_id gnl|my_center|LOCUS_30240 62858 61617 gene locus_tag LOCUS_30250 62858 61617 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047985.1 protein_id gnl|my_center|LOCUS_30250 63325 64449 gene locus_tag LOCUS_30260 gene metX 63325 64449 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_30260 64506 65459 gene locus_tag LOCUS_30270 64506 65459 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_30270 65688 68630 gene locus_tag LOCUS_30280 65688 68630 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201890.1 protein_id gnl|my_center|LOCUS_30280 68901 72350 gene locus_tag LOCUS_30290 68901 72350 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_30290 73873 72359 gene locus_tag LOCUS_30300 73873 72359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 73878 74072 gene locus_tag LOCUS_30310 73878 74072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 74081 75691 gene locus_tag LOCUS_30320 gene pckA 74081 75691 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_30320 78616 75785 gene locus_tag LOCUS_30330 78616 75785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 80843 78852 gene locus_tag LOCUS_30340 80843 78852 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_30340 82654 81086 gene locus_tag LOCUS_30350 82654 81086 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_30350 82793 83344 gene locus_tag LOCUS_30360 82793 83344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 83356 84723 gene locus_tag LOCUS_30370 83356 84723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 84930 85280 gene locus_tag LOCUS_30380 84930 85280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 85900 86673 gene locus_tag LOCUS_30390 85900 86673 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_30390 86919 88136 gene locus_tag LOCUS_30400 86919 88136 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_30400 88141 89223 gene locus_tag LOCUS_30410 88141 89223 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_30410 89397 89804 gene locus_tag LOCUS_30420 89397 89804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 90357 90695 gene locus_tag LOCUS_30430 90357 90695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 92183 90756 gene locus_tag LOCUS_30440 92183 90756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 92233 93408 gene locus_tag LOCUS_30450 92233 93408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 93350 94192 gene locus_tag LOCUS_30460 gene truA 93350 94192 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_30460 94288 94905 gene locus_tag LOCUS_30470 94288 94905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 95064 95915 gene locus_tag LOCUS_30480 95064 95915 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_30480 96712 96053 gene locus_tag LOCUS_30490 96712 96053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 96840 97328 gene locus_tag LOCUS_30500 96840 97328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 99760 97631 gene locus_tag LOCUS_30510 99760 97631 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_30510 99939 102110 gene locus_tag LOCUS_30520 99939 102110 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356699.1 protein_id gnl|my_center|LOCUS_30520 104586 102163 gene locus_tag LOCUS_30530 104586 102163 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_30530 105002 105457 gene locus_tag LOCUS_30540 105002 105457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 105965 106726 gene locus_tag LOCUS_30550 gene yaaA 105965 106726 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704335.1 protein_id gnl|my_center|LOCUS_30550 107163 106759 gene locus_tag LOCUS_30560 107163 106759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 107358 109787 gene locus_tag LOCUS_30570 107358 109787 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_30570 110009 110371 gene locus_tag LOCUS_30580 110009 110371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 110516 110839 gene locus_tag LOCUS_30590 110516 110839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 110972 111346 gene locus_tag LOCUS_30600 110972 111346 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 protein_id gnl|my_center|LOCUS_30600 112155 111349 gene locus_tag LOCUS_30610 112155 111349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 112577 113323 gene locus_tag LOCUS_30620 112577 113323 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_30620 113592 114050 gene locus_tag LOCUS_30630 gene mraZ 113592 114050 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_30630 114047 114946 gene locus_tag LOCUS_30640 gene rsmH 114047 114946 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_30640 114948 115250 gene locus_tag LOCUS_30650 114948 115250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 115269 117425 gene locus_tag LOCUS_30660 115269 117425 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_30660 117422 118891 gene locus_tag LOCUS_30670 117422 118891 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_30670 119147 120415 gene locus_tag LOCUS_30680 gene mraY 119147 120415 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_30680 120429 121766 gene locus_tag LOCUS_30690 gene murD 120429 121766 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_30690 121787 123016 gene locus_tag LOCUS_30700 121787 123016 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_30700 123006 124133 gene locus_tag LOCUS_30710 gene murG 123006 124133 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_30710 124208 125593 gene locus_tag LOCUS_30720 gene murC 124208 125593 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_30720 125611 126390 gene locus_tag LOCUS_30730 125611 126390 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_30730 126514 127839 gene locus_tag LOCUS_30740 gene ftsA 126514 127839 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_30740 127989 129440 gene locus_tag LOCUS_30750 127989 129440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 130049 129618 gene locus_tag LOCUS_30760 130049 129618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 131880 130096 gene locus_tag LOCUS_30770 131880 130096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 133079 131895 gene locus_tag LOCUS_30780 133079 131895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 134562 138656 gene locus_tag LOCUS_30790 134562 138656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 138835 144012 gene locus_tag LOCUS_30800 138835 144012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 146845 144122 gene locus_tag LOCUS_30810 146845 144122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 147273 147545 gene locus_tag LOCUS_30820 147273 147545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 147801 149615 gene locus_tag LOCUS_30830 gene typA 147801 149615 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_30830 150194 149694 gene locus_tag LOCUS_30840 150194 149694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 150808 150296 gene locus_tag LOCUS_30850 150808 150296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 151780 150848 gene locus_tag LOCUS_30860 151780 150848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 152406 151924 gene locus_tag LOCUS_30870 152406 151924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795692.1 protein_id gnl|my_center|LOCUS_30870 152905 152399 gene locus_tag LOCUS_30880 152905 152399 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence019 3294 3124 gene locus_tag LOCUS_30890 3294 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3380 4753 gene locus_tag LOCUS_30900 3380 4753 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203470.1 protein_id gnl|my_center|LOCUS_30900 4776 5540 gene locus_tag LOCUS_30910 4776 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 5870 6337 gene locus_tag LOCUS_30920 5870 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 6644 7798 gene locus_tag LOCUS_30930 6644 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 8203 9336 gene locus_tag LOCUS_30940 8203 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 9711 9636 gene locus_tag LOCUS_t00200 9711 9636 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10926 9805 gene locus_tag LOCUS_30950 10926 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 11166 12008 gene locus_tag LOCUS_30960 11166 12008 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 protein_id gnl|my_center|LOCUS_30960 13426 12260 gene locus_tag LOCUS_30970 13426 12260 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_30970 14662 13625 gene locus_tag LOCUS_30980 14662 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 14864 16267 gene locus_tag LOCUS_30990 14864 16267 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036451.1 protein_id gnl|my_center|LOCUS_30990 16652 19627 gene locus_tag LOCUS_31000 16652 19627 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838102.1 protein_id gnl|my_center|LOCUS_31000 19659 21236 gene locus_tag LOCUS_31010 19659 21236 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_31010 21320 23200 gene locus_tag LOCUS_31020 21320 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 25138 23255 gene locus_tag LOCUS_31030 25138 23255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 25137 26633 gene locus_tag LOCUS_31040 25137 26633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 26748 27149 gene locus_tag LOCUS_31050 26748 27149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 27414 28745 gene locus_tag LOCUS_31060 27414 28745 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_31060 29516 28773 gene locus_tag LOCUS_31070 29516 28773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 30275 29736 gene locus_tag LOCUS_31080 gene bstA 30275 29736 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999070.1 protein_id gnl|my_center|LOCUS_31080 30965 30294 gene locus_tag LOCUS_31090 30965 30294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582702.1 protein_id gnl|my_center|LOCUS_31090 32604 32014 gene locus_tag LOCUS_31100 32604 32014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 33745 32975 gene locus_tag LOCUS_31110 33745 32975 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_31110 34559 33735 gene locus_tag LOCUS_31120 34559 33735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 35209 35565 gene locus_tag LOCUS_31130 35209 35565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 35746 36798 gene locus_tag LOCUS_31140 35746 36798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 36972 38714 gene locus_tag LOCUS_31150 36972 38714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 38983 40407 gene locus_tag LOCUS_31160 38983 40407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 41707 40478 gene locus_tag LOCUS_31170 41707 40478 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_31170 42936 41833 gene locus_tag LOCUS_31180 42936 41833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 43199 46594 gene locus_tag LOCUS_31190 43199 46594 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265500.1 protein_id gnl|my_center|LOCUS_31190 46687 47538 gene locus_tag LOCUS_31200 46687 47538 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 protein_id gnl|my_center|LOCUS_31200 48961 47606 gene locus_tag LOCUS_31210 48961 47606 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_31210 49770 49033 gene locus_tag LOCUS_31220 49770 49033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 49928 50683 gene locus_tag LOCUS_31230 gene kdsB 49928 50683 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_31230 51208 50684 gene locus_tag LOCUS_31240 51208 50684 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_31240 51404 52744 gene locus_tag LOCUS_31250 51404 52744 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_31250 52818 54071 gene locus_tag LOCUS_31260 52818 54071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 55793 54615 gene locus_tag LOCUS_31270 55793 54615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 56058 58190 gene locus_tag LOCUS_31280 56058 58190 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_31280 58267 59058 gene locus_tag LOCUS_31290 gene cdaA 58267 59058 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_31290 59136 59666 gene locus_tag LOCUS_31300 59136 59666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 59746 61140 gene locus_tag LOCUS_31310 59746 61140 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_31310 61607 62941 gene locus_tag LOCUS_31320 61607 62941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 63375 64334 gene locus_tag LOCUS_31330 63375 64334 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_31330 66466 64331 gene locus_tag LOCUS_31340 gene recQ 66466 64331 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_31340 67335 66643 gene locus_tag LOCUS_31350 67335 66643 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_31350 68335 67325 gene locus_tag LOCUS_31360 68335 67325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 68510 68995 gene locus_tag LOCUS_31370 68510 68995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 69001 69942 gene locus_tag LOCUS_31380 69001 69942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 70634 70167 gene locus_tag LOCUS_31390 70634 70167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 71229 70627 gene locus_tag LOCUS_31400 71229 70627 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_31400 74621 71598 gene locus_tag LOCUS_31410 74621 71598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 75653 75021 gene locus_tag LOCUS_31420 75653 75021 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_31420 75865 76932 gene locus_tag LOCUS_31430 75865 76932 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_31430 76946 77170 gene locus_tag LOCUS_31440 76946 77170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 77085 77576 gene locus_tag LOCUS_31450 77085 77576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 77980 80922 gene locus_tag LOCUS_31460 77980 80922 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695755.1 protein_id gnl|my_center|LOCUS_31460 80961 82343 gene locus_tag LOCUS_31470 80961 82343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 82820 82443 gene locus_tag LOCUS_31480 82820 82443 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356039.1 protein_id gnl|my_center|LOCUS_31480 83080 82874 gene locus_tag LOCUS_31490 83080 82874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 83416 84765 gene locus_tag LOCUS_31500 83416 84765 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_31500 84988 85476 gene locus_tag LOCUS_31510 84988 85476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 86037 85477 gene locus_tag LOCUS_31520 86037 85477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 86695 86222 gene locus_tag LOCUS_31530 86695 86222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 87099 86737 gene locus_tag LOCUS_31540 87099 86737 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265752.1 protein_id gnl|my_center|LOCUS_31540 87262 87738 gene locus_tag LOCUS_31550 87262 87738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 88075 87848 gene locus_tag LOCUS_31560 88075 87848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 88619 93007 gene locus_tag LOCUS_31570 88619 93007 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_31570 93279 94208 gene locus_tag LOCUS_31580 93279 94208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 94532 95473 gene locus_tag LOCUS_31590 94532 95473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 96222 95545 gene locus_tag LOCUS_31600 96222 95545 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_31600 96729 96289 gene locus_tag LOCUS_31610 96729 96289 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_31610 98246 96786 gene locus_tag LOCUS_31620 gene ccoG 98246 96786 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_31620 99361 98423 gene locus_tag LOCUS_31630 99361 98423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 99548 99351 gene locus_tag LOCUS_31640 99548 99351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 101758 99626 gene locus_tag LOCUS_31650 gene ccoN 101758 99626 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_31650 104678 102237 gene locus_tag LOCUS_31660 104678 102237 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_31660 104870 106312 gene locus_tag LOCUS_31670 104870 106312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 106467 108941 gene locus_tag LOCUS_31680 106467 108941 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_31680 109159 113511 gene locus_tag LOCUS_31690 109159 113511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 114139 121398 gene locus_tag LOCUS_31700 114139 121398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 121475 122266 gene locus_tag LOCUS_31710 121475 122266 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_31710 123401 122274 gene locus_tag LOCUS_31720 123401 122274 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188734295.1 protein_id gnl|my_center|LOCUS_31720 125675 123411 gene locus_tag LOCUS_31730 125675 123411 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836945.1 protein_id gnl|my_center|LOCUS_31730 126849 125755 gene locus_tag LOCUS_31740 126849 125755 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_31740 128168 127068 gene locus_tag LOCUS_31750 128168 127068 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_31750 129054 128275 gene locus_tag LOCUS_31760 129054 128275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 129757 129077 gene locus_tag LOCUS_31770 129757 129077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 130253 129747 gene locus_tag LOCUS_31780 130253 129747 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_31780 131432 130569 gene locus_tag LOCUS_31790 131432 130569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 133248 131755 gene locus_tag LOCUS_31800 133248 131755 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115242.1 protein_id gnl|my_center|LOCUS_31800 133545 133294 gene locus_tag LOCUS_31810 133545 133294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 134368 133532 gene locus_tag LOCUS_31820 134368 133532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 134828 137284 gene locus_tag LOCUS_31830 134828 137284 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_31830 137357 138904 gene locus_tag LOCUS_31840 137357 138904 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_31840 139092 139358 gene locus_tag LOCUS_31850 139092 139358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 139351 139785 gene locus_tag LOCUS_31860 139351 139785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 139893 140474 gene locus_tag LOCUS_31870 139893 140474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 140586 141548 gene locus_tag LOCUS_31880 140586 141548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 141545 142000 gene locus_tag LOCUS_31890 141545 142000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 142007 142591 gene locus_tag LOCUS_31900 142007 142591 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_31900 142858 143409 gene locus_tag LOCUS_31910 142858 143409 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272617.1 protein_id gnl|my_center|LOCUS_31910 143406 144161 gene locus_tag LOCUS_31920 143406 144161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 144228 144770 gene locus_tag LOCUS_31930 144228 144770 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_31930 144804 145799 gene locus_tag LOCUS_31940 144804 145799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 148340 145929 gene locus_tag LOCUS_31950 gene lon 148340 145929 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882677.1 protein_id gnl|my_center|LOCUS_31950 149042 148476 gene locus_tag LOCUS_31960 149042 148476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 150110 149544 gene locus_tag LOCUS_31970 150110 149544 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_31970 151273 150278 gene locus_tag LOCUS_31980 151273 150278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence020 1325 111 gene locus_tag LOCUS_31990 1325 111 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761338.1 protein_id gnl|my_center|LOCUS_31990 1951 1412 gene locus_tag LOCUS_32000 1951 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2417 1938 gene locus_tag LOCUS_32010 2417 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 3323 2589 gene locus_tag LOCUS_32020 3323 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 5130 3622 gene locus_tag LOCUS_32030 5130 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 8627 6066 gene locus_tag LOCUS_32040 8627 6066 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_32040 9055 9531 gene locus_tag LOCUS_32050 9055 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 9672 10163 gene locus_tag LOCUS_32060 9672 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 10296 11981 gene locus_tag LOCUS_32070 10296 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 12184 12744 gene locus_tag LOCUS_32080 12184 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 14245 12770 gene locus_tag LOCUS_32090 14245 12770 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_32090 15494 14325 gene locus_tag LOCUS_32100 15494 14325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 15746 16732 gene locus_tag LOCUS_32110 15746 16732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 17810 17028 gene locus_tag LOCUS_32120 17810 17028 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_32120 18425 17865 gene locus_tag LOCUS_32130 gene sigZ 18425 17865 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398507.1 protein_id gnl|my_center|LOCUS_32130 19980 18526 gene locus_tag LOCUS_32140 19980 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 20159 21475 gene locus_tag LOCUS_32150 20159 21475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 21468 22175 gene locus_tag LOCUS_32160 21468 22175 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_32160 22310 23368 gene locus_tag LOCUS_32170 22310 23368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 23660 24652 gene locus_tag LOCUS_32180 23660 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 25773 24796 gene locus_tag LOCUS_32190 25773 24796 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_32190 26049 26432 gene locus_tag LOCUS_32200 26049 26432 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_32200 29387 26517 gene locus_tag LOCUS_32210 29387 26517 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_32210 29766 29542 gene locus_tag LOCUS_32220 29766 29542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 29922 32351 gene locus_tag LOCUS_32230 29922 32351 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_32230 33493 32348 gene locus_tag LOCUS_32240 33493 32348 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804722.1 protein_id gnl|my_center|LOCUS_32240 35086 33647 gene locus_tag LOCUS_32250 35086 33647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 35148 36257 gene locus_tag LOCUS_32260 35148 36257 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973842.1 protein_id gnl|my_center|LOCUS_32260 39120 36226 gene locus_tag LOCUS_32270 39120 36226 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_32270 39547 40935 gene locus_tag LOCUS_32280 39547 40935 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_32280 41148 42263 gene locus_tag LOCUS_32290 41148 42263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 43900 42278 gene locus_tag LOCUS_32300 43900 42278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 45093 43954 gene locus_tag LOCUS_32310 45093 43954 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_32310 45228 46061 gene locus_tag LOCUS_32320 45228 46061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 46178 46498 gene locus_tag LOCUS_32330 46178 46498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 46507 49119 gene locus_tag LOCUS_32340 46507 49119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_32340 49724 49371 gene locus_tag LOCUS_32350 49724 49371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 50351 49779 gene locus_tag LOCUS_32360 50351 49779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 51313 50504 gene locus_tag LOCUS_32370 51313 50504 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_32370 52467 51343 gene locus_tag LOCUS_32380 52467 51343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 52708 53193 gene locus_tag LOCUS_32390 52708 53193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 53465 54667 gene locus_tag LOCUS_32400 53465 54667 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401136.1 protein_id gnl|my_center|LOCUS_32400 55675 54746 gene locus_tag LOCUS_32410 55675 54746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 56610 55747 gene locus_tag LOCUS_32420 56610 55747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 56988 57812 gene locus_tag LOCUS_32430 56988 57812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 59310 57823 gene locus_tag LOCUS_32440 gene glpK 59310 57823 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_32440 61045 59381 gene locus_tag LOCUS_32450 gene glpD 61045 59381 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 protein_id gnl|my_center|LOCUS_32450 63856 61208 gene locus_tag LOCUS_32460 63856 61208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 66467 64203 gene locus_tag LOCUS_32470 66467 64203 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391988.1 protein_id gnl|my_center|LOCUS_32470 67213 66470 gene locus_tag LOCUS_32480 67213 66470 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461975.1 protein_id gnl|my_center|LOCUS_32480 67565 67975 gene locus_tag LOCUS_32490 67565 67975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 68062 68646 gene locus_tag LOCUS_32500 68062 68646 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_32500 70058 68781 gene locus_tag LOCUS_32510 70058 68781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 74856 70480 gene locus_tag LOCUS_32520 74856 70480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 75951 74971 gene locus_tag LOCUS_32530 75951 74971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 76275 76607 gene locus_tag LOCUS_32540 76275 76607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 76613 79228 gene locus_tag LOCUS_32550 76613 79228 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_32550 79319 79223 gene locus_tag LOCUS_t00210 79319 79223 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 79367 80674 gene locus_tag LOCUS_32560 79367 80674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 82846 80810 gene locus_tag LOCUS_32570 82846 80810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 83691 82921 gene locus_tag LOCUS_32580 83691 82921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 84846 83854 gene locus_tag LOCUS_32590 84846 83854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 85381 84977 gene locus_tag LOCUS_32600 85381 84977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 87573 85378 gene locus_tag LOCUS_32610 87573 85378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 87976 89763 gene locus_tag LOCUS_32620 87976 89763 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_32620 89763 91163 gene locus_tag LOCUS_32630 89763 91163 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_32630 91268 91951 gene locus_tag LOCUS_32640 91268 91951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 93386 91998 gene locus_tag LOCUS_32650 93386 91998 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868284.1 protein_id gnl|my_center|LOCUS_32650 96930 93583 gene locus_tag LOCUS_32660 96930 93583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 97247 98179 gene locus_tag LOCUS_32670 97247 98179 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_32670 99357 98323 gene locus_tag LOCUS_32680 99357 98323 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_32680 99732 99493 gene locus_tag LOCUS_32690 99732 99493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32690 100309 99923 gene locus_tag LOCUS_32700 100309 99923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 101442 100306 gene locus_tag LOCUS_32710 101442 100306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 102510 101506 gene locus_tag LOCUS_32720 102510 101506 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_32720 103461 102835 gene locus_tag LOCUS_32730 103461 102835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 103687 103481 gene locus_tag LOCUS_32740 103687 103481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 106435 103832 gene locus_tag LOCUS_32750 106435 103832 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_32750 107535 106636 gene locus_tag LOCUS_32760 107535 106636 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028198.1 protein_id gnl|my_center|LOCUS_32760 108676 107567 gene locus_tag LOCUS_32770 108676 107567 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_32770 110681 109125 gene locus_tag LOCUS_32780 110681 109125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 112891 111080 gene locus_tag LOCUS_32790 112891 111080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 113126 112980 gene locus_tag LOCUS_32800 113126 112980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 114717 113563 gene locus_tag LOCUS_32810 114717 113563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 117524 115155 gene locus_tag LOCUS_32820 117524 115155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 119428 117554 gene locus_tag LOCUS_32830 119428 117554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 120416 119556 gene locus_tag LOCUS_32840 120416 119556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 120790 121812 gene locus_tag LOCUS_32850 120790 121812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 121839 122858 gene locus_tag LOCUS_32860 121839 122858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 123260 124123 gene locus_tag LOCUS_32870 123260 124123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 124127 125608 gene locus_tag LOCUS_32880 124127 125608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 125624 127156 gene locus_tag LOCUS_32890 125624 127156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 127163 127567 gene locus_tag LOCUS_32900 127163 127567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 127642 127872 gene locus_tag LOCUS_32910 127642 127872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 128526 128825 gene locus_tag LOCUS_32920 128526 128825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 129243 130415 gene locus_tag LOCUS_32930 129243 130415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 130426 130812 gene locus_tag LOCUS_32940 130426 130812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 131196 131123 gene locus_tag LOCUS_t00220 131196 131123 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 132261 131554 gene locus_tag LOCUS_32950 132261 131554 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_32950 133587 132520 gene locus_tag LOCUS_32960 gene dinB 133587 132520 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968218.1 protein_id gnl|my_center|LOCUS_32960 134573 133623 gene locus_tag LOCUS_32970 134573 133623 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_32970 134971 134591 gene locus_tag LOCUS_32980 134971 134591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 135715 138270 gene locus_tag LOCUS_32990 135715 138270 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_32990 138629 139222 gene locus_tag LOCUS_33000 gene infC 138629 139222 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_33000 139530 139898 gene locus_tag LOCUS_33010 gene rplT 139530 139898 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_33010 140000 140512 gene locus_tag LOCUS_33020 140000 140512 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477501.1 protein_id gnl|my_center|LOCUS_33020 140663 142330 gene locus_tag LOCUS_33030 140663 142330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 142422 145850 gene locus_tag LOCUS_33040 142422 145850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 147241 146012 gene locus_tag LOCUS_33050 147241 146012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 147409 147714 gene locus_tag LOCUS_33060 147409 147714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence021 166 1035 gene locus_tag LOCUS_33070 166 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 1555 2169 gene locus_tag LOCUS_33080 1555 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 2697 2275 gene locus_tag LOCUS_33090 2697 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 3667 2828 gene locus_tag LOCUS_33100 3667 2828 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 protein_id gnl|my_center|LOCUS_33100 5688 3916 gene locus_tag LOCUS_33110 5688 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 5951 8014 gene locus_tag LOCUS_33120 5951 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 8019 8762 gene locus_tag LOCUS_33130 8019 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 8852 9745 gene locus_tag LOCUS_33140 8852 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 9889 11730 gene locus_tag LOCUS_33150 9889 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 13198 11765 gene locus_tag LOCUS_33160 13198 11765 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_33160 13187 14296 gene locus_tag LOCUS_33170 13187 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 14346 14714 gene locus_tag LOCUS_33180 14346 14714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 17169 14752 gene locus_tag LOCUS_33190 17169 14752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_33190 17852 17514 gene locus_tag LOCUS_33200 17852 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 18117 18797 gene locus_tag LOCUS_33210 18117 18797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 19070 20143 gene locus_tag LOCUS_33220 19070 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 20254 20424 gene locus_tag LOCUS_33230 20254 20424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 20577 21380 gene locus_tag LOCUS_33240 20577 21380 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_33240 21455 24391 gene locus_tag LOCUS_33250 21455 24391 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_33250 24624 26336 gene locus_tag LOCUS_33260 24624 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 26787 26560 gene locus_tag LOCUS_33270 26787 26560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 27592 26825 gene locus_tag LOCUS_33280 27592 26825 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_33280 28263 27556 gene locus_tag LOCUS_33290 28263 27556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 28882 29475 gene locus_tag LOCUS_33300 28882 29475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 29565 30578 gene locus_tag LOCUS_33310 29565 30578 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 protein_id gnl|my_center|LOCUS_33310 31149 31529 gene locus_tag LOCUS_33320 31149 31529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 32226 31537 gene locus_tag LOCUS_33330 32226 31537 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_33330 33599 32325 gene locus_tag LOCUS_33340 33599 32325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 33942 34343 gene locus_tag LOCUS_33350 33942 34343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 34589 36919 gene locus_tag LOCUS_33360 34589 36919 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_33360 38062 36947 gene locus_tag LOCUS_33370 38062 36947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 38213 39505 gene locus_tag LOCUS_33380 38213 39505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 39725 40162 gene locus_tag LOCUS_33390 39725 40162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 40791 43796 gene locus_tag LOCUS_33400 40791 43796 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_33400 43783 45120 gene locus_tag LOCUS_33410 43783 45120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 45516 46379 gene locus_tag LOCUS_33420 45516 46379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_33420 46476 49985 gene locus_tag LOCUS_33430 46476 49985 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_33430 51199 50021 gene locus_tag LOCUS_33440 51199 50021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 51739 51401 gene locus_tag LOCUS_33450 51739 51401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 52634 52236 gene locus_tag LOCUS_33460 52634 52236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 55864 52835 gene locus_tag LOCUS_33470 55864 52835 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_33470 58386 56137 gene locus_tag LOCUS_33480 58386 56137 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_33480 58542 58919 gene locus_tag LOCUS_33490 58542 58919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 59688 58945 gene locus_tag LOCUS_33500 59688 58945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 60287 59700 gene locus_tag LOCUS_33510 60287 59700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 61681 60419 gene locus_tag LOCUS_33520 61681 60419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 62901 61780 gene locus_tag LOCUS_33530 62901 61780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 66200 63060 gene locus_tag LOCUS_33540 66200 63060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 68339 66420 gene locus_tag LOCUS_33550 68339 66420 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_33550 69886 68639 gene locus_tag LOCUS_33560 69886 68639 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_33560 69864 71270 gene locus_tag LOCUS_33570 69864 71270 CDS product 23S rRNA (cytosine(2499)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_33570 72375 71416 gene locus_tag LOCUS_33580 72375 71416 CDS product DUF4928 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836658.1 protein_id gnl|my_center|LOCUS_33580 73501 72365 gene locus_tag LOCUS_33590 73501 72365 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_33590 73744 74895 gene locus_tag LOCUS_33600 73744 74895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 74950 75198 gene locus_tag LOCUS_33610 74950 75198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 75335 76864 gene locus_tag LOCUS_33620 75335 76864 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704053.1 protein_id gnl|my_center|LOCUS_33620 76995 77858 gene locus_tag LOCUS_33630 76995 77858 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_33630 77842 78897 gene locus_tag LOCUS_33640 gene corA 77842 78897 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965157.1 protein_id gnl|my_center|LOCUS_33640 79729 78986 gene locus_tag LOCUS_33650 79729 78986 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220090.1 protein_id gnl|my_center|LOCUS_33650 80928 79915 gene locus_tag LOCUS_33660 80928 79915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 81093 82856 gene locus_tag LOCUS_33670 81093 82856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 83109 84401 gene locus_tag LOCUS_33680 83109 84401 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263716.1 protein_id gnl|my_center|LOCUS_33680 84540 85052 gene locus_tag LOCUS_33690 84540 85052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 85232 85053 gene locus_tag LOCUS_33700 85232 85053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 85251 86015 gene locus_tag LOCUS_33710 85251 86015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 86481 87326 gene locus_tag LOCUS_33720 86481 87326 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798627.1 protein_id gnl|my_center|LOCUS_33720 87411 88151 gene locus_tag LOCUS_33730 87411 88151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 88241 88816 gene locus_tag LOCUS_33740 88241 88816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 89518 88883 gene locus_tag LOCUS_33750 89518 88883 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_33750 90144 89674 gene locus_tag LOCUS_33760 90144 89674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 90539 90162 gene locus_tag LOCUS_33770 90539 90162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 91059 90550 gene locus_tag LOCUS_33780 91059 90550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 91455 92105 gene locus_tag LOCUS_33790 91455 92105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 92557 92982 gene locus_tag LOCUS_33800 92557 92982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 94482 93031 gene locus_tag LOCUS_33810 94482 93031 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_33810 96138 94729 gene locus_tag LOCUS_33820 96138 94729 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_33820 98128 96398 gene locus_tag LOCUS_33830 gene sulP 98128 96398 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_33830 98365 99999 gene locus_tag LOCUS_33840 98365 99999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 100378 103485 gene locus_tag LOCUS_33850 100378 103485 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_33850 103593 105068 gene locus_tag LOCUS_33860 103593 105068 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767302.1 protein_id gnl|my_center|LOCUS_33860 105167 108541 gene locus_tag LOCUS_33870 105167 108541 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_33870 108583 110667 gene locus_tag LOCUS_33880 gene ygjK 108583 110667 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_33880 110680 113841 gene locus_tag LOCUS_33890 gene lacZ 110680 113841 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_33890 115251 113881 gene locus_tag LOCUS_33900 115251 113881 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_33900 115595 116518 gene locus_tag LOCUS_33910 115595 116518 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_33910 117622 117017 gene locus_tag LOCUS_33920 117622 117017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 117892 119265 gene locus_tag LOCUS_33930 117892 119265 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_33930 121450 119507 gene locus_tag LOCUS_33940 121450 119507 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839774.1 protein_id gnl|my_center|LOCUS_33940 121837 123540 gene locus_tag LOCUS_33950 121837 123540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 124059 123724 gene locus_tag LOCUS_33960 124059 123724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 124359 128588 gene locus_tag LOCUS_33970 124359 128588 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_33970 128751 129539 gene locus_tag LOCUS_33980 128751 129539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 129694 136038 gene locus_tag LOCUS_33990 129694 136038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 136280 140509 gene locus_tag LOCUS_34000 136280 140509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 140703 141518 gene locus_tag LOCUS_34010 140703 141518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 141692 141534 gene locus_tag LOCUS_34020 141692 141534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 141640 147657 gene locus_tag LOCUS_34030 141640 147657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence022 226 1674 gene locus_tag LOCUS_34040 226 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 1728 3362 gene locus_tag LOCUS_34050 1728 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 3755 3567 gene locus_tag LOCUS_34060 3755 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 3860 4291 gene locus_tag LOCUS_34070 3860 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 4617 4342 gene locus_tag LOCUS_34080 4617 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 5942 4797 gene locus_tag LOCUS_34090 5942 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 6419 6000 gene locus_tag LOCUS_34100 6419 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 6840 6433 gene locus_tag LOCUS_34110 6840 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 7461 6919 gene locus_tag LOCUS_34120 7461 6919 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_34120 9249 7783 gene locus_tag LOCUS_34130 gene proS 9249 7783 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_34130 9668 10819 gene locus_tag LOCUS_34140 9668 10819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 11071 12531 gene locus_tag LOCUS_34150 11071 12531 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_34150 12872 13393 gene locus_tag LOCUS_34160 12872 13393 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_34160 13374 14144 gene locus_tag LOCUS_34170 13374 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 14141 14911 gene locus_tag LOCUS_34180 14141 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 14928 16838 gene locus_tag LOCUS_34190 14928 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 18797 16860 gene locus_tag LOCUS_34200 18797 16860 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 protein_id gnl|my_center|LOCUS_34200 20081 18927 gene locus_tag LOCUS_34210 20081 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 21129 20476 gene locus_tag LOCUS_34220 21129 20476 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856201.1 protein_id gnl|my_center|LOCUS_34220 22275 21160 gene locus_tag LOCUS_34230 22275 21160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_34230 22823 22398 gene locus_tag LOCUS_34240 22823 22398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 23290 24612 gene locus_tag LOCUS_34250 23290 24612 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480671.1 protein_id gnl|my_center|LOCUS_34250 24634 25986 gene locus_tag LOCUS_34260 24634 25986 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480639.1 protein_id gnl|my_center|LOCUS_34260 26060 26542 gene locus_tag LOCUS_34270 26060 26542 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454901.1 protein_id gnl|my_center|LOCUS_34270 29304 26590 gene locus_tag LOCUS_34280 29304 26590 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933304.1 protein_id gnl|my_center|LOCUS_34280 29741 29352 gene locus_tag LOCUS_34290 29741 29352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 30547 29747 gene locus_tag LOCUS_34300 30547 29747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 31228 30842 gene locus_tag LOCUS_34310 31228 30842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 31455 31231 gene locus_tag LOCUS_34320 31455 31231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 33718 31580 gene locus_tag LOCUS_34330 33718 31580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 33984 36032 gene locus_tag LOCUS_34340 gene glgX 33984 36032 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_34340 37491 36436 gene locus_tag LOCUS_34350 37491 36436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 37686 39713 gene locus_tag LOCUS_34360 37686 39713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 40371 39907 gene locus_tag LOCUS_34370 40371 39907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 41240 40596 gene locus_tag LOCUS_34380 41240 40596 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_34380 43263 41278 gene locus_tag LOCUS_34390 43263 41278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 44419 43319 gene locus_tag LOCUS_34400 gene moeB 44419 43319 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_34400 45123 44614 gene locus_tag LOCUS_34410 45123 44614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 46534 45284 gene locus_tag LOCUS_34420 gene fahA 46534 45284 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_34420 47684 46545 gene locus_tag LOCUS_34430 gene hppD 47684 46545 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_34430 48892 47717 gene locus_tag LOCUS_34440 48892 47717 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_34440 49452 49000 gene locus_tag LOCUS_34450 49452 49000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 49669 50970 gene locus_tag LOCUS_34460 49669 50970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 51395 51009 gene locus_tag LOCUS_34470 51395 51009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 53639 51501 gene locus_tag LOCUS_34480 53639 51501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 56171 53646 gene locus_tag LOCUS_34490 56171 53646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 58596 56299 gene locus_tag LOCUS_34500 58596 56299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 59182 58706 gene locus_tag LOCUS_34510 59182 58706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 59487 60653 gene locus_tag LOCUS_34520 59487 60653 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_34520 60678 61808 gene locus_tag LOCUS_34530 60678 61808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 62183 62494 gene locus_tag LOCUS_34540 62183 62494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 62868 62491 gene locus_tag LOCUS_34550 62868 62491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 63162 64022 gene locus_tag LOCUS_34560 63162 64022 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_34560 64122 64664 gene locus_tag LOCUS_34570 64122 64664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 64704 65705 gene locus_tag LOCUS_34580 64704 65705 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_34580 65714 67198 gene locus_tag LOCUS_34590 65714 67198 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_34590 67564 69084 gene locus_tag LOCUS_34600 67564 69084 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 protein_id gnl|my_center|LOCUS_34600 70133 69141 gene locus_tag LOCUS_34610 70133 69141 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 protein_id gnl|my_center|LOCUS_34610 71405 70353 gene locus_tag LOCUS_34620 71405 70353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 72403 71504 gene locus_tag LOCUS_34630 72403 71504 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764904.1 protein_id gnl|my_center|LOCUS_34630 73935 72535 gene locus_tag LOCUS_34640 73935 72535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 74600 74136 gene locus_tag LOCUS_34650 74600 74136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 74921 75115 gene locus_tag LOCUS_34660 74921 75115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 75667 75218 gene locus_tag LOCUS_34670 75667 75218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 78876 75757 gene locus_tag LOCUS_34680 78876 75757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 79087 80271 gene locus_tag LOCUS_34690 79087 80271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 82664 80298 gene locus_tag LOCUS_34700 82664 80298 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021647.1 protein_id gnl|my_center|LOCUS_34700 83910 82699 gene locus_tag LOCUS_34710 83910 82699 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528855.1 protein_id gnl|my_center|LOCUS_34710 84786 83911 gene locus_tag LOCUS_34720 84786 83911 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047532.1 protein_id gnl|my_center|LOCUS_34720 85784 84849 gene locus_tag LOCUS_34730 85784 84849 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_34730 86338 87489 gene locus_tag LOCUS_34740 86338 87489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 87916 87479 gene locus_tag LOCUS_34750 87916 87479 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_34750 88040 88780 gene locus_tag LOCUS_34760 88040 88780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 88895 91228 gene locus_tag LOCUS_34770 88895 91228 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_34770 93495 91594 gene locus_tag LOCUS_34780 93495 91594 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895550.1 protein_id gnl|my_center|LOCUS_34780 93764 95752 gene locus_tag LOCUS_34790 93764 95752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 97662 95749 gene locus_tag LOCUS_34800 97662 95749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 99307 97730 gene locus_tag LOCUS_34810 99307 97730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 100298 99378 gene locus_tag LOCUS_34820 100298 99378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 101476 100337 gene locus_tag LOCUS_34830 101476 100337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 102537 101479 gene locus_tag LOCUS_34840 102537 101479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 104398 102548 gene locus_tag LOCUS_34850 104398 102548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 105937 105230 gene locus_tag LOCUS_34860 105937 105230 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_34860 107973 105934 gene locus_tag LOCUS_34870 107973 105934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 108506 108090 gene locus_tag LOCUS_34880 108506 108090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 108731 111082 gene locus_tag LOCUS_34890 108731 111082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 112244 111120 gene locus_tag LOCUS_34900 112244 111120 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_34900 113623 112319 gene locus_tag LOCUS_34910 113623 112319 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 protein_id gnl|my_center|LOCUS_34910 115758 113734 gene locus_tag LOCUS_34920 115758 113734 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_34920 116006 117730 gene locus_tag LOCUS_34930 116006 117730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 119420 117771 gene locus_tag LOCUS_34940 119420 117771 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_34940 121470 119449 gene locus_tag LOCUS_34950 121470 119449 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_34950 123034 121484 gene locus_tag LOCUS_34960 123034 121484 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118456.1 protein_id gnl|my_center|LOCUS_34960 124799 123183 gene locus_tag LOCUS_34970 124799 123183 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841352.1 protein_id gnl|my_center|LOCUS_34970 126370 124799 gene locus_tag LOCUS_34980 126370 124799 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_34980 128894 126489 gene locus_tag LOCUS_34990 128894 126489 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_34990 130507 129068 gene locus_tag LOCUS_35000 130507 129068 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_35000 133729 130526 gene locus_tag LOCUS_35010 133729 130526 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_35010 137950 133874 gene locus_tag LOCUS_35020 137950 133874 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_35020 138131 138949 gene locus_tag LOCUS_35030 138131 138949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 139489 140187 gene locus_tag LOCUS_35040 139489 140187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 140260 140502 gene locus_tag LOCUS_35050 140260 140502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 140520 141365 gene locus_tag LOCUS_35060 140520 141365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 141424 142185 gene locus_tag LOCUS_35070 141424 142185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 144891 142246 gene locus_tag LOCUS_35080 144891 142246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence023 883 383 gene locus_tag LOCUS_35090 883 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 1876 1001 gene locus_tag LOCUS_35100 1876 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 2106 2819 gene locus_tag LOCUS_35110 2106 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3247 4026 gene locus_tag LOCUS_35120 3247 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 4023 4799 gene locus_tag LOCUS_35130 4023 4799 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_35130 4803 5483 gene locus_tag LOCUS_35140 4803 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 5590 6036 gene locus_tag LOCUS_35150 5590 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 6039 6749 gene locus_tag LOCUS_35160 gene alsD 6039 6749 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 protein_id gnl|my_center|LOCUS_35160 6930 8762 gene locus_tag LOCUS_35170 6930 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 8989 9177 gene locus_tag LOCUS_35180 8989 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 12637 9416 gene locus_tag LOCUS_35190 12637 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_35190 12999 13637 gene locus_tag LOCUS_35200 12999 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 13783 14448 gene locus_tag LOCUS_35210 13783 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 14804 15739 gene locus_tag LOCUS_35220 14804 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 15795 16514 gene locus_tag LOCUS_35230 15795 16514 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_35230 16528 17961 gene locus_tag LOCUS_35240 16528 17961 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_35240 18420 17977 gene locus_tag LOCUS_35250 18420 17977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 20147 18726 gene locus_tag LOCUS_35260 20147 18726 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299143.1 protein_id gnl|my_center|LOCUS_35260 20232 21053 gene locus_tag LOCUS_35270 20232 21053 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_35270 21448 21038 gene locus_tag LOCUS_35280 21448 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 23573 21711 gene locus_tag LOCUS_35290 23573 21711 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_35290 24209 23667 gene locus_tag LOCUS_35300 24209 23667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 25330 24830 gene locus_tag LOCUS_35310 25330 24830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 27147 25729 gene locus_tag LOCUS_35320 27147 25729 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861828.1 protein_id gnl|my_center|LOCUS_35320 29523 27304 gene locus_tag LOCUS_35330 29523 27304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 30538 29537 gene locus_tag LOCUS_35340 30538 29537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 32327 30693 gene locus_tag LOCUS_35350 32327 30693 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941681.1 protein_id gnl|my_center|LOCUS_35350 32576 34183 gene locus_tag LOCUS_35360 32576 34183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 35114 34221 gene locus_tag LOCUS_35370 35114 34221 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_35370 35769 35170 gene locus_tag LOCUS_35380 35769 35170 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 protein_id gnl|my_center|LOCUS_35380 36969 35779 gene locus_tag LOCUS_35390 36969 35779 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373777.1 protein_id gnl|my_center|LOCUS_35390 38458 37178 gene locus_tag LOCUS_35400 38458 37178 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948927.1 protein_id gnl|my_center|LOCUS_35400 39126 38461 gene locus_tag LOCUS_35410 39126 38461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 39883 39293 gene locus_tag LOCUS_35420 39883 39293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385650.1 protein_id gnl|my_center|LOCUS_35420 40872 39895 gene locus_tag LOCUS_35430 40872 39895 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531651.1 protein_id gnl|my_center|LOCUS_35430 41273 40878 gene locus_tag LOCUS_35440 41273 40878 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088362.1 protein_id gnl|my_center|LOCUS_35440 41436 41245 gene locus_tag LOCUS_35450 41436 41245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 41552 42697 gene locus_tag LOCUS_35460 41552 42697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 42791 43687 gene locus_tag LOCUS_35470 42791 43687 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964568.1 protein_id gnl|my_center|LOCUS_35470 43811 44830 gene locus_tag LOCUS_35480 43811 44830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 44989 45183 gene locus_tag LOCUS_35490 44989 45183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 46590 45178 gene locus_tag LOCUS_35500 46590 45178 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_35500 46733 49429 gene locus_tag LOCUS_35510 46733 49429 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107972.1 protein_id gnl|my_center|LOCUS_35510 49542 49799 gene locus_tag LOCUS_35520 49542 49799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 50909 49752 gene locus_tag LOCUS_35530 50909 49752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 51132 52541 gene locus_tag LOCUS_35540 51132 52541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 55822 52637 gene locus_tag LOCUS_35550 55822 52637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 56088 56543 gene locus_tag LOCUS_35560 56088 56543 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019973.1 protein_id gnl|my_center|LOCUS_35560 56670 59234 gene locus_tag LOCUS_35570 56670 59234 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_35570 59426 60325 gene locus_tag LOCUS_35580 59426 60325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766165.1 protein_id gnl|my_center|LOCUS_35580 60432 63707 gene locus_tag LOCUS_35590 60432 63707 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766164.1 protein_id gnl|my_center|LOCUS_35590 63807 65225 gene locus_tag LOCUS_35600 63807 65225 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760594.1 protein_id gnl|my_center|LOCUS_35600 65244 66305 gene locus_tag LOCUS_35610 65244 66305 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760595.1 protein_id gnl|my_center|LOCUS_35610 66302 69433 gene locus_tag LOCUS_35620 66302 69433 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766163.1 protein_id gnl|my_center|LOCUS_35620 69560 69907 gene locus_tag LOCUS_35630 69560 69907 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964018.1 protein_id gnl|my_center|LOCUS_35630 70001 74683 gene locus_tag LOCUS_35640 70001 74683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 74797 75384 gene locus_tag LOCUS_35650 74797 75384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766161.1 protein_id gnl|my_center|LOCUS_35650 75807 78773 gene locus_tag LOCUS_35660 75807 78773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 79026 79802 gene locus_tag LOCUS_35670 79026 79802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 81790 79835 gene locus_tag LOCUS_35680 81790 79835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 82391 82173 gene locus_tag LOCUS_35690 82391 82173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 84104 82650 gene locus_tag LOCUS_35700 84104 82650 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 protein_id gnl|my_center|LOCUS_35700 85337 84252 gene locus_tag LOCUS_35710 85337 84252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 88829 85587 gene locus_tag LOCUS_35720 88829 85587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 90692 89604 gene locus_tag LOCUS_35730 90692 89604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 91612 90899 gene locus_tag LOCUS_35740 91612 90899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 92831 91896 gene locus_tag LOCUS_35750 92831 91896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 93385 92864 gene locus_tag LOCUS_35760 93385 92864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 94829 93399 gene locus_tag LOCUS_35770 94829 93399 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_35770 95092 96903 gene locus_tag LOCUS_35780 95092 96903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 98336 97116 gene locus_tag LOCUS_35790 98336 97116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 102439 98816 gene locus_tag LOCUS_35800 102439 98816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 102840 102457 gene locus_tag LOCUS_35810 102840 102457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 103177 102830 gene locus_tag LOCUS_35820 103177 102830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 103905 103465 gene locus_tag LOCUS_35830 103905 103465 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_35830 105069 104107 gene locus_tag LOCUS_35840 gene ansB 105069 104107 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791484.1 protein_id gnl|my_center|LOCUS_35840 105529 105134 gene locus_tag LOCUS_35850 105529 105134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 106710 105589 gene locus_tag LOCUS_35860 gene hisC 106710 105589 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897361.1 protein_id gnl|my_center|LOCUS_35860 109661 106797 gene locus_tag LOCUS_35870 109661 106797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 110020 111639 gene locus_tag LOCUS_35880 110020 111639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 113399 111696 gene locus_tag LOCUS_35890 113399 111696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 113759 115039 gene locus_tag LOCUS_35900 gene serS 113759 115039 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_35900 115236 115943 gene locus_tag LOCUS_35910 115236 115943 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_35910 116217 116783 gene locus_tag LOCUS_35920 gene frr 116217 116783 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_35920 118957 117152 gene locus_tag LOCUS_35930 118957 117152 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_35930 119346 119675 gene locus_tag LOCUS_35940 119346 119675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 119668 122295 gene locus_tag LOCUS_35950 119668 122295 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_35950 123136 122339 gene locus_tag LOCUS_35960 123136 122339 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790660.1 protein_id gnl|my_center|LOCUS_35960 124309 123401 gene locus_tag LOCUS_35970 124309 123401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 125132 124740 gene locus_tag LOCUS_35980 gene gcvH 125132 124740 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_35980 126665 125352 gene locus_tag LOCUS_35990 126665 125352 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_35990 127145 126732 gene locus_tag LOCUS_36000 127145 126732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 127508 128089 gene locus_tag LOCUS_36010 127508 128089 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_36010 131033 128364 gene locus_tag LOCUS_36020 131033 128364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 133411 131825 gene locus_tag LOCUS_36030 133411 131825 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_36030 136533 133669 gene locus_tag LOCUS_36040 gene uvrA 136533 133669 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_36040 137478 136657 gene locus_tag LOCUS_36050 137478 136657 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963590.1 protein_id gnl|my_center|LOCUS_36050 137697 138170 gene locus_tag LOCUS_36060 137697 138170 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545395.1 protein_id gnl|my_center|LOCUS_36060 138181 139416 gene locus_tag LOCUS_36070 gene nusA 138181 139416 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_36070 139749 142994 gene locus_tag LOCUS_36080 139749 142994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 143182 145083 gene locus_tag LOCUS_36090 143182 145083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 >Feature sequence024 884 108 gene locus_tag LOCUS_36100 884 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 1141 2136 gene locus_tag LOCUS_36110 1141 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 3221 2163 gene locus_tag LOCUS_36120 3221 2163 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_36120 3386 3231 gene locus_tag LOCUS_36130 3386 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 4054 3386 gene locus_tag LOCUS_36140 4054 3386 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819982.1 protein_id gnl|my_center|LOCUS_36140 4172 5014 gene locus_tag LOCUS_36150 4172 5014 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832366.1 protein_id gnl|my_center|LOCUS_36150 5156 5905 gene locus_tag LOCUS_36160 5156 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 6134 6709 gene locus_tag LOCUS_36170 6134 6709 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_36170 6699 7997 gene locus_tag LOCUS_36180 6699 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 8162 8043 gene locus_tag LOCUS_36190 8162 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 9082 8165 gene locus_tag LOCUS_36200 9082 8165 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_36200 10108 9245 gene locus_tag LOCUS_36210 10108 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 11298 10180 gene locus_tag LOCUS_36220 11298 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 11852 11307 gene locus_tag LOCUS_36230 11852 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 12964 12071 gene locus_tag LOCUS_36240 12964 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 13854 12985 gene locus_tag LOCUS_36250 13854 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 15060 13951 gene locus_tag LOCUS_36260 15060 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 15584 15934 gene locus_tag LOCUS_36270 15584 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 16162 17085 gene locus_tag LOCUS_36280 16162 17085 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_36280 17087 17812 gene locus_tag LOCUS_36290 17087 17812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_36290 17819 19333 gene locus_tag LOCUS_36300 17819 19333 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_36300 19326 20297 gene locus_tag LOCUS_36310 19326 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 21907 22359 gene locus_tag LOCUS_36320 gene tnpA 21907 22359 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_36320 22462 23055 gene locus_tag LOCUS_36330 22462 23055 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085819.1 protein_id gnl|my_center|LOCUS_36330 23392 25758 gene locus_tag LOCUS_36340 23392 25758 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_36340 25800 26591 gene locus_tag LOCUS_36350 25800 26591 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_36350 26646 27836 gene locus_tag LOCUS_36360 26646 27836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_36360 28907 27876 gene locus_tag LOCUS_36370 28907 27876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 29427 29029 gene locus_tag LOCUS_36380 29427 29029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 29612 30115 gene locus_tag LOCUS_36390 29612 30115 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_36390 31349 30165 gene locus_tag LOCUS_36400 31349 30165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 31806 32495 gene locus_tag LOCUS_36410 31806 32495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 33498 32542 gene locus_tag LOCUS_36420 33498 32542 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_36420 34616 33468 gene locus_tag LOCUS_36430 34616 33468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 35573 34734 gene locus_tag LOCUS_36440 35573 34734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 36335 35577 gene locus_tag LOCUS_36450 36335 35577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 36828 36328 gene locus_tag LOCUS_36460 36828 36328 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_36460 37322 37855 gene locus_tag LOCUS_36470 37322 37855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 37996 40809 gene locus_tag LOCUS_36480 37996 40809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 42002 40923 gene locus_tag LOCUS_36490 42002 40923 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 protein_id gnl|my_center|LOCUS_36490 42769 41999 gene locus_tag LOCUS_36500 42769 41999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 45602 43026 gene locus_tag LOCUS_36510 45602 43026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 46000 45605 gene locus_tag LOCUS_36520 46000 45605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 46545 46327 gene locus_tag LOCUS_36530 46545 46327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 47272 46610 gene locus_tag LOCUS_36540 47272 46610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 47777 47274 gene locus_tag LOCUS_36550 47777 47274 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_36550 48760 48041 gene locus_tag LOCUS_36560 48760 48041 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762145.1 protein_id gnl|my_center|LOCUS_36560 49279 48992 gene locus_tag LOCUS_36570 49279 48992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 52337 49266 gene locus_tag LOCUS_36580 52337 49266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 53414 52347 gene locus_tag LOCUS_36590 53414 52347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 55241 53418 gene locus_tag LOCUS_36600 55241 53418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 56824 55430 gene locus_tag LOCUS_36610 56824 55430 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993309.1 protein_id gnl|my_center|LOCUS_36610 57945 57193 gene locus_tag LOCUS_36620 57945 57193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 58640 57957 gene locus_tag LOCUS_36630 58640 57957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 59043 58750 gene locus_tag LOCUS_36640 59043 58750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 59576 59040 gene locus_tag LOCUS_36650 59576 59040 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_36650 60000 59569 gene locus_tag LOCUS_36660 60000 59569 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_36660 60915 60067 gene locus_tag LOCUS_36670 60915 60067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 62017 61067 gene locus_tag LOCUS_36680 62017 61067 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246662.1 protein_id gnl|my_center|LOCUS_36680 64971 62215 gene locus_tag LOCUS_36690 64971 62215 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073740.1 protein_id gnl|my_center|LOCUS_36690 65937 65083 gene locus_tag LOCUS_36700 65937 65083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 66626 66126 gene locus_tag LOCUS_36710 66626 66126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 66935 68026 gene locus_tag LOCUS_36720 66935 68026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 68023 69639 gene locus_tag LOCUS_36730 68023 69639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 69644 71944 gene locus_tag LOCUS_36740 69644 71944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 72082 75204 gene locus_tag LOCUS_36750 72082 75204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 75972 75205 gene locus_tag LOCUS_36760 75972 75205 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_36760 77100 76078 gene locus_tag LOCUS_36770 77100 76078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 77693 77235 gene locus_tag LOCUS_36780 77693 77235 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_36780 77968 78351 gene locus_tag LOCUS_36790 77968 78351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 78512 78862 gene locus_tag LOCUS_36800 78512 78862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 78846 81464 gene locus_tag LOCUS_36810 78846 81464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_36810 81672 82217 gene locus_tag LOCUS_36820 81672 82217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 82909 85863 gene locus_tag LOCUS_36830 82909 85863 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_36830 85869 87260 gene locus_tag LOCUS_36840 85869 87260 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_36840 87915 87352 gene locus_tag LOCUS_36850 87915 87352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 88256 88005 gene locus_tag LOCUS_36860 88256 88005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 89501 88272 gene locus_tag LOCUS_36870 89501 88272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552141.1 protein_id gnl|my_center|LOCUS_36870 90417 89860 gene locus_tag LOCUS_36880 90417 89860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 91658 90582 gene locus_tag LOCUS_36890 91658 90582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 92589 91828 gene locus_tag LOCUS_36900 92589 91828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 93444 92695 gene locus_tag LOCUS_36910 93444 92695 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_36910 96158 93441 gene locus_tag LOCUS_36920 96158 93441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 97154 96393 gene locus_tag LOCUS_36930 97154 96393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 98282 97164 gene locus_tag LOCUS_36940 98282 97164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 98523 101852 gene locus_tag LOCUS_36950 98523 101852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_36950 103173 102166 gene locus_tag LOCUS_36960 103173 102166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 103927 103295 gene locus_tag LOCUS_36970 103927 103295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 105232 104201 gene locus_tag LOCUS_36980 105232 104201 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337441.1 protein_id gnl|my_center|LOCUS_36980 105911 105297 gene locus_tag LOCUS_36990 105911 105297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 106611 106147 gene locus_tag LOCUS_37000 106611 106147 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706073.1 protein_id gnl|my_center|LOCUS_37000 108360 106684 gene locus_tag LOCUS_37010 108360 106684 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 protein_id gnl|my_center|LOCUS_37010 110731 108410 gene locus_tag LOCUS_37020 110731 108410 CDS product ethanolamine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513617.1 protein_id gnl|my_center|LOCUS_37020 111328 110861 gene locus_tag LOCUS_37030 111328 110861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 111851 111312 gene locus_tag LOCUS_37040 111851 111312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 112128 112775 gene locus_tag LOCUS_37050 112128 112775 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242863.1 protein_id gnl|my_center|LOCUS_37050 113377 112742 gene locus_tag LOCUS_37060 113377 112742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 113854 113417 gene locus_tag LOCUS_37070 113854 113417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 114439 113858 gene locus_tag LOCUS_37080 114439 113858 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_37080 115674 114664 gene locus_tag LOCUS_37090 115674 114664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 116897 115722 gene locus_tag LOCUS_37100 116897 115722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 117434 116925 gene locus_tag LOCUS_37110 117434 116925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 118281 117694 gene locus_tag LOCUS_37120 118281 117694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 119435 119139 gene locus_tag LOCUS_37130 119435 119139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 121410 119674 gene locus_tag LOCUS_37140 121410 119674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 121950 122666 gene locus_tag LOCUS_37150 121950 122666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 122659 123345 gene locus_tag LOCUS_37160 122659 123345 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_37160 124500 123430 gene locus_tag LOCUS_37170 124500 123430 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064449.1 protein_id gnl|my_center|LOCUS_37170 125332 124601 gene locus_tag LOCUS_37180 125332 124601 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_37180 126438 125416 gene locus_tag LOCUS_37190 126438 125416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 128370 126703 gene locus_tag LOCUS_37200 128370 126703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 128558 129016 gene locus_tag LOCUS_37210 128558 129016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 129421 129008 gene locus_tag LOCUS_37220 129421 129008 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241885.1 protein_id gnl|my_center|LOCUS_37220 129505 129957 gene locus_tag LOCUS_37230 129505 129957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 131255 130038 gene locus_tag LOCUS_37240 131255 130038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 131548 132501 gene locus_tag LOCUS_37250 131548 132501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 134618 132570 gene locus_tag LOCUS_37260 134618 132570 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071523.1 protein_id gnl|my_center|LOCUS_37260 134928 136391 gene locus_tag LOCUS_37270 134928 136391 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_37270 139228 136457 gene locus_tag LOCUS_37280 139228 136457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 139963 139547 gene locus_tag LOCUS_37290 gene moaE 139963 139547 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531878.1 protein_id gnl|my_center|LOCUS_37290 140234 140893 gene locus_tag LOCUS_37300 140234 140893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 140990 141184 gene locus_tag LOCUS_37310 gene rpsU 140990 141184 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_37310 >Feature sequence025 1 6255 gene locus_tag LOCUS_37320 1 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 6361 6942 gene locus_tag LOCUS_37330 6361 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 7650 6955 gene locus_tag LOCUS_37340 7650 6955 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_37340 8423 7824 gene locus_tag LOCUS_37350 8423 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 9938 8883 gene locus_tag LOCUS_37360 9938 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 11226 9931 gene locus_tag LOCUS_37370 11226 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 11297 11503 gene locus_tag LOCUS_37380 11297 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 12249 11494 gene locus_tag LOCUS_37390 12249 11494 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_37390 12704 12291 gene locus_tag LOCUS_37400 12704 12291 CDS product DUF2000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967594.1 protein_id gnl|my_center|LOCUS_37400 13740 12790 gene locus_tag LOCUS_37410 13740 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 14127 17108 gene locus_tag LOCUS_37420 14127 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 17587 17192 gene locus_tag LOCUS_37430 17587 17192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 17824 18606 gene locus_tag LOCUS_37440 17824 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 19801 18716 gene locus_tag LOCUS_37450 19801 18716 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071538.1 protein_id gnl|my_center|LOCUS_37450 20200 20754 gene locus_tag LOCUS_37460 20200 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 22365 21229 gene locus_tag LOCUS_37470 22365 21229 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_37470 24553 22496 gene locus_tag LOCUS_37480 24553 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 26377 25067 gene locus_tag LOCUS_37490 26377 25067 CDS product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435280.1 protein_id gnl|my_center|LOCUS_37490 29327 26697 gene locus_tag LOCUS_37500 29327 26697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_37500 29698 29333 gene locus_tag LOCUS_37510 29698 29333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 31335 30094 gene locus_tag LOCUS_37520 31335 30094 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_37520 31713 32207 gene locus_tag LOCUS_37530 31713 32207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 33776 32598 gene locus_tag LOCUS_37540 33776 32598 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_37540 34086 35444 gene locus_tag LOCUS_37550 34086 35444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 36668 35685 gene locus_tag LOCUS_37560 36668 35685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 36994 37689 gene locus_tag LOCUS_37570 36994 37689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 39163 37772 gene locus_tag LOCUS_37580 39163 37772 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_37580 40273 41970 gene locus_tag LOCUS_37590 40273 41970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 42157 43953 gene locus_tag LOCUS_37600 42157 43953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 44292 45956 gene locus_tag LOCUS_37610 44292 45956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 46227 50291 gene locus_tag LOCUS_37620 46227 50291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 50686 51615 gene locus_tag LOCUS_37630 50686 51615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 51638 53080 gene locus_tag LOCUS_37640 51638 53080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 53276 53148 gene locus_tag LOCUS_37650 53276 53148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 53768 54748 gene locus_tag LOCUS_37660 53768 54748 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402917.1 protein_id gnl|my_center|LOCUS_37660 54767 56425 gene locus_tag LOCUS_37670 54767 56425 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229097.1 protein_id gnl|my_center|LOCUS_37670 60222 56470 gene locus_tag LOCUS_37680 60222 56470 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_37680 60713 60462 gene locus_tag LOCUS_37690 60713 60462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 60840 61184 gene locus_tag LOCUS_37700 60840 61184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 61191 62462 gene locus_tag LOCUS_37710 61191 62462 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_37710 62921 62490 gene locus_tag LOCUS_37720 62921 62490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 64902 63172 gene locus_tag LOCUS_37730 64902 63172 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_37730 66756 65140 gene locus_tag LOCUS_37740 66756 65140 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444186.1 protein_id gnl|my_center|LOCUS_37740 69004 67232 gene locus_tag LOCUS_37750 69004 67232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 69316 70890 gene locus_tag LOCUS_37760 69316 70890 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_37760 72027 70897 gene locus_tag LOCUS_37770 72027 70897 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_37770 72719 72270 gene locus_tag LOCUS_37780 72719 72270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 73081 74400 gene locus_tag LOCUS_37790 73081 74400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 76071 74500 gene locus_tag LOCUS_37800 76071 74500 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_37800 77414 76083 gene locus_tag LOCUS_37810 gene dacB 77414 76083 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 protein_id gnl|my_center|LOCUS_37810 77644 79398 gene locus_tag LOCUS_37820 77644 79398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 80660 79605 gene locus_tag LOCUS_37830 gene bioF 80660 79605 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870815.1 protein_id gnl|my_center|LOCUS_37830 81677 80661 gene locus_tag LOCUS_37840 81677 80661 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_37840 82177 81686 gene locus_tag LOCUS_37850 82177 81686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 83243 82215 gene locus_tag LOCUS_37860 83243 82215 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_37860 83664 85580 gene locus_tag LOCUS_37870 83664 85580 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_37870 86003 88408 gene locus_tag LOCUS_37880 gene lon 86003 88408 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_37880 88600 89253 gene locus_tag LOCUS_37890 88600 89253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 89829 89290 gene locus_tag LOCUS_37900 89829 89290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 90818 90045 gene locus_tag LOCUS_37910 90818 90045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 91353 92048 gene locus_tag LOCUS_37920 91353 92048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 92546 92055 gene locus_tag LOCUS_37930 92546 92055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 95967 92719 gene locus_tag LOCUS_37940 95967 92719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 97270 95975 gene locus_tag LOCUS_37950 97270 95975 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_37950 97542 101270 gene locus_tag LOCUS_37960 97542 101270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 101291 101593 gene locus_tag LOCUS_37970 101291 101593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 102255 101650 gene locus_tag LOCUS_37980 102255 101650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 103141 102353 gene locus_tag LOCUS_37990 103141 102353 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_37990 103433 103149 gene locus_tag LOCUS_38000 103433 103149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 103590 104273 gene locus_tag LOCUS_38010 103590 104273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 104476 105060 gene locus_tag LOCUS_38020 104476 105060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 105500 105081 gene locus_tag LOCUS_38030 gene rbfA 105500 105081 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_38030 106377 105541 gene locus_tag LOCUS_38040 106377 105541 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467799.1 protein_id gnl|my_center|LOCUS_38040 106632 108743 gene locus_tag LOCUS_38050 gene recG 106632 108743 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_38050 109641 109033 gene locus_tag LOCUS_38060 109641 109033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 109852 111159 gene locus_tag LOCUS_38070 109852 111159 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_38070 111822 112217 gene locus_tag LOCUS_38080 111822 112217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 112395 113600 gene locus_tag LOCUS_38090 112395 113600 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403228.1 protein_id gnl|my_center|LOCUS_38090 113605 114045 gene locus_tag LOCUS_38100 113605 114045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 114597 114088 gene locus_tag LOCUS_38110 114597 114088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 116448 114778 gene locus_tag LOCUS_38120 116448 114778 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_38120 117018 116557 gene locus_tag LOCUS_38130 117018 116557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 118481 117078 gene locus_tag LOCUS_38140 118481 117078 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_38140 119012 118677 gene locus_tag LOCUS_38150 gene ssb 119012 118677 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_38150 119518 120357 gene locus_tag LOCUS_38160 119518 120357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 120545 121414 gene locus_tag LOCUS_38170 120545 121414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 122155 121517 gene locus_tag LOCUS_38180 122155 121517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 122221 123138 gene locus_tag LOCUS_38190 122221 123138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 123186 123635 gene locus_tag LOCUS_38200 123186 123635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 123818 124354 gene locus_tag LOCUS_38210 gene dcd 123818 124354 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_38210 127995 124351 gene locus_tag LOCUS_38220 127995 124351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 131638 128297 gene locus_tag LOCUS_38230 131638 128297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_38230 132427 135297 gene locus_tag LOCUS_38240 132427 135297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 135626 136300 gene locus_tag LOCUS_38250 135626 136300 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_38250 >Feature sequence026 604 107 gene locus_tag LOCUS_38260 604 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 1235 618 gene locus_tag LOCUS_38270 1235 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 1338 2468 gene locus_tag LOCUS_38280 1338 2468 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_38280 3662 2475 gene locus_tag LOCUS_38290 3662 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 4315 6465 gene locus_tag LOCUS_38300 4315 6465 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_38300 6471 7253 gene locus_tag LOCUS_38310 gene cobA 6471 7253 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_38310 7250 7891 gene locus_tag LOCUS_38320 7250 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 8165 8896 gene locus_tag LOCUS_38330 gene cysH 8165 8896 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958980.1 protein_id gnl|my_center|LOCUS_38330 8805 9002 gene locus_tag LOCUS_38340 8805 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 9048 10052 gene locus_tag LOCUS_38350 9048 10052 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_38350 11473 10127 gene locus_tag LOCUS_38360 gene mtaB 11473 10127 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_38360 12368 11565 gene locus_tag LOCUS_38370 12368 11565 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_38370 12714 13247 gene locus_tag LOCUS_38380 12714 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 13515 14552 gene locus_tag LOCUS_38390 gene lpxK 13515 14552 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_38390 16998 14596 gene locus_tag LOCUS_38400 16998 14596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_38400 17255 17932 gene locus_tag LOCUS_38410 17255 17932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 18080 19783 gene locus_tag LOCUS_38420 18080 19783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 19814 20500 gene locus_tag LOCUS_38430 19814 20500 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_38430 20686 21780 gene locus_tag LOCUS_38440 20686 21780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 21777 22583 gene locus_tag LOCUS_38450 21777 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 22614 23678 gene locus_tag LOCUS_38460 22614 23678 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066664.1 protein_id gnl|my_center|LOCUS_38460 23812 24828 gene locus_tag LOCUS_38470 23812 24828 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203499.1 protein_id gnl|my_center|LOCUS_38470 24825 25598 gene locus_tag LOCUS_38480 24825 25598 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_38480 25782 26612 gene locus_tag LOCUS_38490 25782 26612 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_38490 26624 27007 gene locus_tag LOCUS_38500 26624 27007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 27667 27482 gene locus_tag LOCUS_38510 27667 27482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 27790 28896 gene locus_tag LOCUS_38520 27790 28896 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_38520 28887 29522 gene locus_tag LOCUS_38530 gene rpoE 28887 29522 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_38530 31530 29734 gene locus_tag LOCUS_38540 31530 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 32964 31618 gene locus_tag LOCUS_38550 32964 31618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 33442 34092 gene locus_tag LOCUS_38560 33442 34092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 34503 34096 gene locus_tag LOCUS_38570 34503 34096 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_38570 35168 36304 gene locus_tag LOCUS_38580 35168 36304 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_38580 36557 37741 gene locus_tag LOCUS_38590 36557 37741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 37808 39208 gene locus_tag LOCUS_38600 gene lpdA 37808 39208 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_38600 39916 39245 gene locus_tag LOCUS_38610 gene rsmI 39916 39245 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_38610 40190 39921 gene locus_tag LOCUS_38620 gene purS 40190 39921 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_38620 40891 40187 gene locus_tag LOCUS_38630 gene pssA 40891 40187 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_38630 41207 44194 gene locus_tag LOCUS_38640 41207 44194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 44342 44863 gene locus_tag LOCUS_38650 44342 44863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 44923 46182 gene locus_tag LOCUS_38660 44923 46182 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_38660 47055 46195 gene locus_tag LOCUS_38670 47055 46195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 47175 50978 gene locus_tag LOCUS_38680 47175 50978 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922114.1 protein_id gnl|my_center|LOCUS_38680 51941 50988 gene locus_tag LOCUS_38690 51941 50988 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_38690 52102 52860 gene locus_tag LOCUS_38700 52102 52860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 52981 53406 gene locus_tag LOCUS_38710 52981 53406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 53516 55504 gene locus_tag LOCUS_38720 53516 55504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 55511 56146 gene locus_tag LOCUS_38730 55511 56146 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_38730 56680 57840 gene locus_tag LOCUS_38740 56680 57840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 57955 58575 gene locus_tag LOCUS_38750 57955 58575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839969.1 protein_id gnl|my_center|LOCUS_38750 58576 59373 gene locus_tag LOCUS_38760 58576 59373 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244223.1 protein_id gnl|my_center|LOCUS_38760 59498 60535 gene locus_tag LOCUS_38770 59498 60535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 60615 60794 gene locus_tag LOCUS_38780 60615 60794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 61085 61300 gene locus_tag LOCUS_38790 61085 61300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 61386 63620 gene locus_tag LOCUS_38800 61386 63620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 63684 64226 gene locus_tag LOCUS_38810 63684 64226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 64207 64653 gene locus_tag LOCUS_38820 64207 64653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 65461 64757 gene locus_tag LOCUS_38830 65461 64757 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_38830 66553 65462 gene locus_tag LOCUS_38840 66553 65462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 66769 67740 gene locus_tag LOCUS_38850 66769 67740 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_38850 67927 69015 gene locus_tag LOCUS_38860 67927 69015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 69398 69814 gene locus_tag LOCUS_38870 69398 69814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 69949 70458 gene locus_tag LOCUS_38880 69949 70458 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962661.1 protein_id gnl|my_center|LOCUS_38880 70591 71142 gene locus_tag LOCUS_38890 70591 71142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 71407 73302 gene locus_tag LOCUS_38900 71407 73302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 73417 73857 gene locus_tag LOCUS_38910 73417 73857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 73943 75166 gene locus_tag LOCUS_38920 73943 75166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 75276 76400 gene locus_tag LOCUS_38930 75276 76400 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974502.1 protein_id gnl|my_center|LOCUS_38930 76502 78133 gene locus_tag LOCUS_38940 76502 78133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 78211 79143 gene locus_tag LOCUS_38950 78211 79143 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246662.1 protein_id gnl|my_center|LOCUS_38950 79396 79698 gene locus_tag LOCUS_38960 79396 79698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 79908 81215 gene locus_tag LOCUS_38970 79908 81215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 81373 82401 gene locus_tag LOCUS_38980 81373 82401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 82498 83652 gene locus_tag LOCUS_38990 82498 83652 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_38990 83661 84707 gene locus_tag LOCUS_39000 83661 84707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 84919 85275 gene locus_tag LOCUS_39010 84919 85275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 85275 85787 gene locus_tag LOCUS_39020 85275 85787 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444234.1 protein_id gnl|my_center|LOCUS_39020 85961 86899 gene locus_tag LOCUS_39030 85961 86899 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_39030 86906 87490 gene locus_tag LOCUS_39040 86906 87490 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_39040 88069 87530 gene locus_tag LOCUS_39050 88069 87530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 88862 89734 gene locus_tag LOCUS_39060 88862 89734 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_39060 89772 89957 gene locus_tag LOCUS_39070 89772 89957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 89994 90731 gene locus_tag LOCUS_39080 89994 90731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 92239 90836 gene locus_tag LOCUS_39090 92239 90836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 93748 92297 gene locus_tag LOCUS_39100 93748 92297 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_39100 95426 93987 gene locus_tag LOCUS_39110 95426 93987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 96269 95523 gene locus_tag LOCUS_39120 96269 95523 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_39120 97333 96266 gene locus_tag LOCUS_39130 97333 96266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 98945 97473 gene locus_tag LOCUS_39140 98945 97473 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946795.1 protein_id gnl|my_center|LOCUS_39140 99532 98990 gene locus_tag LOCUS_39150 99532 98990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 100921 99734 gene locus_tag LOCUS_39160 100921 99734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 101007 103121 gene locus_tag LOCUS_39170 101007 103121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 103980 103168 gene locus_tag LOCUS_39180 103980 103168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 106437 103984 gene locus_tag LOCUS_39190 106437 103984 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_39190 106533 108032 gene locus_tag LOCUS_39200 106533 108032 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208163.1 protein_id gnl|my_center|LOCUS_39200 108731 108138 gene locus_tag LOCUS_39210 108731 108138 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_39210 109189 108818 gene locus_tag LOCUS_39220 109189 108818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 110669 109272 gene locus_tag LOCUS_39230 110669 109272 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_39230 111715 110666 gene locus_tag LOCUS_39240 111715 110666 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_39240 113467 111728 gene locus_tag LOCUS_39250 113467 111728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 114174 113602 gene locus_tag LOCUS_39260 114174 113602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 116702 114297 gene locus_tag LOCUS_39270 116702 114297 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294690.1 protein_id gnl|my_center|LOCUS_39270 117087 120065 gene locus_tag LOCUS_39280 117087 120065 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_39280 120068 120814 gene locus_tag LOCUS_39290 120068 120814 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_39290 121488 121012 gene locus_tag LOCUS_39300 121488 121012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 121702 122085 gene locus_tag LOCUS_39310 121702 122085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 122082 122489 gene locus_tag LOCUS_39320 122082 122489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 123921 122509 gene locus_tag LOCUS_39330 gene aspA 123921 122509 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421213.1 protein_id gnl|my_center|LOCUS_39330 124960 123932 gene locus_tag LOCUS_39340 124960 123932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 127361 125274 gene locus_tag LOCUS_39350 127361 125274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 127806 127354 gene locus_tag LOCUS_39360 127806 127354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 128908 127919 gene locus_tag LOCUS_39370 128908 127919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 129295 128996 gene locus_tag LOCUS_39380 129295 128996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 131217 129367 gene locus_tag LOCUS_39390 131217 129367 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_39390 132147 131443 gene locus_tag LOCUS_39400 132147 131443 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_39400 132441 133913 gene locus_tag LOCUS_39410 132441 133913 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079703094.1 protein_id gnl|my_center|LOCUS_39410 133974 134675 gene locus_tag LOCUS_39420 133974 134675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_39420 >Feature sequence027 1861 95 gene locus_tag LOCUS_39430 1861 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 2921 1947 gene locus_tag LOCUS_39440 2921 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 3147 4370 gene locus_tag LOCUS_39450 3147 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 4381 7569 gene locus_tag LOCUS_39460 4381 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 7736 10105 gene locus_tag LOCUS_39470 7736 10105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39470 11094 10171 gene locus_tag LOCUS_39480 11094 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 13375 11099 gene locus_tag LOCUS_39490 13375 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 16149 13537 gene locus_tag LOCUS_39500 16149 13537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_39500 16484 16149 gene locus_tag LOCUS_39510 16484 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 16683 16943 gene locus_tag LOCUS_39520 16683 16943 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_39520 16940 17359 gene locus_tag LOCUS_39530 16940 17359 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_39530 17444 18388 gene locus_tag LOCUS_39540 17444 18388 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 protein_id gnl|my_center|LOCUS_39540 19611 18457 gene locus_tag LOCUS_39550 19611 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 22096 19901 gene locus_tag LOCUS_39560 22096 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 22689 23858 gene locus_tag LOCUS_39570 22689 23858 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_39570 23861 25303 gene locus_tag LOCUS_39580 23861 25303 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531228.1 protein_id gnl|my_center|LOCUS_39580 25337 26014 gene locus_tag LOCUS_39590 25337 26014 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115023.1 protein_id gnl|my_center|LOCUS_39590 26011 27099 gene locus_tag LOCUS_39600 26011 27099 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_39600 27126 30368 gene locus_tag LOCUS_39610 gene lacZ 27126 30368 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_39610 30566 31423 gene locus_tag LOCUS_39620 30566 31423 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_39620 32119 35289 gene locus_tag LOCUS_39630 32119 35289 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_39630 35357 37066 gene locus_tag LOCUS_39640 35357 37066 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_39640 37193 38632 gene locus_tag LOCUS_39650 37193 38632 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_39650 38934 39662 gene locus_tag LOCUS_39660 38934 39662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 39707 41203 gene locus_tag LOCUS_39670 39707 41203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 41219 42127 gene locus_tag LOCUS_39680 41219 42127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 42314 44272 gene locus_tag LOCUS_39690 42314 44272 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120386.1 protein_id gnl|my_center|LOCUS_39690 44301 45782 gene locus_tag LOCUS_39700 44301 45782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 45796 48183 gene locus_tag LOCUS_39710 45796 48183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 48252 49820 gene locus_tag LOCUS_39720 48252 49820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 49907 51169 gene locus_tag LOCUS_39730 49907 51169 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202725.1 protein_id gnl|my_center|LOCUS_39730 51396 53423 gene locus_tag LOCUS_39740 51396 53423 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120386.1 protein_id gnl|my_center|LOCUS_39740 53548 55374 gene locus_tag LOCUS_39750 53548 55374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 55419 57071 gene locus_tag LOCUS_39760 55419 57071 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921866.1 protein_id gnl|my_center|LOCUS_39760 57865 57113 gene locus_tag LOCUS_39770 57865 57113 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_39770 58591 57866 gene locus_tag LOCUS_39780 58591 57866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 59269 58922 gene locus_tag LOCUS_39790 59269 58922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 61172 59361 gene locus_tag LOCUS_39800 61172 59361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 63109 61373 gene locus_tag LOCUS_39810 63109 61373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 65428 63299 gene locus_tag LOCUS_39820 65428 63299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 65680 69726 gene locus_tag LOCUS_39830 65680 69726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 70172 73210 gene locus_tag LOCUS_39840 70172 73210 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_39840 73230 74951 gene locus_tag LOCUS_39850 73230 74951 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_39850 74964 76535 gene locus_tag LOCUS_39860 74964 76535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 78714 76870 gene locus_tag LOCUS_39870 78714 76870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 78875 79972 gene locus_tag LOCUS_39880 78875 79972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 83027 80028 gene locus_tag LOCUS_39890 83027 80028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 84941 83115 gene locus_tag LOCUS_39900 84941 83115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_39900 86045 84954 gene locus_tag LOCUS_39910 86045 84954 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 protein_id gnl|my_center|LOCUS_39910 87488 86046 gene locus_tag LOCUS_39920 gene aldA 87488 86046 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066669.1 protein_id gnl|my_center|LOCUS_39920 88308 87538 gene locus_tag LOCUS_39930 gene kduD 88308 87538 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210830.1 protein_id gnl|my_center|LOCUS_39930 89380 88364 gene locus_tag LOCUS_39940 89380 88364 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_39940 91179 89542 gene locus_tag LOCUS_39950 91179 89542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090123410.1 protein_id gnl|my_center|LOCUS_39950 91489 92625 gene locus_tag LOCUS_39960 91489 92625 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_39960 92597 94738 gene locus_tag LOCUS_39970 92597 94738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 94701 97433 gene locus_tag LOCUS_39980 gene galB 94701 97433 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_39980 98267 97467 gene locus_tag LOCUS_39990 98267 97467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 99309 98533 gene locus_tag LOCUS_40000 99309 98533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 100910 99450 gene locus_tag LOCUS_40010 gene aldA 100910 99450 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115933.1 protein_id gnl|my_center|LOCUS_40010 101706 100924 gene locus_tag LOCUS_40020 101706 100924 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460373.1 protein_id gnl|my_center|LOCUS_40020 104175 101752 gene locus_tag LOCUS_40030 104175 101752 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_40030 105367 104222 gene locus_tag LOCUS_40040 105367 104222 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061901.1 protein_id gnl|my_center|LOCUS_40040 106539 105397 gene locus_tag LOCUS_40050 106539 105397 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243166.1 protein_id gnl|my_center|LOCUS_40050 107684 106545 gene locus_tag LOCUS_40060 107684 106545 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061900.1 protein_id gnl|my_center|LOCUS_40060 109308 107704 gene locus_tag LOCUS_40070 109308 107704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 109821 111899 gene locus_tag LOCUS_40080 109821 111899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 114194 111978 gene locus_tag LOCUS_40090 114194 111978 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033404426.1 protein_id gnl|my_center|LOCUS_40090 114813 115778 gene locus_tag LOCUS_40100 114813 115778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 115936 115861 gene locus_tag LOCUS_t00230 115936 115861 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 116148 117059 gene locus_tag LOCUS_40110 116148 117059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 117136 117795 gene locus_tag LOCUS_40120 117136 117795 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151672826.1 protein_id gnl|my_center|LOCUS_40120 118470 117886 gene locus_tag LOCUS_40130 118470 117886 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729010.1 protein_id gnl|my_center|LOCUS_40130 120256 118625 gene locus_tag LOCUS_40140 120256 118625 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_40140 120478 120906 gene locus_tag LOCUS_40150 120478 120906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 122234 120945 gene locus_tag LOCUS_40160 122234 120945 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_40160 122574 122236 gene locus_tag LOCUS_40170 122574 122236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 122946 122608 gene locus_tag LOCUS_40180 122946 122608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 123126 124121 gene locus_tag LOCUS_40190 123126 124121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 124132 125382 gene locus_tag LOCUS_40200 124132 125382 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_40200 126414 125449 gene locus_tag LOCUS_40210 126414 125449 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315056.1 protein_id gnl|my_center|LOCUS_40210 126638 127126 gene locus_tag LOCUS_40220 126638 127126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 >Feature sequence028 694 1842 gene locus_tag LOCUS_40230 694 1842 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922549.1 protein_id gnl|my_center|LOCUS_40230 2366 4693 gene locus_tag LOCUS_40240 2366 4693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_40240 4910 5725 gene locus_tag LOCUS_40250 4910 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 5877 6317 gene locus_tag LOCUS_40260 5877 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 7080 6370 gene locus_tag LOCUS_40270 7080 6370 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_40270 7346 8575 gene locus_tag LOCUS_40280 7346 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 8841 10085 gene locus_tag LOCUS_40290 8841 10085 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_40290 12312 10132 gene locus_tag LOCUS_40300 12312 10132 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679967.1 protein_id gnl|my_center|LOCUS_40300 12981 12430 gene locus_tag LOCUS_40310 12981 12430 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190407.1 protein_id gnl|my_center|LOCUS_40310 13132 13953 gene locus_tag LOCUS_40320 13132 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 14900 14076 gene locus_tag LOCUS_40330 14900 14076 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966310.1 protein_id gnl|my_center|LOCUS_40330 17468 14910 gene locus_tag LOCUS_40340 17468 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 21459 17761 gene locus_tag LOCUS_40350 21459 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 22378 21650 gene locus_tag LOCUS_40360 22378 21650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 23876 22455 gene locus_tag LOCUS_40370 23876 22455 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640003.1 protein_id gnl|my_center|LOCUS_40370 25089 23914 gene locus_tag LOCUS_40380 25089 23914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 25967 25107 gene locus_tag LOCUS_40390 25967 25107 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_40390 29420 26139 gene locus_tag LOCUS_40400 29420 26139 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_40400 29753 30811 gene locus_tag LOCUS_40410 29753 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 31956 30808 gene locus_tag LOCUS_40420 31956 30808 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_40420 32965 31928 gene locus_tag LOCUS_40430 32965 31928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 34317 33109 gene locus_tag LOCUS_40440 34317 33109 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_40440 34682 34314 gene locus_tag LOCUS_40450 34682 34314 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_40450 36650 34896 gene locus_tag LOCUS_40460 36650 34896 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_40460 36983 37504 gene locus_tag LOCUS_40470 36983 37504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_40470 39642 37540 gene locus_tag LOCUS_40480 39642 37540 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_40480 40269 39715 gene locus_tag LOCUS_40490 40269 39715 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_40490 41178 40444 gene locus_tag LOCUS_40500 41178 40444 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_40500 41482 41189 gene locus_tag LOCUS_40510 gene gatC 41482 41189 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404034.1 protein_id gnl|my_center|LOCUS_40510 41641 42291 gene locus_tag LOCUS_40520 41641 42291 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_40520 42771 43439 gene locus_tag LOCUS_40530 42771 43439 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_40530 45658 43436 gene locus_tag LOCUS_40540 45658 43436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 46071 46949 gene locus_tag LOCUS_40550 46071 46949 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_40550 48299 47286 gene locus_tag LOCUS_40560 48299 47286 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_40560 49005 48646 gene locus_tag LOCUS_40570 49005 48646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 49232 49005 gene locus_tag LOCUS_40580 49232 49005 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_40580 49678 49439 gene locus_tag LOCUS_40590 49678 49439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40590 51869 49884 gene locus_tag LOCUS_40600 51869 49884 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_40600 55647 52096 gene locus_tag LOCUS_40610 gene smc 55647 52096 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092731919.1 protein_id gnl|my_center|LOCUS_40610 56686 56270 gene locus_tag LOCUS_40620 56686 56270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 56739 56813 gene locus_tag LOCUS_t00240 56739 56813 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 57083 58075 gene locus_tag LOCUS_40630 57083 58075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079007.1 protein_id gnl|my_center|LOCUS_40630 58106 59005 gene locus_tag LOCUS_40640 58106 59005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 59002 59910 gene locus_tag LOCUS_40650 59002 59910 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_40650 60937 60023 gene locus_tag LOCUS_40660 60937 60023 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_40660 61575 61117 gene locus_tag LOCUS_40670 61575 61117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 62422 61595 gene locus_tag LOCUS_40680 62422 61595 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_40680 63172 65238 gene locus_tag LOCUS_40690 63172 65238 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975187.1 protein_id gnl|my_center|LOCUS_40690 65253 66092 gene locus_tag LOCUS_40700 65253 66092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 66223 68202 gene locus_tag LOCUS_40710 66223 68202 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_40710 68905 68399 gene locus_tag LOCUS_40720 68905 68399 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933430.1 protein_id gnl|my_center|LOCUS_40720 70323 68902 gene locus_tag LOCUS_40730 70323 68902 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_40730 71830 70391 gene locus_tag LOCUS_40740 gene miaB 71830 70391 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_40740 72228 73046 gene locus_tag LOCUS_40750 72228 73046 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946870.1 protein_id gnl|my_center|LOCUS_40750 73169 73978 gene locus_tag LOCUS_40760 73169 73978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 73986 74531 gene locus_tag LOCUS_40770 73986 74531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 77129 74823 gene locus_tag LOCUS_40780 77129 74823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 77343 78155 gene locus_tag LOCUS_40790 77343 78155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 78878 78225 gene locus_tag LOCUS_40800 78878 78225 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_40800 79540 78989 gene locus_tag LOCUS_40810 79540 78989 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_40810 80624 79554 gene locus_tag LOCUS_40820 80624 79554 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_40820 80891 82084 gene locus_tag LOCUS_40830 80891 82084 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_40830 83229 82219 gene locus_tag LOCUS_40840 gene aroF 83229 82219 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_40840 84093 83296 gene locus_tag LOCUS_40850 gene trpA 84093 83296 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_40850 85361 84177 gene locus_tag LOCUS_40860 gene trpB 85361 84177 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_40860 86029 85364 gene locus_tag LOCUS_40870 86029 85364 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_40870 86844 86029 gene locus_tag LOCUS_40880 gene trpC 86844 86029 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_40880 87977 86988 gene locus_tag LOCUS_40890 gene trpD 87977 86988 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_40890 88686 88084 gene locus_tag LOCUS_40900 88686 88084 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_40900 90130 88712 gene locus_tag LOCUS_40910 90130 88712 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_40910 91401 90394 gene locus_tag LOCUS_40920 gene holA 91401 90394 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_40920 92460 91435 gene locus_tag LOCUS_40930 gene hemH 92460 91435 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957341.1 protein_id gnl|my_center|LOCUS_40930 92774 93559 gene locus_tag LOCUS_40940 gene surE 92774 93559 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_40940 93608 93907 gene locus_tag LOCUS_40950 93608 93907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 93978 95120 gene locus_tag LOCUS_40960 gene lpxB 93978 95120 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_40960 96082 95264 gene locus_tag LOCUS_40970 96082 95264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 96097 96309 gene locus_tag LOCUS_40980 96097 96309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 96597 96268 gene locus_tag LOCUS_40990 96597 96268 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540506.1 protein_id gnl|my_center|LOCUS_40990 97548 96613 gene locus_tag LOCUS_41000 97548 96613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 99022 97559 gene locus_tag LOCUS_41010 gene thrC 99022 97559 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967249.1 protein_id gnl|my_center|LOCUS_41010 101225 100581 gene locus_tag LOCUS_41020 101225 100581 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_41020 102115 101411 gene locus_tag LOCUS_41030 102115 101411 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_41030 102481 103821 gene locus_tag LOCUS_41040 gene rseP 102481 103821 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_41040 104302 104386 gene locus_tag LOCUS_t00250 104302 104386 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 104478 105524 gene locus_tag LOCUS_41050 104478 105524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 108815 105588 gene locus_tag LOCUS_41060 108815 105588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 109383 109814 gene locus_tag LOCUS_41070 109383 109814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 109983 110246 gene locus_tag LOCUS_41080 109983 110246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 111402 110350 gene locus_tag LOCUS_41090 111402 110350 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144017.1 protein_id gnl|my_center|LOCUS_41090 111727 112318 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtacatgagggttccaccatcagataggacttcgac 112808 112449 gene locus_tag LOCUS_41100 112808 112449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 113115 112822 gene locus_tag LOCUS_41110 113115 112822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 113504 113112 gene locus_tag LOCUS_41120 113504 113112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 114021 113494 gene locus_tag LOCUS_41130 114021 113494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 114266 114018 gene locus_tag LOCUS_41140 114266 114018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 114580 114341 gene locus_tag LOCUS_41150 114580 114341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 117280 114608 gene locus_tag LOCUS_41160 117280 114608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 118938 117280 gene locus_tag LOCUS_41170 118938 117280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 119748 118951 gene locus_tag LOCUS_41180 119748 118951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 120087 119755 gene locus_tag LOCUS_41190 120087 119755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 120387 120091 gene locus_tag LOCUS_41200 120387 120091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 121120 120380 gene locus_tag LOCUS_41210 121120 120380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 121554 121120 gene locus_tag LOCUS_41220 121554 121120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 122375 121629 gene locus_tag LOCUS_41230 122375 121629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 122817 122443 gene locus_tag LOCUS_41240 122817 122443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 123256 123038 gene locus_tag LOCUS_41250 123256 123038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 124279 123266 gene locus_tag LOCUS_41260 124279 123266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 124866 124276 gene locus_tag LOCUS_41270 124866 124276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 125306 124863 gene locus_tag LOCUS_41280 125306 124863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 125832 125596 gene locus_tag LOCUS_41290 125832 125596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 >Feature sequence029 3237 826 gene locus_tag LOCUS_41300 3237 826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_41300 3504 5480 gene locus_tag LOCUS_41310 3504 5480 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974668.1 protein_id gnl|my_center|LOCUS_41310 5562 6839 gene locus_tag LOCUS_41320 5562 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 6959 9094 gene locus_tag LOCUS_41330 6959 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 12221 9144 gene locus_tag LOCUS_41340 12221 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 13339 12575 gene locus_tag LOCUS_41350 13339 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 13739 14080 gene locus_tag LOCUS_41360 13739 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 14082 16718 gene locus_tag LOCUS_41370 14082 16718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_41370 17065 18708 gene locus_tag LOCUS_41380 17065 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 18746 21784 gene locus_tag LOCUS_41390 18746 21784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 21788 22537 gene locus_tag LOCUS_41400 21788 22537 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_41400 23892 22624 gene locus_tag LOCUS_41410 23892 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 24207 26306 gene locus_tag LOCUS_41420 24207 26306 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533597.1 protein_id gnl|my_center|LOCUS_41420 26551 27834 gene locus_tag LOCUS_41430 gene rhaI 26551 27834 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 protein_id gnl|my_center|LOCUS_41430 27836 29212 gene locus_tag LOCUS_41440 27836 29212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 29220 30368 gene locus_tag LOCUS_41450 29220 30368 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_41450 30383 31786 gene locus_tag LOCUS_41460 30383 31786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_41460 34519 31832 gene locus_tag LOCUS_41470 34519 31832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_41470 34857 34516 gene locus_tag LOCUS_41480 34857 34516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 35119 36525 gene locus_tag LOCUS_41490 35119 36525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 36848 36648 gene locus_tag LOCUS_41500 36848 36648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 36988 37854 gene locus_tag LOCUS_41510 36988 37854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 39239 37809 gene locus_tag LOCUS_41520 39239 37809 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_41520 40451 39675 gene locus_tag LOCUS_41530 40451 39675 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_41530 40682 40927 gene locus_tag LOCUS_41540 40682 40927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 41113 41262 gene locus_tag LOCUS_41550 41113 41262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 41269 42297 gene locus_tag LOCUS_41560 41269 42297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 42618 43061 gene locus_tag LOCUS_41570 42618 43061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 43845 43084 gene locus_tag LOCUS_41580 43845 43084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 44444 43842 gene locus_tag LOCUS_41590 44444 43842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 44821 45489 gene locus_tag LOCUS_41600 44821 45489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 45559 48330 gene locus_tag LOCUS_41610 45559 48330 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_41610 48652 50946 gene locus_tag LOCUS_41620 48652 50946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 51060 50878 gene locus_tag LOCUS_41630 51060 50878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 51268 51086 gene locus_tag LOCUS_41640 51268 51086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 51270 55502 gene locus_tag LOCUS_41650 51270 55502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 56357 55605 gene locus_tag LOCUS_41660 56357 55605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 57768 56506 gene locus_tag LOCUS_41670 57768 56506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 59168 58074 gene locus_tag LOCUS_41680 59168 58074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 62456 59304 gene locus_tag LOCUS_41690 62456 59304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_41690 66019 62747 gene locus_tag LOCUS_41700 66019 62747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_41700 67299 66241 gene locus_tag LOCUS_41710 67299 66241 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_41710 67636 68151 gene locus_tag LOCUS_41720 67636 68151 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_41720 69970 68504 gene locus_tag LOCUS_41730 69970 68504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 73801 70157 gene locus_tag LOCUS_41740 73801 70157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 74001 75125 gene locus_tag LOCUS_41750 74001 75125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 75831 75286 gene locus_tag LOCUS_41760 75831 75286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 76173 76736 gene locus_tag LOCUS_41770 76173 76736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 77204 79084 gene locus_tag LOCUS_41780 77204 79084 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_41780 79233 81608 gene locus_tag LOCUS_41790 79233 81608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_41790 81996 85034 gene locus_tag LOCUS_41800 81996 85034 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_41800 85055 86464 gene locus_tag LOCUS_41810 85055 86464 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_41810 88443 86560 gene locus_tag LOCUS_41820 88443 86560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 89266 88697 gene locus_tag LOCUS_41830 89266 88697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 89432 89584 gene locus_tag LOCUS_41840 89432 89584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 90268 91677 gene locus_tag LOCUS_41850 90268 91677 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_41850 92109 93509 gene locus_tag LOCUS_41860 92109 93509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 94287 93904 gene locus_tag LOCUS_41870 94287 93904 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681772.1 protein_id gnl|my_center|LOCUS_41870 94490 94269 gene locus_tag LOCUS_41880 94490 94269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 96238 94988 gene locus_tag LOCUS_41890 96238 94988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 96854 96300 gene locus_tag LOCUS_41900 96854 96300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 97260 96859 gene locus_tag LOCUS_41910 97260 96859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 97673 97317 gene locus_tag LOCUS_41920 97673 97317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 98128 97937 gene locus_tag LOCUS_41930 98128 97937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 98627 98553 gene locus_tag LOCUS_t00260 98627 98553 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 99887 99213 gene locus_tag LOCUS_41940 gene ung 99887 99213 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106436.1 protein_id gnl|my_center|LOCUS_41940 102368 100041 gene locus_tag LOCUS_41950 102368 100041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 102662 103069 gene locus_tag LOCUS_41960 102662 103069 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_41960 103066 104553 gene locus_tag LOCUS_41970 103066 104553 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_41970 104841 104599 gene locus_tag LOCUS_41980 104841 104599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 105682 105113 gene locus_tag LOCUS_41990 105682 105113 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_41990 106261 105740 gene locus_tag LOCUS_42000 106261 105740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 106993 106553 gene locus_tag LOCUS_42010 106993 106553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 107925 107035 gene locus_tag LOCUS_42020 107925 107035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 108559 107981 gene locus_tag LOCUS_42030 108559 107981 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_42030 109484 108582 gene locus_tag LOCUS_42040 gene cyoE 109484 108582 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_42040 111347 109488 gene locus_tag LOCUS_42050 111347 109488 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_42050 112677 111514 gene locus_tag LOCUS_42060 112677 111514 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_42060 114051 112777 gene locus_tag LOCUS_42070 114051 112777 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_42070 115016 114102 gene locus_tag LOCUS_42080 115016 114102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 115569 115039 gene locus_tag LOCUS_42090 115569 115039 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_42090 117015 115606 gene locus_tag LOCUS_42100 gene nrfD 117015 115606 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_42100 120380 117129 gene locus_tag LOCUS_42110 120380 117129 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_42110 121874 120459 gene locus_tag LOCUS_42120 121874 120459 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_42120 >Feature sequence030 17 89 gene locus_tag LOCUS_t00270 17 89 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1250 156 gene locus_tag LOCUS_42130 1250 156 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434862.1 protein_id gnl|my_center|LOCUS_42130 1500 2264 gene locus_tag LOCUS_42140 1500 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 2388 3290 gene locus_tag LOCUS_42150 2388 3290 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_42150 4072 3341 gene locus_tag LOCUS_42160 4072 3341 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155666.1 protein_id gnl|my_center|LOCUS_42160 5797 4211 gene locus_tag LOCUS_42170 gene pckA 5797 4211 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_42170 7391 6054 gene locus_tag LOCUS_42180 7391 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 8103 7393 gene locus_tag LOCUS_42190 8103 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 8805 8251 gene locus_tag LOCUS_42200 8805 8251 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166195.1 protein_id gnl|my_center|LOCUS_42200 8926 10932 gene locus_tag LOCUS_42210 gene pulA 8926 10932 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_42210 11026 11592 gene locus_tag LOCUS_42220 11026 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 11755 13722 gene locus_tag LOCUS_42230 11755 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 16027 13730 gene locus_tag LOCUS_42240 16027 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 16641 16204 gene locus_tag LOCUS_42250 16641 16204 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211810.1 protein_id gnl|my_center|LOCUS_42250 17921 16668 gene locus_tag LOCUS_42260 17921 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 19186 17963 gene locus_tag LOCUS_42270 19186 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 19658 20602 gene locus_tag LOCUS_42280 19658 20602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 20777 23854 gene locus_tag LOCUS_42290 20777 23854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_42290 23863 25074 gene locus_tag LOCUS_42300 23863 25074 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_42300 25074 25577 gene locus_tag LOCUS_42310 25074 25577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 25823 26467 gene locus_tag LOCUS_42320 25823 26467 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501624.1 protein_id gnl|my_center|LOCUS_42320 26866 28860 gene locus_tag LOCUS_42330 26866 28860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 29008 30828 gene locus_tag LOCUS_42340 29008 30828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 33220 30881 gene locus_tag LOCUS_42350 33220 30881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_42350 33376 33546 gene locus_tag LOCUS_42360 33376 33546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 34942 33620 gene locus_tag LOCUS_42370 34942 33620 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_42370 36589 34994 gene locus_tag LOCUS_42380 36589 34994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 37287 36841 gene locus_tag LOCUS_42390 37287 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 38142 37339 gene locus_tag LOCUS_42400 gene proC 38142 37339 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194039.1 protein_id gnl|my_center|LOCUS_42400 38422 38892 gene locus_tag LOCUS_42410 38422 38892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 38983 39591 gene locus_tag LOCUS_42420 38983 39591 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_42420 42105 39712 gene locus_tag LOCUS_42430 42105 39712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_42430 43044 42595 gene locus_tag LOCUS_42440 gene lysM 43044 42595 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_42440 44829 43348 gene locus_tag LOCUS_42450 44829 43348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192863.1 protein_id gnl|my_center|LOCUS_42450 45746 45030 gene locus_tag LOCUS_42460 45746 45030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 47087 45786 gene locus_tag LOCUS_42470 47087 45786 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_42470 47840 47187 gene locus_tag LOCUS_42480 47840 47187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 48511 47993 gene locus_tag LOCUS_42490 gene folK 48511 47993 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_42490 48710 53524 gene locus_tag LOCUS_42500 48710 53524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 53845 54237 gene locus_tag LOCUS_42510 53845 54237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 54518 54333 gene locus_tag LOCUS_42520 54518 54333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 55759 54515 gene locus_tag LOCUS_42530 gene xseA 55759 54515 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_42530 56002 55826 gene locus_tag LOCUS_42540 56002 55826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 58698 56320 gene locus_tag LOCUS_42550 58698 56320 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_42550 63903 58702 gene locus_tag LOCUS_42560 63903 58702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 64549 65271 gene locus_tag LOCUS_42570 64549 65271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 66384 65536 gene locus_tag LOCUS_42580 66384 65536 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141814429.1 protein_id gnl|my_center|LOCUS_42580 66928 66431 gene locus_tag LOCUS_42590 66928 66431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 68157 67012 gene locus_tag LOCUS_42600 gene acdA 68157 67012 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_42600 69558 68422 gene locus_tag LOCUS_42610 69558 68422 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_42610 69855 71024 gene locus_tag LOCUS_42620 69855 71024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 72516 71248 gene locus_tag LOCUS_42630 72516 71248 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_42630 72769 73686 gene locus_tag LOCUS_42640 72769 73686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 74499 73741 gene locus_tag LOCUS_42650 gene fabG 74499 73741 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402833.1 protein_id gnl|my_center|LOCUS_42650 75323 74619 gene locus_tag LOCUS_42660 75323 74619 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_42660 76366 75569 gene locus_tag LOCUS_42670 76366 75569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 77184 76624 gene locus_tag LOCUS_42680 77184 76624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 78078 77308 gene locus_tag LOCUS_42690 78078 77308 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390489.1 protein_id gnl|my_center|LOCUS_42690 78890 78093 gene locus_tag LOCUS_42700 78890 78093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 79353 79913 gene locus_tag LOCUS_42710 79353 79913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 80467 79910 gene locus_tag LOCUS_42720 80467 79910 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_42720 81080 80478 gene locus_tag LOCUS_42730 81080 80478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 81908 81267 gene locus_tag LOCUS_42740 81908 81267 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_42740 82459 81986 gene locus_tag LOCUS_42750 gene rlmH 82459 81986 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107863.1 protein_id gnl|my_center|LOCUS_42750 82948 82523 gene locus_tag LOCUS_42760 82948 82523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 83458 84930 gene locus_tag LOCUS_42770 83458 84930 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_42770 85019 85633 gene locus_tag LOCUS_42780 85019 85633 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_42780 85824 88148 gene locus_tag LOCUS_42790 85824 88148 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839622.1 protein_id gnl|my_center|LOCUS_42790 88767 88432 gene locus_tag LOCUS_42800 88767 88432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 89153 88767 gene locus_tag LOCUS_42810 89153 88767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 91930 89336 gene locus_tag LOCUS_42820 91930 89336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 92326 93084 gene locus_tag LOCUS_42830 92326 93084 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_42830 93838 93107 gene locus_tag LOCUS_42840 93838 93107 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_42840 93991 97074 gene locus_tag LOCUS_42850 93991 97074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_42850 97415 100690 gene locus_tag LOCUS_42860 97415 100690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 101020 105135 gene locus_tag LOCUS_42870 101020 105135 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_42870 105412 111186 gene locus_tag LOCUS_42880 105412 111186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 111664 112143 gene locus_tag LOCUS_42890 111664 112143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 >Feature sequence031 777 190 gene locus_tag LOCUS_42900 777 190 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_42900 2716 1088 gene locus_tag LOCUS_42910 2716 1088 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762102.1 protein_id gnl|my_center|LOCUS_42910 3867 2968 gene locus_tag LOCUS_42920 3867 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 6203 3867 gene locus_tag LOCUS_42930 6203 3867 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_42930 6697 6302 gene locus_tag LOCUS_42940 6697 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 8022 6823 gene locus_tag LOCUS_42950 gene porV 8022 6823 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_42950 8202 8867 gene locus_tag LOCUS_42960 8202 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 8981 9817 gene locus_tag LOCUS_42970 8981 9817 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172344.1 protein_id gnl|my_center|LOCUS_42970 10032 12497 gene locus_tag LOCUS_42980 10032 12497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_42980 12589 13284 gene locus_tag LOCUS_42990 12589 13284 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878919.1 protein_id gnl|my_center|LOCUS_42990 13355 14929 gene locus_tag LOCUS_43000 13355 14929 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481484.1 protein_id gnl|my_center|LOCUS_43000 14975 17386 gene locus_tag LOCUS_43010 14975 17386 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_43010 17623 18102 gene locus_tag LOCUS_43020 17623 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 18032 18703 gene locus_tag LOCUS_43030 18032 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 18700 19380 gene locus_tag LOCUS_43040 18700 19380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 19972 19430 gene locus_tag LOCUS_43050 19972 19430 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_43050 20681 20025 gene locus_tag LOCUS_43060 20681 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 21176 20691 gene locus_tag LOCUS_43070 21176 20691 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_43070 21372 21734 gene locus_tag LOCUS_43080 gene queD 21372 21734 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102949761.1 protein_id gnl|my_center|LOCUS_43080 21867 22649 gene locus_tag LOCUS_43090 21867 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 22747 24288 gene locus_tag LOCUS_43100 22747 24288 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_43100 24298 25065 gene locus_tag LOCUS_43110 24298 25065 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730405.1 protein_id gnl|my_center|LOCUS_43110 25708 25088 gene locus_tag LOCUS_43120 25708 25088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 26442 26005 gene locus_tag LOCUS_43130 26442 26005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 27208 26453 gene locus_tag LOCUS_43140 27208 26453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 27784 27245 gene locus_tag LOCUS_43150 27784 27245 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_43150 28711 27797 gene locus_tag LOCUS_43160 28711 27797 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275180.1 protein_id gnl|my_center|LOCUS_43160 30121 28841 gene locus_tag LOCUS_43170 30121 28841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 30554 34627 gene locus_tag LOCUS_43180 30554 34627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 34697 35629 gene locus_tag LOCUS_43190 34697 35629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 36578 35706 gene locus_tag LOCUS_43200 36578 35706 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_43200 37607 36699 gene locus_tag LOCUS_43210 37607 36699 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_43210 38562 37717 gene locus_tag LOCUS_43220 38562 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 39288 40421 gene locus_tag LOCUS_43230 39288 40421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 41353 40418 gene locus_tag LOCUS_43240 41353 40418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 42856 41363 gene locus_tag LOCUS_43250 42856 41363 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226064.1 protein_id gnl|my_center|LOCUS_43250 43308 45530 gene locus_tag LOCUS_43260 gene katG 43308 45530 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391529.1 protein_id gnl|my_center|LOCUS_43260 46790 46590 gene locus_tag LOCUS_43270 46790 46590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 47189 48259 gene locus_tag LOCUS_43280 47189 48259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 48432 49007 gene locus_tag LOCUS_43290 48432 49007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_43290 49617 49078 gene locus_tag LOCUS_43300 49617 49078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 49775 50860 gene locus_tag LOCUS_43310 49775 50860 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_43310 51146 52033 gene locus_tag LOCUS_43320 51146 52033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 52067 52912 gene locus_tag LOCUS_43330 52067 52912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 52912 54222 gene locus_tag LOCUS_43340 52912 54222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 55328 54219 gene locus_tag LOCUS_43350 55328 54219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 56390 55428 gene locus_tag LOCUS_43360 56390 55428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 57011 56460 gene locus_tag LOCUS_43370 57011 56460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 58052 57366 gene locus_tag LOCUS_43380 58052 57366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 58735 58061 gene locus_tag LOCUS_43390 58735 58061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 59240 58845 gene locus_tag LOCUS_43400 gene vapC 59240 58845 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651560.1 protein_id gnl|my_center|LOCUS_43400 59454 59224 gene locus_tag LOCUS_43410 59454 59224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 60776 59703 gene locus_tag LOCUS_43420 60776 59703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 61426 60911 gene locus_tag LOCUS_43430 61426 60911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 62716 61499 gene locus_tag LOCUS_43440 62716 61499 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_43440 64179 62980 gene locus_tag LOCUS_43450 64179 62980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 66955 64538 gene locus_tag LOCUS_43460 66955 64538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 67958 66966 gene locus_tag LOCUS_43470 67958 66966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 68693 68172 gene locus_tag LOCUS_43480 68693 68172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 69874 68714 gene locus_tag LOCUS_43490 69874 68714 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905558.1 protein_id gnl|my_center|LOCUS_43490 70330 69884 gene locus_tag LOCUS_43500 70330 69884 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_43500 70564 71604 gene locus_tag LOCUS_43510 70564 71604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 71999 71601 gene locus_tag LOCUS_43520 71999 71601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 73049 72078 gene locus_tag LOCUS_43530 73049 72078 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130543805.1 protein_id gnl|my_center|LOCUS_43530 73230 76406 gene locus_tag LOCUS_43540 73230 76406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_43540 77133 76567 gene locus_tag LOCUS_43550 77133 76567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 77982 77254 gene locus_tag LOCUS_43560 77982 77254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 78796 77975 gene locus_tag LOCUS_43570 78796 77975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 79122 80144 gene locus_tag LOCUS_43580 79122 80144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 82519 80150 gene locus_tag LOCUS_43590 82519 80150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 83893 82541 gene locus_tag LOCUS_43600 83893 82541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 84795 83902 gene locus_tag LOCUS_43610 84795 83902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 85215 86870 gene locus_tag LOCUS_43620 85215 86870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 86940 87689 gene locus_tag LOCUS_43630 86940 87689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 87682 88596 gene locus_tag LOCUS_43640 87682 88596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 88593 88955 gene locus_tag LOCUS_43650 88593 88955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 89734 88970 gene locus_tag LOCUS_43660 89734 88970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 90501 92900 gene locus_tag LOCUS_43670 90501 92900 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_43670 93114 93857 gene locus_tag LOCUS_43680 93114 93857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 95124 93898 gene locus_tag LOCUS_43690 95124 93898 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_43690 96013 95168 gene locus_tag LOCUS_43700 96013 95168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 96325 97818 gene locus_tag LOCUS_43710 96325 97818 CDS product IS1182-like element ISBf5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203619.1 protein_id gnl|my_center|LOCUS_43710 99440 97974 gene locus_tag LOCUS_43720 99440 97974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 102561 99469 gene locus_tag LOCUS_43730 102561 99469 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_43730 102736 102924 gene locus_tag LOCUS_43740 102736 102924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 102970 103686 gene locus_tag LOCUS_43750 102970 103686 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_43750 104864 103704 gene locus_tag LOCUS_43760 gene galK 104864 103704 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_43760 107447 105120 gene locus_tag LOCUS_43770 107447 105120 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_43770 107935 107534 gene locus_tag LOCUS_43780 107935 107534 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_43780 108740 108195 gene locus_tag LOCUS_43790 108740 108195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 108908 109174 gene locus_tag LOCUS_43800 108908 109174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 112313 109200 gene locus_tag LOCUS_43810 112313 109200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_43810 112506 114710 gene locus_tag LOCUS_43820 112506 114710 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766160.1 protein_id gnl|my_center|LOCUS_43820 116353 114734 gene locus_tag LOCUS_43830 116353 114734 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113202.1 protein_id gnl|my_center|LOCUS_43830 116688 117872 gene locus_tag LOCUS_43840 116688 117872 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102291.1 protein_id gnl|my_center|LOCUS_43840 118348 119070 gene locus_tag LOCUS_43850 118348 119070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 119067 119768 gene locus_tag LOCUS_43860 119067 119768 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_43860 >Feature sequence032 243 1517 gene locus_tag LOCUS_43870 243 1517 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_43870 3999 1570 gene locus_tag LOCUS_43880 3999 1570 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_43880 8763 4264 gene locus_tag LOCUS_43890 8763 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 10198 9011 gene locus_tag LOCUS_43900 10198 9011 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_43900 12042 10627 gene locus_tag LOCUS_43910 12042 10627 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083637.1 protein_id gnl|my_center|LOCUS_43910 12305 14446 gene locus_tag LOCUS_43920 12305 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 16949 14529 gene locus_tag LOCUS_43930 16949 14529 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_43930 17417 16956 gene locus_tag LOCUS_43940 17417 16956 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_43940 18850 17429 gene locus_tag LOCUS_43950 18850 17429 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220208744.1 protein_id gnl|my_center|LOCUS_43950 20397 18865 gene locus_tag LOCUS_43960 20397 18865 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_43960 20713 21531 gene locus_tag LOCUS_43970 20713 21531 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_43970 21608 21997 gene locus_tag LOCUS_43980 21608 21997 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258306.1 protein_id gnl|my_center|LOCUS_43980 22882 21989 gene locus_tag LOCUS_43990 22882 21989 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537927.1 protein_id gnl|my_center|LOCUS_43990 23049 24122 gene locus_tag LOCUS_44000 23049 24122 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_44000 24371 25021 gene locus_tag LOCUS_44010 24371 25021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 25094 25885 gene locus_tag LOCUS_44020 25094 25885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 25976 26455 gene locus_tag LOCUS_44030 25976 26455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 26623 26414 gene locus_tag LOCUS_44040 26623 26414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 27082 29778 gene locus_tag LOCUS_44050 27082 29778 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_44050 31396 29792 gene locus_tag LOCUS_44060 31396 29792 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_44060 32367 31504 gene locus_tag LOCUS_44070 32367 31504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 32640 33365 gene locus_tag LOCUS_44080 gene recO 32640 33365 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_44080 33835 33455 gene locus_tag LOCUS_44090 33835 33455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 34212 33988 gene locus_tag LOCUS_44100 34212 33988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 37205 34542 gene locus_tag LOCUS_44110 37205 34542 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_44110 38194 37214 gene locus_tag LOCUS_44120 38194 37214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 38781 38266 gene locus_tag LOCUS_44130 38781 38266 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_44130 39613 38978 gene locus_tag LOCUS_44140 39613 38978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 39904 41460 gene locus_tag LOCUS_44150 39904 41460 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_44150 42827 41598 gene locus_tag LOCUS_44160 42827 41598 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_44160 43367 42897 gene locus_tag LOCUS_44170 gene tsaE 43367 42897 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_44170 43607 45577 gene locus_tag LOCUS_44180 gene gyrB 43607 45577 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962691.1 protein_id gnl|my_center|LOCUS_44180 46454 45663 gene locus_tag LOCUS_44190 46454 45663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 47284 46451 gene locus_tag LOCUS_44200 gene ppk2 47284 46451 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_44200 47598 48551 gene locus_tag LOCUS_44210 47598 48551 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175128.1 protein_id gnl|my_center|LOCUS_44210 49395 48562 gene locus_tag LOCUS_44220 49395 48562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 49896 49576 gene locus_tag LOCUS_44230 49896 49576 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405420.1 protein_id gnl|my_center|LOCUS_44230 49980 50513 gene locus_tag LOCUS_44240 49980 50513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 51295 50531 gene locus_tag LOCUS_44250 51295 50531 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_44250 52214 51300 gene locus_tag LOCUS_44260 52214 51300 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481721.1 protein_id gnl|my_center|LOCUS_44260 53040 54410 gene locus_tag LOCUS_44270 53040 54410 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_44270 55136 55351 gene locus_tag LOCUS_44280 55136 55351 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816366.1 protein_id gnl|my_center|LOCUS_44280 55348 55971 gene locus_tag LOCUS_44290 55348 55971 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836389.1 protein_id gnl|my_center|LOCUS_44290 56060 59338 gene locus_tag LOCUS_44300 56060 59338 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_44300 59623 60114 gene locus_tag LOCUS_44310 59623 60114 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_44310 60127 60888 gene locus_tag LOCUS_44320 60127 60888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 60891 61646 gene locus_tag LOCUS_44330 60891 61646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 61774 63021 gene locus_tag LOCUS_44340 61774 63021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 63108 64070 gene locus_tag LOCUS_44350 63108 64070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 64352 65014 gene locus_tag LOCUS_44360 64352 65014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 67757 65106 gene locus_tag LOCUS_44370 67757 65106 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055271316.1 protein_id gnl|my_center|LOCUS_44370 67897 68154 gene locus_tag LOCUS_44380 67897 68154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 68168 68776 gene locus_tag LOCUS_44390 68168 68776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 69080 69766 gene locus_tag LOCUS_44400 69080 69766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_44400 69926 72757 gene locus_tag LOCUS_44410 69926 72757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 73043 74923 gene locus_tag LOCUS_44420 73043 74923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 75089 75481 gene locus_tag LOCUS_44430 75089 75481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 75677 76741 gene locus_tag LOCUS_44440 75677 76741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 76995 78242 gene locus_tag LOCUS_44450 76995 78242 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947976.1 protein_id gnl|my_center|LOCUS_44450 78301 78561 gene locus_tag LOCUS_44460 78301 78561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 78568 79707 gene locus_tag LOCUS_44470 78568 79707 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275543.1 protein_id gnl|my_center|LOCUS_44470 79845 80858 gene locus_tag LOCUS_44480 79845 80858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 81060 81515 gene locus_tag LOCUS_44490 81060 81515 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_44490 81636 82172 gene locus_tag LOCUS_44500 81636 82172 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_44500 82860 82474 gene locus_tag LOCUS_44510 82860 82474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 82944 83234 gene locus_tag LOCUS_44520 82944 83234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 83231 84142 gene locus_tag LOCUS_44530 83231 84142 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849692.1 protein_id gnl|my_center|LOCUS_44530 85124 84321 gene locus_tag LOCUS_44540 85124 84321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 85234 86376 gene locus_tag LOCUS_44550 gene rsgA 85234 86376 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_44550 86619 88979 gene locus_tag LOCUS_44560 86619 88979 CDS product pyrroloquinoline quinone-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829735.1 protein_id gnl|my_center|LOCUS_44560 89032 90993 gene locus_tag LOCUS_44570 89032 90993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 91109 91411 gene locus_tag LOCUS_44580 91109 91411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 91420 92325 gene locus_tag LOCUS_44590 91420 92325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 92939 92322 gene locus_tag LOCUS_44600 92939 92322 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_44600 94130 93084 gene locus_tag LOCUS_44610 94130 93084 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_44610 94448 95098 gene locus_tag LOCUS_44620 94448 95098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 95286 95894 gene locus_tag LOCUS_44630 95286 95894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 95896 96591 gene locus_tag LOCUS_44640 95896 96591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 96662 97972 gene locus_tag LOCUS_44650 96662 97972 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_44650 98043 99062 gene locus_tag LOCUS_44660 98043 99062 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_44660 99094 99672 gene locus_tag LOCUS_44670 99094 99672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 99713 100354 gene locus_tag LOCUS_44680 99713 100354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 100454 101176 gene locus_tag LOCUS_44690 100454 101176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 102245 101325 gene locus_tag LOCUS_44700 102245 101325 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_44700 103224 102238 gene locus_tag LOCUS_44710 103224 102238 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_44710 104051 103323 gene locus_tag LOCUS_44720 104051 103323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 105291 104443 gene locus_tag LOCUS_44730 105291 104443 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061282.1 protein_id gnl|my_center|LOCUS_44730 105712 106461 gene locus_tag LOCUS_44740 105712 106461 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_44740 106690 108258 gene locus_tag LOCUS_44750 106690 108258 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_44750 108409 108846 gene locus_tag LOCUS_44760 108409 108846 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921390.1 protein_id gnl|my_center|LOCUS_44760 108882 109616 gene locus_tag LOCUS_44770 108882 109616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 109613 110065 gene locus_tag LOCUS_44780 109613 110065 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_44780 111017 110103 gene locus_tag LOCUS_44790 111017 110103 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140159.1 protein_id gnl|my_center|LOCUS_44790 111590 112657 gene locus_tag LOCUS_44800 111590 112657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 115694 112674 gene locus_tag LOCUS_44810 115694 112674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 116351 115884 gene locus_tag LOCUS_44820 116351 115884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 118738 116348 gene locus_tag LOCUS_44830 118738 116348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 >Feature sequence033 1410 223 gene locus_tag LOCUS_44840 1410 223 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022386.1 protein_id gnl|my_center|LOCUS_44840 2896 1412 gene locus_tag LOCUS_44850 2896 1412 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_44850 3261 3187 gene locus_tag LOCUS_t00280 3261 3187 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3414 4334 gene locus_tag LOCUS_44860 3414 4334 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_44860 5297 4374 gene locus_tag LOCUS_44870 5297 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 5522 5310 gene locus_tag LOCUS_44880 5522 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 6207 5548 gene locus_tag LOCUS_44890 6207 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 7391 6354 gene locus_tag LOCUS_44900 gene rlmN 7391 6354 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_44900 9547 7733 gene locus_tag LOCUS_44910 9547 7733 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_44910 10045 11487 gene locus_tag LOCUS_44920 gene rpoN 10045 11487 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_44920 11762 12100 gene locus_tag LOCUS_44930 11762 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 12088 14721 gene locus_tag LOCUS_44940 12088 14721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_44940 15266 14769 gene locus_tag LOCUS_44950 15266 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 15721 15263 gene locus_tag LOCUS_44960 15721 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 16161 15724 gene locus_tag LOCUS_44970 16161 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 17196 16204 gene locus_tag LOCUS_44980 17196 16204 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448438.1 protein_id gnl|my_center|LOCUS_44980 17383 17766 gene locus_tag LOCUS_44990 17383 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 17810 18676 gene locus_tag LOCUS_45000 17810 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 18874 20328 gene locus_tag LOCUS_45010 18874 20328 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_45010 20880 20377 gene locus_tag LOCUS_45020 20880 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 21715 20912 gene locus_tag LOCUS_45030 21715 20912 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 protein_id gnl|my_center|LOCUS_45030 23383 21722 gene locus_tag LOCUS_45040 23383 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 25115 23391 gene locus_tag LOCUS_45050 25115 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 27467 25119 gene locus_tag LOCUS_45060 27467 25119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 28711 27464 gene locus_tag LOCUS_45070 28711 27464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 29754 28708 gene locus_tag LOCUS_45080 29754 28708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 31748 29751 gene locus_tag LOCUS_45090 31748 29751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 32643 33062 gene locus_tag LOCUS_45100 32643 33062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 33138 34217 gene locus_tag LOCUS_45110 33138 34217 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404739.1 protein_id gnl|my_center|LOCUS_45110 35676 34555 gene locus_tag LOCUS_45120 35676 34555 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_45120 36095 36787 gene locus_tag LOCUS_45130 36095 36787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 36968 40501 gene locus_tag LOCUS_45140 36968 40501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 41922 40780 gene locus_tag LOCUS_45150 41922 40780 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_45150 43413 42043 gene locus_tag LOCUS_45160 43413 42043 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106462662.1 protein_id gnl|my_center|LOCUS_45160 43626 44789 gene locus_tag LOCUS_45170 43626 44789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 45035 46102 gene locus_tag LOCUS_45180 gene thiL 45035 46102 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_45180 46188 47177 gene locus_tag LOCUS_45190 46188 47177 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_45190 47498 48949 gene locus_tag LOCUS_45200 gene hpaE 47498 48949 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 protein_id gnl|my_center|LOCUS_45200 49224 50177 gene locus_tag LOCUS_45210 49224 50177 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921611.1 protein_id gnl|my_center|LOCUS_45210 50398 50775 gene locus_tag LOCUS_45220 50398 50775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 50877 53447 gene locus_tag LOCUS_45230 50877 53447 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_45230 53857 53489 gene locus_tag LOCUS_45240 53857 53489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 58143 54127 gene locus_tag LOCUS_45250 58143 54127 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_45250 58271 59491 gene locus_tag LOCUS_45260 58271 59491 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_45260 59585 60775 gene locus_tag LOCUS_45270 59585 60775 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310345.1 protein_id gnl|my_center|LOCUS_45270 60869 62071 gene locus_tag LOCUS_45280 60869 62071 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_45280 62374 63111 gene locus_tag LOCUS_45290 62374 63111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 65836 63206 gene locus_tag LOCUS_45300 65836 63206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 66128 68263 gene locus_tag LOCUS_45310 66128 68263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 68600 69376 gene locus_tag LOCUS_45320 68600 69376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 69377 69625 gene locus_tag LOCUS_45330 69377 69625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 69698 70285 gene locus_tag LOCUS_45340 69698 70285 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181124.1 protein_id gnl|my_center|LOCUS_45340 70303 70938 gene locus_tag LOCUS_45350 70303 70938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 74458 71189 gene locus_tag LOCUS_45360 74458 71189 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_45360 75735 75049 gene locus_tag LOCUS_45370 75735 75049 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_45370 76784 75732 gene locus_tag LOCUS_45380 76784 75732 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764715.1 protein_id gnl|my_center|LOCUS_45380 78855 76891 gene locus_tag LOCUS_45390 78855 76891 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704425.1 protein_id gnl|my_center|LOCUS_45390 79292 81043 gene locus_tag LOCUS_45400 79292 81043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 81305 81230 gene locus_tag LOCUS_t00290 81305 81230 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 83812 81389 gene locus_tag LOCUS_45410 83812 81389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_45410 84398 86881 gene locus_tag LOCUS_45420 84398 86881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 87210 87422 gene locus_tag LOCUS_45430 87210 87422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 87426 87878 gene locus_tag LOCUS_45440 87426 87878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45440 87936 88625 gene locus_tag LOCUS_45450 87936 88625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 88803 90575 gene locus_tag LOCUS_45460 88803 90575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 90673 91728 gene locus_tag LOCUS_45470 90673 91728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 91795 93402 gene locus_tag LOCUS_45480 91795 93402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 93739 94392 gene locus_tag LOCUS_45490 93739 94392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 95469 94432 gene locus_tag LOCUS_45500 95469 94432 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_45500 96691 95786 gene locus_tag LOCUS_45510 96691 95786 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_45510 98171 96792 gene locus_tag LOCUS_45520 98171 96792 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_45520 98992 98315 gene locus_tag LOCUS_45530 98992 98315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 100017 99136 gene locus_tag LOCUS_45540 100017 99136 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_45540 101417 100017 gene locus_tag LOCUS_45550 101417 100017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 102178 101519 gene locus_tag LOCUS_45560 102178 101519 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839781.1 protein_id gnl|my_center|LOCUS_45560 103266 102376 gene locus_tag LOCUS_45570 103266 102376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 104740 103490 gene locus_tag LOCUS_45580 104740 103490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 104944 106059 gene locus_tag LOCUS_45590 104944 106059 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_45590 106056 106862 gene locus_tag LOCUS_45600 106056 106862 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_45600 106866 107555 gene locus_tag LOCUS_45610 106866 107555 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_45610 108968 107799 gene locus_tag LOCUS_45620 108968 107799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 109303 108965 gene locus_tag LOCUS_45630 109303 108965 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_45630 109755 109303 gene locus_tag LOCUS_45640 gene dtd 109755 109303 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_45640 110802 110146 gene locus_tag LOCUS_45650 110802 110146 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399300.1 protein_id gnl|my_center|LOCUS_45650 111416 112534 gene locus_tag LOCUS_45660 111416 112534 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_45660 112854 113555 gene locus_tag LOCUS_45670 gene aat 112854 113555 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767399.1 protein_id gnl|my_center|LOCUS_45670 113614 115335 gene locus_tag LOCUS_45680 113614 115335 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_45680 >Feature sequence034 113 1096 gene locus_tag LOCUS_45690 113 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 1096 1659 gene locus_tag LOCUS_45700 1096 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 4435 2204 gene locus_tag LOCUS_45710 4435 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 4590 4847 gene locus_tag LOCUS_45720 4590 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 4970 5152 gene locus_tag LOCUS_45730 4970 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 6864 5497 gene locus_tag LOCUS_45740 6864 5497 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_45740 8044 7526 gene locus_tag LOCUS_45750 8044 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 9105 8110 gene locus_tag LOCUS_45760 9105 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 9797 9237 gene locus_tag LOCUS_45770 9797 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 10402 9845 gene locus_tag LOCUS_45780 10402 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 11656 10511 gene locus_tag LOCUS_45790 11656 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 13024 11726 gene locus_tag LOCUS_45800 13024 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 14249 13275 gene locus_tag LOCUS_45810 14249 13275 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_45810 14372 15559 gene locus_tag LOCUS_45820 14372 15559 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_45820 15608 16831 gene locus_tag LOCUS_45830 15608 16831 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_45830 16949 18532 gene locus_tag LOCUS_45840 16949 18532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 21645 18544 gene locus_tag LOCUS_45850 21645 18544 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 protein_id gnl|my_center|LOCUS_45850 22742 21657 gene locus_tag LOCUS_45860 22742 21657 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392398.1 protein_id gnl|my_center|LOCUS_45860 25127 22806 gene locus_tag LOCUS_45870 25127 22806 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840058.1 protein_id gnl|my_center|LOCUS_45870 27286 25175 gene locus_tag LOCUS_45880 27286 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 27713 28108 gene locus_tag LOCUS_45890 27713 28108 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_45890 28257 28925 gene locus_tag LOCUS_45900 28257 28925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 29023 32136 gene locus_tag LOCUS_45910 29023 32136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 32379 34787 gene locus_tag LOCUS_45920 32379 34787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 35316 38066 gene locus_tag LOCUS_45930 35316 38066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 38079 50513 gene locus_tag LOCUS_45940 38079 50513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 50572 59709 gene locus_tag LOCUS_45950 50572 59709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 60480 59770 gene locus_tag LOCUS_45960 60480 59770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 61974 60601 gene locus_tag LOCUS_45970 61974 60601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 62314 62688 gene locus_tag LOCUS_45980 62314 62688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 62835 63629 gene locus_tag LOCUS_45990 62835 63629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 64928 63639 gene locus_tag LOCUS_46000 64928 63639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 65479 64925 gene locus_tag LOCUS_46010 65479 64925 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_46010 65675 67345 gene locus_tag LOCUS_46020 65675 67345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 69794 67554 gene locus_tag LOCUS_46030 69794 67554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 70800 69976 gene locus_tag LOCUS_46040 70800 69976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 71028 71570 gene locus_tag LOCUS_46050 71028 71570 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_46050 71548 72192 gene locus_tag LOCUS_46060 71548 72192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 72189 72983 gene locus_tag LOCUS_46070 72189 72983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 72994 74493 gene locus_tag LOCUS_46080 72994 74493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 75913 74552 gene locus_tag LOCUS_46090 75913 74552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 76588 75956 gene locus_tag LOCUS_46100 76588 75956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 77319 78317 gene locus_tag LOCUS_46110 77319 78317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 78448 78978 gene locus_tag LOCUS_46120 78448 78978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 78993 79724 gene locus_tag LOCUS_46130 78993 79724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 79737 83045 gene locus_tag LOCUS_46140 79737 83045 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_46140 83371 83165 gene locus_tag LOCUS_46150 83371 83165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 83468 84421 gene locus_tag LOCUS_46160 83468 84421 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_46160 84432 85349 gene locus_tag LOCUS_46170 gene rbsK 84432 85349 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_46170 86973 85612 gene locus_tag LOCUS_46180 86973 85612 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_46180 87612 87184 gene locus_tag LOCUS_46190 87612 87184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 88026 90335 gene locus_tag LOCUS_46200 88026 90335 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_46200 90542 91675 gene locus_tag LOCUS_46210 90542 91675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 98921 91842 gene locus_tag LOCUS_46220 98921 91842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 103332 99121 gene locus_tag LOCUS_46230 103332 99121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 110612 103515 gene locus_tag LOCUS_46240 110612 103515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 <112064 110817 gene locus_tag LOCUS_46250 <112064 110817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029446868.1:two-component regulator propeller domain-containing protein >Feature sequence035 4912 1952 gene locus_tag LOCUS_46260 4912 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 7611 5245 gene locus_tag LOCUS_46270 7611 5245 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_46270 10971 8128 gene locus_tag LOCUS_46280 10971 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 13124 11415 gene locus_tag LOCUS_46290 13124 11415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 14843 13134 gene locus_tag LOCUS_46300 14843 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 17910 15163 gene locus_tag LOCUS_46310 17910 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 20146 18452 gene locus_tag LOCUS_46320 20146 18452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 20405 22636 gene locus_tag LOCUS_46330 20405 22636 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_46330 22789 24558 gene locus_tag LOCUS_46340 22789 24558 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_46340 26160 24601 gene locus_tag LOCUS_46350 26160 24601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 26321 27490 gene locus_tag LOCUS_46360 26321 27490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 27529 28923 gene locus_tag LOCUS_46370 gene leuC 27529 28923 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072959918.1 protein_id gnl|my_center|LOCUS_46370 28984 29568 gene locus_tag LOCUS_46380 gene leuD 28984 29568 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_46380 29599 30708 gene locus_tag LOCUS_46390 gene leuB 29599 30708 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_46390 31025 32809 gene locus_tag LOCUS_46400 31025 32809 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_46400 32806 33900 gene locus_tag LOCUS_46410 32806 33900 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_46410 35354 33909 gene locus_tag LOCUS_46420 35354 33909 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_46420 36253 35615 gene locus_tag LOCUS_46430 36253 35615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 37313 36435 gene locus_tag LOCUS_46440 37313 36435 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_46440 37391 38002 gene locus_tag LOCUS_46450 37391 38002 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_46450 40646 38010 gene locus_tag LOCUS_46460 40646 38010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_46460 40983 40666 gene locus_tag LOCUS_46470 40983 40666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 41282 42700 gene locus_tag LOCUS_46480 41282 42700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 42809 45151 gene locus_tag LOCUS_46490 42809 45151 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_46490 46198 45260 gene locus_tag LOCUS_46500 46198 45260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 46260 46784 gene locus_tag LOCUS_46510 46260 46784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 46787 47455 gene locus_tag LOCUS_46520 46787 47455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 49108 47558 gene locus_tag LOCUS_46530 49108 47558 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_46530 50306 49227 gene locus_tag LOCUS_46540 50306 49227 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485002.1 protein_id gnl|my_center|LOCUS_46540 52555 50624 gene locus_tag LOCUS_46550 52555 50624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 53147 52566 gene locus_tag LOCUS_46560 53147 52566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 54453 53320 gene locus_tag LOCUS_46570 54453 53320 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023113.1 protein_id gnl|my_center|LOCUS_46570 55169 54690 gene locus_tag LOCUS_46580 55169 54690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 55260 55661 gene locus_tag LOCUS_46590 55260 55661 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_46590 56143 55757 gene locus_tag LOCUS_46600 56143 55757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 56908 56204 gene locus_tag LOCUS_46610 56908 56204 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_46610 57779 57006 gene locus_tag LOCUS_46620 57779 57006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 60152 57903 gene locus_tag LOCUS_46630 60152 57903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 60567 60328 gene locus_tag LOCUS_46640 60567 60328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 61529 60720 gene locus_tag LOCUS_46650 61529 60720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 61989 61594 gene locus_tag LOCUS_46660 61989 61594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 62379 61996 gene locus_tag LOCUS_46670 62379 61996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 62519 63076 gene locus_tag LOCUS_46680 gene msrA 62519 63076 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_46680 63481 64578 gene locus_tag LOCUS_46690 63481 64578 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_46690 64630 64941 gene locus_tag LOCUS_46700 64630 64941 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_46700 64948 66354 gene locus_tag LOCUS_46710 64948 66354 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_46710 66586 67533 gene locus_tag LOCUS_46720 66586 67533 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_46720 67838 70378 gene locus_tag LOCUS_46730 67838 70378 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_46730 70463 71314 gene locus_tag LOCUS_46740 70463 71314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 72054 71356 gene locus_tag LOCUS_46750 72054 71356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 78090 72133 gene locus_tag LOCUS_46760 78090 72133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 90831 78169 gene locus_tag LOCUS_46770 90831 78169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 91561 92784 gene locus_tag LOCUS_46780 91561 92784 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_46780 93630 95093 gene locus_tag LOCUS_46790 93630 95093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 95108 95935 gene locus_tag LOCUS_46800 95108 95935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_46800 95947 97233 gene locus_tag LOCUS_46810 95947 97233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_46810 97264 98127 gene locus_tag LOCUS_46820 97264 98127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 99280 98270 gene locus_tag LOCUS_46830 99280 98270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 100213 99431 gene locus_tag LOCUS_46840 100213 99431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 100307 101341 gene locus_tag LOCUS_46850 100307 101341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 101503 103299 gene locus_tag LOCUS_46860 gene asnB 101503 103299 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_46860 103318 104751 gene locus_tag LOCUS_46870 103318 104751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 104802 106250 gene locus_tag LOCUS_46880 104802 106250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 106914 106240 gene locus_tag LOCUS_46890 106914 106240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 107417 107127 gene locus_tag LOCUS_46900 107417 107127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 107715 107371 gene locus_tag LOCUS_46910 107715 107371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 108803 107733 gene locus_tag LOCUS_46920 108803 107733 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839729.1 protein_id gnl|my_center|LOCUS_46920 >Feature sequence036 827 471 gene locus_tag LOCUS_46930 827 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 1896 829 gene locus_tag LOCUS_46940 1896 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 2771 2199 gene locus_tag LOCUS_46950 2771 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 3592 2747 gene locus_tag LOCUS_46960 3592 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 3838 3593 gene locus_tag LOCUS_46970 3838 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46970 4793 3987 gene locus_tag LOCUS_46980 4793 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 11284 4808 gene locus_tag LOCUS_46990 11284 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 12529 11375 gene locus_tag LOCUS_47000 12529 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 15579 12697 gene locus_tag LOCUS_47010 15579 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 16321 18699 gene locus_tag LOCUS_47020 16321 18699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_47020 19531 18755 gene locus_tag LOCUS_47030 19531 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 20326 19829 gene locus_tag LOCUS_47040 20326 19829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 20539 22875 gene locus_tag LOCUS_47050 20539 22875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 23701 22928 gene locus_tag LOCUS_47060 23701 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 23925 25835 gene locus_tag LOCUS_47070 23925 25835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 26055 26768 gene locus_tag LOCUS_47080 26055 26768 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210367.1 protein_id gnl|my_center|LOCUS_47080 28329 26791 gene locus_tag LOCUS_47090 28329 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 29481 28354 gene locus_tag LOCUS_47100 29481 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 30611 30240 gene locus_tag LOCUS_47110 30611 30240 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705203.1 protein_id gnl|my_center|LOCUS_47110 32065 30713 gene locus_tag LOCUS_47120 32065 30713 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190823.1 protein_id gnl|my_center|LOCUS_47120 32958 32263 gene locus_tag LOCUS_47130 32958 32263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 33377 33057 gene locus_tag LOCUS_47140 33377 33057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 33698 33378 gene locus_tag LOCUS_47150 33698 33378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 34610 33771 gene locus_tag LOCUS_47160 34610 33771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 35300 34959 gene locus_tag LOCUS_47170 35300 34959 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_47170 35592 35281 gene locus_tag LOCUS_47180 35592 35281 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_47180 36174 35734 gene locus_tag LOCUS_47190 36174 35734 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226516.1 protein_id gnl|my_center|LOCUS_47190 36516 36187 gene locus_tag LOCUS_47200 36516 36187 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969808.1 protein_id gnl|my_center|LOCUS_47200 37508 36936 gene locus_tag LOCUS_47210 37508 36936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 39138 37594 gene locus_tag LOCUS_47220 39138 37594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 39972 39592 gene locus_tag LOCUS_47230 39972 39592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 40232 41395 gene locus_tag LOCUS_47240 gene dinB 40232 41395 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_47240 41400 44342 gene locus_tag LOCUS_47250 41400 44342 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_47250 46916 44397 gene locus_tag LOCUS_47260 46916 44397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_47260 47077 47841 gene locus_tag LOCUS_47270 47077 47841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 47898 48290 gene locus_tag LOCUS_47280 47898 48290 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530093.1 protein_id gnl|my_center|LOCUS_47280 49591 48491 gene locus_tag LOCUS_47290 49591 48491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 50467 49688 gene locus_tag LOCUS_47300 50467 49688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 51645 50605 gene locus_tag LOCUS_47310 51645 50605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 54121 52007 gene locus_tag LOCUS_47320 54121 52007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 54697 54227 gene locus_tag LOCUS_47330 54697 54227 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_47330 55106 54774 gene locus_tag LOCUS_47340 55106 54774 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_47340 56770 55253 gene locus_tag LOCUS_47350 56770 55253 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928859.1 protein_id gnl|my_center|LOCUS_47350 57692 56889 gene locus_tag LOCUS_47360 57692 56889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 58000 57839 gene locus_tag LOCUS_47370 58000 57839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 58092 60356 gene locus_tag LOCUS_47380 58092 60356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_47380 61189 60410 gene locus_tag LOCUS_47390 61189 60410 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_47390 62065 61286 gene locus_tag LOCUS_47400 62065 61286 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_47400 63397 62081 gene locus_tag LOCUS_47410 63397 62081 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_47410 63753 63424 gene locus_tag LOCUS_47420 63753 63424 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788139.1 protein_id gnl|my_center|LOCUS_47420 65015 63765 gene locus_tag LOCUS_47430 65015 63765 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_47430 65961 65134 gene locus_tag LOCUS_47440 65961 65134 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_47440 66812 65958 gene locus_tag LOCUS_47450 66812 65958 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_47450 66982 68118 gene locus_tag LOCUS_47460 66982 68118 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391455.1 protein_id gnl|my_center|LOCUS_47460 69712 68288 gene locus_tag LOCUS_47470 69712 68288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 69796 70602 gene locus_tag LOCUS_47480 69796 70602 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_47480 70705 71076 gene locus_tag LOCUS_47490 70705 71076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 71430 71750 gene locus_tag LOCUS_47500 71430 71750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 71896 73152 gene locus_tag LOCUS_47510 71896 73152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 73776 73459 gene locus_tag LOCUS_47520 73776 73459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 74030 75226 gene locus_tag LOCUS_47530 74030 75226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 77625 75238 gene locus_tag LOCUS_47540 77625 75238 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_47540 78248 77904 gene locus_tag LOCUS_47550 78248 77904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 79254 78799 gene locus_tag LOCUS_47560 79254 78799 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402907.1 protein_id gnl|my_center|LOCUS_47560 80352 79366 gene locus_tag LOCUS_47570 80352 79366 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_47570 83023 80594 gene locus_tag LOCUS_47580 83023 80594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_47580 83293 83877 gene locus_tag LOCUS_47590 83293 83877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 86381 84024 gene locus_tag LOCUS_47600 86381 84024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_47600 87302 86793 gene locus_tag LOCUS_47610 87302 86793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 88401 87670 gene locus_tag LOCUS_47620 88401 87670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 89105 88557 gene locus_tag LOCUS_47630 89105 88557 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_47630 91869 89308 gene locus_tag LOCUS_47640 91869 89308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 92575 91955 gene locus_tag LOCUS_47650 92575 91955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 94239 92839 gene locus_tag LOCUS_47660 94239 92839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 94779 95567 gene locus_tag LOCUS_47670 94779 95567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 95574 96290 gene locus_tag LOCUS_47680 95574 96290 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_47680 96491 98872 gene locus_tag LOCUS_47690 96491 98872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_47690 99345 103586 gene locus_tag LOCUS_47700 99345 103586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 >Feature sequence037 130 1248 gene locus_tag LOCUS_47710 130 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 1319 3196 gene locus_tag LOCUS_47720 1319 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 3675 4655 gene locus_tag LOCUS_47730 3675 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 4820 5929 gene locus_tag LOCUS_47740 4820 5929 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_47740 7040 5934 gene locus_tag LOCUS_47750 7040 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 8230 7127 gene locus_tag LOCUS_47760 8230 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 9866 8484 gene locus_tag LOCUS_47770 9866 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 10076 11155 gene locus_tag LOCUS_47780 10076 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 11148 11882 gene locus_tag LOCUS_47790 11148 11882 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_47790 12615 13532 gene locus_tag LOCUS_47800 12615 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 14001 14645 gene locus_tag LOCUS_47810 14001 14645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 15583 16416 gene locus_tag LOCUS_47820 15583 16416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 17243 16695 gene locus_tag LOCUS_47830 17243 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 17539 18114 gene locus_tag LOCUS_47840 17539 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 20815 18221 gene locus_tag LOCUS_47850 20815 18221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_47850 21149 20820 gene locus_tag LOCUS_47860 21149 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 21371 21733 gene locus_tag LOCUS_47870 21371 21733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 22733 22050 gene locus_tag LOCUS_47880 22733 22050 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_47880 23817 22744 gene locus_tag LOCUS_47890 23817 22744 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_47890 24394 26760 gene locus_tag LOCUS_47900 24394 26760 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_47900 26920 27477 gene locus_tag LOCUS_47910 26920 27477 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911193.1 protein_id gnl|my_center|LOCUS_47910 27487 28302 gene locus_tag LOCUS_47920 27487 28302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 28371 29468 gene locus_tag LOCUS_47930 28371 29468 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_47930 29841 29473 gene locus_tag LOCUS_47940 29841 29473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 29929 30096 gene locus_tag LOCUS_47950 29929 30096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 30217 31401 gene locus_tag LOCUS_47960 30217 31401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 31928 31455 gene locus_tag LOCUS_47970 31928 31455 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_47970 32808 31978 gene locus_tag LOCUS_47980 32808 31978 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_47980 33663 32959 gene locus_tag LOCUS_47990 33663 32959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 34965 33832 gene locus_tag LOCUS_48000 34965 33832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 35156 36595 gene locus_tag LOCUS_48010 35156 36595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 36696 37643 gene locus_tag LOCUS_48020 36696 37643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 37640 37861 gene locus_tag LOCUS_48030 37640 37861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 37949 38488 gene locus_tag LOCUS_48040 37949 38488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 38747 40162 gene locus_tag LOCUS_48050 38747 40162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 protein_id gnl|my_center|LOCUS_48050 41929 40217 gene locus_tag LOCUS_48060 41929 40217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 42739 42275 gene locus_tag LOCUS_48070 42739 42275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 43169 42954 gene locus_tag LOCUS_48080 43169 42954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 43239 43598 gene locus_tag LOCUS_48090 43239 43598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 43975 44505 gene locus_tag LOCUS_48100 43975 44505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 44617 45636 gene locus_tag LOCUS_48110 44617 45636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 46097 46390 gene locus_tag LOCUS_48120 46097 46390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 46559 47068 gene locus_tag LOCUS_48130 46559 47068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 47276 50317 gene locus_tag LOCUS_48140 47276 50317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_48140 51887 50394 gene locus_tag LOCUS_48150 51887 50394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 52243 52851 gene locus_tag LOCUS_48160 52243 52851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 52895 53461 gene locus_tag LOCUS_48170 52895 53461 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258945.1 protein_id gnl|my_center|LOCUS_48170 53531 54916 gene locus_tag LOCUS_48180 53531 54916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 55635 54913 gene locus_tag LOCUS_48190 55635 54913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 55839 56840 gene locus_tag LOCUS_48200 gene bla 55839 56840 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_48200 56837 57988 gene locus_tag LOCUS_48210 56837 57988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_48210 58431 59249 gene locus_tag LOCUS_48220 58431 59249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 59799 62135 gene locus_tag LOCUS_48230 59799 62135 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_48230 62221 63423 gene locus_tag LOCUS_48240 62221 63423 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139375234.1 protein_id gnl|my_center|LOCUS_48240 63434 64534 gene locus_tag LOCUS_48250 63434 64534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 64724 65911 gene locus_tag LOCUS_48260 64724 65911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 66687 66076 gene locus_tag LOCUS_48270 66687 66076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 67237 66728 gene locus_tag LOCUS_48280 67237 66728 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_48280 67899 70289 gene locus_tag LOCUS_48290 67899 70289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 72062 70362 gene locus_tag LOCUS_48300 72062 70362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_48300 72947 72507 gene locus_tag LOCUS_48310 72947 72507 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090283.1 protein_id gnl|my_center|LOCUS_48310 74197 73073 gene locus_tag LOCUS_48320 74197 73073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 76129 74309 gene locus_tag LOCUS_48330 76129 74309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_48330 77562 76213 gene locus_tag LOCUS_48340 gene accC 77562 76213 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_48340 78107 77595 gene locus_tag LOCUS_48350 gene accB 78107 77595 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_48350 78677 78111 gene locus_tag LOCUS_48360 gene efp 78677 78111 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_48360 79893 78904 gene locus_tag LOCUS_48370 79893 78904 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_48370 81649 80111 gene locus_tag LOCUS_48380 81649 80111 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_48380 82107 82592 gene locus_tag LOCUS_48390 82107 82592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 82878 86528 gene locus_tag LOCUS_48400 82878 86528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 86557 88818 gene locus_tag LOCUS_48410 86557 88818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 89381 88854 gene locus_tag LOCUS_48420 gene lspA 89381 88854 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460289.1 protein_id gnl|my_center|LOCUS_48420 89618 90862 gene locus_tag LOCUS_48430 89618 90862 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_48430 91808 90915 gene locus_tag LOCUS_48440 91808 90915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_48440 91816 92025 gene locus_tag LOCUS_48450 91816 92025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 94264 93680 gene locus_tag LOCUS_48460 94264 93680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 95119 94652 gene locus_tag LOCUS_48470 95119 94652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 95290 97011 gene locus_tag LOCUS_48480 95290 97011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 97833 98477 gene locus_tag LOCUS_48490 97833 98477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 98619 100172 gene locus_tag LOCUS_48500 98619 100172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 100581 102470 gene locus_tag LOCUS_48510 100581 102470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 102812 103384 gene locus_tag LOCUS_48520 102812 103384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 103408 103674 gene locus_tag LOCUS_48530 gene rpsR 103408 103674 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_48530 103760 104206 gene locus_tag LOCUS_48540 gene rplI 103760 104206 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_48540 105007 104267 gene locus_tag LOCUS_48550 105007 104267 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970604.1 protein_id gnl|my_center|LOCUS_48550 106317 105250 gene locus_tag LOCUS_48560 gene serC 106317 105250 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_48560 >Feature sequence038 2773 161 gene locus_tag LOCUS_48570 2773 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 3720 2884 gene locus_tag LOCUS_48580 3720 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 4660 3749 gene locus_tag LOCUS_48590 4660 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 5018 4851 gene locus_tag LOCUS_48600 5018 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 5496 5011 gene locus_tag LOCUS_48610 5496 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 5941 5663 gene locus_tag LOCUS_48620 5941 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 6564 7982 gene locus_tag LOCUS_48630 6564 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 8109 8819 gene locus_tag LOCUS_48640 8109 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 9504 10130 gene locus_tag LOCUS_48650 9504 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 10900 10265 gene locus_tag LOCUS_48660 10900 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 12781 11246 gene locus_tag LOCUS_48670 12781 11246 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203629.1 protein_id gnl|my_center|LOCUS_48670 13161 12793 gene locus_tag LOCUS_48680 13161 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 13927 13316 gene locus_tag LOCUS_48690 13927 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 14320 13979 gene locus_tag LOCUS_48700 14320 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 14431 14733 gene locus_tag LOCUS_48710 14431 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 14717 14938 gene locus_tag LOCUS_48720 14717 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 15491 15336 gene locus_tag LOCUS_48730 15491 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 16596 15646 gene locus_tag LOCUS_48740 16596 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 18098 17307 gene locus_tag LOCUS_48750 18098 17307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 19259 18135 gene locus_tag LOCUS_48760 19259 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 20500 19823 gene locus_tag LOCUS_48770 20500 19823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 21160 20945 gene locus_tag LOCUS_48780 21160 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 21864 21307 gene locus_tag LOCUS_48790 21864 21307 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_48790 22084 21851 gene locus_tag LOCUS_48800 22084 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 22706 22086 gene locus_tag LOCUS_48810 22706 22086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 23819 22716 gene locus_tag LOCUS_48820 23819 22716 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104264.1 protein_id gnl|my_center|LOCUS_48820 24227 23820 gene locus_tag LOCUS_48830 24227 23820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 25303 24230 gene locus_tag LOCUS_48840 gene hypE 25303 24230 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_48840 27052 25310 gene locus_tag LOCUS_48850 27052 25310 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880726.1 protein_id gnl|my_center|LOCUS_48850 28161 27049 gene locus_tag LOCUS_48860 gene hypD 28161 27049 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_48860 28461 28168 gene locus_tag LOCUS_48870 28461 28168 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_48870 30772 28424 gene locus_tag LOCUS_48880 gene hypF 30772 28424 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582504.1 protein_id gnl|my_center|LOCUS_48880 31494 30772 gene locus_tag LOCUS_48890 31494 30772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 32200 31826 gene locus_tag LOCUS_48900 32200 31826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 33721 32210 gene locus_tag LOCUS_48910 33721 32210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 34019 33696 gene locus_tag LOCUS_48920 34019 33696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 34397 34029 gene locus_tag LOCUS_48930 34397 34029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 34897 34403 gene locus_tag LOCUS_48940 34897 34403 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939205.1 protein_id gnl|my_center|LOCUS_48940 36601 35006 gene locus_tag LOCUS_48950 36601 35006 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258626.1 protein_id gnl|my_center|LOCUS_48950 37594 36629 gene locus_tag LOCUS_48960 37594 36629 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 protein_id gnl|my_center|LOCUS_48960 38781 37819 gene locus_tag LOCUS_48970 38781 37819 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_48970 39461 38820 gene locus_tag LOCUS_48980 39461 38820 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692786.1 protein_id gnl|my_center|LOCUS_48980 39860 39504 gene locus_tag LOCUS_48990 39860 39504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 40556 39927 gene locus_tag LOCUS_49000 40556 39927 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940880.1 protein_id gnl|my_center|LOCUS_49000 41924 40641 gene locus_tag LOCUS_49010 41924 40641 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697398.1 protein_id gnl|my_center|LOCUS_49010 43059 41953 gene locus_tag LOCUS_49020 gene hisC 43059 41953 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546009.1 protein_id gnl|my_center|LOCUS_49020 43365 44825 gene locus_tag LOCUS_49030 gene gabD 43365 44825 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_49030 46229 44835 gene locus_tag LOCUS_49040 46229 44835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 48517 46331 gene locus_tag LOCUS_49050 48517 46331 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_49050 48854 48522 gene locus_tag LOCUS_49060 48854 48522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 50069 51394 gene locus_tag LOCUS_49070 50069 51394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 52696 51506 gene locus_tag LOCUS_49080 52696 51506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 53002 53568 gene locus_tag LOCUS_49090 53002 53568 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795316.1 protein_id gnl|my_center|LOCUS_49090 53565 54653 gene locus_tag LOCUS_49100 53565 54653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 54965 57337 gene locus_tag LOCUS_49110 54965 57337 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_49110 57875 57465 gene locus_tag LOCUS_49120 57875 57465 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_49120 58437 57946 gene locus_tag LOCUS_49130 58437 57946 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_49130 59595 58477 gene locus_tag LOCUS_49140 59595 58477 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_49140 61194 59629 gene locus_tag LOCUS_49150 61194 59629 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860915.1 protein_id gnl|my_center|LOCUS_49150 62544 61240 gene locus_tag LOCUS_49160 62544 61240 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_49160 65272 62672 gene locus_tag LOCUS_49170 65272 62672 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 protein_id gnl|my_center|LOCUS_49170 65441 66298 gene locus_tag LOCUS_49180 65441 66298 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 protein_id gnl|my_center|LOCUS_49180 66993 66367 gene locus_tag LOCUS_49190 66993 66367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_49190 69893 66972 gene locus_tag LOCUS_49200 69893 66972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 70149 71864 gene locus_tag LOCUS_49210 70149 71864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 72174 75335 gene locus_tag LOCUS_49220 72174 75335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 75339 75959 gene locus_tag LOCUS_49230 gene degU 75339 75959 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_49230 76249 76653 gene locus_tag LOCUS_49240 76249 76653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 76706 77095 gene locus_tag LOCUS_49250 76706 77095 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978389.1 protein_id gnl|my_center|LOCUS_49250 77653 80076 gene locus_tag LOCUS_49260 77653 80076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_49260 80264 81469 gene locus_tag LOCUS_49270 80264 81469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 81536 82708 gene locus_tag LOCUS_49280 81536 82708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 82962 83291 gene locus_tag LOCUS_49290 82962 83291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 83291 85942 gene locus_tag LOCUS_49300 83291 85942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_49300 86286 87110 gene locus_tag LOCUS_49310 86286 87110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 87185 88084 gene locus_tag LOCUS_49320 87185 88084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 88212 88943 gene locus_tag LOCUS_49330 88212 88943 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033930894.1 protein_id gnl|my_center|LOCUS_49330 89222 89932 gene locus_tag LOCUS_49340 89222 89932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 90129 92108 gene locus_tag LOCUS_49350 90129 92108 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_49350 92908 92177 gene locus_tag LOCUS_49360 92908 92177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 93783 93028 gene locus_tag LOCUS_49370 93783 93028 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_49370 94815 93787 gene locus_tag LOCUS_49380 94815 93787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 95735 94812 gene locus_tag LOCUS_49390 95735 94812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 97462 96098 gene locus_tag LOCUS_49400 97462 96098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 97724 99130 gene locus_tag LOCUS_49410 97724 99130 CDS product IS4-like element ISLpn6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946421.1 protein_id gnl|my_center|LOCUS_49410 >Feature sequence039 221 4000 gene locus_tag LOCUS_49420 221 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 4066 7680 gene locus_tag LOCUS_49430 4066 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 7758 11408 gene locus_tag LOCUS_49440 7758 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 13674 11461 gene locus_tag LOCUS_49450 13674 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 13738 15426 gene locus_tag LOCUS_49460 13738 15426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 16172 15594 gene locus_tag LOCUS_49470 16172 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 16900 16397 gene locus_tag LOCUS_49480 16900 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 17747 16908 gene locus_tag LOCUS_49490 17747 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 18564 18052 gene locus_tag LOCUS_49500 18564 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 19675 18725 gene locus_tag LOCUS_49510 19675 18725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 24018 19948 gene locus_tag LOCUS_49520 24018 19948 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_49520 25401 24733 gene locus_tag LOCUS_49530 25401 24733 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_49530 26456 25419 gene locus_tag LOCUS_49540 26456 25419 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_49540 27484 26729 gene locus_tag LOCUS_49550 27484 26729 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_49550 28523 27765 gene locus_tag LOCUS_49560 28523 27765 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_49560 29875 28574 gene locus_tag LOCUS_49570 29875 28574 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_49570 30339 29941 gene locus_tag LOCUS_49580 30339 29941 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_49580 32657 30456 gene locus_tag LOCUS_49590 32657 30456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 33668 32865 gene locus_tag LOCUS_49600 33668 32865 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029033.1 protein_id gnl|my_center|LOCUS_49600 35102 33792 gene locus_tag LOCUS_49610 35102 33792 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_49610 38362 35114 gene locus_tag LOCUS_49620 38362 35114 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076455918.1 protein_id gnl|my_center|LOCUS_49620 40893 38926 gene locus_tag LOCUS_49630 40893 38926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 42361 40910 gene locus_tag LOCUS_49640 42361 40910 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_49640 45487 42386 gene locus_tag LOCUS_49650 45487 42386 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076455918.1 protein_id gnl|my_center|LOCUS_49650 46615 45893 gene locus_tag LOCUS_49660 46615 45893 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_49660 47465 47043 gene locus_tag LOCUS_49670 47465 47043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 48404 47592 gene locus_tag LOCUS_49680 48404 47592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 48787 49659 gene locus_tag LOCUS_49690 48787 49659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 49806 51791 gene locus_tag LOCUS_49700 49806 51791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 52038 55055 gene locus_tag LOCUS_49710 52038 55055 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_49710 55079 56599 gene locus_tag LOCUS_49720 55079 56599 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_49720 56829 58139 gene locus_tag LOCUS_49730 56829 58139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 58230 59111 gene locus_tag LOCUS_49740 58230 59111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 59169 60218 gene locus_tag LOCUS_49750 59169 60218 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_49750 60271 61365 gene locus_tag LOCUS_49760 60271 61365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 61393 62094 gene locus_tag LOCUS_49770 61393 62094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 62173 63714 gene locus_tag LOCUS_49780 62173 63714 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_49780 63720 65060 gene locus_tag LOCUS_49790 gene xylA 63720 65060 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_49790 65067 66686 gene locus_tag LOCUS_49800 65067 66686 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_49800 66807 68348 gene locus_tag LOCUS_49810 66807 68348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 68345 69937 gene locus_tag LOCUS_49820 gene xynB 68345 69937 CDS product xylan 1,4-beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245202.1 protein_id gnl|my_center|LOCUS_49820 69980 71113 gene locus_tag LOCUS_49830 69980 71113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 71411 71899 gene locus_tag LOCUS_49840 71411 71899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 73190 72081 gene locus_tag LOCUS_49850 73190 72081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 74305 73250 gene locus_tag LOCUS_49860 74305 73250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 74505 76067 gene locus_tag LOCUS_49870 74505 76067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 77040 76093 gene locus_tag LOCUS_49880 77040 76093 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266870.1 protein_id gnl|my_center|LOCUS_49880 77819 77211 gene locus_tag LOCUS_49890 77819 77211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 78602 77838 gene locus_tag LOCUS_49900 78602 77838 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170061.1 protein_id gnl|my_center|LOCUS_49900 78732 79094 gene locus_tag LOCUS_49910 78732 79094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 79615 79160 gene locus_tag LOCUS_49920 79615 79160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 80528 79683 gene locus_tag LOCUS_49930 80528 79683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 80855 81499 gene locus_tag LOCUS_49940 80855 81499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 82909 81506 gene locus_tag LOCUS_49950 82909 81506 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_49950 84424 83048 gene locus_tag LOCUS_49960 84424 83048 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_49960 84559 85911 gene locus_tag LOCUS_49970 84559 85911 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932690.1 protein_id gnl|my_center|LOCUS_49970 86026 86217 gene locus_tag LOCUS_49980 86026 86217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 86223 86642 gene locus_tag LOCUS_49990 86223 86642 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_49990 86653 87648 gene locus_tag LOCUS_50000 86653 87648 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809024.1 protein_id gnl|my_center|LOCUS_50000 87653 89173 gene locus_tag LOCUS_50010 87653 89173 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040412.1 protein_id gnl|my_center|LOCUS_50010 89384 90766 gene locus_tag LOCUS_50020 89384 90766 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_50020 91446 90784 gene locus_tag LOCUS_50030 91446 90784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 92325 91450 gene locus_tag LOCUS_50040 92325 91450 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456728.1 protein_id gnl|my_center|LOCUS_50040 93446 92448 gene locus_tag LOCUS_50050 93446 92448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 94459 93455 gene locus_tag LOCUS_50060 94459 93455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 95433 94519 gene locus_tag LOCUS_50070 95433 94519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 96539 95547 gene locus_tag LOCUS_50080 96539 95547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 97425 96574 gene locus_tag LOCUS_50090 97425 96574 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438284.1 protein_id gnl|my_center|LOCUS_50090 98430 97534 gene locus_tag LOCUS_50100 98430 97534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 98647 99927 gene locus_tag LOCUS_50110 98647 99927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 100566 101855 gene locus_tag LOCUS_50120 100566 101855 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_50120 102310 103728 gene locus_tag LOCUS_50130 102310 103728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 >Feature sequence040 339 1391 gene locus_tag LOCUS_50140 339 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 3031 1430 gene locus_tag LOCUS_50150 3031 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 3564 3205 gene locus_tag LOCUS_50160 3564 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_50160 4227 3667 gene locus_tag LOCUS_50170 4227 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 4947 4276 gene locus_tag LOCUS_50180 4947 4276 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962995.1 protein_id gnl|my_center|LOCUS_50180 6164 4956 gene locus_tag LOCUS_50190 6164 4956 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_50190 6624 6331 gene locus_tag LOCUS_50200 6624 6331 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_50200 6775 7275 gene locus_tag LOCUS_50210 6775 7275 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163512.1 protein_id gnl|my_center|LOCUS_50210 7465 8007 gene locus_tag LOCUS_50220 7465 8007 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_50220 8037 9575 gene locus_tag LOCUS_50230 8037 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 10356 9673 gene locus_tag LOCUS_50240 10356 9673 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 protein_id gnl|my_center|LOCUS_50240 11419 10688 gene locus_tag LOCUS_50250 11419 10688 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_50250 12172 11582 gene locus_tag LOCUS_50260 12172 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 14135 12495 gene locus_tag LOCUS_50270 14135 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 15243 14218 gene locus_tag LOCUS_50280 15243 14218 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768135.1 protein_id gnl|my_center|LOCUS_50280 16111 15416 gene locus_tag LOCUS_50290 16111 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 16775 16185 gene locus_tag LOCUS_50300 16775 16185 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761425.1 protein_id gnl|my_center|LOCUS_50300 17096 17707 gene locus_tag LOCUS_50310 17096 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 18668 17796 gene locus_tag LOCUS_50320 18668 17796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 21074 19587 gene locus_tag LOCUS_50330 21074 19587 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_50330 23237 21114 gene locus_tag LOCUS_50340 gene metG 23237 21114 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962236.1 protein_id gnl|my_center|LOCUS_50340 23405 23608 gene locus_tag LOCUS_50350 23405 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 23663 24241 gene locus_tag LOCUS_50360 23663 24241 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_50360 24225 24569 gene locus_tag LOCUS_50370 24225 24569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 24597 25091 gene locus_tag LOCUS_50380 24597 25091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 25780 26898 gene locus_tag LOCUS_50390 25780 26898 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_50390 26972 28150 gene locus_tag LOCUS_50400 26972 28150 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_50400 30273 28249 gene locus_tag LOCUS_50410 30273 28249 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_50410 30749 30414 gene locus_tag LOCUS_50420 30749 30414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 31912 30848 gene locus_tag LOCUS_50430 31912 30848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 33993 32170 gene locus_tag LOCUS_50440 33993 32170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 34147 35448 gene locus_tag LOCUS_50450 34147 35448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173416272.1 protein_id gnl|my_center|LOCUS_50450 36072 35644 gene locus_tag LOCUS_50460 36072 35644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_50460 36703 36281 gene locus_tag LOCUS_50470 36703 36281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 38664 37393 gene locus_tag LOCUS_50480 38664 37393 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_50480 40241 38865 gene locus_tag LOCUS_50490 40241 38865 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202702.1 protein_id gnl|my_center|LOCUS_50490 40594 41850 gene locus_tag LOCUS_50500 40594 41850 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_50500 41872 42561 gene locus_tag LOCUS_50510 41872 42561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_50510 43231 45606 gene locus_tag LOCUS_50520 43231 45606 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_50520 45619 47973 gene locus_tag LOCUS_50530 45619 47973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_50530 48091 48789 gene locus_tag LOCUS_50540 48091 48789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_50540 50304 48865 gene locus_tag LOCUS_50550 50304 48865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 51312 50425 gene locus_tag LOCUS_50560 51312 50425 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_50560 51569 52900 gene locus_tag LOCUS_50570 51569 52900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 52927 53415 gene locus_tag LOCUS_50580 gene paaJ 52927 53415 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_50580 53542 54318 gene locus_tag LOCUS_50590 gene paaG 53542 54318 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_50590 54734 55813 gene locus_tag LOCUS_50600 gene meaB 54734 55813 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_50600 56008 56601 gene locus_tag LOCUS_50610 56008 56601 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402887.1 protein_id gnl|my_center|LOCUS_50610 56702 57136 gene locus_tag LOCUS_50620 56702 57136 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_50620 57315 58088 gene locus_tag LOCUS_50630 57315 58088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 58174 59439 gene locus_tag LOCUS_50640 58174 59439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 60666 61085 gene locus_tag LOCUS_50650 60666 61085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 62103 61117 gene locus_tag LOCUS_50660 62103 61117 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_50660 63032 62295 gene locus_tag LOCUS_50670 63032 62295 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_50670 63735 63049 gene locus_tag LOCUS_50680 63735 63049 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_50680 64476 63790 gene locus_tag LOCUS_50690 64476 63790 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_50690 64592 64473 gene locus_tag LOCUS_50700 64592 64473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 65310 64606 gene locus_tag LOCUS_50710 65310 64606 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_50710 65674 66372 gene locus_tag LOCUS_50720 65674 66372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764108.1 protein_id gnl|my_center|LOCUS_50720 66432 67193 gene locus_tag LOCUS_50730 66432 67193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_50730 67283 67368 gene locus_tag LOCUS_t00300 67283 67368 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67425 68390 gene locus_tag LOCUS_50740 67425 68390 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965824.1 protein_id gnl|my_center|LOCUS_50740 69270 68479 gene locus_tag LOCUS_50750 69270 68479 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_50750 69652 69969 gene locus_tag LOCUS_50760 69652 69969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 70203 70601 gene locus_tag LOCUS_50770 70203 70601 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_50770 70706 71344 gene locus_tag LOCUS_50780 70706 71344 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_50780 71434 72333 gene locus_tag LOCUS_50790 71434 72333 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_50790 72336 72743 gene locus_tag LOCUS_50800 72336 72743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 73098 73916 gene locus_tag LOCUS_50810 73098 73916 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783689.1 protein_id gnl|my_center|LOCUS_50810 73945 74823 gene locus_tag LOCUS_50820 gene cysM 73945 74823 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208391.1 protein_id gnl|my_center|LOCUS_50820 77203 74849 gene locus_tag LOCUS_50830 77203 74849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 79032 77359 gene locus_tag LOCUS_50840 79032 77359 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_50840 80007 79165 gene locus_tag LOCUS_50850 80007 79165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 80640 81749 gene locus_tag LOCUS_50860 80640 81749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 81751 82257 gene locus_tag LOCUS_50870 81751 82257 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888793.1 protein_id gnl|my_center|LOCUS_50870 82259 82978 gene locus_tag LOCUS_50880 82259 82978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 83093 83479 gene locus_tag LOCUS_50890 83093 83479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 84583 86331 gene locus_tag LOCUS_50900 84583 86331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 86553 90551 gene locus_tag LOCUS_50910 86553 90551 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_50910 90820 91440 gene locus_tag LOCUS_50920 90820 91440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 91685 95779 gene locus_tag LOCUS_50930 91685 95779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 96845 96117 gene locus_tag LOCUS_50940 96845 96117 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_50940 98114 96981 gene locus_tag LOCUS_50950 98114 96981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 98265 98837 gene locus_tag LOCUS_50960 98265 98837 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_50960 98903 99880 gene locus_tag LOCUS_50970 98903 99880 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785419.1 protein_id gnl|my_center|LOCUS_50970 100053 100586 gene locus_tag LOCUS_50980 100053 100586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 100619 101641 gene locus_tag LOCUS_50990 100619 101641 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774253.1 protein_id gnl|my_center|LOCUS_50990 >Feature sequence041 208 1725 gene locus_tag LOCUS_51000 208 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 1738 2970 gene locus_tag LOCUS_51010 1738 2970 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861451.1 protein_id gnl|my_center|LOCUS_51010 5419 3029 gene locus_tag LOCUS_51020 5419 3029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_51020 6900 5530 gene locus_tag LOCUS_51030 6900 5530 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046312529.1 protein_id gnl|my_center|LOCUS_51030 8014 7154 gene locus_tag LOCUS_51040 8014 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 8236 8841 gene locus_tag LOCUS_51050 8236 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 9087 8890 gene locus_tag LOCUS_51060 9087 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 10073 9330 gene locus_tag LOCUS_51070 10073 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 10655 14209 gene locus_tag LOCUS_51080 10655 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 14476 17268 gene locus_tag LOCUS_51090 14476 17268 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_51090 18662 17415 gene locus_tag LOCUS_51100 18662 17415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 18739 19398 gene locus_tag LOCUS_51110 18739 19398 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_51110 19861 19457 gene locus_tag LOCUS_51120 19861 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 20604 19972 gene locus_tag LOCUS_51130 20604 19972 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_51130 20631 21278 gene locus_tag LOCUS_51140 gene pyrE 20631 21278 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288884.1 protein_id gnl|my_center|LOCUS_51140 21396 22481 gene locus_tag LOCUS_51150 21396 22481 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_51150 22574 23359 gene locus_tag LOCUS_51160 22574 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 24016 24555 gene locus_tag LOCUS_51170 24016 24555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 24676 25698 gene locus_tag LOCUS_51180 24676 25698 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456185.1 protein_id gnl|my_center|LOCUS_51180 25799 26749 gene locus_tag LOCUS_51190 25799 26749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 27437 26895 gene locus_tag LOCUS_51200 27437 26895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 27439 27930 gene locus_tag LOCUS_51210 27439 27930 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_51210 28284 27925 gene locus_tag LOCUS_51220 28284 27925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 28804 28262 gene locus_tag LOCUS_51230 28804 28262 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076326.1 protein_id gnl|my_center|LOCUS_51230 28921 30087 gene locus_tag LOCUS_51240 28921 30087 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_51240 31221 30166 gene locus_tag LOCUS_51250 gene rfbB 31221 30166 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_51250 32186 31239 gene locus_tag LOCUS_51260 32186 31239 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_51260 32542 33294 gene locus_tag LOCUS_51270 32542 33294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 33318 34565 gene locus_tag LOCUS_51280 33318 34565 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_51280 34595 35617 gene locus_tag LOCUS_51290 gene rfaE1 34595 35617 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_51290 38359 35633 gene locus_tag LOCUS_51300 38359 35633 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_51300 39021 38704 gene locus_tag LOCUS_51310 39021 38704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 40542 39292 gene locus_tag LOCUS_51320 gene lysA 40542 39292 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_51320 43239 40597 gene locus_tag LOCUS_51330 43239 40597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_51330 43572 43243 gene locus_tag LOCUS_51340 43572 43243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 43865 44326 gene locus_tag LOCUS_51350 43865 44326 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962711.1 protein_id gnl|my_center|LOCUS_51350 44376 44789 gene locus_tag LOCUS_51360 44376 44789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 45320 44853 gene locus_tag LOCUS_51370 45320 44853 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963598.1 protein_id gnl|my_center|LOCUS_51370 45417 46370 gene locus_tag LOCUS_51380 gene oxyR 45417 46370 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649559.1 protein_id gnl|my_center|LOCUS_51380 46935 46381 gene locus_tag LOCUS_51390 46935 46381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 47344 48081 gene locus_tag LOCUS_51400 47344 48081 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_51400 48050 48682 gene locus_tag LOCUS_51410 48050 48682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 49979 48861 gene locus_tag LOCUS_51420 49979 48861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_51420 51362 50343 gene locus_tag LOCUS_51430 51362 50343 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_51430 52446 51418 gene locus_tag LOCUS_51440 52446 51418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 53983 52730 gene locus_tag LOCUS_51450 53983 52730 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_51450 54539 54201 gene locus_tag LOCUS_51460 gene glnB 54539 54201 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_51460 54844 56931 gene locus_tag LOCUS_51470 54844 56931 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_51470 57156 57686 gene locus_tag LOCUS_51480 gene sigW 57156 57686 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_51480 57676 58473 gene locus_tag LOCUS_51490 57676 58473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 58483 59223 gene locus_tag LOCUS_51500 58483 59223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 61444 59543 gene locus_tag LOCUS_51510 61444 59543 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_51510 63934 61508 gene locus_tag LOCUS_51520 63934 61508 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_51520 64304 64846 gene locus_tag LOCUS_51530 64304 64846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 66130 64913 gene locus_tag LOCUS_51540 66130 64913 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_51540 66151 67548 gene locus_tag LOCUS_51550 66151 67548 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_51550 68337 67573 gene locus_tag LOCUS_51560 68337 67573 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_51560 69248 68334 gene locus_tag LOCUS_51570 69248 68334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 72010 69470 gene locus_tag LOCUS_51580 72010 69470 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_51580 73110 72337 gene locus_tag LOCUS_51590 73110 72337 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109413831.1 protein_id gnl|my_center|LOCUS_51590 74951 73374 gene locus_tag LOCUS_51600 74951 73374 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_51600 75015 75725 gene locus_tag LOCUS_51610 75015 75725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 75737 76258 gene locus_tag LOCUS_51620 75737 76258 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919345.1 protein_id gnl|my_center|LOCUS_51620 77184 76264 gene locus_tag LOCUS_51630 77184 76264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 78225 77239 gene locus_tag LOCUS_51640 78225 77239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 78593 79096 gene locus_tag LOCUS_51650 78593 79096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 79151 80455 gene locus_tag LOCUS_51660 79151 80455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 80679 81335 gene locus_tag LOCUS_51670 80679 81335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 82496 81399 gene locus_tag LOCUS_51680 82496 81399 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042596355.1 protein_id gnl|my_center|LOCUS_51680 82715 83284 gene locus_tag LOCUS_51690 82715 83284 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_51690 84923 83313 gene locus_tag LOCUS_51700 gene ggt 84923 83313 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_51700 85112 85570 gene locus_tag LOCUS_51710 85112 85570 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_51710 85678 86517 gene locus_tag LOCUS_51720 85678 86517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 86528 87670 gene locus_tag LOCUS_51730 86528 87670 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888425.1 protein_id gnl|my_center|LOCUS_51730 87852 89102 gene locus_tag LOCUS_51740 87852 89102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 89227 90021 gene locus_tag LOCUS_51750 89227 90021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 90049 90237 gene locus_tag LOCUS_51760 90049 90237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 90250 90765 gene locus_tag LOCUS_51770 90250 90765 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_51770 92044 91040 gene locus_tag LOCUS_51780 92044 91040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 92237 93346 gene locus_tag LOCUS_51790 92237 93346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 93419 93874 gene locus_tag LOCUS_51800 93419 93874 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_51800 93867 96035 gene locus_tag LOCUS_51810 93867 96035 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114512.1 protein_id gnl|my_center|LOCUS_51810 96164 97312 gene locus_tag LOCUS_51820 96164 97312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 97303 98400 gene locus_tag LOCUS_51830 97303 98400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 98946 100550 gene locus_tag LOCUS_51840 98946 100550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 101175 >102045 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatgagtgggttccaatgttagataggacttcgac >Feature sequence042 3759 1342 gene locus_tag LOCUS_51850 3759 1342 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_51850 4209 3865 gene locus_tag LOCUS_51860 4209 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 5151 4285 gene locus_tag LOCUS_51870 5151 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 7962 5215 gene locus_tag LOCUS_51880 7962 5215 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_51880 8145 9686 gene locus_tag LOCUS_51890 8145 9686 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_51890 11925 9724 gene locus_tag LOCUS_51900 11925 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 14214 12151 gene locus_tag LOCUS_51910 14214 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 14383 15447 gene locus_tag LOCUS_51920 14383 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 15476 15994 gene locus_tag LOCUS_51930 15476 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 16405 17439 gene locus_tag LOCUS_51940 16405 17439 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_51940 17587 18198 gene locus_tag LOCUS_51950 17587 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 19193 18195 gene locus_tag LOCUS_51960 gene murB 19193 18195 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_51960 19773 19195 gene locus_tag LOCUS_51970 19773 19195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 21595 19787 gene locus_tag LOCUS_51980 21595 19787 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_51980 21991 22848 gene locus_tag LOCUS_51990 21991 22848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 22931 23371 gene locus_tag LOCUS_52000 22931 23371 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_52000 23612 25645 gene locus_tag LOCUS_52010 gene ppk1 23612 25645 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529560.1 protein_id gnl|my_center|LOCUS_52010 25890 27050 gene locus_tag LOCUS_52020 25890 27050 CDS product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_52020 27137 27799 gene locus_tag LOCUS_52030 27137 27799 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992322.1 protein_id gnl|my_center|LOCUS_52030 27892 29553 gene locus_tag LOCUS_52040 27892 29553 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880772.1 protein_id gnl|my_center|LOCUS_52040 29819 30889 gene locus_tag LOCUS_52050 gene ilvC 29819 30889 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_52050 30991 32256 gene locus_tag LOCUS_52060 gene ilvA 30991 32256 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120302.1 protein_id gnl|my_center|LOCUS_52060 32330 33319 gene locus_tag LOCUS_52070 32330 33319 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 protein_id gnl|my_center|LOCUS_52070 33546 33926 gene locus_tag LOCUS_52080 33546 33926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 33960 34808 gene locus_tag LOCUS_52090 33960 34808 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_52090 34916 35386 gene locus_tag LOCUS_52100 34916 35386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 35548 36243 gene locus_tag LOCUS_52110 35548 36243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 36794 36264 gene locus_tag LOCUS_52120 36794 36264 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546342.1 protein_id gnl|my_center|LOCUS_52120 37228 36815 gene locus_tag LOCUS_52130 37228 36815 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528904.1 protein_id gnl|my_center|LOCUS_52130 37952 37281 gene locus_tag LOCUS_52140 37952 37281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 38134 38919 gene locus_tag LOCUS_52150 38134 38919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 38946 40469 gene locus_tag LOCUS_52160 38946 40469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 41212 40661 gene locus_tag LOCUS_52170 41212 40661 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_52170 42382 41222 gene locus_tag LOCUS_52180 42382 41222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 44764 43112 gene locus_tag LOCUS_52190 44764 43112 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_52190 45154 45624 gene locus_tag LOCUS_52200 45154 45624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 45735 48650 gene locus_tag LOCUS_52210 45735 48650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 48827 51676 gene locus_tag LOCUS_52220 48827 51676 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_52220 51782 52468 gene locus_tag LOCUS_52230 51782 52468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 52553 53506 gene locus_tag LOCUS_52240 52553 53506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_52240 53810 56665 gene locus_tag LOCUS_52250 53810 56665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 56672 57382 gene locus_tag LOCUS_52260 56672 57382 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_52260 66245 57432 gene locus_tag LOCUS_52270 66245 57432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 67885 66626 gene locus_tag LOCUS_52280 67885 66626 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_52280 68714 67950 gene locus_tag LOCUS_52290 68714 67950 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_52290 69575 68859 gene locus_tag LOCUS_52300 69575 68859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 70595 69684 gene locus_tag LOCUS_52310 70595 69684 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_52310 72022 70664 gene locus_tag LOCUS_52320 72022 70664 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839812.1 protein_id gnl|my_center|LOCUS_52320 73278 72157 gene locus_tag LOCUS_52330 73278 72157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 74488 73475 gene locus_tag LOCUS_52340 74488 73475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 76394 74682 gene locus_tag LOCUS_52350 76394 74682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 77171 76440 gene locus_tag LOCUS_52360 gene gldF 77171 76440 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_52360 77886 77215 gene locus_tag LOCUS_52370 77886 77215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 78794 77892 gene locus_tag LOCUS_52380 gene gldA 78794 77892 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_52380 78993 80087 gene locus_tag LOCUS_52390 gene ykfB 78993 80087 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 protein_id gnl|my_center|LOCUS_52390 81751 80153 gene locus_tag LOCUS_52400 81751 80153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 82506 81991 gene locus_tag LOCUS_52410 82506 81991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 82829 85777 gene locus_tag LOCUS_52420 82829 85777 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_52420 86486 87925 gene locus_tag LOCUS_52430 86486 87925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 88330 88007 gene locus_tag LOCUS_52440 88330 88007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 88851 90377 gene locus_tag LOCUS_52450 88851 90377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 90787 90416 gene locus_tag LOCUS_52460 90787 90416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 91354 92628 gene locus_tag LOCUS_52470 91354 92628 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_52470 92711 93220 gene locus_tag LOCUS_52480 92711 93220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 94641 93268 gene locus_tag LOCUS_52490 94641 93268 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_52490 94836 95129 gene locus_tag LOCUS_52500 94836 95129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 95179 96552 gene locus_tag LOCUS_52510 95179 96552 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_52510 98829 96649 gene locus_tag LOCUS_52520 98829 96649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 99715 99233 gene locus_tag LOCUS_52530 99715 99233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 99948 100673 gene locus_tag LOCUS_52540 99948 100673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 >Feature sequence043 710 165 gene locus_tag LOCUS_52550 710 165 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027542149.1 protein_id gnl|my_center|LOCUS_52550 1705 839 gene locus_tag LOCUS_52560 1705 839 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852985.1 protein_id gnl|my_center|LOCUS_52560 4941 1879 gene locus_tag LOCUS_52570 4941 1879 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_52570 8119 5060 gene locus_tag LOCUS_52580 8119 5060 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309664.1 protein_id gnl|my_center|LOCUS_52580 8568 8116 gene locus_tag LOCUS_52590 8568 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 9671 8772 gene locus_tag LOCUS_52600 9671 8772 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777001.1 protein_id gnl|my_center|LOCUS_52600 10622 9762 gene locus_tag LOCUS_52610 10622 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 11902 10775 gene locus_tag LOCUS_52620 11902 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 12719 11946 gene locus_tag LOCUS_52630 12719 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 13347 12742 gene locus_tag LOCUS_52640 13347 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 13578 14636 gene locus_tag LOCUS_52650 13578 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 15520 14702 gene locus_tag LOCUS_52660 15520 14702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 protein_id gnl|my_center|LOCUS_52660 15656 17992 gene locus_tag LOCUS_52670 15656 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 17995 19476 gene locus_tag LOCUS_52680 17995 19476 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_52680 19439 20521 gene locus_tag LOCUS_52690 19439 20521 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_52690 20590 21339 gene locus_tag LOCUS_52700 20590 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 21407 23452 gene locus_tag LOCUS_52710 21407 23452 CDS product chitobiase/beta-hexosaminidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222583402.1 protein_id gnl|my_center|LOCUS_52710 24769 23612 gene locus_tag LOCUS_52720 24769 23612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 24955 25758 gene locus_tag LOCUS_52730 24955 25758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 26548 25766 gene locus_tag LOCUS_52740 26548 25766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 28671 26704 gene locus_tag LOCUS_52750 28671 26704 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_52750 29891 28809 gene locus_tag LOCUS_52760 29891 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 30763 30047 gene locus_tag LOCUS_52770 30763 30047 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_52770 31748 30771 gene locus_tag LOCUS_52780 31748 30771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 32993 31905 gene locus_tag LOCUS_52790 32993 31905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 33362 33006 gene locus_tag LOCUS_52800 33362 33006 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_52800 35375 33390 gene locus_tag LOCUS_52810 35375 33390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 35743 35534 gene locus_tag LOCUS_52820 35743 35534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 35960 35721 gene locus_tag LOCUS_52830 35960 35721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 36472 36071 gene locus_tag LOCUS_52840 36472 36071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 37223 36537 gene locus_tag LOCUS_52850 37223 36537 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_52850 38184 37213 gene locus_tag LOCUS_52860 38184 37213 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_52860 40153 38321 gene locus_tag LOCUS_52870 40153 38321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 41221 40487 gene locus_tag LOCUS_52880 41221 40487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 41446 42468 gene locus_tag LOCUS_52890 41446 42468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 42710 45142 gene locus_tag LOCUS_52900 42710 45142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_52900 46376 45111 gene locus_tag LOCUS_52910 46376 45111 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_52910 47601 46426 gene locus_tag LOCUS_52920 47601 46426 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_52920 47888 47688 gene locus_tag LOCUS_52930 47888 47688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 48720 47965 gene locus_tag LOCUS_52940 48720 47965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 50984 48933 gene locus_tag LOCUS_52950 50984 48933 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_52950 52636 51569 gene locus_tag LOCUS_52960 52636 51569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 53781 52705 gene locus_tag LOCUS_52970 53781 52705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 53935 55167 gene locus_tag LOCUS_52980 53935 55167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 56006 55176 gene locus_tag LOCUS_52990 gene sseA 56006 55176 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 protein_id gnl|my_center|LOCUS_52990 56804 56043 gene locus_tag LOCUS_53000 56804 56043 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_53000 57683 56856 gene locus_tag LOCUS_53010 57683 56856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 58778 57762 gene locus_tag LOCUS_53020 58778 57762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53020 59702 58881 gene locus_tag LOCUS_53030 59702 58881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 60306 59809 gene locus_tag LOCUS_53040 60306 59809 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408018.1 protein_id gnl|my_center|LOCUS_53040 61806 60382 gene locus_tag LOCUS_53050 61806 60382 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039042.1 protein_id gnl|my_center|LOCUS_53050 62636 61809 gene locus_tag LOCUS_53060 62636 61809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 63560 62982 gene locus_tag LOCUS_53070 63560 62982 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084104.1 protein_id gnl|my_center|LOCUS_53070 64009 63572 gene locus_tag LOCUS_53080 64009 63572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 65358 64054 gene locus_tag LOCUS_53090 65358 64054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 66875 65709 gene locus_tag LOCUS_53100 66875 65709 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_53100 67515 66928 gene locus_tag LOCUS_53110 67515 66928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 68444 67752 gene locus_tag LOCUS_53120 68444 67752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 68768 69808 gene locus_tag LOCUS_53130 68768 69808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 69904 70812 gene locus_tag LOCUS_53140 69904 70812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 71022 71321 gene locus_tag LOCUS_53150 71022 71321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 72759 71341 gene locus_tag LOCUS_53160 72759 71341 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838467.1 protein_id gnl|my_center|LOCUS_53160 75099 73159 gene locus_tag LOCUS_53170 75099 73159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 75814 75221 gene locus_tag LOCUS_53180 75814 75221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 76627 75839 gene locus_tag LOCUS_53190 76627 75839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 78369 76885 gene locus_tag LOCUS_53200 78369 76885 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640003.1 protein_id gnl|my_center|LOCUS_53200 78572 79642 gene locus_tag LOCUS_53210 78572 79642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 79627 80364 gene locus_tag LOCUS_53220 79627 80364 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762319.1 protein_id gnl|my_center|LOCUS_53220 80698 80366 gene locus_tag LOCUS_53230 80698 80366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 81014 80718 gene locus_tag LOCUS_53240 81014 80718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 82420 81110 gene locus_tag LOCUS_53250 82420 81110 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222229.1 protein_id gnl|my_center|LOCUS_53250 84222 82861 gene locus_tag LOCUS_53260 84222 82861 CDS product His-Xaa-Ser system-associated MauG-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_53260 85090 84374 gene locus_tag LOCUS_53270 85090 84374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 86540 85335 gene locus_tag LOCUS_53280 86540 85335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 87067 86735 gene locus_tag LOCUS_53290 87067 86735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 87457 87116 gene locus_tag LOCUS_53300 87457 87116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 88177 87761 gene locus_tag LOCUS_53310 88177 87761 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863690.1 protein_id gnl|my_center|LOCUS_53310 88756 88331 gene locus_tag LOCUS_53320 88756 88331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 89165 88764 gene locus_tag LOCUS_53330 89165 88764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 90277 89237 gene locus_tag LOCUS_53340 90277 89237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 91774 90602 gene locus_tag LOCUS_53350 91774 90602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 92415 92951 gene locus_tag LOCUS_53360 92415 92951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 93009 93521 gene locus_tag LOCUS_53370 93009 93521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 94246 93578 gene locus_tag LOCUS_53380 94246 93578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 95235 95786 gene locus_tag LOCUS_53390 95235 95786 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_53390 95799 96212 gene locus_tag LOCUS_53400 95799 96212 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_53400 96506 97924 gene locus_tag LOCUS_53410 96506 97924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 98151 98561 gene locus_tag LOCUS_53420 98151 98561 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_53420 98768 99397 gene locus_tag LOCUS_53430 98768 99397 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_53430 99461 100561 gene locus_tag LOCUS_53440 gene paaK 99461 100561 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206374.1 protein_id gnl|my_center|LOCUS_53440 >Feature sequence044 242 1099 gene locus_tag LOCUS_53450 242 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 1192 2883 gene locus_tag LOCUS_53460 1192 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 3234 2866 gene locus_tag LOCUS_53470 3234 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 3392 4876 gene locus_tag LOCUS_53480 3392 4876 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_53480 4886 5383 gene locus_tag LOCUS_53490 4886 5383 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_53490 5431 6228 gene locus_tag LOCUS_53500 5431 6228 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_53500 6294 8144 gene locus_tag LOCUS_53510 6294 8144 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064744.1 protein_id gnl|my_center|LOCUS_53510 8210 9106 gene locus_tag LOCUS_53520 8210 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807011.1 protein_id gnl|my_center|LOCUS_53520 9201 9923 gene locus_tag LOCUS_53530 9201 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 10260 12200 gene locus_tag LOCUS_53540 10260 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 12268 13683 gene locus_tag LOCUS_53550 12268 13683 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_53550 13712 14785 gene locus_tag LOCUS_53560 13712 14785 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948100.1 protein_id gnl|my_center|LOCUS_53560 14824 15711 gene locus_tag LOCUS_53570 14824 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 16962 17441 gene locus_tag LOCUS_53580 16962 17441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 17725 18300 gene locus_tag LOCUS_53590 17725 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 18309 18857 gene locus_tag LOCUS_53600 18309 18857 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_53600 19328 19810 gene locus_tag LOCUS_53610 19328 19810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 19912 20811 gene locus_tag LOCUS_53620 19912 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 20896 21588 gene locus_tag LOCUS_53630 20896 21588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 23239 21620 gene locus_tag LOCUS_53640 23239 21620 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_53640 24130 23405 gene locus_tag LOCUS_53650 24130 23405 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_53650 24183 25115 gene locus_tag LOCUS_53660 24183 25115 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_53660 25240 26913 gene locus_tag LOCUS_53670 25240 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 28686 27142 gene locus_tag LOCUS_53680 28686 27142 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_53680 28872 29162 gene locus_tag LOCUS_53690 28872 29162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 29188 30045 gene locus_tag LOCUS_53700 29188 30045 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870676.1 protein_id gnl|my_center|LOCUS_53700 30126 30641 gene locus_tag LOCUS_53710 30126 30641 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_53710 30665 32500 gene locus_tag LOCUS_53720 30665 32500 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_53720 32537 32905 gene locus_tag LOCUS_53730 32537 32905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 32918 33934 gene locus_tag LOCUS_53740 32918 33934 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_53740 33952 34224 gene locus_tag LOCUS_53750 33952 34224 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438991.1 protein_id gnl|my_center|LOCUS_53750 34327 34974 gene locus_tag LOCUS_53760 34327 34974 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_53760 35386 35793 gene locus_tag LOCUS_53770 35386 35793 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528197.1 protein_id gnl|my_center|LOCUS_53770 36183 37331 gene locus_tag LOCUS_53780 36183 37331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 37474 39051 gene locus_tag LOCUS_53790 37474 39051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 39070 39381 gene locus_tag LOCUS_53800 39070 39381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 40597 39620 gene locus_tag LOCUS_53810 40597 39620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_53810 40796 41377 gene locus_tag LOCUS_53820 40796 41377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 41390 43048 gene locus_tag LOCUS_53830 gene ggt 41390 43048 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231470.1 protein_id gnl|my_center|LOCUS_53830 43151 43558 gene locus_tag LOCUS_53840 43151 43558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 43574 44395 gene locus_tag LOCUS_53850 43574 44395 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_53850 44466 46184 gene locus_tag LOCUS_53860 44466 46184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 46397 46894 gene locus_tag LOCUS_53870 46397 46894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 46891 47319 gene locus_tag LOCUS_53880 46891 47319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 47443 48111 gene locus_tag LOCUS_53890 47443 48111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 48108 48674 gene locus_tag LOCUS_53900 48108 48674 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_53900 48759 49649 gene locus_tag LOCUS_53910 48759 49649 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406212.1 protein_id gnl|my_center|LOCUS_53910 50054 52687 gene locus_tag LOCUS_53920 50054 52687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_53920 52775 53107 gene locus_tag LOCUS_53930 52775 53107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 53168 55795 gene locus_tag LOCUS_53940 53168 55795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_53940 57336 56008 gene locus_tag LOCUS_53950 57336 56008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 58486 57569 gene locus_tag LOCUS_53960 58486 57569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 59261 60013 gene locus_tag LOCUS_53970 59261 60013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 60164 61588 gene locus_tag LOCUS_53980 60164 61588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 61627 62259 gene locus_tag LOCUS_53990 61627 62259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53990 62338 63048 gene locus_tag LOCUS_54000 62338 63048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 63433 65472 gene locus_tag LOCUS_54010 63433 65472 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144228.1 protein_id gnl|my_center|LOCUS_54010 66261 65677 gene locus_tag LOCUS_54020 66261 65677 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_54020 66469 67356 gene locus_tag LOCUS_54030 gene rpoE 66469 67356 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_54030 67402 68229 gene locus_tag LOCUS_54040 67402 68229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 68286 69323 gene locus_tag LOCUS_54050 68286 69323 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060935.1 protein_id gnl|my_center|LOCUS_54050 69370 69630 gene locus_tag LOCUS_54060 69370 69630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 70520 72964 gene locus_tag LOCUS_54070 70520 72964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_54070 73850 74272 gene locus_tag LOCUS_54080 73850 74272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 75350 74451 gene locus_tag LOCUS_54090 75350 74451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 76072 75494 gene locus_tag LOCUS_54100 76072 75494 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_54100 76852 76097 gene locus_tag LOCUS_54110 76852 76097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 78334 77213 gene locus_tag LOCUS_54120 78334 77213 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_54120 79901 78609 gene locus_tag LOCUS_54130 79901 78609 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975891.1 protein_id gnl|my_center|LOCUS_54130 80433 79930 gene locus_tag LOCUS_54140 80433 79930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 81040 80441 gene locus_tag LOCUS_54150 81040 80441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 82036 81062 gene locus_tag LOCUS_54160 82036 81062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 83692 82331 gene locus_tag LOCUS_54170 83692 82331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 85397 83850 gene locus_tag LOCUS_54180 85397 83850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 86090 85500 gene locus_tag LOCUS_54190 86090 85500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 87257 86739 gene locus_tag LOCUS_54200 87257 86739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 87855 87412 gene locus_tag LOCUS_54210 87855 87412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 88670 87927 gene locus_tag LOCUS_54220 88670 87927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 89313 88816 gene locus_tag LOCUS_54230 89313 88816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 90205 89390 gene locus_tag LOCUS_54240 90205 89390 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_54240 90748 90296 gene locus_tag LOCUS_54250 90748 90296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 91698 91024 gene locus_tag LOCUS_54260 91698 91024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 92386 91823 gene locus_tag LOCUS_54270 92386 91823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 95039 92613 gene locus_tag LOCUS_54280 gene galB 95039 92613 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_54280 96029 95136 gene locus_tag LOCUS_54290 96029 95136 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_54290 97055 96288 gene locus_tag LOCUS_54300 97055 96288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 97678 97205 gene locus_tag LOCUS_54310 97678 97205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 98208 97843 gene locus_tag LOCUS_54320 98208 97843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 99739 98360 gene locus_tag LOCUS_54330 99739 98360 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001443162.1 protein_id gnl|my_center|LOCUS_54330 >Feature sequence045 365 1270 gene locus_tag LOCUS_54340 gene rlmF 365 1270 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666006.1 protein_id gnl|my_center|LOCUS_54340 1332 1643 gene locus_tag LOCUS_54350 1332 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 1630 2307 gene locus_tag LOCUS_54360 1630 2307 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_54360 2410 2937 gene locus_tag LOCUS_54370 2410 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 3023 4432 gene locus_tag LOCUS_54380 gene pepQ 3023 4432 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_54380 4508 4885 gene locus_tag LOCUS_54390 4508 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 4887 7484 gene locus_tag LOCUS_54400 4887 7484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_54400 8964 7531 gene locus_tag LOCUS_54410 8964 7531 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_54410 9750 9193 gene locus_tag LOCUS_54420 9750 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 10191 9946 gene locus_tag LOCUS_54430 10191 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 11030 10437 gene locus_tag LOCUS_54440 11030 10437 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_54440 11840 11280 gene locus_tag LOCUS_54450 11840 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 12103 13233 gene locus_tag LOCUS_54460 12103 13233 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_54460 13478 14209 gene locus_tag LOCUS_54470 13478 14209 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_54470 14933 14220 gene locus_tag LOCUS_54480 gene pyrH 14933 14220 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_54480 15880 15050 gene locus_tag LOCUS_54490 gene tsf 15880 15050 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_54490 16653 15928 gene locus_tag LOCUS_54500 gene rpsB 16653 15928 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_54500 17090 16704 gene locus_tag LOCUS_54510 gene rpsI 17090 16704 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109004.1 protein_id gnl|my_center|LOCUS_54510 17553 17110 gene locus_tag LOCUS_54520 gene rplM 17553 17110 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902658.1 protein_id gnl|my_center|LOCUS_54520 18219 18608 gene locus_tag LOCUS_54530 18219 18608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 19376 18615 gene locus_tag LOCUS_54540 19376 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 20795 19485 gene locus_tag LOCUS_54550 20795 19485 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_54550 21235 23637 gene locus_tag LOCUS_54560 21235 23637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_54560 23887 24954 gene locus_tag LOCUS_54570 gene fni 23887 24954 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599487.1 protein_id gnl|my_center|LOCUS_54570 24951 26273 gene locus_tag LOCUS_54580 24951 26273 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_54580 26503 27474 gene locus_tag LOCUS_54590 26503 27474 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_54590 28204 27788 gene locus_tag LOCUS_54600 28204 27788 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_54600 31578 28363 gene locus_tag LOCUS_54610 31578 28363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_54610 31936 32364 gene locus_tag LOCUS_54620 31936 32364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 32399 33028 gene locus_tag LOCUS_54630 32399 33028 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918963.1 protein_id gnl|my_center|LOCUS_54630 33041 33466 gene locus_tag LOCUS_54640 33041 33466 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_54640 33671 34717 gene locus_tag LOCUS_54650 33671 34717 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_54650 34833 35153 gene locus_tag LOCUS_54660 34833 35153 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_54660 35164 35565 gene locus_tag LOCUS_54670 35164 35565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 35740 36927 gene locus_tag LOCUS_54680 35740 36927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 37042 39264 gene locus_tag LOCUS_54690 37042 39264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 39810 40163 gene locus_tag LOCUS_54700 39810 40163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 40178 41026 gene locus_tag LOCUS_54710 gene mutM 40178 41026 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989743.1 protein_id gnl|my_center|LOCUS_54710 40914 41903 gene locus_tag LOCUS_54720 40914 41903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 42003 42764 gene locus_tag LOCUS_54730 42003 42764 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208285.1 protein_id gnl|my_center|LOCUS_54730 42764 43834 gene locus_tag LOCUS_54740 42764 43834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 43897 44769 gene locus_tag LOCUS_54750 43897 44769 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_54750 44962 45771 gene locus_tag LOCUS_54760 44962 45771 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_54760 45898 46527 gene locus_tag LOCUS_54770 45898 46527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 47452 46679 gene locus_tag LOCUS_54780 47452 46679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 47770 48969 gene locus_tag LOCUS_54790 47770 48969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 49215 50351 gene locus_tag LOCUS_54800 49215 50351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 50935 51306 gene locus_tag LOCUS_54810 50935 51306 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_54810 51299 51769 gene locus_tag LOCUS_54820 51299 51769 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808562.1 protein_id gnl|my_center|LOCUS_54820 51878 52177 gene locus_tag LOCUS_54830 51878 52177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 52486 53178 gene locus_tag LOCUS_54840 52486 53178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 53183 54301 gene locus_tag LOCUS_54850 53183 54301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 54594 55043 gene locus_tag LOCUS_54860 54594 55043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 56193 55045 gene locus_tag LOCUS_54870 56193 55045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 56463 57077 gene locus_tag LOCUS_54880 56463 57077 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378149.1 protein_id gnl|my_center|LOCUS_54880 57248 57775 gene locus_tag LOCUS_54890 57248 57775 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_54890 57772 58575 gene locus_tag LOCUS_54900 57772 58575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 58700 59572 gene locus_tag LOCUS_54910 58700 59572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 59632 60438 gene locus_tag LOCUS_54920 59632 60438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 61118 60648 gene locus_tag LOCUS_54930 61118 60648 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338413.1 protein_id gnl|my_center|LOCUS_54930 61819 62199 gene locus_tag LOCUS_54940 61819 62199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 62380 63237 gene locus_tag LOCUS_54950 62380 63237 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_54950 63269 64081 gene locus_tag LOCUS_54960 63269 64081 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_54960 66038 64236 gene locus_tag LOCUS_54970 66038 64236 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_54970 66231 67580 gene locus_tag LOCUS_54980 66231 67580 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_54980 67725 69674 gene locus_tag LOCUS_54990 67725 69674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 69843 71033 gene locus_tag LOCUS_55000 69843 71033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 74995 71189 gene locus_tag LOCUS_55010 74995 71189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 79398 75340 gene locus_tag LOCUS_55020 79398 75340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 85323 79720 gene locus_tag LOCUS_55030 85323 79720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 89496 85468 gene locus_tag LOCUS_55040 89496 85468 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_55040 >Feature sequence046 370 2301 gene locus_tag LOCUS_55050 370 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 3892 2372 gene locus_tag LOCUS_55060 3892 2372 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_55060 4609 4133 gene locus_tag LOCUS_55070 4609 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 4787 6031 gene locus_tag LOCUS_55080 4787 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 6038 6769 gene locus_tag LOCUS_55090 6038 6769 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_55090 8174 7359 gene locus_tag LOCUS_55100 8174 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 9012 8239 gene locus_tag LOCUS_55110 9012 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 9846 9076 gene locus_tag LOCUS_55120 9846 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 10382 9843 gene locus_tag LOCUS_55130 10382 9843 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_55130 12643 10868 gene locus_tag LOCUS_55140 12643 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 14169 13105 gene locus_tag LOCUS_55150 14169 13105 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_55150 15347 14262 gene locus_tag LOCUS_55160 15347 14262 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_55160 17017 15512 gene locus_tag LOCUS_55170 17017 15512 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919376.1 protein_id gnl|my_center|LOCUS_55170 17867 17082 gene locus_tag LOCUS_55180 17867 17082 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397463.1 protein_id gnl|my_center|LOCUS_55180 18144 19196 gene locus_tag LOCUS_55190 18144 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 19259 19654 gene locus_tag LOCUS_55200 19259 19654 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_55200 21350 19830 gene locus_tag LOCUS_55210 21350 19830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 21457 21912 gene locus_tag LOCUS_55220 21457 21912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 22233 22015 gene locus_tag LOCUS_55230 22233 22015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 22998 22600 gene locus_tag LOCUS_55240 22998 22600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 23181 24143 gene locus_tag LOCUS_55250 23181 24143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 24227 25546 gene locus_tag LOCUS_55260 24227 25546 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760358.1 protein_id gnl|my_center|LOCUS_55260 25761 25609 gene locus_tag LOCUS_55270 25761 25609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 26021 26497 gene locus_tag LOCUS_55280 26021 26497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 26743 28410 gene locus_tag LOCUS_55290 26743 28410 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990061.1 protein_id gnl|my_center|LOCUS_55290 28535 29413 gene locus_tag LOCUS_55300 28535 29413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 29513 30940 gene locus_tag LOCUS_55310 29513 30940 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_55310 30944 31984 gene locus_tag LOCUS_55320 30944 31984 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_55320 31981 32688 gene locus_tag LOCUS_55330 31981 32688 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_55330 32810 33703 gene locus_tag LOCUS_55340 32810 33703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 33788 35041 gene locus_tag LOCUS_55350 33788 35041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 36749 35298 gene locus_tag LOCUS_55360 36749 35298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 37250 36756 gene locus_tag LOCUS_55370 37250 36756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 40838 37695 gene locus_tag LOCUS_55380 40838 37695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 41227 40841 gene locus_tag LOCUS_55390 41227 40841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 42629 41370 gene locus_tag LOCUS_55400 42629 41370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 43247 47374 gene locus_tag LOCUS_55410 43247 47374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 47564 54844 gene locus_tag LOCUS_55420 47564 54844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 55050 60764 gene locus_tag LOCUS_55430 55050 60764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 61539 61246 gene locus_tag LOCUS_55440 61539 61246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 61502 65578 gene locus_tag LOCUS_55450 61502 65578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 65768 73117 gene locus_tag LOCUS_55460 65768 73117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 73372 79128 gene locus_tag LOCUS_55470 73372 79128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 80447 84583 gene locus_tag LOCUS_55480 80447 84583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 >Feature sequence047 192 1070 gene locus_tag LOCUS_55490 192 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 1704 2216 gene locus_tag LOCUS_55500 1704 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 2311 3930 gene locus_tag LOCUS_55510 2311 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 4205 5278 gene locus_tag LOCUS_55520 4205 5278 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346255.1 protein_id gnl|my_center|LOCUS_55520 5364 6152 gene locus_tag LOCUS_55530 5364 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 7228 6440 gene locus_tag LOCUS_55540 7228 6440 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 protein_id gnl|my_center|LOCUS_55540 7789 8319 gene locus_tag LOCUS_55550 7789 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 8421 9209 gene locus_tag LOCUS_55560 8421 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 11219 9363 gene locus_tag LOCUS_55570 11219 9363 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085117.1 protein_id gnl|my_center|LOCUS_55570 12188 11238 gene locus_tag LOCUS_55580 12188 11238 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_55580 12443 12700 gene locus_tag LOCUS_55590 12443 12700 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_55590 12723 14402 gene locus_tag LOCUS_55600 12723 14402 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_55600 14437 15405 gene locus_tag LOCUS_55610 14437 15405 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228724.1 protein_id gnl|my_center|LOCUS_55610 15477 15941 gene locus_tag LOCUS_55620 15477 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 15987 16457 gene locus_tag LOCUS_55630 15987 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 16860 16468 gene locus_tag LOCUS_55640 16860 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 17414 17001 gene locus_tag LOCUS_55650 17414 17001 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691774.1 protein_id gnl|my_center|LOCUS_55650 18817 17465 gene locus_tag LOCUS_55660 18817 17465 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946627.1 protein_id gnl|my_center|LOCUS_55660 20094 18814 gene locus_tag LOCUS_55670 gene kynU 20094 18814 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_55670 21170 20097 gene locus_tag LOCUS_55680 21170 20097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 21699 21178 gene locus_tag LOCUS_55690 21699 21178 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_55690 23197 21749 gene locus_tag LOCUS_55700 23197 21749 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_55700 23375 24130 gene locus_tag LOCUS_55710 23375 24130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 24187 24990 gene locus_tag LOCUS_55720 gene blaOXA 24187 24990 CDS product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246349.1 protein_id gnl|my_center|LOCUS_55720 25205 25762 gene locus_tag LOCUS_55730 25205 25762 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460612.1 protein_id gnl|my_center|LOCUS_55730 25765 27975 gene locus_tag LOCUS_55740 25765 27975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 28024 28494 gene locus_tag LOCUS_55750 28024 28494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 28505 29068 gene locus_tag LOCUS_55760 28505 29068 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704905.1 protein_id gnl|my_center|LOCUS_55760 29087 29707 gene locus_tag LOCUS_55770 29087 29707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 29712 30866 gene locus_tag LOCUS_55780 29712 30866 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184138029.1 protein_id gnl|my_center|LOCUS_55780 30874 31323 gene locus_tag LOCUS_55790 30874 31323 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225379.1 protein_id gnl|my_center|LOCUS_55790 31326 32108 gene locus_tag LOCUS_55800 31326 32108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 32264 33718 gene locus_tag LOCUS_55810 32264 33718 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615699.1 protein_id gnl|my_center|LOCUS_55810 33789 34028 gene locus_tag LOCUS_55820 33789 34028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 36781 34154 gene locus_tag LOCUS_55830 36781 34154 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_55830 37104 36778 gene locus_tag LOCUS_55840 37104 36778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 37439 37726 gene locus_tag LOCUS_55850 37439 37726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 37710 38441 gene locus_tag LOCUS_55860 37710 38441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 38469 39005 gene locus_tag LOCUS_55870 38469 39005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 39892 39002 gene locus_tag LOCUS_55880 39892 39002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 40600 39893 gene locus_tag LOCUS_55890 40600 39893 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_55890 41704 40610 gene locus_tag LOCUS_55900 41704 40610 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_55900 43571 41718 gene locus_tag LOCUS_55910 43571 41718 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_55910 43686 44222 gene locus_tag LOCUS_55920 43686 44222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 44336 45874 gene locus_tag LOCUS_55930 44336 45874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 45882 46709 gene locus_tag LOCUS_55940 45882 46709 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114248.1 protein_id gnl|my_center|LOCUS_55940 46969 48093 gene locus_tag LOCUS_55950 46969 48093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 48099 49394 gene locus_tag LOCUS_55960 48099 49394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 49573 50235 gene locus_tag LOCUS_55970 49573 50235 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036990.1 protein_id gnl|my_center|LOCUS_55970 50213 50752 gene locus_tag LOCUS_55980 50213 50752 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267284.1 protein_id gnl|my_center|LOCUS_55980 50749 51426 gene locus_tag LOCUS_55990 gene mtnC 50749 51426 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167481.1 protein_id gnl|my_center|LOCUS_55990 53087 51471 gene locus_tag LOCUS_56000 53087 51471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 53366 54082 gene locus_tag LOCUS_56010 53366 54082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 54107 54871 gene locus_tag LOCUS_56020 54107 54871 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_56020 55077 56711 gene locus_tag LOCUS_56030 55077 56711 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_56030 56871 58001 gene locus_tag LOCUS_56040 56871 58001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 58134 61172 gene locus_tag LOCUS_56050 58134 61172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_56050 62715 61210 gene locus_tag LOCUS_56060 gene cysS 62715 61210 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_56060 63662 62811 gene locus_tag LOCUS_56070 63662 62811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 64871 63891 gene locus_tag LOCUS_56080 64871 63891 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_56080 65941 65144 gene locus_tag LOCUS_56090 65941 65144 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_56090 67975 66092 gene locus_tag LOCUS_56100 gene mutL 67975 66092 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_56100 68321 68007 gene locus_tag LOCUS_56110 68321 68007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 68668 70560 gene locus_tag LOCUS_56120 68668 70560 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_56120 71543 70653 gene locus_tag LOCUS_56130 71543 70653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 71914 71666 gene locus_tag LOCUS_56140 71914 71666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 73023 71926 gene locus_tag LOCUS_56150 73023 71926 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_56150 73426 74976 gene locus_tag LOCUS_56160 73426 74976 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_56160 75028 77874 gene locus_tag LOCUS_56170 75028 77874 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_56170 78003 78554 gene locus_tag LOCUS_56180 78003 78554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 78965 78603 gene locus_tag LOCUS_56190 78965 78603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 79133 79732 gene locus_tag LOCUS_56200 79133 79732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 79768 80658 gene locus_tag LOCUS_56210 79768 80658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 81160 80663 gene locus_tag LOCUS_56220 81160 80663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 81681 81268 gene locus_tag LOCUS_56230 81681 81268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 82515 81688 gene locus_tag LOCUS_56240 82515 81688 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225044.1 protein_id gnl|my_center|LOCUS_56240 85414 82619 gene locus_tag LOCUS_56250 gene polA 85414 82619 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_56250 86228 85506 gene locus_tag LOCUS_56260 86228 85506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56260 86512 86225 gene locus_tag LOCUS_56270 86512 86225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 87477 86611 gene locus_tag LOCUS_56280 87477 86611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 87693 87502 gene locus_tag LOCUS_56290 87693 87502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 88288 87701 gene locus_tag LOCUS_56300 88288 87701 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084757677.1 protein_id gnl|my_center|LOCUS_56300 >Feature sequence048 129 827 gene locus_tag LOCUS_56310 129 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 868 1809 gene locus_tag LOCUS_56320 868 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 1955 2899 gene locus_tag LOCUS_56330 1955 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 2912 4264 gene locus_tag LOCUS_56340 2912 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 4353 5069 gene locus_tag LOCUS_56350 4353 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 6274 5066 gene locus_tag LOCUS_56360 gene uxuA 6274 5066 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_56360 7399 6314 gene locus_tag LOCUS_56370 7399 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 7667 7900 gene locus_tag LOCUS_56380 7667 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 8673 7924 gene locus_tag LOCUS_56390 8673 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812228.1 protein_id gnl|my_center|LOCUS_56390 8934 10379 gene locus_tag LOCUS_56400 8934 10379 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640003.1 protein_id gnl|my_center|LOCUS_56400 11489 10443 gene locus_tag LOCUS_56410 11489 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 12673 11807 gene locus_tag LOCUS_56420 12673 11807 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_56420 12964 13584 gene locus_tag LOCUS_56430 12964 13584 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765767.1 protein_id gnl|my_center|LOCUS_56430 13601 14566 gene locus_tag LOCUS_56440 13601 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 14718 17423 gene locus_tag LOCUS_56450 14718 17423 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_56450 18426 17434 gene locus_tag LOCUS_56460 18426 17434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 19317 18478 gene locus_tag LOCUS_56470 19317 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 21065 19668 gene locus_tag LOCUS_56480 21065 19668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 21824 21081 gene locus_tag LOCUS_56490 21824 21081 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_56490 22064 23002 gene locus_tag LOCUS_56500 22064 23002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 23318 25792 gene locus_tag LOCUS_56510 23318 25792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 25816 27303 gene locus_tag LOCUS_56520 25816 27303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 27303 28292 gene locus_tag LOCUS_56530 27303 28292 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940962.1 protein_id gnl|my_center|LOCUS_56530 28318 29841 gene locus_tag LOCUS_56540 28318 29841 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_56540 31602 29959 gene locus_tag LOCUS_56550 31602 29959 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_56550 33285 31669 gene locus_tag LOCUS_56560 33285 31669 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404351.1 protein_id gnl|my_center|LOCUS_56560 36062 33435 gene locus_tag LOCUS_56570 36062 33435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 38855 36222 gene locus_tag LOCUS_56580 38855 36222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_56580 39178 38852 gene locus_tag LOCUS_56590 39178 38852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 40413 39376 gene locus_tag LOCUS_56600 40413 39376 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 protein_id gnl|my_center|LOCUS_56600 40711 43149 gene locus_tag LOCUS_56610 40711 43149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_56610 43710 46904 gene locus_tag LOCUS_56620 43710 46904 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_56620 46923 48380 gene locus_tag LOCUS_56630 46923 48380 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_56630 48396 48881 gene locus_tag LOCUS_56640 48396 48881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 48973 49551 gene locus_tag LOCUS_56650 48973 49551 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383225.1 protein_id gnl|my_center|LOCUS_56650 49560 50210 gene locus_tag LOCUS_56660 49560 50210 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383225.1 protein_id gnl|my_center|LOCUS_56660 50353 51474 gene locus_tag LOCUS_56670 gene dctP 50353 51474 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_56670 51517 54837 gene locus_tag LOCUS_56680 51517 54837 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975826.1 protein_id gnl|my_center|LOCUS_56680 54849 57512 gene locus_tag LOCUS_56690 54849 57512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 60985 57836 gene locus_tag LOCUS_56700 60985 57836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 62768 60996 gene locus_tag LOCUS_56710 62768 60996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 63275 62832 gene locus_tag LOCUS_56720 63275 62832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 63778 63326 gene locus_tag LOCUS_56730 63778 63326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 64670 63912 gene locus_tag LOCUS_56740 64670 63912 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_56740 66329 64935 gene locus_tag LOCUS_56750 66329 64935 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_56750 66903 66418 gene locus_tag LOCUS_56760 66903 66418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 68063 66984 gene locus_tag LOCUS_56770 68063 66984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 68780 68310 gene locus_tag LOCUS_56780 68780 68310 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125205.1 protein_id gnl|my_center|LOCUS_56780 69333 68881 gene locus_tag LOCUS_56790 69333 68881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 71268 70021 gene locus_tag LOCUS_56800 gene hutI 71268 70021 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_56800 73033 71363 gene locus_tag LOCUS_56810 gene hutU 73033 71363 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_56810 74585 73011 gene locus_tag LOCUS_56820 gene hutH 74585 73011 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838340.1 protein_id gnl|my_center|LOCUS_56820 75448 74594 gene locus_tag LOCUS_56830 75448 74594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 77815 75551 gene locus_tag LOCUS_56840 77815 75551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_56840 79226 78123 gene locus_tag LOCUS_56850 79226 78123 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_56850 79569 80540 gene locus_tag LOCUS_56860 79569 80540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 80515 81234 gene locus_tag LOCUS_56870 80515 81234 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_56870 81455 82882 gene locus_tag LOCUS_56880 81455 82882 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_56880 >Feature sequence049 1031 216 gene locus_tag LOCUS_56890 1031 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 1337 3463 gene locus_tag LOCUS_56900 1337 3463 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_56900 3467 4486 gene locus_tag LOCUS_56910 3467 4486 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_56910 5401 4787 gene locus_tag LOCUS_56920 5401 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 protein_id gnl|my_center|LOCUS_56920 6314 5601 gene locus_tag LOCUS_56930 6314 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 6969 6766 gene locus_tag LOCUS_56940 6969 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 7322 8539 gene locus_tag LOCUS_56950 7322 8539 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_56950 11091 8839 gene locus_tag LOCUS_56960 11091 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 12695 11703 gene locus_tag LOCUS_56970 gene hemW 12695 11703 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_56970 13421 12888 gene locus_tag LOCUS_56980 13421 12888 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329360.1 protein_id gnl|my_center|LOCUS_56980 13556 14179 gene locus_tag LOCUS_56990 13556 14179 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894739.1 protein_id gnl|my_center|LOCUS_56990 17829 14245 gene locus_tag LOCUS_57000 17829 14245 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_57000 18794 17892 gene locus_tag LOCUS_57010 18794 17892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 protein_id gnl|my_center|LOCUS_57010 20273 19203 gene locus_tag LOCUS_57020 20273 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 20568 22280 gene locus_tag LOCUS_57030 20568 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 23404 22466 gene locus_tag LOCUS_57040 23404 22466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 24061 23408 gene locus_tag LOCUS_57050 24061 23408 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_57050 24863 24291 gene locus_tag LOCUS_57060 24863 24291 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_57060 25790 25011 gene locus_tag LOCUS_57070 25790 25011 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_57070 26349 25948 gene locus_tag LOCUS_57080 gene mce 26349 25948 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_57080 28755 26455 gene locus_tag LOCUS_57090 28755 26455 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_57090 29695 28760 gene locus_tag LOCUS_57100 29695 28760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 30659 29853 gene locus_tag LOCUS_57110 30659 29853 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_57110 31616 30822 gene locus_tag LOCUS_57120 31616 30822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 32862 32080 gene locus_tag LOCUS_57130 gene cysQ 32862 32080 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_57130 33018 34049 gene locus_tag LOCUS_57140 gene galE 33018 34049 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_57140 34066 35988 gene locus_tag LOCUS_57150 34066 35988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 37723 36137 gene locus_tag LOCUS_57160 37723 36137 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_57160 38242 37805 gene locus_tag LOCUS_57170 38242 37805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 38585 40384 gene locus_tag LOCUS_57180 gene uvrC 38585 40384 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_57180 40387 41199 gene locus_tag LOCUS_57190 gene hutG 40387 41199 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095940.1 protein_id gnl|my_center|LOCUS_57190 41196 42572 gene locus_tag LOCUS_57200 41196 42572 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389057.1 protein_id gnl|my_center|LOCUS_57200 43465 42695 gene locus_tag LOCUS_57210 43465 42695 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_57210 45605 43479 gene locus_tag LOCUS_57220 gene scpA 45605 43479 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_57220 46170 46931 gene locus_tag LOCUS_57230 46170 46931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 47715 46966 gene locus_tag LOCUS_57240 47715 46966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 48517 49704 gene locus_tag LOCUS_57250 48517 49704 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_57250 50805 49882 gene locus_tag LOCUS_57260 50805 49882 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_57260 50899 51402 gene locus_tag LOCUS_57270 50899 51402 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_57270 52685 51507 gene locus_tag LOCUS_57280 52685 51507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_57280 53381 52698 gene locus_tag LOCUS_57290 53381 52698 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_57290 54685 53480 gene locus_tag LOCUS_57300 54685 53480 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_57300 55973 54768 gene locus_tag LOCUS_57310 55973 54768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_57310 56840 56067 gene locus_tag LOCUS_57320 56840 56067 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_57320 57502 56903 gene locus_tag LOCUS_57330 57502 56903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 57808 58764 gene locus_tag LOCUS_57340 gene metF 57808 58764 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_57340 58777 61317 gene locus_tag LOCUS_57350 58777 61317 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_57350 61783 64917 gene locus_tag LOCUS_57360 61783 64917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 65124 66584 gene locus_tag LOCUS_57370 gene dacB 65124 66584 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_57370 66791 67510 gene locus_tag LOCUS_57380 66791 67510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 68885 67599 gene locus_tag LOCUS_57390 68885 67599 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_57390 69321 68968 gene locus_tag LOCUS_57400 69321 68968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 69799 69341 gene locus_tag LOCUS_57410 69799 69341 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_57410 72470 70245 gene locus_tag LOCUS_57420 72470 70245 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_57420 72835 72919 gene locus_tag LOCUS_t00310 72835 72919 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 73055 74461 gene locus_tag LOCUS_57430 gene tig 73055 74461 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_57430 74630 75340 gene locus_tag LOCUS_57440 gene clpP 74630 75340 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_57440 75511 76758 gene locus_tag LOCUS_57450 gene clpX 75511 76758 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_57450 76765 77505 gene locus_tag LOCUS_57460 gene truA 76765 77505 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_57460 78398 77502 gene locus_tag LOCUS_57470 78398 77502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 78557 78772 gene locus_tag LOCUS_57480 78557 78772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 79097 80473 gene locus_tag LOCUS_57490 79097 80473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 >Feature sequence050 2555 2325 gene locus_tag LOCUS_57500 2555 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 2620 3000 gene locus_tag LOCUS_57510 2620 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 2997 3299 gene locus_tag LOCUS_57520 2997 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 3494 4744 gene locus_tag LOCUS_57530 3494 4744 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_57530 6725 4758 gene locus_tag LOCUS_57540 gene dnaG 6725 4758 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964171.1 protein_id gnl|my_center|LOCUS_57540 8047 7055 gene locus_tag LOCUS_57550 8047 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 8333 8022 gene locus_tag LOCUS_57560 gene yajC 8333 8022 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116168.1 protein_id gnl|my_center|LOCUS_57560 8905 8408 gene locus_tag LOCUS_57570 8905 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 9344 9871 gene locus_tag LOCUS_57580 9344 9871 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881430.1 protein_id gnl|my_center|LOCUS_57580 10052 13222 gene locus_tag LOCUS_57590 10052 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 13243 14631 gene locus_tag LOCUS_57600 13243 14631 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_57600 15379 14681 gene locus_tag LOCUS_57610 gene folE 15379 14681 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962795.1 protein_id gnl|my_center|LOCUS_57610 15508 16032 gene locus_tag LOCUS_57620 15508 16032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 16579 17976 gene locus_tag LOCUS_57630 gene lpdA 16579 17976 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_57630 19326 18028 gene locus_tag LOCUS_57640 19326 18028 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_57640 21558 19369 gene locus_tag LOCUS_57650 21558 19369 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_57650 21895 22848 gene locus_tag LOCUS_57660 21895 22848 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994177.1 protein_id gnl|my_center|LOCUS_57660 23029 23646 gene locus_tag LOCUS_57670 23029 23646 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_57670 23661 24314 gene locus_tag LOCUS_57680 23661 24314 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_57680 25996 24452 gene locus_tag LOCUS_57690 25996 24452 CDS product IS1182-like element ISBf5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203619.1 protein_id gnl|my_center|LOCUS_57690 26981 26082 gene locus_tag LOCUS_57700 26981 26082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 28165 27065 gene locus_tag LOCUS_57710 28165 27065 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_57710 28886 28347 gene locus_tag LOCUS_57720 28886 28347 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395060.1 protein_id gnl|my_center|LOCUS_57720 29930 28995 gene locus_tag LOCUS_57730 gene mdh 29930 28995 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_57730 30227 31780 gene locus_tag LOCUS_57740 30227 31780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 31958 33166 gene locus_tag LOCUS_57750 gene sucC 31958 33166 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_57750 34696 33239 gene locus_tag LOCUS_57760 34696 33239 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 protein_id gnl|my_center|LOCUS_57760 34983 35600 gene locus_tag LOCUS_57770 34983 35600 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_57770 35634 37358 gene locus_tag LOCUS_57780 35634 37358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 38595 37525 gene locus_tag LOCUS_57790 38595 37525 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_57790 38988 40766 gene locus_tag LOCUS_57800 gene sppA 38988 40766 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_57800 41412 40840 gene locus_tag LOCUS_57810 41412 40840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 41782 42465 gene locus_tag LOCUS_57820 41782 42465 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_57820 42667 43473 gene locus_tag LOCUS_57830 42667 43473 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_57830 43573 44487 gene locus_tag LOCUS_57840 43573 44487 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_57840 44491 45072 gene locus_tag LOCUS_57850 44491 45072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 45557 46930 gene locus_tag LOCUS_57860 45557 46930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 48249 47158 gene locus_tag LOCUS_57870 48249 47158 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_57870 48368 48817 gene locus_tag LOCUS_57880 48368 48817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 48891 49472 gene locus_tag LOCUS_57890 48891 49472 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_57890 49631 50737 gene locus_tag LOCUS_57900 49631 50737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 50741 51001 gene locus_tag LOCUS_57910 50741 51001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 51270 51539 gene locus_tag LOCUS_57920 gene groES 51270 51539 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_57920 51603 53240 gene locus_tag LOCUS_57930 gene groL 51603 53240 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_57930 54419 53571 gene locus_tag LOCUS_57940 54419 53571 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_57940 54555 54779 gene locus_tag LOCUS_57950 54555 54779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 56093 54789 gene locus_tag LOCUS_57960 56093 54789 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963042.1 protein_id gnl|my_center|LOCUS_57960 56824 56180 gene locus_tag LOCUS_57970 56824 56180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 63275 57141 gene locus_tag LOCUS_57980 63275 57141 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_57980 64453 63410 gene locus_tag LOCUS_57990 64453 63410 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_57990 64813 64457 gene locus_tag LOCUS_58000 64813 64457 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_58000 66508 64988 gene locus_tag LOCUS_58010 66508 64988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 67560 66517 gene locus_tag LOCUS_58020 67560 66517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 68693 67614 gene locus_tag LOCUS_58030 68693 67614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 69315 70994 gene locus_tag LOCUS_58040 69315 70994 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_58040 72242 71448 gene locus_tag LOCUS_58050 72242 71448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 72766 72299 gene locus_tag LOCUS_58060 72766 72299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 74173 73544 gene locus_tag LOCUS_58070 74173 73544 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 protein_id gnl|my_center|LOCUS_58070 74364 75806 gene locus_tag LOCUS_58080 74364 75806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 75850 76032 gene locus_tag LOCUS_58090 75850 76032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 76339 76010 gene locus_tag LOCUS_58100 76339 76010 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_58100 76578 76336 gene locus_tag LOCUS_58110 76578 76336 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_58110 79046 76665 gene locus_tag LOCUS_58120 79046 76665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_58120 79490 80020 gene locus_tag LOCUS_58130 79490 80020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 >Feature sequence051 1291 188 gene locus_tag LOCUS_58140 1291 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 2178 1393 gene locus_tag LOCUS_58150 2178 1393 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458575.1 protein_id gnl|my_center|LOCUS_58150 2403 4640 gene locus_tag LOCUS_58160 2403 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 7969 4685 gene locus_tag LOCUS_58170 7969 4685 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073269.1 protein_id gnl|my_center|LOCUS_58170 9135 8020 gene locus_tag LOCUS_58180 9135 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 9529 9140 gene locus_tag LOCUS_58190 9529 9140 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356374.1 protein_id gnl|my_center|LOCUS_58190 11099 9531 gene locus_tag LOCUS_58200 11099 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 11300 11551 gene locus_tag LOCUS_58210 11300 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 13667 11712 gene locus_tag LOCUS_58220 13667 11712 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409258.1 protein_id gnl|my_center|LOCUS_58220 16263 13861 gene locus_tag LOCUS_58230 16263 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 18584 16269 gene locus_tag LOCUS_58240 18584 16269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 19357 18758 gene locus_tag LOCUS_58250 19357 18758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 19851 19363 gene locus_tag LOCUS_58260 19851 19363 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_58260 21683 20052 gene locus_tag LOCUS_58270 21683 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 22460 22008 gene locus_tag LOCUS_58280 22460 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 22759 22481 gene locus_tag LOCUS_58290 22759 22481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 23407 22847 gene locus_tag LOCUS_58300 23407 22847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 23841 23428 gene locus_tag LOCUS_58310 23841 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 25032 23968 gene locus_tag LOCUS_58320 25032 23968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 26369 25143 gene locus_tag LOCUS_58330 26369 25143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 27488 26376 gene locus_tag LOCUS_58340 27488 26376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 28560 27700 gene locus_tag LOCUS_58350 28560 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 28731 29264 gene locus_tag LOCUS_58360 28731 29264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 31612 29336 gene locus_tag LOCUS_58370 31612 29336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 32364 31672 gene locus_tag LOCUS_58380 32364 31672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_58380 32810 32397 gene locus_tag LOCUS_58390 32810 32397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 34034 33195 gene locus_tag LOCUS_58400 34034 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 34866 34045 gene locus_tag LOCUS_58410 34866 34045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58410 35910 34996 gene locus_tag LOCUS_58420 35910 34996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 37408 37148 gene locus_tag LOCUS_58430 37408 37148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 39409 38510 gene locus_tag LOCUS_58440 39409 38510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 39608 40042 gene locus_tag LOCUS_58450 39608 40042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 40354 41442 gene locus_tag LOCUS_58460 40354 41442 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_58460 41541 43049 gene locus_tag LOCUS_58470 41541 43049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 45659 43092 gene locus_tag LOCUS_58480 45659 43092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_58480 45975 45646 gene locus_tag LOCUS_58490 45975 45646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 47101 46112 gene locus_tag LOCUS_58500 gene add 47101 46112 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 protein_id gnl|my_center|LOCUS_58500 47342 47205 gene locus_tag LOCUS_58510 47342 47205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 49455 47356 gene locus_tag LOCUS_58520 49455 47356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 49955 49461 gene locus_tag LOCUS_58530 49955 49461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 52708 50072 gene locus_tag LOCUS_58540 52708 50072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 53103 54953 gene locus_tag LOCUS_58550 53103 54953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 54964 55725 gene locus_tag LOCUS_58560 54964 55725 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_58560 56395 55730 gene locus_tag LOCUS_58570 gene pdeM 56395 55730 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_58570 59024 56577 gene locus_tag LOCUS_58580 59024 56577 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921429.1 protein_id gnl|my_center|LOCUS_58580 60288 59146 gene locus_tag LOCUS_58590 60288 59146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 60468 62231 gene locus_tag LOCUS_58600 60468 62231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 62289 62843 gene locus_tag LOCUS_58610 62289 62843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 62824 64176 gene locus_tag LOCUS_58620 62824 64176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 64476 65081 gene locus_tag LOCUS_58630 64476 65081 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_58630 65092 65424 gene locus_tag LOCUS_58640 65092 65424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 65501 67318 gene locus_tag LOCUS_58650 65501 67318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 67350 68105 gene locus_tag LOCUS_58660 67350 68105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 68344 69315 gene locus_tag LOCUS_58670 68344 69315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 69455 70270 gene locus_tag LOCUS_58680 69455 70270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 70636 71364 gene locus_tag LOCUS_58690 70636 71364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 71721 72335 gene locus_tag LOCUS_58700 71721 72335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 73101 72508 gene locus_tag LOCUS_58710 73101 72508 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107536.1 protein_id gnl|my_center|LOCUS_58710 73959 73357 gene locus_tag LOCUS_58720 73959 73357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 75634 74354 gene locus_tag LOCUS_58730 75634 74354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 76217 75675 gene locus_tag LOCUS_58740 76217 75675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 77266 76763 gene locus_tag LOCUS_58750 77266 76763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 77508 80033 gene locus_tag LOCUS_58760 77508 80033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 >Feature sequence052 390 1601 gene locus_tag LOCUS_58770 390 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 1604 2167 gene locus_tag LOCUS_58780 1604 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 3553 2222 gene locus_tag LOCUS_58790 3553 2222 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_58790 3663 4322 gene locus_tag LOCUS_58800 3663 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 5460 5110 gene locus_tag LOCUS_58810 5460 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 7445 5781 gene locus_tag LOCUS_58820 7445 5781 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869266.1 protein_id gnl|my_center|LOCUS_58820 8020 7466 gene locus_tag LOCUS_58830 8020 7466 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968864.1 protein_id gnl|my_center|LOCUS_58830 8019 8219 gene locus_tag LOCUS_58840 8019 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 8967 8164 gene locus_tag LOCUS_58850 8967 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 9520 10941 gene locus_tag LOCUS_58860 9520 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 11119 14349 gene locus_tag LOCUS_58870 11119 14349 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_58870 16588 14390 gene locus_tag LOCUS_58880 16588 14390 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919029.1 protein_id gnl|my_center|LOCUS_58880 16844 17392 gene locus_tag LOCUS_58890 16844 17392 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_58890 17395 18258 gene locus_tag LOCUS_58900 17395 18258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 18453 18809 gene locus_tag LOCUS_58910 18453 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 18942 20075 gene locus_tag LOCUS_58920 18942 20075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 21288 20140 gene locus_tag LOCUS_58930 21288 20140 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_58930 21887 21345 gene locus_tag LOCUS_58940 21887 21345 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076327.1 protein_id gnl|my_center|LOCUS_58940 22227 21901 gene locus_tag LOCUS_58950 22227 21901 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_58950 22852 22304 gene locus_tag LOCUS_58960 22852 22304 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_58960 23797 23108 gene locus_tag LOCUS_58970 23797 23108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 25096 23801 gene locus_tag LOCUS_58980 25096 23801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 25943 25218 gene locus_tag LOCUS_58990 gene rluF 25943 25218 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_58990 26727 25945 gene locus_tag LOCUS_59000 gene speB 26727 25945 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_59000 27578 26724 gene locus_tag LOCUS_59010 27578 26724 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_59010 28115 27615 gene locus_tag LOCUS_59020 28115 27615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 28410 28135 gene locus_tag LOCUS_59030 28410 28135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 29216 28776 gene locus_tag LOCUS_59040 29216 28776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 29300 30850 gene locus_tag LOCUS_59050 29300 30850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 31595 30951 gene locus_tag LOCUS_59060 31595 30951 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818863.1 protein_id gnl|my_center|LOCUS_59060 33035 31824 gene locus_tag LOCUS_59070 33035 31824 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_59070 33430 33107 gene locus_tag LOCUS_59080 33430 33107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 34224 33658 gene locus_tag LOCUS_59090 34224 33658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 34625 34260 gene locus_tag LOCUS_59100 34625 34260 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922434.1 protein_id gnl|my_center|LOCUS_59100 36073 34682 gene locus_tag LOCUS_59110 36073 34682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 36455 37702 gene locus_tag LOCUS_59120 36455 37702 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972982.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59120 37745 37918 gene locus_tag LOCUS_59130 37745 37918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 38437 37931 gene locus_tag LOCUS_59140 38437 37931 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947340.1 protein_id gnl|my_center|LOCUS_59140 39041 38556 gene locus_tag LOCUS_59150 39041 38556 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_59150 39876 39043 gene locus_tag LOCUS_59160 39876 39043 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_59160 40670 40224 gene locus_tag LOCUS_59170 40670 40224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 41646 40783 gene locus_tag LOCUS_59180 41646 40783 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020663.1 protein_id gnl|my_center|LOCUS_59180 42662 41781 gene locus_tag LOCUS_59190 42662 41781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59190 43799 42789 gene locus_tag LOCUS_59200 43799 42789 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_59200 45740 43896 gene locus_tag LOCUS_59210 45740 43896 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_59210 45821 47308 gene locus_tag LOCUS_59220 45821 47308 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223535.1 protein_id gnl|my_center|LOCUS_59220 47332 47646 gene locus_tag LOCUS_59230 47332 47646 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582838.1 protein_id gnl|my_center|LOCUS_59230 47742 48206 gene locus_tag LOCUS_59240 gene smpB 47742 48206 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_59240 48349 49137 gene locus_tag LOCUS_59250 48349 49137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 51164 49488 gene locus_tag LOCUS_59260 51164 49488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 51714 51172 gene locus_tag LOCUS_59270 51714 51172 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_59270 51936 54563 gene locus_tag LOCUS_59280 51936 54563 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_59280 54638 55336 gene locus_tag LOCUS_59290 54638 55336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 55410 55922 gene locus_tag LOCUS_59300 55410 55922 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_59300 56152 57369 gene locus_tag LOCUS_59310 56152 57369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 57377 57712 gene locus_tag LOCUS_59320 57377 57712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 57805 58302 gene locus_tag LOCUS_59330 57805 58302 CDS product DUF6141 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093726791.1 protein_id gnl|my_center|LOCUS_59330 59781 58444 gene locus_tag LOCUS_59340 59781 58444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 60598 59783 gene locus_tag LOCUS_59350 60598 59783 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_59350 61939 60626 gene locus_tag LOCUS_59360 61939 60626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 62070 62945 gene locus_tag LOCUS_59370 62070 62945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 62958 64118 gene locus_tag LOCUS_59380 62958 64118 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_59380 64130 64546 gene locus_tag LOCUS_59390 64130 64546 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203080.1 protein_id gnl|my_center|LOCUS_59390 64558 64902 gene locus_tag LOCUS_59400 64558 64902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 64966 66180 gene locus_tag LOCUS_59410 64966 66180 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_59410 66507 66926 gene locus_tag LOCUS_59420 66507 66926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 67049 68467 gene locus_tag LOCUS_59430 gene putP 67049 68467 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_59430 69604 68513 gene locus_tag LOCUS_59440 69604 68513 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_59440 70213 69794 gene locus_tag LOCUS_59450 70213 69794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 70966 70376 gene locus_tag LOCUS_59460 70966 70376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 71790 70963 gene locus_tag LOCUS_59470 71790 70963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_59470 72612 72016 gene locus_tag LOCUS_59480 72612 72016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 73438 72632 gene locus_tag LOCUS_59490 73438 72632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 73662 74123 gene locus_tag LOCUS_59500 73662 74123 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_59500 74107 74760 gene locus_tag LOCUS_59510 74107 74760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 75884 74832 gene locus_tag LOCUS_59520 75884 74832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 76304 75888 gene locus_tag LOCUS_59530 76304 75888 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_59530 77221 76409 gene locus_tag LOCUS_59540 77221 76409 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_59540 78679 77228 gene locus_tag LOCUS_59550 78679 77228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 79487 78891 gene locus_tag LOCUS_59560 79487 78891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 >Feature sequence053 691 191 gene locus_tag LOCUS_59570 691 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 1316 753 gene locus_tag LOCUS_59580 1316 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 3494 1332 gene locus_tag LOCUS_59590 3494 1332 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071523.1 protein_id gnl|my_center|LOCUS_59590 3660 5780 gene locus_tag LOCUS_59600 3660 5780 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_59600 6590 6072 gene locus_tag LOCUS_59610 6590 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 7124 6663 gene locus_tag LOCUS_59620 7124 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 8294 10489 gene locus_tag LOCUS_59630 8294 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 10896 11459 gene locus_tag LOCUS_59640 10896 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 12294 11509 gene locus_tag LOCUS_59650 12294 11509 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391645.1 protein_id gnl|my_center|LOCUS_59650 12656 13462 gene locus_tag LOCUS_59660 12656 13462 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_59660 13455 14252 gene locus_tag LOCUS_59670 13455 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 14888 14469 gene locus_tag LOCUS_59680 14888 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 18055 15374 gene locus_tag LOCUS_59690 18055 15374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_59690 18381 18055 gene locus_tag LOCUS_59700 18381 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 19909 18527 gene locus_tag LOCUS_59710 19909 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 20911 20045 gene locus_tag LOCUS_59720 20911 20045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 21424 21804 gene locus_tag LOCUS_59730 21424 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 21955 22710 gene locus_tag LOCUS_59740 21955 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 22715 23359 gene locus_tag LOCUS_59750 22715 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 23597 23406 gene locus_tag LOCUS_59760 23597 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 23548 24774 gene locus_tag LOCUS_59770 23548 24774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 26307 25018 gene locus_tag LOCUS_59780 26307 25018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 33101 26526 gene locus_tag LOCUS_59790 33101 26526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 33513 34940 gene locus_tag LOCUS_59800 33513 34940 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 protein_id gnl|my_center|LOCUS_59800 35902 34937 gene locus_tag LOCUS_59810 35902 34937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 37289 36378 gene locus_tag LOCUS_59820 37289 36378 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_59820 37479 38723 gene locus_tag LOCUS_59830 37479 38723 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761527.1 protein_id gnl|my_center|LOCUS_59830 38838 39503 gene locus_tag LOCUS_59840 38838 39503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_59840 39514 40761 gene locus_tag LOCUS_59850 39514 40761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_59850 40758 41927 gene locus_tag LOCUS_59860 40758 41927 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_59860 41997 43358 gene locus_tag LOCUS_59870 41997 43358 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_59870 43542 44840 gene locus_tag LOCUS_59880 43542 44840 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_59880 46332 44881 gene locus_tag LOCUS_59890 46332 44881 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_59890 47886 46480 gene locus_tag LOCUS_59900 47886 46480 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_59900 49676 47883 gene locus_tag LOCUS_59910 49676 47883 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_59910 50185 49679 gene locus_tag LOCUS_59920 50185 49679 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_59920 50360 51268 gene locus_tag LOCUS_59930 gene xerD 50360 51268 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_59930 51360 52991 gene locus_tag LOCUS_59940 51360 52991 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_59940 53328 54503 gene locus_tag LOCUS_59950 53328 54503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 54602 54988 gene locus_tag LOCUS_59960 54602 54988 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038312.1 protein_id gnl|my_center|LOCUS_59960 54985 57408 gene locus_tag LOCUS_59970 54985 57408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 59205 57739 gene locus_tag LOCUS_59980 59205 57739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 59522 59758 gene locus_tag LOCUS_59990 59522 59758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 59902 60798 gene locus_tag LOCUS_60000 59902 60798 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_60000 61476 60820 gene locus_tag LOCUS_60010 61476 60820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 62216 63148 gene locus_tag LOCUS_60020 62216 63148 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_60020 63407 64036 gene locus_tag LOCUS_60030 63407 64036 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_60030 64149 64937 gene locus_tag LOCUS_60040 64149 64937 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_60040 65071 65577 gene locus_tag LOCUS_60050 65071 65577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 65869 66444 gene locus_tag LOCUS_60060 65869 66444 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_60060 66583 67593 gene locus_tag LOCUS_60070 gene obgE 66583 67593 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_60070 67633 69084 gene locus_tag LOCUS_60080 67633 69084 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_60080 71593 69320 gene locus_tag LOCUS_60090 71593 69320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 74349 71863 gene locus_tag LOCUS_60100 74349 71863 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_60100 75872 74616 gene locus_tag LOCUS_60110 75872 74616 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 protein_id gnl|my_center|LOCUS_60110 76551 75874 gene locus_tag LOCUS_60120 76551 75874 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_60120 76802 77533 gene locus_tag LOCUS_60130 76802 77533 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_60130 77612 78397 gene locus_tag LOCUS_60140 77612 78397 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_60140 >Feature sequence054 203 3196 gene locus_tag LOCUS_60150 203 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60150 3209 3835 gene locus_tag LOCUS_60160 3209 3835 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_60160 3943 4407 gene locus_tag LOCUS_60170 3943 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 5737 4451 gene locus_tag LOCUS_60180 5737 4451 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_60180 6174 7934 gene locus_tag LOCUS_60190 6174 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 8418 9329 gene locus_tag LOCUS_60200 8418 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440690.1 protein_id gnl|my_center|LOCUS_60200 10538 9516 gene locus_tag LOCUS_60210 10538 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 11209 10760 gene locus_tag LOCUS_60220 11209 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60220 11675 12964 gene locus_tag LOCUS_60230 11675 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 13751 13257 gene locus_tag LOCUS_60240 13751 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402939.1 protein_id gnl|my_center|LOCUS_60240 14688 13879 gene locus_tag LOCUS_60250 14688 13879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 15723 14923 gene locus_tag LOCUS_60260 15723 14923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 16816 16241 gene locus_tag LOCUS_60270 16816 16241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 17676 17056 gene locus_tag LOCUS_60280 17676 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 17911 20298 gene locus_tag LOCUS_60290 17911 20298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_60290 20425 20766 gene locus_tag LOCUS_60300 20425 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 20766 23372 gene locus_tag LOCUS_60310 20766 23372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_60310 24448 23462 gene locus_tag LOCUS_60320 24448 23462 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_60320 24758 24486 gene locus_tag LOCUS_60330 24758 24486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 28167 24859 gene locus_tag LOCUS_60340 28167 24859 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_60340 28356 28646 gene locus_tag LOCUS_60350 28356 28646 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_60350 28768 29181 gene locus_tag LOCUS_60360 28768 29181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 29184 30050 gene locus_tag LOCUS_60370 29184 30050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_60370 31639 30398 gene locus_tag LOCUS_60380 31639 30398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 32341 31808 gene locus_tag LOCUS_60390 32341 31808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 33541 32351 gene locus_tag LOCUS_60400 33541 32351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 34435 33611 gene locus_tag LOCUS_60410 34435 33611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 35777 34794 gene locus_tag LOCUS_60420 35777 34794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_60420 36125 36982 gene locus_tag LOCUS_60430 36125 36982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 37275 38498 gene locus_tag LOCUS_60440 37275 38498 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826550.1 protein_id gnl|my_center|LOCUS_60440 44435 39096 gene locus_tag LOCUS_60450 44435 39096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 45040 45474 gene locus_tag LOCUS_60460 45040 45474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 46346 45477 gene locus_tag LOCUS_60470 46346 45477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 48039 46396 gene locus_tag LOCUS_60480 48039 46396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 48185 48682 gene locus_tag LOCUS_60490 48185 48682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 49189 48749 gene locus_tag LOCUS_60500 49189 48749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 51065 49194 gene locus_tag LOCUS_60510 51065 49194 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_60510 53293 51197 gene locus_tag LOCUS_60520 53293 51197 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_60520 55845 53665 gene locus_tag LOCUS_60530 55845 53665 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_60530 57100 56627 gene locus_tag LOCUS_60540 57100 56627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 57128 57373 gene locus_tag LOCUS_60550 57128 57373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 57521 58555 gene locus_tag LOCUS_60560 57521 58555 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662662.1 protein_id gnl|my_center|LOCUS_60560 60095 58617 gene locus_tag LOCUS_60570 60095 58617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 61006 60251 gene locus_tag LOCUS_60580 61006 60251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_60580 61926 61138 gene locus_tag LOCUS_60590 61926 61138 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_60590 62420 61938 gene locus_tag LOCUS_60600 62420 61938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 63499 62417 gene locus_tag LOCUS_60610 63499 62417 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_60610 63898 63542 gene locus_tag LOCUS_60620 63898 63542 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_60620 64935 64087 gene locus_tag LOCUS_60630 gene panC 64935 64087 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_60630 65127 65942 gene locus_tag LOCUS_60640 65127 65942 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_60640 66217 67554 gene locus_tag LOCUS_60650 66217 67554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 67884 69722 gene locus_tag LOCUS_60660 gene glmS 67884 69722 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_60660 69779 70411 gene locus_tag LOCUS_60670 69779 70411 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_60670 70496 71806 gene locus_tag LOCUS_60680 gene murA 70496 71806 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_60680 71803 72105 gene locus_tag LOCUS_60690 71803 72105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 72323 73510 gene locus_tag LOCUS_60700 72323 73510 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_60700 73958 75121 gene locus_tag LOCUS_60710 73958 75121 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_60710 >Feature sequence055 305 658 gene locus_tag LOCUS_60720 305 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 1646 750 gene locus_tag LOCUS_60730 gene era 1646 750 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_60730 2333 1743 gene locus_tag LOCUS_60740 2333 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 3245 2484 gene locus_tag LOCUS_60750 3245 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 3332 3847 gene locus_tag LOCUS_60760 3332 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 4046 6541 gene locus_tag LOCUS_60770 4046 6541 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_60770 7353 6766 gene locus_tag LOCUS_60780 7353 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 7707 15392 gene locus_tag LOCUS_60790 7707 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60790 16309 15425 gene locus_tag LOCUS_60800 16309 15425 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_60800 16825 16397 gene locus_tag LOCUS_60810 16825 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 19480 18287 gene locus_tag LOCUS_60820 19480 18287 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_60820 20982 19780 gene locus_tag LOCUS_60830 20982 19780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_60830 22117 21389 gene locus_tag LOCUS_60840 22117 21389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 22758 24797 gene locus_tag LOCUS_60850 22758 24797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_60850 24907 25740 gene locus_tag LOCUS_60860 24907 25740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 25667 25831 gene locus_tag LOCUS_60870 25667 25831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 25856 26869 gene locus_tag LOCUS_60880 25856 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945959.1 protein_id gnl|my_center|LOCUS_60880 27653 26913 gene locus_tag LOCUS_60890 27653 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 28129 29283 gene locus_tag LOCUS_60900 28129 29283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 31050 29407 gene locus_tag LOCUS_60910 31050 29407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 31363 33630 gene locus_tag LOCUS_60920 31363 33630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_60920 35348 33792 gene locus_tag LOCUS_60930 35348 33792 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_60930 36115 35687 gene locus_tag LOCUS_60940 36115 35687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 37922 36243 gene locus_tag LOCUS_60950 37922 36243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_60950 38535 39554 gene locus_tag LOCUS_60960 gene fbp 38535 39554 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261083.1 protein_id gnl|my_center|LOCUS_60960 39839 39564 gene locus_tag LOCUS_60970 39839 39564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 40243 39851 gene locus_tag LOCUS_60980 40243 39851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 41491 40502 gene locus_tag LOCUS_60990 41491 40502 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_60990 42449 41496 gene locus_tag LOCUS_61000 42449 41496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 42809 42582 gene locus_tag LOCUS_61010 42809 42582 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464456.1 protein_id gnl|my_center|LOCUS_61010 43086 42874 gene locus_tag LOCUS_61020 43086 42874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 44901 43087 gene locus_tag LOCUS_61030 44901 43087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 46229 44931 gene locus_tag LOCUS_61040 46229 44931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61040 47274 46399 gene locus_tag LOCUS_61050 47274 46399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 47534 47962 gene locus_tag LOCUS_61060 47534 47962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 48543 49223 gene locus_tag LOCUS_61070 48543 49223 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_61070 51197 49215 gene locus_tag LOCUS_61080 51197 49215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 51658 51242 gene locus_tag LOCUS_61090 51658 51242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 51877 52248 gene locus_tag LOCUS_61100 51877 52248 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_61100 52245 53852 gene locus_tag LOCUS_61110 52245 53852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61110 54879 53899 gene locus_tag LOCUS_61120 gene egtD 54879 53899 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_61120 56328 55051 gene locus_tag LOCUS_61130 gene egtB 56328 55051 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146537106.1 protein_id gnl|my_center|LOCUS_61130 57488 56589 gene locus_tag LOCUS_61140 57488 56589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 59203 57881 gene locus_tag LOCUS_61150 59203 57881 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_61150 60043 59225 gene locus_tag LOCUS_61160 60043 59225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 61032 60151 gene locus_tag LOCUS_61170 61032 60151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61170 61889 61083 gene locus_tag LOCUS_61180 61889 61083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 62427 61900 gene locus_tag LOCUS_61190 62427 61900 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015938.1 protein_id gnl|my_center|LOCUS_61190 62634 65114 gene locus_tag LOCUS_61200 gene priA 62634 65114 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_61200 67471 65195 gene locus_tag LOCUS_61210 67471 65195 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_61210 68042 67575 gene locus_tag LOCUS_61220 68042 67575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 68252 69865 gene locus_tag LOCUS_61230 68252 69865 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_61230 70005 70379 gene locus_tag LOCUS_61240 70005 70379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61240 70442 70867 gene locus_tag LOCUS_61250 70442 70867 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070493.1 protein_id gnl|my_center|LOCUS_61250 >Feature sequence056 634 155 gene locus_tag LOCUS_61260 634 155 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_61260 801 1607 gene locus_tag LOCUS_61270 gene mscS 801 1607 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_61270 2279 1641 gene locus_tag LOCUS_61280 2279 1641 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_61280 3540 2797 gene locus_tag LOCUS_61290 3540 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 5441 3540 gene locus_tag LOCUS_61300 5441 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61300 5909 6208 gene locus_tag LOCUS_61310 5909 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 6392 6466 gene locus_tag LOCUS_t00320 6392 6466 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6843 8744 gene locus_tag LOCUS_61320 6843 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 8737 9354 gene locus_tag LOCUS_61330 8737 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 9516 9935 gene locus_tag LOCUS_61340 9516 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 9981 10982 gene locus_tag LOCUS_61350 9981 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 11224 12906 gene locus_tag LOCUS_61360 gene ggt 11224 12906 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703698.1 protein_id gnl|my_center|LOCUS_61360 13138 13740 gene locus_tag LOCUS_61370 13138 13740 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_61370 13831 14838 gene locus_tag LOCUS_61380 13831 14838 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 protein_id gnl|my_center|LOCUS_61380 15012 18233 gene locus_tag LOCUS_61390 15012 18233 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_61390 18252 19589 gene locus_tag LOCUS_61400 18252 19589 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_61400 19611 20522 gene locus_tag LOCUS_61410 19611 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 20630 21970 gene locus_tag LOCUS_61420 20630 21970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 21992 23362 gene locus_tag LOCUS_61430 21992 23362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 23364 24557 gene locus_tag LOCUS_61440 23364 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 24550 25536 gene locus_tag LOCUS_61450 24550 25536 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 protein_id gnl|my_center|LOCUS_61450 25533 27464 gene locus_tag LOCUS_61460 25533 27464 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_61460 27543 28787 gene locus_tag LOCUS_61470 27543 28787 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_61470 28815 29972 gene locus_tag LOCUS_61480 28815 29972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 29973 31643 gene locus_tag LOCUS_61490 29973 31643 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_61490 33469 31739 gene locus_tag LOCUS_61500 33469 31739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61500 36628 33488 gene locus_tag LOCUS_61510 36628 33488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_61510 37311 36727 gene locus_tag LOCUS_61520 37311 36727 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_61520 37831 37313 gene locus_tag LOCUS_61530 37831 37313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 39127 37850 gene locus_tag LOCUS_61540 39127 37850 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 protein_id gnl|my_center|LOCUS_61540 39921 40634 gene locus_tag LOCUS_61550 39921 40634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 40731 41228 gene locus_tag LOCUS_61560 40731 41228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 43839 41419 gene locus_tag LOCUS_61570 43839 41419 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_61570 43994 45634 gene locus_tag LOCUS_61580 43994 45634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61580 45684 46265 gene locus_tag LOCUS_61590 45684 46265 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766766.1 protein_id gnl|my_center|LOCUS_61590 46320 47123 gene locus_tag LOCUS_61600 46320 47123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 47195 49120 gene locus_tag LOCUS_61610 47195 49120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 49206 52394 gene locus_tag LOCUS_61620 49206 52394 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929325.1 protein_id gnl|my_center|LOCUS_61620 52569 53399 gene locus_tag LOCUS_61630 52569 53399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 53694 54704 gene locus_tag LOCUS_61640 53694 54704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 56888 54798 gene locus_tag LOCUS_61650 56888 54798 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_61650 58973 57117 gene locus_tag LOCUS_61660 58973 57117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 60333 58963 gene locus_tag LOCUS_61670 60333 58963 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051261.1 protein_id gnl|my_center|LOCUS_61670 61528 60599 gene locus_tag LOCUS_61680 61528 60599 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 protein_id gnl|my_center|LOCUS_61680 62421 61525 gene locus_tag LOCUS_61690 62421 61525 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_61690 62621 63505 gene locus_tag LOCUS_61700 62621 63505 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 protein_id gnl|my_center|LOCUS_61700 63515 64951 gene locus_tag LOCUS_61710 63515 64951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 64948 65466 gene locus_tag LOCUS_61720 64948 65466 CDS product UGSC family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877150.1 protein_id gnl|my_center|LOCUS_61720 66484 65471 gene locus_tag LOCUS_61730 66484 65471 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717004.1 protein_id gnl|my_center|LOCUS_61730 >Feature sequence057 476 1072 gene locus_tag LOCUS_61740 476 1072 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140947.1 protein_id gnl|my_center|LOCUS_61740 1503 1132 gene locus_tag LOCUS_61750 1503 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 1829 1500 gene locus_tag LOCUS_61760 1829 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 2186 3391 gene locus_tag LOCUS_61770 2186 3391 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_61770 3398 5512 gene locus_tag LOCUS_61780 3398 5512 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_61780 5887 6879 gene locus_tag LOCUS_61790 5887 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61790 7054 7293 gene locus_tag LOCUS_61800 7054 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61800 7339 9435 gene locus_tag LOCUS_61810 gene feoB 7339 9435 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_61810 10823 9489 gene locus_tag LOCUS_61820 10823 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61820 13830 10843 gene locus_tag LOCUS_61830 13830 10843 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_61830 15417 13978 gene locus_tag LOCUS_61840 15417 13978 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_61840 16758 15475 gene locus_tag LOCUS_61850 16758 15475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 20076 16870 gene locus_tag LOCUS_61860 20076 16870 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_61860 22102 20171 gene locus_tag LOCUS_61870 22102 20171 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_61870 22294 23439 gene locus_tag LOCUS_61880 22294 23439 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_61880 23522 24964 gene locus_tag LOCUS_61890 23522 24964 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635991.1 protein_id gnl|my_center|LOCUS_61890 25019 25768 gene locus_tag LOCUS_61900 25019 25768 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_61900 25916 26737 gene locus_tag LOCUS_61910 gene murQ 25916 26737 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_61910 26742 27224 gene locus_tag LOCUS_61920 26742 27224 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527000.1 protein_id gnl|my_center|LOCUS_61920 27226 28527 gene locus_tag LOCUS_61930 27226 28527 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_61930 28520 30160 gene locus_tag LOCUS_61940 28520 30160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 31864 30155 gene locus_tag LOCUS_61950 gene malL 31864 30155 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_61950 33523 31865 gene locus_tag LOCUS_61960 33523 31865 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_61960 33768 36185 gene locus_tag LOCUS_61970 33768 36185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_61970 36348 38693 gene locus_tag LOCUS_61980 36348 38693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_61980 41788 38939 gene locus_tag LOCUS_61990 41788 38939 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_61990 41984 43672 gene locus_tag LOCUS_62000 41984 43672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_62000 45148 43715 gene locus_tag LOCUS_62010 45148 43715 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_62010 47534 45375 gene locus_tag LOCUS_62020 47534 45375 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_62020 50931 47776 gene locus_tag LOCUS_62030 50931 47776 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_62030 51522 51118 gene locus_tag LOCUS_62040 51522 51118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62040 52095 51658 gene locus_tag LOCUS_62050 52095 51658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 52554 52123 gene locus_tag LOCUS_62060 52554 52123 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399400.1 protein_id gnl|my_center|LOCUS_62060 52805 53893 gene locus_tag LOCUS_62070 52805 53893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 54764 53925 gene locus_tag LOCUS_62080 54764 53925 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_62080 56084 55032 gene locus_tag LOCUS_62090 56084 55032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 protein_id gnl|my_center|LOCUS_62090 57150 56161 gene locus_tag LOCUS_62100 57150 56161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 59022 57172 gene locus_tag LOCUS_62110 59022 57172 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694585.1 protein_id gnl|my_center|LOCUS_62110 59525 61483 gene locus_tag LOCUS_62120 59525 61483 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_62120 61897 61664 gene locus_tag LOCUS_62130 61897 61664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 62113 62307 gene locus_tag LOCUS_62140 62113 62307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 62455 63573 gene locus_tag LOCUS_62150 gene hisC 62455 63573 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_62150 63742 64224 gene locus_tag LOCUS_62160 63742 64224 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948566.1 protein_id gnl|my_center|LOCUS_62160 64349 66316 gene locus_tag LOCUS_62170 64349 66316 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_62170 >Feature sequence058 306 1280 gene locus_tag LOCUS_62180 306 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 1341 2489 gene locus_tag LOCUS_62190 1341 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 2795 5836 gene locus_tag LOCUS_62200 2795 5836 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_62200 5848 7176 gene locus_tag LOCUS_62210 5848 7176 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_62210 7307 8203 gene locus_tag LOCUS_62220 gene xerC 7307 8203 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765425.1 protein_id gnl|my_center|LOCUS_62220 8287 8583 gene locus_tag LOCUS_62230 8287 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 9011 9085 gene locus_tag LOCUS_t00330 9011 9085 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9172 9255 gene locus_tag LOCUS_t00340 9172 9255 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9337 9412 gene locus_tag LOCUS_t00350 9337 9412 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9574 9648 gene locus_tag LOCUS_t00360 9574 9648 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9708 10904 gene locus_tag LOCUS_62240 gene tuf 9708 10904 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963319.1 protein_id gnl|my_center|LOCUS_62240 11141 11214 gene locus_tag LOCUS_t00370 11141 11214 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11265 11453 gene locus_tag LOCUS_62250 gene secE 11265 11453 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_62250 11470 12018 gene locus_tag LOCUS_62260 gene nusG 11470 12018 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_62260 12103 12564 gene locus_tag LOCUS_62270 gene rplK 12103 12564 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_62270 12626 13318 gene locus_tag LOCUS_62280 gene rplA 12626 13318 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_62280 13338 13898 gene locus_tag LOCUS_62290 gene rplJ 13338 13898 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_62290 14014 14400 gene locus_tag LOCUS_62300 gene rplL 14014 14400 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_62300 14618 18445 gene locus_tag LOCUS_62310 gene rpoB 14618 18445 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_62310 18527 22834 gene locus_tag LOCUS_62320 gene rpoC 18527 22834 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_62320 23465 22872 gene locus_tag LOCUS_62330 23465 22872 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_62330 24016 23558 gene locus_tag LOCUS_62340 24016 23558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 26887 24119 gene locus_tag LOCUS_62350 26887 24119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 27148 27819 gene locus_tag LOCUS_62360 27148 27819 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_62360 28852 27980 gene locus_tag LOCUS_62370 gene rfbD 28852 27980 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_62370 29437 28886 gene locus_tag LOCUS_62380 gene rfbC 29437 28886 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_62380 30810 29509 gene locus_tag LOCUS_62390 gene der 30810 29509 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_62390 31051 32367 gene locus_tag LOCUS_62400 31051 32367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_62400 32616 33533 gene locus_tag LOCUS_62410 32616 33533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 34913 33618 gene locus_tag LOCUS_62420 34913 33618 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143163.1 protein_id gnl|my_center|LOCUS_62420 36305 35196 gene locus_tag LOCUS_62430 36305 35196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 38006 36366 gene locus_tag LOCUS_62440 38006 36366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 38519 38905 gene locus_tag LOCUS_62450 38519 38905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 38927 40408 gene locus_tag LOCUS_62460 38927 40408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 40443 42395 gene locus_tag LOCUS_62470 40443 42395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 42430 44376 gene locus_tag LOCUS_62480 42430 44376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 44418 45743 gene locus_tag LOCUS_62490 44418 45743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 45803 52411 gene locus_tag LOCUS_62500 45803 52411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 52417 52926 gene locus_tag LOCUS_62510 52417 52926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 53307 52978 gene locus_tag LOCUS_62520 53307 52978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 53614 54189 gene locus_tag LOCUS_62530 53614 54189 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 protein_id gnl|my_center|LOCUS_62530 54714 55745 gene locus_tag LOCUS_62540 54714 55745 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_62540 56945 55884 gene locus_tag LOCUS_62550 56945 55884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 57185 57586 gene locus_tag LOCUS_62560 57185 57586 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614659.1 protein_id gnl|my_center|LOCUS_62560 57618 57932 gene locus_tag LOCUS_62570 57618 57932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 58578 58066 gene locus_tag LOCUS_62580 58578 58066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 58775 60652 gene locus_tag LOCUS_62590 58775 60652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 60930 65786 gene locus_tag LOCUS_62600 60930 65786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 >Feature sequence059 <1 1027 gene locus_tag LOCUS_62610 <1 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257289.1:DUF4397 domain-containing protein 1190 3838 gene locus_tag LOCUS_62620 1190 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 4691 3849 gene locus_tag LOCUS_62630 4691 3849 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_62630 4845 6503 gene locus_tag LOCUS_62640 4845 6503 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_62640 6838 6533 gene locus_tag LOCUS_62650 6838 6533 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_62650 7974 6841 gene locus_tag LOCUS_62660 gene recF 7974 6841 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_62660 8515 9423 gene locus_tag LOCUS_62670 gene pdhA 8515 9423 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_62670 9634 10335 gene locus_tag LOCUS_62680 9634 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_62680 10347 10868 gene locus_tag LOCUS_62690 gene ribH 10347 10868 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_62690 10895 11749 gene locus_tag LOCUS_62700 10895 11749 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_62700 11918 12496 gene locus_tag LOCUS_62710 11918 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 12603 13469 gene locus_tag LOCUS_62720 12603 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 13572 15116 gene locus_tag LOCUS_62730 13572 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 15349 17283 gene locus_tag LOCUS_62740 15349 17283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 18014 17280 gene locus_tag LOCUS_62750 18014 17280 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_62750 18252 19109 gene locus_tag LOCUS_62760 18252 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 19796 19200 gene locus_tag LOCUS_62770 19796 19200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62770 20883 21107 gene locus_tag LOCUS_62780 20883 21107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 21769 21413 gene locus_tag LOCUS_62790 21769 21413 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_62790 22552 21887 gene locus_tag LOCUS_62800 22552 21887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 22741 25218 gene locus_tag LOCUS_62810 22741 25218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 25825 26502 gene locus_tag LOCUS_62820 25825 26502 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704560.1 protein_id gnl|my_center|LOCUS_62820 26607 26834 gene locus_tag LOCUS_62830 26607 26834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 26816 27463 gene locus_tag LOCUS_62840 26816 27463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 27537 28019 gene locus_tag LOCUS_62850 27537 28019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 28278 28027 gene locus_tag LOCUS_62860 28278 28027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 28451 30211 gene locus_tag LOCUS_62870 28451 30211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 30297 33146 gene locus_tag LOCUS_62880 30297 33146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 33786 33214 gene locus_tag LOCUS_62890 33786 33214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 36245 33921 gene locus_tag LOCUS_62900 36245 33921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 37138 36785 gene locus_tag LOCUS_62910 37138 36785 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_62910 37327 37863 gene locus_tag LOCUS_62920 37327 37863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_62920 37947 39233 gene locus_tag LOCUS_62930 37947 39233 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_62930 39384 40910 gene locus_tag LOCUS_62940 39384 40910 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_62940 41322 42560 gene locus_tag LOCUS_62950 41322 42560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 44447 42768 gene locus_tag LOCUS_62960 44447 42768 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142698.1 protein_id gnl|my_center|LOCUS_62960 45568 44705 gene locus_tag LOCUS_62970 45568 44705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 46374 45640 gene locus_tag LOCUS_62980 46374 45640 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_62980 48384 46387 gene locus_tag LOCUS_62990 48384 46387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62990 48542 49642 gene locus_tag LOCUS_63000 48542 49642 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403585.1 protein_id gnl|my_center|LOCUS_63000 49748 50008 gene locus_tag LOCUS_63010 49748 50008 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933446.1 protein_id gnl|my_center|LOCUS_63010 50014 50823 gene locus_tag LOCUS_63020 gene pyrF 50014 50823 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_63020 51484 50894 gene locus_tag LOCUS_63030 51484 50894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880985.1 protein_id gnl|my_center|LOCUS_63030 51939 53166 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgaagtcctatctctaagtggaaccctcatatac 54460 53612 gene locus_tag LOCUS_63040 54460 53612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 55138 54464 gene locus_tag LOCUS_63050 55138 54464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 57579 55150 gene locus_tag LOCUS_63060 57579 55150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 58002 57592 gene locus_tag LOCUS_63070 58002 57592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 59716 57995 gene locus_tag LOCUS_63080 59716 57995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 61181 59718 gene locus_tag LOCUS_63090 61181 59718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 61765 61184 gene locus_tag LOCUS_63100 61765 61184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63100 63299 61776 gene locus_tag LOCUS_63110 63299 61776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 63639 64286 gene locus_tag LOCUS_63120 63639 64286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 64426 64647 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttagtcctacctataatggaataaac >Feature sequence060 1847 420 gene locus_tag LOCUS_63130 1847 420 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_63130 5156 2004 gene locus_tag LOCUS_63140 5156 2004 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106605886.1 protein_id gnl|my_center|LOCUS_63140 6280 5567 gene locus_tag LOCUS_63150 6280 5567 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964190.1 protein_id gnl|my_center|LOCUS_63150 6320 7279 gene locus_tag LOCUS_63160 6320 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 7309 8163 gene locus_tag LOCUS_63170 7309 8163 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_63170 8470 8835 gene locus_tag LOCUS_63180 8470 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 9895 8876 gene locus_tag LOCUS_63190 9895 8876 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_63190 10023 10388 gene locus_tag LOCUS_63200 10023 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 11953 10424 gene locus_tag LOCUS_63210 gene lysS 11953 10424 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_63210 12128 13030 gene locus_tag LOCUS_63220 12128 13030 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_63220 15185 13737 gene locus_tag LOCUS_63230 15185 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 16455 15436 gene locus_tag LOCUS_63240 16455 15436 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_63240 16886 19495 gene locus_tag LOCUS_63250 16886 19495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 19591 19941 gene locus_tag LOCUS_63260 19591 19941 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_63260 20265 21911 gene locus_tag LOCUS_63270 20265 21911 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_63270 21908 23707 gene locus_tag LOCUS_63280 21908 23707 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_63280 23846 24898 gene locus_tag LOCUS_63290 23846 24898 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_63290 25037 25243 gene locus_tag LOCUS_63300 25037 25243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63300 25256 27700 gene locus_tag LOCUS_63310 25256 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 28906 27764 gene locus_tag LOCUS_63320 28906 27764 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_63320 30442 29048 gene locus_tag LOCUS_63330 30442 29048 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 protein_id gnl|my_center|LOCUS_63330 30560 31207 gene locus_tag LOCUS_63340 30560 31207 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_63340 32104 31556 gene locus_tag LOCUS_63350 32104 31556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 37705 32501 gene locus_tag LOCUS_63360 37705 32501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 41828 37848 gene locus_tag LOCUS_63370 41828 37848 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_63370 42757 42308 gene locus_tag LOCUS_63380 42757 42308 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_63380 42898 44379 gene locus_tag LOCUS_63390 gene guaB 42898 44379 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_63390 44376 45017 gene locus_tag LOCUS_63400 44376 45017 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883143.1 protein_id gnl|my_center|LOCUS_63400 45070 45189 gene locus_tag LOCUS_63410 45070 45189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 45224 46456 gene locus_tag LOCUS_63420 45224 46456 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_63420 47046 46483 gene locus_tag LOCUS_63430 47046 46483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 47487 48914 gene locus_tag LOCUS_63440 47487 48914 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_63440 48918 50321 gene locus_tag LOCUS_63450 48918 50321 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_63450 50515 51102 gene locus_tag LOCUS_63460 50515 51102 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_63460 51307 51768 gene locus_tag LOCUS_63470 51307 51768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63470 52923 51895 gene locus_tag LOCUS_63480 52923 51895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 53782 52934 gene locus_tag LOCUS_63490 53782 52934 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_63490 54287 53886 gene locus_tag LOCUS_63500 54287 53886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63500 54646 55146 gene locus_tag LOCUS_63510 54646 55146 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_63510 55315 55599 gene locus_tag LOCUS_63520 55315 55599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 56554 55625 gene locus_tag LOCUS_63530 56554 55625 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138475095.1 protein_id gnl|my_center|LOCUS_63530 56946 56581 gene locus_tag LOCUS_63540 56946 56581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63540 57982 57026 gene locus_tag LOCUS_63550 57982 57026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819539.1 protein_id gnl|my_center|LOCUS_63550 58327 58710 gene locus_tag LOCUS_63560 58327 58710 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_63560 58700 60043 gene locus_tag LOCUS_63570 58700 60043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 60224 62572 gene locus_tag LOCUS_63580 60224 62572 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_63580 62732 64120 gene locus_tag LOCUS_63590 62732 64120 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038648.1 protein_id gnl|my_center|LOCUS_63590 >Feature sequence061 85 13 gene locus_tag LOCUS_t00380 85 13 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 401 1399 gene locus_tag LOCUS_63600 gene gap 401 1399 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_63600 1595 2794 gene locus_tag LOCUS_63610 1595 2794 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_63610 2931 3338 gene locus_tag LOCUS_63620 2931 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 4396 3389 gene locus_tag LOCUS_63630 4396 3389 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_63630 10110 4657 gene locus_tag LOCUS_63640 10110 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 12098 10983 gene locus_tag LOCUS_63650 12098 10983 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816129.1 protein_id gnl|my_center|LOCUS_63650 13408 12332 gene locus_tag LOCUS_63660 13408 12332 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_63660 14151 13408 gene locus_tag LOCUS_63670 14151 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63670 15167 14268 gene locus_tag LOCUS_63680 15167 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63680 15966 15145 gene locus_tag LOCUS_63690 15966 15145 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_63690 17040 15988 gene locus_tag LOCUS_63700 17040 15988 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764710.1 protein_id gnl|my_center|LOCUS_63700 17436 17041 gene locus_tag LOCUS_63710 17436 17041 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_63710 17657 19171 gene locus_tag LOCUS_63720 17657 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 20029 19181 gene locus_tag LOCUS_63730 20029 19181 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_63730 20327 20806 gene locus_tag LOCUS_63740 20327 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 21615 20935 gene locus_tag LOCUS_63750 gene trmD 21615 20935 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_63750 21806 22093 gene locus_tag LOCUS_63760 21806 22093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 22879 22205 gene locus_tag LOCUS_63770 22879 22205 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_63770 23231 23689 gene locus_tag LOCUS_63780 23231 23689 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_63780 23934 24902 gene locus_tag LOCUS_63790 23934 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 25575 24955 gene locus_tag LOCUS_63800 25575 24955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63800 25963 28698 gene locus_tag LOCUS_63810 25963 28698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 28735 29457 gene locus_tag LOCUS_63820 28735 29457 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_63820 30375 29605 gene locus_tag LOCUS_63830 30375 29605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 31325 31104 gene locus_tag LOCUS_63840 31325 31104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 32808 31279 gene locus_tag LOCUS_63850 32808 31279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 33201 33785 gene locus_tag LOCUS_63860 33201 33785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 35041 33782 gene locus_tag LOCUS_63870 35041 33782 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_63870 36066 35188 gene locus_tag LOCUS_63880 36066 35188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 36539 36225 gene locus_tag LOCUS_63890 36539 36225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63890 37115 36717 gene locus_tag LOCUS_63900 37115 36717 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_63900 37977 37285 gene locus_tag LOCUS_63910 37977 37285 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_63910 38361 40754 gene locus_tag LOCUS_63920 38361 40754 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_63920 40848 41198 gene locus_tag LOCUS_63930 40848 41198 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_63930 41258 42430 gene locus_tag LOCUS_63940 41258 42430 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_63940 42521 44023 gene locus_tag LOCUS_63950 42521 44023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 45588 44086 gene locus_tag LOCUS_63960 45588 44086 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_63960 48522 45601 gene locus_tag LOCUS_63970 48522 45601 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_63970 49680 48814 gene locus_tag LOCUS_63980 49680 48814 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_63980 49866 51035 gene locus_tag LOCUS_63990 49866 51035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 51131 51913 gene locus_tag LOCUS_64000 51131 51913 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_64000 51990 52748 gene locus_tag LOCUS_64010 51990 52748 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_64010 52752 53852 gene locus_tag LOCUS_64020 gene ugpC 52752 53852 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_64020 53872 56244 gene locus_tag LOCUS_64030 53872 56244 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990086.1 protein_id gnl|my_center|LOCUS_64030 56256 56915 gene locus_tag LOCUS_64040 gene pgmB 56256 56915 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_64040 57163 57238 gene locus_tag LOCUS_t00390 57163 57238 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 57323 57396 gene locus_tag LOCUS_t00400 57323 57396 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 60005 57402 gene locus_tag LOCUS_64050 60005 57402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_64050 60331 60005 gene locus_tag LOCUS_64060 60331 60005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64060 >Feature sequence062 1175 381 gene locus_tag LOCUS_64070 1175 381 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_64070 1445 2518 gene locus_tag LOCUS_64080 1445 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 2749 4143 gene locus_tag LOCUS_64090 2749 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 6323 4347 gene locus_tag LOCUS_64100 6323 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 6735 7334 gene locus_tag LOCUS_64110 6735 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64110 8139 7363 gene locus_tag LOCUS_64120 8139 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 8656 9630 gene locus_tag LOCUS_64130 8656 9630 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_64130 10067 13093 gene locus_tag LOCUS_64140 gene secDF 10067 13093 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_64140 13446 15359 gene locus_tag LOCUS_64150 13446 15359 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_64150 21384 15394 gene locus_tag LOCUS_64160 21384 15394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 24567 21697 gene locus_tag LOCUS_64170 gene leuS 24567 21697 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_64170 24840 25598 gene locus_tag LOCUS_64180 24840 25598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 25686 27599 gene locus_tag LOCUS_64190 25686 27599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 27814 28323 gene locus_tag LOCUS_64200 27814 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 28335 29402 gene locus_tag LOCUS_64210 28335 29402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 29627 30073 gene locus_tag LOCUS_64220 29627 30073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64220 30638 30144 gene locus_tag LOCUS_64230 30638 30144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 30778 31656 gene locus_tag LOCUS_64240 30778 31656 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_64240 31703 32077 gene locus_tag LOCUS_64250 31703 32077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 32083 32880 gene locus_tag LOCUS_64260 32083 32880 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_64260 32957 33682 gene locus_tag LOCUS_64270 gene truB 32957 33682 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_64270 35891 34146 gene locus_tag LOCUS_64280 35891 34146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 36068 38503 gene locus_tag LOCUS_64290 36068 38503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 38541 39728 gene locus_tag LOCUS_64300 38541 39728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64300 39906 40418 gene locus_tag LOCUS_64310 39906 40418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 40512 40901 gene locus_tag LOCUS_64320 40512 40901 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_64320 41669 40854 gene locus_tag LOCUS_64330 41669 40854 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811658.1 protein_id gnl|my_center|LOCUS_64330 43113 41680 gene locus_tag LOCUS_64340 43113 41680 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_64340 43212 43589 gene locus_tag LOCUS_64350 43212 43589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 43710 44810 gene locus_tag LOCUS_64360 43710 44810 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_64360 44982 45392 gene locus_tag LOCUS_64370 gene gloA 44982 45392 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 protein_id gnl|my_center|LOCUS_64370 45497 46579 gene locus_tag LOCUS_64380 45497 46579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 48309 46588 gene locus_tag LOCUS_64390 48309 46588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 48554 49000 gene locus_tag LOCUS_64400 48554 49000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 49055 52858 gene locus_tag LOCUS_64410 49055 52858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 55587 52927 gene locus_tag LOCUS_64420 55587 52927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 56260 55886 gene locus_tag LOCUS_64430 56260 55886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 56338 57330 gene locus_tag LOCUS_64440 56338 57330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 57567 58259 gene locus_tag LOCUS_64450 57567 58259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 58767 59285 gene locus_tag LOCUS_64460 58767 59285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 59963 59289 gene locus_tag LOCUS_64470 59963 59289 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_64470 >Feature sequence063 1454 297 gene locus_tag LOCUS_64480 1454 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 2800 1466 gene locus_tag LOCUS_64490 2800 1466 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_64490 3338 2820 gene locus_tag LOCUS_64500 3338 2820 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_64500 4116 3439 gene locus_tag LOCUS_64510 4116 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 4435 5283 gene locus_tag LOCUS_64520 4435 5283 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_64520 5419 6435 gene locus_tag LOCUS_64530 gene pfkA 5419 6435 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_64530 6509 6901 gene locus_tag LOCUS_64540 6509 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 8376 6925 gene locus_tag LOCUS_64550 8376 6925 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_64550 10061 8400 gene locus_tag LOCUS_64560 10061 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_64560 11522 10122 gene locus_tag LOCUS_64570 11522 10122 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_64570 11631 12290 gene locus_tag LOCUS_64580 11631 12290 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496500.1 protein_id gnl|my_center|LOCUS_64580 12935 12363 gene locus_tag LOCUS_64590 12935 12363 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927022.1 protein_id gnl|my_center|LOCUS_64590 13353 14423 gene locus_tag LOCUS_64600 13353 14423 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_64600 16106 14691 gene locus_tag LOCUS_64610 16106 14691 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_64610 19106 16137 gene locus_tag LOCUS_64620 19106 16137 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108255.1 protein_id gnl|my_center|LOCUS_64620 20176 19844 gene locus_tag LOCUS_64630 20176 19844 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_64630 20588 20211 gene locus_tag LOCUS_64640 20588 20211 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878974.1 protein_id gnl|my_center|LOCUS_64640 21121 20612 gene locus_tag LOCUS_64650 21121 20612 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_64650 21999 21175 gene locus_tag LOCUS_64660 21999 21175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 23751 22210 gene locus_tag LOCUS_64670 23751 22210 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_64670 24116 25324 gene locus_tag LOCUS_64680 24116 25324 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_64680 26063 25476 gene locus_tag LOCUS_64690 26063 25476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64690 26266 27771 gene locus_tag LOCUS_64700 26266 27771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 28044 30074 gene locus_tag LOCUS_64710 28044 30074 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_64710 31338 30199 gene locus_tag LOCUS_64720 31338 30199 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_64720 32895 31390 gene locus_tag LOCUS_64730 32895 31390 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_64730 34443 33067 gene locus_tag LOCUS_64740 gene glmM 34443 33067 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_64740 34573 35301 gene locus_tag LOCUS_64750 34573 35301 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_64750 35366 35953 gene locus_tag LOCUS_64760 35366 35953 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_64760 36191 39001 gene locus_tag LOCUS_64770 36191 39001 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_64770 39044 40645 gene locus_tag LOCUS_64780 39044 40645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64780 41890 40778 gene locus_tag LOCUS_64790 41890 40778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 42175 42828 gene locus_tag LOCUS_64800 42175 42828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_64800 42855 44318 gene locus_tag LOCUS_64810 42855 44318 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_64810 44328 44942 gene locus_tag LOCUS_64820 gene pncA 44328 44942 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135078.1 protein_id gnl|my_center|LOCUS_64820 45050 46297 gene locus_tag LOCUS_64830 gene rocD 45050 46297 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_64830 46490 49291 gene locus_tag LOCUS_64840 46490 49291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 49924 49343 gene locus_tag LOCUS_64850 49924 49343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 50569 50006 gene locus_tag LOCUS_64860 50569 50006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 51083 54223 gene locus_tag LOCUS_64870 51083 54223 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_64870 54283 55911 gene locus_tag LOCUS_64880 54283 55911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64880 56231 56473 gene locus_tag LOCUS_64890 56231 56473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64890 57230 56571 gene locus_tag LOCUS_64900 57230 56571 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_64900 57429 58727 gene locus_tag LOCUS_64910 57429 58727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 59244 59849 gene locus_tag LOCUS_64920 59244 59849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64920 >Feature sequence064 164 1228 gene locus_tag LOCUS_64930 164 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 1325 1726 gene locus_tag LOCUS_64940 1325 1726 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661089.1 protein_id gnl|my_center|LOCUS_64940 2826 1897 gene locus_tag LOCUS_64950 2826 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64950 3084 3470 gene locus_tag LOCUS_64960 3084 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64960 3484 5901 gene locus_tag LOCUS_64970 3484 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 7011 6247 gene locus_tag LOCUS_64980 7011 6247 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_64980 7198 9651 gene locus_tag LOCUS_64990 gene pheT 7198 9651 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107364.1 protein_id gnl|my_center|LOCUS_64990 9670 9957 gene locus_tag LOCUS_65000 9670 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 9964 10257 gene locus_tag LOCUS_65010 9964 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 10440 12122 gene locus_tag LOCUS_65020 gene rny 10440 12122 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_65020 12270 13322 gene locus_tag LOCUS_65030 12270 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 13403 13777 gene locus_tag LOCUS_65040 13403 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65040 13783 14817 gene locus_tag LOCUS_65050 13783 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 14833 15822 gene locus_tag LOCUS_65060 14833 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 17560 15830 gene locus_tag LOCUS_65070 17560 15830 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_65070 18195 17560 gene locus_tag LOCUS_65080 18195 17560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 19170 18448 gene locus_tag LOCUS_65090 19170 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65090 20107 19175 gene locus_tag LOCUS_65100 20107 19175 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_65100 21221 20220 gene locus_tag LOCUS_65110 21221 20220 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_65110 22246 21221 gene locus_tag LOCUS_65120 22246 21221 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_65120 23115 22246 gene locus_tag LOCUS_65130 23115 22246 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_65130 24121 23126 gene locus_tag LOCUS_65140 24121 23126 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_65140 24428 25096 gene locus_tag LOCUS_65150 24428 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 27486 25171 gene locus_tag LOCUS_65160 27486 25171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65160 27805 27512 gene locus_tag LOCUS_65170 27805 27512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 27768 27917 gene locus_tag LOCUS_65180 27768 27917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 28957 28244 gene locus_tag LOCUS_65190 28957 28244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 29511 28975 gene locus_tag LOCUS_65200 29511 28975 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105495.1 protein_id gnl|my_center|LOCUS_65200 29963 33202 gene locus_tag LOCUS_65210 29963 33202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 33267 34295 gene locus_tag LOCUS_65220 33267 34295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 34464 35051 gene locus_tag LOCUS_65230 34464 35051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 35055 35780 gene locus_tag LOCUS_65240 35055 35780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 35934 37172 gene locus_tag LOCUS_65250 35934 37172 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_65250 38460 37198 gene locus_tag LOCUS_65260 38460 37198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 38914 38633 gene locus_tag LOCUS_65270 38914 38633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 39234 39097 gene locus_tag LOCUS_65280 39234 39097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 39717 39322 gene locus_tag LOCUS_65290 39717 39322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 40022 39714 gene locus_tag LOCUS_65300 40022 39714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65300 40783 40022 gene locus_tag LOCUS_65310 gene lptB 40783 40022 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_65310 41561 40800 gene locus_tag LOCUS_65320 41561 40800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65320 43091 41730 gene locus_tag LOCUS_65330 43091 41730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 43957 43346 gene locus_tag LOCUS_65340 43957 43346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 44499 43954 gene locus_tag LOCUS_65350 44499 43954 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_65350 46027 44789 gene locus_tag LOCUS_65360 46027 44789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 46218 47315 gene locus_tag LOCUS_65370 46218 47315 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_65370 47879 50254 gene locus_tag LOCUS_65380 47879 50254 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_65380 51826 50294 gene locus_tag LOCUS_65390 51826 50294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_65390 52757 51897 gene locus_tag LOCUS_65400 52757 51897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 53869 53144 gene locus_tag LOCUS_65410 53869 53144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 55313 53844 gene locus_tag LOCUS_65420 55313 53844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 56638 55508 gene locus_tag LOCUS_65430 56638 55508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 58034 57366 gene locus_tag LOCUS_65440 58034 57366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 >Feature sequence065 970 122 gene locus_tag LOCUS_65450 gene ilvE 970 122 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_65450 1316 3442 gene locus_tag LOCUS_65460 1316 3442 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_65460 4912 3482 gene locus_tag LOCUS_65470 4912 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 5307 5062 gene locus_tag LOCUS_65480 5307 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65480 5639 7168 gene locus_tag LOCUS_65490 5639 7168 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_65490 7872 7228 gene locus_tag LOCUS_65500 7872 7228 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989831.1 protein_id gnl|my_center|LOCUS_65500 8370 8029 gene locus_tag LOCUS_65510 8370 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65510 8942 8394 gene locus_tag LOCUS_65520 8942 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 9466 9047 gene locus_tag LOCUS_65530 9466 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65530 9795 9520 gene locus_tag LOCUS_65540 9795 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 12344 10044 gene locus_tag LOCUS_65550 12344 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 16063 12707 gene locus_tag LOCUS_65560 16063 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65560 19045 16487 gene locus_tag LOCUS_65570 19045 16487 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_65570 20327 19548 gene locus_tag LOCUS_65580 20327 19548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 20802 21569 gene locus_tag LOCUS_65590 20802 21569 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_65590 21589 22098 gene locus_tag LOCUS_65600 21589 22098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 23357 22143 gene locus_tag LOCUS_65610 gene pcaF 23357 22143 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969982.1 protein_id gnl|my_center|LOCUS_65610 23532 23990 gene locus_tag LOCUS_65620 23532 23990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65620 24195 24794 gene locus_tag LOCUS_65630 24195 24794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65630 26780 24846 gene locus_tag LOCUS_65640 26780 24846 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 protein_id gnl|my_center|LOCUS_65640 28063 27008 gene locus_tag LOCUS_65650 28063 27008 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_65650 28722 28234 gene locus_tag LOCUS_65660 28722 28234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65660 32032 29213 gene locus_tag LOCUS_65670 32032 29213 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_65670 32467 33480 gene locus_tag LOCUS_65680 32467 33480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65680 33493 34500 gene locus_tag LOCUS_65690 33493 34500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202753.1 protein_id gnl|my_center|LOCUS_65690 34632 35549 gene locus_tag LOCUS_65700 34632 35549 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_65700 35793 36539 gene locus_tag LOCUS_65710 35793 36539 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_65710 37017 38402 gene locus_tag LOCUS_65720 gene radA 37017 38402 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_65720 38556 38981 gene locus_tag LOCUS_65730 38556 38981 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_65730 39013 39906 gene locus_tag LOCUS_65740 39013 39906 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838741.1 protein_id gnl|my_center|LOCUS_65740 39971 41404 gene locus_tag LOCUS_65750 gene asnS 39971 41404 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_65750 44884 41930 gene locus_tag LOCUS_65760 44884 41930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 45083 46495 gene locus_tag LOCUS_65770 45083 46495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65770 46697 47863 gene locus_tag LOCUS_65780 46697 47863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_65780 49833 47923 gene locus_tag LOCUS_65790 49833 47923 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_65790 52423 49958 gene locus_tag LOCUS_65800 52423 49958 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_65800 52782 53030 gene locus_tag LOCUS_65810 52782 53030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_65810 53037 54224 gene locus_tag LOCUS_65820 53037 54224 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224029.1 protein_id gnl|my_center|LOCUS_65820 >Feature sequence066 320 3613 gene locus_tag LOCUS_65830 320 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 6812 3657 gene locus_tag LOCUS_65840 6812 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_65840 8696 6969 gene locus_tag LOCUS_65850 8696 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 8878 10251 gene locus_tag LOCUS_65860 8878 10251 CDS product DUF4403 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964213.1 protein_id gnl|my_center|LOCUS_65860 10647 10312 gene locus_tag LOCUS_65870 10647 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65870 12172 10832 gene locus_tag LOCUS_65880 gene nhaD 12172 10832 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_65880 12515 13522 gene locus_tag LOCUS_65890 gene dusB 12515 13522 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_65890 13700 15121 gene locus_tag LOCUS_65900 13700 15121 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_65900 15239 15166 gene locus_tag LOCUS_t00410 15239 15166 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15456 16187 gene locus_tag LOCUS_65910 15456 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 16551 16174 gene locus_tag LOCUS_65920 16551 16174 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262045.1 protein_id gnl|my_center|LOCUS_65920 18012 16558 gene locus_tag LOCUS_65930 18012 16558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 20098 18647 gene locus_tag LOCUS_65940 20098 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65940 20288 20515 gene locus_tag LOCUS_65950 20288 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 21993 20527 gene locus_tag LOCUS_65960 21993 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 23929 22607 gene locus_tag LOCUS_65970 23929 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65970 25084 24047 gene locus_tag LOCUS_65980 25084 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65980 25281 26522 gene locus_tag LOCUS_65990 25281 26522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 26590 27207 gene locus_tag LOCUS_66000 26590 27207 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_66000 27323 27841 gene locus_tag LOCUS_66010 27323 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 28031 30718 gene locus_tag LOCUS_66020 28031 30718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 31956 31636 gene locus_tag LOCUS_66030 31956 31636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66030 32267 36682 gene locus_tag LOCUS_66040 32267 36682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66040 37317 37244 gene locus_tag LOCUS_t00420 37317 37244 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37963 39375 gene locus_tag LOCUS_66050 37963 39375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 39444 40535 gene locus_tag LOCUS_66060 39444 40535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 40536 41462 gene locus_tag LOCUS_66070 40536 41462 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407249.1 protein_id gnl|my_center|LOCUS_66070 41707 47445 gene locus_tag LOCUS_66080 41707 47445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 47651 48067 gene locus_tag LOCUS_66090 47651 48067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 48196 49194 gene locus_tag LOCUS_66100 48196 49194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66100 49661 52759 gene locus_tag LOCUS_66110 49661 52759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 53140 55527 gene locus_tag LOCUS_66120 53140 55527 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_66120 >Feature sequence067 2601 1495 gene locus_tag LOCUS_66130 2601 1495 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_66130 3703 2606 gene locus_tag LOCUS_66140 3703 2606 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020711.1 protein_id gnl|my_center|LOCUS_66140 4050 3709 gene locus_tag LOCUS_66150 4050 3709 CDS product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251206.1 protein_id gnl|my_center|LOCUS_66150 4749 4063 gene locus_tag LOCUS_66160 4749 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 7450 4760 gene locus_tag LOCUS_66170 7450 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 7889 9169 gene locus_tag LOCUS_66180 7889 9169 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114109.1 protein_id gnl|my_center|LOCUS_66180 10040 9156 gene locus_tag LOCUS_66190 10040 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 10163 11446 gene locus_tag LOCUS_66200 10163 11446 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114109.1 protein_id gnl|my_center|LOCUS_66200 12391 11516 gene locus_tag LOCUS_66210 12391 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 13548 12388 gene locus_tag LOCUS_66220 13548 12388 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114111.1 protein_id gnl|my_center|LOCUS_66220 14438 13620 gene locus_tag LOCUS_66230 14438 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66230 16065 14512 gene locus_tag LOCUS_66240 16065 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66240 17641 16145 gene locus_tag LOCUS_66250 17641 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66250 17870 18757 gene locus_tag LOCUS_66260 17870 18757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66260 18829 19659 gene locus_tag LOCUS_66270 18829 19659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66270 19659 20972 gene locus_tag LOCUS_66280 19659 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66280 24918 21358 gene locus_tag LOCUS_66290 24918 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66290 27250 24971 gene locus_tag LOCUS_66300 27250 24971 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_66300 28090 30507 gene locus_tag LOCUS_66310 28090 30507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66310 31325 30513 gene locus_tag LOCUS_66320 31325 30513 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_66320 34533 31636 gene locus_tag LOCUS_66330 34533 31636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66330 36240 34621 gene locus_tag LOCUS_66340 36240 34621 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_66340 37035 36268 gene locus_tag LOCUS_66350 37035 36268 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_66350 39358 37181 gene locus_tag LOCUS_66360 39358 37181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 39733 40788 gene locus_tag LOCUS_66370 39733 40788 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_66370 40946 41530 gene locus_tag LOCUS_66380 40946 41530 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_66380 43016 41577 gene locus_tag LOCUS_66390 gene abgB 43016 41577 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156451.1 protein_id gnl|my_center|LOCUS_66390 44762 43113 gene locus_tag LOCUS_66400 44762 43113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66400 45567 44827 gene locus_tag LOCUS_66410 45567 44827 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_66410 46555 45608 gene locus_tag LOCUS_66420 46555 45608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 47642 46683 gene locus_tag LOCUS_66430 47642 46683 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_66430 48738 48322 gene locus_tag LOCUS_66440 48738 48322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 48859 49509 gene locus_tag LOCUS_66450 48859 49509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66450 49868 50335 gene locus_tag LOCUS_66460 49868 50335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66460 50578 51732 gene locus_tag LOCUS_66470 50578 51732 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_66470 51773 51979 gene locus_tag LOCUS_66480 51773 51979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 52343 52516 gene locus_tag LOCUS_66490 52343 52516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 >Feature sequence068 245 1288 gene locus_tag LOCUS_66500 245 1288 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_66500 2362 1904 gene locus_tag LOCUS_66510 2362 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66510 2660 2902 gene locus_tag LOCUS_66520 2660 2902 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_66520 2923 4074 gene locus_tag LOCUS_66530 2923 4074 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_66530 5573 4101 gene locus_tag LOCUS_66540 5573 4101 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_66540 5968 5597 gene locus_tag LOCUS_66550 5968 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66550 6424 6047 gene locus_tag LOCUS_66560 6424 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 7833 6424 gene locus_tag LOCUS_66570 gene rlmD 7833 6424 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_66570 8636 7896 gene locus_tag LOCUS_66580 8636 7896 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_66580 8707 10560 gene locus_tag LOCUS_66590 8707 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 10562 11317 gene locus_tag LOCUS_66600 10562 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 11314 12600 gene locus_tag LOCUS_66610 11314 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66610 12673 13743 gene locus_tag LOCUS_66620 12673 13743 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_66620 13750 15075 gene locus_tag LOCUS_66630 13750 15075 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_66630 16176 15178 gene locus_tag LOCUS_66640 gene mgrA 16176 15178 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_66640 17559 16297 gene locus_tag LOCUS_66650 17559 16297 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_66650 20347 17627 gene locus_tag LOCUS_66660 20347 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66660 20603 22435 gene locus_tag LOCUS_66670 20603 22435 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_66670 22584 23495 gene locus_tag LOCUS_66680 22584 23495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66680 23544 24737 gene locus_tag LOCUS_66690 23544 24737 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_66690 24991 26547 gene locus_tag LOCUS_66700 24991 26547 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_66700 27626 28771 gene locus_tag LOCUS_66710 27626 28771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 28855 29664 gene locus_tag LOCUS_66720 28855 29664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 29887 31260 gene locus_tag LOCUS_66730 29887 31260 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_66730 33164 31368 gene locus_tag LOCUS_66740 33164 31368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 33485 35293 gene locus_tag LOCUS_66750 33485 35293 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_66750 35315 37138 gene locus_tag LOCUS_66760 35315 37138 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_66760 37392 39422 gene locus_tag LOCUS_66770 37392 39422 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552478.1 protein_id gnl|my_center|LOCUS_66770 39601 40980 gene locus_tag LOCUS_66780 39601 40980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 42589 41012 gene locus_tag LOCUS_66790 42589 41012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 44466 42745 gene locus_tag LOCUS_66800 44466 42745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66800 46194 44539 gene locus_tag LOCUS_66810 46194 44539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 47189 46311 gene locus_tag LOCUS_66820 47189 46311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66820 49489 47429 gene locus_tag LOCUS_66830 49489 47429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66830 50796 50404 gene locus_tag LOCUS_66840 50796 50404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 <51816 50937 gene locus_tag LOCUS_66850 <51816 50937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010714088.1:AraC family transcriptional regulator >Feature sequence069 490 1140 gene locus_tag LOCUS_66860 490 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66860 2507 1344 gene locus_tag LOCUS_66870 2507 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66870 3206 3676 gene locus_tag LOCUS_66880 3206 3676 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_66880 5051 3666 gene locus_tag LOCUS_66890 5051 3666 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_66890 5328 5906 gene locus_tag LOCUS_66900 5328 5906 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391659.1 protein_id gnl|my_center|LOCUS_66900 6128 6394 gene locus_tag LOCUS_66910 6128 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66910 6686 6399 gene locus_tag LOCUS_66920 6686 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66920 7966 6968 gene locus_tag LOCUS_66930 7966 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 9152 8025 gene locus_tag LOCUS_66940 9152 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 9608 9201 gene locus_tag LOCUS_66950 9608 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 10021 9551 gene locus_tag LOCUS_66960 10021 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 10772 10035 gene locus_tag LOCUS_66970 10772 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 11026 10781 gene locus_tag LOCUS_66980 11026 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66980 11676 11251 gene locus_tag LOCUS_66990 11676 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66990 12356 11778 gene locus_tag LOCUS_67000 12356 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 12805 13113 gene locus_tag LOCUS_67010 12805 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67010 13140 13562 gene locus_tag LOCUS_67020 13140 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67020 13945 16614 gene locus_tag LOCUS_67030 13945 16614 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_67030 16683 17927 gene locus_tag LOCUS_67040 16683 17927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67040 18154 18651 gene locus_tag LOCUS_67050 18154 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 19359 18664 gene locus_tag LOCUS_67060 19359 18664 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_67060 20391 19375 gene locus_tag LOCUS_67070 20391 19375 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_67070 21304 20540 gene locus_tag LOCUS_67080 21304 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67080 23356 21521 gene locus_tag LOCUS_67090 23356 21521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67090 23729 24838 gene locus_tag LOCUS_67100 23729 24838 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_67100 26260 24896 gene locus_tag LOCUS_67110 26260 24896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 27318 26287 gene locus_tag LOCUS_67120 27318 26287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67120 27691 28653 gene locus_tag LOCUS_67130 27691 28653 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_67130 34292 28746 gene locus_tag LOCUS_67140 34292 28746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 38619 34387 gene locus_tag LOCUS_67150 38619 34387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 39033 39803 gene locus_tag LOCUS_67160 39033 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 40276 39857 gene locus_tag LOCUS_67170 40276 39857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67170 41628 40525 gene locus_tag LOCUS_67180 gene hisC 41628 40525 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257058.1 protein_id gnl|my_center|LOCUS_67180 41943 42980 gene locus_tag LOCUS_67190 41943 42980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67190 42977 43711 gene locus_tag LOCUS_67200 42977 43711 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762319.1 protein_id gnl|my_center|LOCUS_67200 44864 43695 gene locus_tag LOCUS_67210 44864 43695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 45065 45391 gene locus_tag LOCUS_67220 45065 45391 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_67220 48137 45450 gene locus_tag LOCUS_67230 48137 45450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 49422 48310 gene locus_tag LOCUS_67240 49422 48310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 >Feature sequence070 1442 198 gene locus_tag LOCUS_67250 1442 198 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967203.1 protein_id gnl|my_center|LOCUS_67250 2708 1503 gene locus_tag LOCUS_67260 2708 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67260 3118 2708 gene locus_tag LOCUS_67270 3118 2708 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233803.1 protein_id gnl|my_center|LOCUS_67270 3767 3348 gene locus_tag LOCUS_67280 3767 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 3894 5042 gene locus_tag LOCUS_67290 3894 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67290 5109 6578 gene locus_tag LOCUS_67300 5109 6578 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_67300 7691 6642 gene locus_tag LOCUS_67310 7691 6642 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256581.1 protein_id gnl|my_center|LOCUS_67310 8346 7702 gene locus_tag LOCUS_67320 8346 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67320 9039 8449 gene locus_tag LOCUS_67330 9039 8449 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_67330 10401 9133 gene locus_tag LOCUS_67340 10401 9133 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246404.1 protein_id gnl|my_center|LOCUS_67340 11487 10909 gene locus_tag LOCUS_67350 11487 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 11886 15842 gene locus_tag LOCUS_67360 11886 15842 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066611.1 protein_id gnl|my_center|LOCUS_67360 16546 16055 gene locus_tag LOCUS_67370 16546 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67370 16772 18331 gene locus_tag LOCUS_67380 16772 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_67380 18580 19020 gene locus_tag LOCUS_67390 gene norC 18580 19020 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_67390 19094 20428 gene locus_tag LOCUS_67400 19094 20428 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338149.1 protein_id gnl|my_center|LOCUS_67400 20513 21295 gene locus_tag LOCUS_67410 gene nirQ 20513 21295 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_67410 21311 23059 gene locus_tag LOCUS_67420 21311 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 23677 23138 gene locus_tag LOCUS_67430 23677 23138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 23941 25050 gene locus_tag LOCUS_67440 23941 25050 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839725.1 protein_id gnl|my_center|LOCUS_67440 25026 25826 gene locus_tag LOCUS_67450 25026 25826 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_67450 25913 26422 gene locus_tag LOCUS_67460 25913 26422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 27014 26511 gene locus_tag LOCUS_67470 27014 26511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 28464 27007 gene locus_tag LOCUS_67480 28464 27007 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_67480 29804 28530 gene locus_tag LOCUS_67490 29804 28530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67490 31632 29893 gene locus_tag LOCUS_67500 31632 29893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 32440 31622 gene locus_tag LOCUS_67510 gene hypB 32440 31622 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_67510 32815 32474 gene locus_tag LOCUS_67520 32815 32474 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675609.1 protein_id gnl|my_center|LOCUS_67520 37211 32913 gene locus_tag LOCUS_67530 37211 32913 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_67530 41536 37232 gene locus_tag LOCUS_67540 41536 37232 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_67540 42421 41720 gene locus_tag LOCUS_67550 42421 41720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67550 44322 42748 gene locus_tag LOCUS_67560 44322 42748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 44442 45629 gene locus_tag LOCUS_67570 44442 45629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 45721 46692 gene locus_tag LOCUS_67580 45721 46692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 46835 48439 gene locus_tag LOCUS_67590 46835 48439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67590 48474 49433 gene locus_tag LOCUS_67600 48474 49433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67600 >Feature sequence071 297 1631 gene locus_tag LOCUS_67610 297 1631 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963042.1 protein_id gnl|my_center|LOCUS_67610 2816 1638 gene locus_tag LOCUS_67620 2816 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67620 3761 2907 gene locus_tag LOCUS_67630 3761 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 4540 3758 gene locus_tag LOCUS_67640 4540 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67640 5068 4550 gene locus_tag LOCUS_67650 5068 4550 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_67650 7003 5210 gene locus_tag LOCUS_67660 7003 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 7281 6994 gene locus_tag LOCUS_67670 7281 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 7795 7265 gene locus_tag LOCUS_67680 7795 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 8098 7811 gene locus_tag LOCUS_67690 8098 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67690 9191 8526 gene locus_tag LOCUS_67700 9191 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67700 10116 9352 gene locus_tag LOCUS_67710 10116 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67710 10720 10307 gene locus_tag LOCUS_67720 10720 10307 CDS product DUF3052 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_67720 12282 10753 gene locus_tag LOCUS_67730 gene atsA 12282 10753 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_67730 14519 12792 gene locus_tag LOCUS_67740 14519 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67740 14811 16421 gene locus_tag LOCUS_67750 14811 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67750 16503 17207 gene locus_tag LOCUS_67760 16503 17207 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_67760 18508 17210 gene locus_tag LOCUS_67770 18508 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 19455 18574 gene locus_tag LOCUS_67780 19455 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67780 20666 19584 gene locus_tag LOCUS_67790 20666 19584 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 protein_id gnl|my_center|LOCUS_67790 21381 20692 gene locus_tag LOCUS_67800 21381 20692 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_67800 22417 21374 gene locus_tag LOCUS_67810 22417 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 22650 23756 gene locus_tag LOCUS_67820 22650 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 25303 23930 gene locus_tag LOCUS_67830 25303 23930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 25523 25942 gene locus_tag LOCUS_67840 25523 25942 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231627.1 protein_id gnl|my_center|LOCUS_67840 25932 26258 gene locus_tag LOCUS_67850 25932 26258 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_67850 26918 26370 gene locus_tag LOCUS_67860 26918 26370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67860 27108 27971 gene locus_tag LOCUS_67870 27108 27971 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102100637.1 protein_id gnl|my_center|LOCUS_67870 28861 28010 gene locus_tag LOCUS_67880 28861 28010 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_67880 28935 29858 gene locus_tag LOCUS_67890 28935 29858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 30726 29953 gene locus_tag LOCUS_67900 30726 29953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67900 31272 30844 gene locus_tag LOCUS_67910 31272 30844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67910 32997 32098 gene locus_tag LOCUS_67920 32997 32098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67920 33649 33071 gene locus_tag LOCUS_67930 33649 33071 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_67930 34245 33706 gene locus_tag LOCUS_67940 34245 33706 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_67940 35680 34304 gene locus_tag LOCUS_67950 35680 34304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67950 36153 35704 gene locus_tag LOCUS_67960 gene rimI 36153 35704 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107807.1 protein_id gnl|my_center|LOCUS_67960 36638 37870 gene locus_tag LOCUS_67970 gene pvdM 36638 37870 CDS product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_67970 38570 37902 gene locus_tag LOCUS_67980 38570 37902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67980 39563 38583 gene locus_tag LOCUS_67990 39563 38583 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921611.1 protein_id gnl|my_center|LOCUS_67990 40458 39652 gene locus_tag LOCUS_68000 40458 39652 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_68000 40612 41496 gene locus_tag LOCUS_68010 40612 41496 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_68010 43786 41546 gene locus_tag LOCUS_68020 43786 41546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68020 45023 43983 gene locus_tag LOCUS_68030 gene lpxD 45023 43983 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_68030 46396 45218 gene locus_tag LOCUS_68040 46396 45218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68040 46526 47506 gene locus_tag LOCUS_68050 46526 47506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68050 48046 47633 gene locus_tag LOCUS_68060 48046 47633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68060 <48600 48050 gene locus_tag LOCUS_68070 <48600 48050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:CHAT domain-containing protein >Feature sequence072 <1 2433 gene locus_tag LOCUS_68080 <1 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121811552.1:ABC transporter permease 2531 3745 gene locus_tag LOCUS_68090 2531 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68090 3940 4557 gene locus_tag LOCUS_68100 3940 4557 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_68100 4716 5513 gene locus_tag LOCUS_68110 4716 5513 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237656.1 protein_id gnl|my_center|LOCUS_68110 5589 5978 gene locus_tag LOCUS_68120 5589 5978 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723119.1 protein_id gnl|my_center|LOCUS_68120 8027 6192 gene locus_tag LOCUS_68130 8027 6192 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_68130 8530 9486 gene locus_tag LOCUS_68140 8530 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68140 11415 9547 gene locus_tag LOCUS_68150 11415 9547 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_68150 13031 11553 gene locus_tag LOCUS_68160 13031 11553 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979771.1 protein_id gnl|my_center|LOCUS_68160 13349 14383 gene locus_tag LOCUS_68170 13349 14383 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_68170 14444 15484 gene locus_tag LOCUS_68180 14444 15484 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 protein_id gnl|my_center|LOCUS_68180 17109 15526 gene locus_tag LOCUS_68190 17109 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68190 17597 17175 gene locus_tag LOCUS_68200 17597 17175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68200 18580 17741 gene locus_tag LOCUS_68210 18580 17741 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107775.1 protein_id gnl|my_center|LOCUS_68210 19686 18589 gene locus_tag LOCUS_68220 19686 18589 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_68220 19856 20188 gene locus_tag LOCUS_68230 19856 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68230 20195 22849 gene locus_tag LOCUS_68240 20195 22849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_68240 22876 25491 gene locus_tag LOCUS_68250 22876 25491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_68250 25560 26042 gene locus_tag LOCUS_68260 25560 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68260 26111 26866 gene locus_tag LOCUS_68270 26111 26866 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 protein_id gnl|my_center|LOCUS_68270 27767 26883 gene locus_tag LOCUS_68280 27767 26883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68280 28004 28735 gene locus_tag LOCUS_68290 28004 28735 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_68290 29067 30938 gene locus_tag LOCUS_68300 29067 30938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 31052 33217 gene locus_tag LOCUS_68310 31052 33217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68310 33350 33571 gene locus_tag LOCUS_68320 33350 33571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 33582 33998 gene locus_tag LOCUS_68330 33582 33998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68330 34055 34915 gene locus_tag LOCUS_68340 34055 34915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68340 35313 35852 gene locus_tag LOCUS_68350 35313 35852 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_68350 35845 36480 gene locus_tag LOCUS_68360 35845 36480 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_68360 36762 37232 gene locus_tag LOCUS_68370 36762 37232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68370 37583 37269 gene locus_tag LOCUS_68380 37583 37269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 38721 39986 gene locus_tag LOCUS_68390 38721 39986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68390 40087 40950 gene locus_tag LOCUS_68400 40087 40950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68400 41764 40937 gene locus_tag LOCUS_68410 41764 40937 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_68410 42628 43194 gene locus_tag LOCUS_68420 42628 43194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 43216 44610 gene locus_tag LOCUS_68430 43216 44610 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928419.1 protein_id gnl|my_center|LOCUS_68430 44756 47011 gene locus_tag LOCUS_68440 44756 47011 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_68440 47037 47504 gene locus_tag LOCUS_68450 47037 47504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68450 >Feature sequence073 506 2128 gene locus_tag LOCUS_68460 506 2128 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_68460 2900 6100 gene locus_tag LOCUS_68470 2900 6100 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_68470 6112 7563 gene locus_tag LOCUS_68480 6112 7563 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759577.1 protein_id gnl|my_center|LOCUS_68480 7596 8291 gene locus_tag LOCUS_68490 7596 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68490 8303 8815 gene locus_tag LOCUS_68500 8303 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68500 9177 9389 gene locus_tag LOCUS_68510 9177 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68510 10104 9466 gene locus_tag LOCUS_68520 10104 9466 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920422.1 protein_id gnl|my_center|LOCUS_68520 10899 10159 gene locus_tag LOCUS_68530 10899 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 11119 12069 gene locus_tag LOCUS_68540 11119 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68540 12803 12111 gene locus_tag LOCUS_68550 12803 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68550 15309 12991 gene locus_tag LOCUS_68560 15309 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68560 15459 16538 gene locus_tag LOCUS_68570 15459 16538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68570 21057 16627 gene locus_tag LOCUS_68580 21057 16627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 21683 22963 gene locus_tag LOCUS_68590 21683 22963 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_68590 23094 25106 gene locus_tag LOCUS_68600 23094 25106 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_68600 25318 26460 gene locus_tag LOCUS_68610 25318 26460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 29311 26534 gene locus_tag LOCUS_68620 29311 26534 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_68620 29842 30519 gene locus_tag LOCUS_68630 29842 30519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68630 30907 31413 gene locus_tag LOCUS_68640 30907 31413 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_68640 31981 31490 gene locus_tag LOCUS_68650 31981 31490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68650 32601 34550 gene locus_tag LOCUS_68660 32601 34550 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_68660 34915 36612 gene locus_tag LOCUS_68670 34915 36612 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_68670 39362 36954 gene locus_tag LOCUS_68680 39362 36954 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_68680 40387 39545 gene locus_tag LOCUS_68690 40387 39545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68690 41623 40493 gene locus_tag LOCUS_68700 41623 40493 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839763.1 protein_id gnl|my_center|LOCUS_68700 43740 41713 gene locus_tag LOCUS_68710 43740 41713 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_68710 44715 44041 gene locus_tag LOCUS_68720 44715 44041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68720 45101 46366 gene locus_tag LOCUS_68730 45101 46366 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_68730 >Feature sequence074 810 601 gene locus_tag LOCUS_68740 810 601 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393002.1 protein_id gnl|my_center|LOCUS_68740 899 2542 gene locus_tag LOCUS_68750 899 2542 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_68750 4554 2737 gene locus_tag LOCUS_68760 4554 2737 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_68760 5145 4744 gene locus_tag LOCUS_68770 5145 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68770 5948 5184 gene locus_tag LOCUS_68780 5948 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68780 6278 8263 gene locus_tag LOCUS_68790 6278 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68790 8484 9053 gene locus_tag LOCUS_68800 8484 9053 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084757677.1 protein_id gnl|my_center|LOCUS_68800 9786 11450 gene locus_tag LOCUS_68810 9786 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68810 11959 11492 gene locus_tag LOCUS_68820 11959 11492 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397282.1 protein_id gnl|my_center|LOCUS_68820 12239 11994 gene locus_tag LOCUS_68830 12239 11994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 12302 12970 gene locus_tag LOCUS_68840 12302 12970 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_68840 16142 13008 gene locus_tag LOCUS_68850 16142 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_68850 18007 16409 gene locus_tag LOCUS_68860 18007 16409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68860 18909 20939 gene locus_tag LOCUS_68870 18909 20939 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555800.1 protein_id gnl|my_center|LOCUS_68870 23116 20936 gene locus_tag LOCUS_68880 23116 20936 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_68880 23374 23189 gene locus_tag LOCUS_68890 23374 23189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 24077 23532 gene locus_tag LOCUS_68900 24077 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68900 25618 24296 gene locus_tag LOCUS_68910 25618 24296 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762522.1 protein_id gnl|my_center|LOCUS_68910 25781 28531 gene locus_tag LOCUS_68920 gene ppdK 25781 28531 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_68920 29023 28643 gene locus_tag LOCUS_68930 29023 28643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68930 29991 29269 gene locus_tag LOCUS_68940 29991 29269 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_68940 31202 29988 gene locus_tag LOCUS_68950 31202 29988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68950 31623 31393 gene locus_tag LOCUS_68960 31623 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68960 31751 32674 gene locus_tag LOCUS_68970 31751 32674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974497.1 protein_id gnl|my_center|LOCUS_68970 32671 33477 gene locus_tag LOCUS_68980 32671 33477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68980 34326 35105 gene locus_tag LOCUS_68990 34326 35105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 35127 38336 gene locus_tag LOCUS_69000 35127 38336 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_69000 38352 39113 gene locus_tag LOCUS_69010 38352 39113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69010 42781 39119 gene locus_tag LOCUS_69020 gene purL 42781 39119 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962854.1 protein_id gnl|my_center|LOCUS_69020 43359 42856 gene locus_tag LOCUS_69030 43359 42856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69030 43586 44386 gene locus_tag LOCUS_69040 43586 44386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 >Feature sequence075 4486 3080 gene locus_tag LOCUS_69050 4486 3080 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_69050 5389 4808 gene locus_tag LOCUS_69060 5389 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69060 6606 5956 gene locus_tag LOCUS_69070 6606 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69070 7899 6961 gene locus_tag LOCUS_69080 7899 6961 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_69080 8274 7939 gene locus_tag LOCUS_69090 8274 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69090 8520 8281 gene locus_tag LOCUS_69100 8520 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 9043 9927 gene locus_tag LOCUS_69110 9043 9927 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 protein_id gnl|my_center|LOCUS_69110 12403 9965 gene locus_tag LOCUS_69120 12403 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69120 12570 13736 gene locus_tag LOCUS_69130 12570 13736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69130 14589 13810 gene locus_tag LOCUS_69140 14589 13810 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_69140 16006 14822 gene locus_tag LOCUS_69150 16006 14822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69150 16912 16007 gene locus_tag LOCUS_69160 16912 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69160 17425 19383 gene locus_tag LOCUS_69170 17425 19383 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_69170 21189 19666 gene locus_tag LOCUS_69180 21189 19666 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_69180 22500 21256 gene locus_tag LOCUS_69190 22500 21256 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_69190 23159 22548 gene locus_tag LOCUS_69200 23159 22548 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400754.1 protein_id gnl|my_center|LOCUS_69200 24275 23313 gene locus_tag LOCUS_69210 24275 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 24762 24406 gene locus_tag LOCUS_69220 24762 24406 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140715.1 protein_id gnl|my_center|LOCUS_69220 24888 25367 gene locus_tag LOCUS_69230 24888 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69230 25472 28063 gene locus_tag LOCUS_69240 25472 28063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 28274 29953 gene locus_tag LOCUS_69250 gene ettA 28274 29953 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_69250 30716 30147 gene locus_tag LOCUS_69260 30716 30147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69260 31746 31132 gene locus_tag LOCUS_69270 31746 31132 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356718.1 protein_id gnl|my_center|LOCUS_69270 33858 31972 gene locus_tag LOCUS_69280 33858 31972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69280 36335 34140 gene locus_tag LOCUS_69290 36335 34140 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_69290 36848 36393 gene locus_tag LOCUS_69300 36848 36393 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_69300 37224 37682 gene locus_tag LOCUS_69310 37224 37682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 37861 40209 gene locus_tag LOCUS_69320 37861 40209 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_69320 40492 41568 gene locus_tag LOCUS_69330 40492 41568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 41677 42450 gene locus_tag LOCUS_69340 41677 42450 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065091.1 protein_id gnl|my_center|LOCUS_69340 42452 43567 gene locus_tag LOCUS_69350 42452 43567 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477940.1 protein_id gnl|my_center|LOCUS_69350 43608 44078 gene locus_tag LOCUS_69360 43608 44078 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021653.1 protein_id gnl|my_center|LOCUS_69360 >Feature sequence076 1059 229 gene locus_tag LOCUS_69370 1059 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 1185 2222 gene locus_tag LOCUS_69380 1185 2222 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_69380 4094 2322 gene locus_tag LOCUS_69390 4094 2322 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_69390 4838 4101 gene locus_tag LOCUS_69400 4838 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69400 5828 4872 gene locus_tag LOCUS_69410 5828 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69410 6498 5818 gene locus_tag LOCUS_69420 6498 5818 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_69420 7571 6498 gene locus_tag LOCUS_69430 7571 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69430 9221 7635 gene locus_tag LOCUS_69440 9221 7635 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_69440 10743 9559 gene locus_tag LOCUS_69450 gene megL 10743 9559 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_69450 11580 11002 gene locus_tag LOCUS_69460 11580 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 12629 11676 gene locus_tag LOCUS_69470 12629 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69470 13387 12731 gene locus_tag LOCUS_69480 13387 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69480 15832 13412 gene locus_tag LOCUS_69490 15832 13412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_69490 17191 15953 gene locus_tag LOCUS_69500 17191 15953 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089905.1 protein_id gnl|my_center|LOCUS_69500 17672 17331 gene locus_tag LOCUS_69510 17672 17331 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_69510 18192 17674 gene locus_tag LOCUS_69520 18192 17674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 19205 18507 gene locus_tag LOCUS_69530 19205 18507 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762319.1 protein_id gnl|my_center|LOCUS_69530 20258 19218 gene locus_tag LOCUS_69540 20258 19218 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_69540 20502 20882 gene locus_tag LOCUS_69550 20502 20882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 20893 21825 gene locus_tag LOCUS_69560 20893 21825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 23380 22145 gene locus_tag LOCUS_69570 23380 22145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69570 24814 25347 gene locus_tag LOCUS_69580 24814 25347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69580 25344 26039 gene locus_tag LOCUS_69590 25344 26039 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_69590 26141 27877 gene locus_tag LOCUS_69600 26141 27877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161615.1 protein_id gnl|my_center|LOCUS_69600 28271 27966 gene locus_tag LOCUS_69610 28271 27966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69610 28801 28355 gene locus_tag LOCUS_69620 28801 28355 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 protein_id gnl|my_center|LOCUS_69620 29687 28809 gene locus_tag LOCUS_69630 29687 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 30697 29771 gene locus_tag LOCUS_69640 30697 29771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69640 32369 30672 gene locus_tag LOCUS_69650 32369 30672 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878782.1 protein_id gnl|my_center|LOCUS_69650 33086 32721 gene locus_tag LOCUS_69660 33086 32721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69660 33748 33083 gene locus_tag LOCUS_69670 33748 33083 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_69670 34952 33753 gene locus_tag LOCUS_69680 34952 33753 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_69680 35351 35004 gene locus_tag LOCUS_69690 35351 35004 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145104183.1 protein_id gnl|my_center|LOCUS_69690 35710 35372 gene locus_tag LOCUS_69700 35710 35372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 36188 35847 gene locus_tag LOCUS_69710 36188 35847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69710 36626 36189 gene locus_tag LOCUS_69720 36626 36189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 37785 36649 gene locus_tag LOCUS_69730 37785 36649 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_69730 38474 37896 gene locus_tag LOCUS_69740 38474 37896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69740 38602 39360 gene locus_tag LOCUS_69750 38602 39360 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136101.1 protein_id gnl|my_center|LOCUS_69750 39887 39411 gene locus_tag LOCUS_69760 39887 39411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69760 40858 39899 gene locus_tag LOCUS_69770 40858 39899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 41361 40855 gene locus_tag LOCUS_69780 41361 40855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69780 43201 41633 gene locus_tag LOCUS_69790 43201 41633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 >Feature sequence077 317 883 gene locus_tag LOCUS_69800 317 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69800 2692 1058 gene locus_tag LOCUS_69810 2692 1058 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_69810 4417 2984 gene locus_tag LOCUS_69820 4417 2984 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_69820 4688 4900 gene locus_tag LOCUS_69830 4688 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69830 4893 5675 gene locus_tag LOCUS_69840 gene dapF 4893 5675 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_69840 5741 5968 gene locus_tag LOCUS_69850 5741 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69850 6039 7181 gene locus_tag LOCUS_69860 6039 7181 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_69860 7144 7404 gene locus_tag LOCUS_69870 7144 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 7785 7480 gene locus_tag LOCUS_69880 7785 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 8204 10312 gene locus_tag LOCUS_69890 8204 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69890 11459 10467 gene locus_tag LOCUS_69900 11459 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69900 12371 11574 gene locus_tag LOCUS_69910 12371 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 14597 12510 gene locus_tag LOCUS_69920 14597 12510 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_69920 14758 15777 gene locus_tag LOCUS_69930 14758 15777 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_69930 15870 17861 gene locus_tag LOCUS_69940 15870 17861 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403313.1 protein_id gnl|my_center|LOCUS_69940 18502 17912 gene locus_tag LOCUS_69950 18502 17912 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_69950 19472 18708 gene locus_tag LOCUS_69960 gene mazG 19472 18708 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_69960 19612 19815 gene locus_tag LOCUS_69970 19612 19815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69970 20350 19991 gene locus_tag LOCUS_69980 20350 19991 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_69980 21673 20372 gene locus_tag LOCUS_69990 21673 20372 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_69990 22027 22641 gene locus_tag LOCUS_70000 gene recR 22027 22641 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963432.1 protein_id gnl|my_center|LOCUS_70000 22643 24640 gene locus_tag LOCUS_70010 22643 24640 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_70010 25286 24657 gene locus_tag LOCUS_70020 25286 24657 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_70020 26209 25382 gene locus_tag LOCUS_70030 26209 25382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70030 26829 27719 gene locus_tag LOCUS_70040 26829 27719 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_70040 27771 28952 gene locus_tag LOCUS_70050 27771 28952 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_70050 29063 29902 gene locus_tag LOCUS_70060 29063 29902 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_70060 29987 31084 gene locus_tag LOCUS_70070 29987 31084 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_70070 31152 31934 gene locus_tag LOCUS_70080 31152 31934 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_70080 31946 34189 gene locus_tag LOCUS_70090 31946 34189 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_70090 34324 34923 gene locus_tag LOCUS_70100 34324 34923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70100 35418 34915 gene locus_tag LOCUS_70110 35418 34915 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964405.1 protein_id gnl|my_center|LOCUS_70110 35598 36269 gene locus_tag LOCUS_70120 35598 36269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70120 36259 37011 gene locus_tag LOCUS_70130 36259 37011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70130 37313 38491 gene locus_tag LOCUS_70140 37313 38491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70140 38810 39940 gene locus_tag LOCUS_70150 38810 39940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70150 40010 41155 gene locus_tag LOCUS_70160 40010 41155 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_70160 41353 41670 gene locus_tag LOCUS_70170 41353 41670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 >Feature sequence078 144 950 gene locus_tag LOCUS_70180 144 950 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976165.1 protein_id gnl|my_center|LOCUS_70180 1257 6092 gene locus_tag LOCUS_70190 1257 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 6288 7184 gene locus_tag LOCUS_70200 6288 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_70200 7184 7855 gene locus_tag LOCUS_70210 7184 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_70210 8934 7933 gene locus_tag LOCUS_70220 8934 7933 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 protein_id gnl|my_center|LOCUS_70220 9135 11486 gene locus_tag LOCUS_70230 9135 11486 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044346855.1 protein_id gnl|my_center|LOCUS_70230 11528 12397 gene locus_tag LOCUS_70240 11528 12397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_70240 13110 15731 gene locus_tag LOCUS_70250 13110 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 15976 16650 gene locus_tag LOCUS_70260 15976 16650 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537831.1 protein_id gnl|my_center|LOCUS_70260 16647 17579 gene locus_tag LOCUS_70270 16647 17579 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384692.1 protein_id gnl|my_center|LOCUS_70270 17597 18523 gene locus_tag LOCUS_70280 17597 18523 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384693.1 protein_id gnl|my_center|LOCUS_70280 20031 18577 gene locus_tag LOCUS_70290 20031 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 22400 20421 gene locus_tag LOCUS_70300 22400 20421 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_70300 23780 22419 gene locus_tag LOCUS_70310 23780 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70310 24906 23998 gene locus_tag LOCUS_70320 24906 23998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70320 25149 25598 gene locus_tag LOCUS_70330 25149 25598 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_70330 25726 27084 gene locus_tag LOCUS_70340 25726 27084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 27274 28656 gene locus_tag LOCUS_70350 27274 28656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 30127 28664 gene locus_tag LOCUS_70360 30127 28664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70360 31098 30295 gene locus_tag LOCUS_70370 31098 30295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70370 32013 31111 gene locus_tag LOCUS_70380 32013 31111 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130995.1 protein_id gnl|my_center|LOCUS_70380 32194 31982 gene locus_tag LOCUS_70390 32194 31982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 33123 32191 gene locus_tag LOCUS_70400 33123 32191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 33354 33857 gene locus_tag LOCUS_70410 33354 33857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70410 33904 34416 gene locus_tag LOCUS_70420 33904 34416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70420 34637 35023 gene locus_tag LOCUS_70430 34637 35023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70430 35103 36065 gene locus_tag LOCUS_70440 35103 36065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70440 36069 36821 gene locus_tag LOCUS_70450 36069 36821 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_70450 37716 36838 gene locus_tag LOCUS_70460 37716 36838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70460 38750 37812 gene locus_tag LOCUS_70470 38750 37812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_70470 39446 38877 gene locus_tag LOCUS_70480 39446 38877 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_70480 39833 40408 gene locus_tag LOCUS_70490 39833 40408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 >Feature sequence079 2450 546 gene locus_tag LOCUS_70500 2450 546 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_70500 2717 3232 gene locus_tag LOCUS_70510 2717 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70510 4089 3268 gene locus_tag LOCUS_70520 4089 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70520 4925 4089 gene locus_tag LOCUS_70530 4925 4089 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_70530 6429 4954 gene locus_tag LOCUS_70540 gene crtI 6429 4954 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_70540 7041 6622 gene locus_tag LOCUS_70550 7041 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70550 7203 10589 gene locus_tag LOCUS_70560 gene mfd 7203 10589 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_70560 11869 10631 gene locus_tag LOCUS_70570 11869 10631 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_70570 12025 12711 gene locus_tag LOCUS_70580 12025 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70580 12806 14308 gene locus_tag LOCUS_70590 12806 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70590 15323 14319 gene locus_tag LOCUS_70600 gene porQ 15323 14319 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714810.1 protein_id gnl|my_center|LOCUS_70600 16713 15400 gene locus_tag LOCUS_70610 16713 15400 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_70610 17145 19304 gene locus_tag LOCUS_70620 17145 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70620 19564 21084 gene locus_tag LOCUS_70630 19564 21084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70630 22267 21134 gene locus_tag LOCUS_70640 22267 21134 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_70640 24729 22435 gene locus_tag LOCUS_70650 24729 22435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70650 26282 24921 gene locus_tag LOCUS_70660 26282 24921 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_70660 27798 26551 gene locus_tag LOCUS_70670 27798 26551 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_70670 28690 27962 gene locus_tag LOCUS_70680 28690 27962 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_70680 28797 29183 gene locus_tag LOCUS_70690 28797 29183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70690 29295 31277 gene locus_tag LOCUS_70700 gene ftsH 29295 31277 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_70700 32026 31463 gene locus_tag LOCUS_70710 32026 31463 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_70710 32209 34119 gene locus_tag LOCUS_70720 32209 34119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70720 34365 34835 gene locus_tag LOCUS_70730 34365 34835 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_70730 34970 35281 gene locus_tag LOCUS_70740 34970 35281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 38679 35287 gene locus_tag LOCUS_70750 38679 35287 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123348.1 protein_id gnl|my_center|LOCUS_70750 >Feature sequence080 703 1548 gene locus_tag LOCUS_70760 703 1548 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_70760 2790 1852 gene locus_tag LOCUS_70770 2790 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70770 2913 4283 gene locus_tag LOCUS_70780 2913 4283 CDS product NlpC/P60 family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524287.1 protein_id gnl|my_center|LOCUS_70780 4405 5028 gene locus_tag LOCUS_70790 4405 5028 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939818.1 protein_id gnl|my_center|LOCUS_70790 8284 5129 gene locus_tag LOCUS_70800 8284 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_70800 8849 11236 gene locus_tag LOCUS_70810 8849 11236 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_70810 11338 12948 gene locus_tag LOCUS_70820 11338 12948 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_70820 13785 12976 gene locus_tag LOCUS_70830 13785 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 14587 13862 gene locus_tag LOCUS_70840 14587 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 15982 14690 gene locus_tag LOCUS_70850 15982 14690 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405198.1 protein_id gnl|my_center|LOCUS_70850 16370 17074 gene locus_tag LOCUS_70860 16370 17074 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_70860 17089 18546 gene locus_tag LOCUS_70870 17089 18546 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_70870 19561 18623 gene locus_tag LOCUS_70880 19561 18623 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_70880 20217 22181 gene locus_tag LOCUS_70890 20217 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 22318 25314 gene locus_tag LOCUS_70900 22318 25314 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_70900 25397 26923 gene locus_tag LOCUS_70910 25397 26923 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_70910 27068 28576 gene locus_tag LOCUS_70920 27068 28576 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_70920 28648 29121 gene locus_tag LOCUS_70930 28648 29121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70930 29193 29594 gene locus_tag LOCUS_70940 29193 29594 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810737.1 protein_id gnl|my_center|LOCUS_70940 29809 30843 gene locus_tag LOCUS_70950 29809 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70950 30943 31893 gene locus_tag LOCUS_70960 30943 31893 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531728.1 protein_id gnl|my_center|LOCUS_70960 32064 32678 gene locus_tag LOCUS_70970 32064 32678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70970 32659 33015 gene locus_tag LOCUS_70980 32659 33015 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_70980 33139 33870 gene locus_tag LOCUS_70990 33139 33870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70990 33990 34829 gene locus_tag LOCUS_71000 33990 34829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71000 >Feature sequence081 123 803 gene locus_tag LOCUS_71010 gene cmk 123 803 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_71010 800 1501 gene locus_tag LOCUS_71020 800 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71020 1619 3289 gene locus_tag LOCUS_71030 1619 3289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524145.1 protein_id gnl|my_center|LOCUS_71030 3725 3306 gene locus_tag LOCUS_71040 3725 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71040 4764 4093 gene locus_tag LOCUS_71050 4764 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71050 5960 4836 gene locus_tag LOCUS_71060 5960 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71060 6969 6100 gene locus_tag LOCUS_71070 6969 6100 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_71070 9487 7304 gene locus_tag LOCUS_71080 gene pnp 9487 7304 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_71080 10030 9755 gene locus_tag LOCUS_71090 gene rpsO 10030 9755 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964145.1 protein_id gnl|my_center|LOCUS_71090 11143 10181 gene locus_tag LOCUS_71100 11143 10181 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_71100 11981 11241 gene locus_tag LOCUS_71110 11981 11241 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_71110 12260 12580 gene locus_tag LOCUS_71120 12260 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71120 12619 13269 gene locus_tag LOCUS_71130 12619 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71130 13440 14420 gene locus_tag LOCUS_71140 13440 14420 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_71140 14970 14398 gene locus_tag LOCUS_71150 14970 14398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71150 15680 14967 gene locus_tag LOCUS_71160 gene hddC 15680 14967 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 protein_id gnl|my_center|LOCUS_71160 16256 15684 gene locus_tag LOCUS_71170 16256 15684 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_71170 17337 16312 gene locus_tag LOCUS_71180 17337 16312 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 protein_id gnl|my_center|LOCUS_71180 18562 17423 gene locus_tag LOCUS_71190 18562 17423 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_71190 19512 18559 gene locus_tag LOCUS_71200 19512 18559 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_71200 19938 19546 gene locus_tag LOCUS_71210 19938 19546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71210 20938 20348 gene locus_tag LOCUS_71220 20938 20348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71220 22400 21126 gene locus_tag LOCUS_71230 22400 21126 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_71230 24457 22541 gene locus_tag LOCUS_71240 24457 22541 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_71240 26323 25097 gene locus_tag LOCUS_71250 26323 25097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 27545 28489 gene locus_tag LOCUS_71260 27545 28489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71260 28652 29524 gene locus_tag LOCUS_71270 28652 29524 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_71270 29706 30686 gene locus_tag LOCUS_71280 gene desE 29706 30686 CDS product fatty acid desaturase DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399588.1 protein_id gnl|my_center|LOCUS_71280 33386 30717 gene locus_tag LOCUS_71290 33386 30717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_71290 33722 33399 gene locus_tag LOCUS_71300 33722 33399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71300 33920 34267 gene locus_tag LOCUS_71310 33920 34267 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_71310 >Feature sequence082 310 1047 gene locus_tag LOCUS_71320 310 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71320 1971 1231 gene locus_tag LOCUS_71330 gene rlmB 1971 1231 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_71330 2153 5686 gene locus_tag LOCUS_71340 2153 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71340 6861 5701 gene locus_tag LOCUS_71350 6861 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71350 7675 6956 gene locus_tag LOCUS_71360 7675 6956 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_71360 8145 8702 gene locus_tag LOCUS_71370 8145 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71370 8911 9366 gene locus_tag LOCUS_71380 8911 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71380 9438 10202 gene locus_tag LOCUS_71390 9438 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71390 10751 10227 gene locus_tag LOCUS_71400 10751 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71400 10877 11998 gene locus_tag LOCUS_71410 10877 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71410 12423 12004 gene locus_tag LOCUS_71420 gene folB 12423 12004 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_71420 12558 13775 gene locus_tag LOCUS_71430 12558 13775 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_71430 14342 15577 gene locus_tag LOCUS_71440 14342 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71440 16855 15620 gene locus_tag LOCUS_71450 gene aroA 16855 15620 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_71450 17142 16918 gene locus_tag LOCUS_71460 17142 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71460 18445 17450 gene locus_tag LOCUS_71470 18445 17450 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_71470 18733 19515 gene locus_tag LOCUS_71480 18733 19515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71480 19553 19840 gene locus_tag LOCUS_71490 19553 19840 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_71490 20238 19909 gene locus_tag LOCUS_71500 20238 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71500 20678 21607 gene locus_tag LOCUS_71510 gene aroB 20678 21607 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_71510 21799 24420 gene locus_tag LOCUS_71520 21799 24420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71520 24426 24773 gene locus_tag LOCUS_71530 24426 24773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71530 24896 26902 gene locus_tag LOCUS_71540 24896 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71540 26924 28027 gene locus_tag LOCUS_71550 gene gcvT 26924 28027 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_71550 28162 28662 gene locus_tag LOCUS_71560 28162 28662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71560 31168 28778 gene locus_tag LOCUS_71570 31168 28778 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_71570 32384 31419 gene locus_tag LOCUS_71580 32384 31419 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_71580 33064 32519 gene locus_tag LOCUS_71590 33064 32519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71590 33128 33700 gene locus_tag LOCUS_71600 33128 33700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71600 34214 33756 gene locus_tag LOCUS_71610 34214 33756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71610 >Feature sequence083 1218 175 gene locus_tag LOCUS_71620 1218 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71620 1721 1215 gene locus_tag LOCUS_71630 1721 1215 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903443.1 protein_id gnl|my_center|LOCUS_71630 2614 1724 gene locus_tag LOCUS_71640 2614 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71640 4334 2979 gene locus_tag LOCUS_71650 gene hemN 4334 2979 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_71650 4823 5113 gene locus_tag LOCUS_71660 4823 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 5501 6442 gene locus_tag LOCUS_71670 5501 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71670 6445 8274 gene locus_tag LOCUS_71680 6445 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71680 9174 8293 gene locus_tag LOCUS_71690 9174 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71690 10002 9571 gene locus_tag LOCUS_71700 10002 9571 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_71700 11690 10467 gene locus_tag LOCUS_71710 11690 10467 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_71710 12576 11905 gene locus_tag LOCUS_71720 12576 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 13087 12569 gene locus_tag LOCUS_71730 13087 12569 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_71730 13892 13122 gene locus_tag LOCUS_71740 gene bla2 13892 13122 CDS product BcII family subclass B1 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016124981.1 protein_id gnl|my_center|LOCUS_71740 14550 13885 gene locus_tag LOCUS_71750 14550 13885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71750 16424 14547 gene locus_tag LOCUS_71760 16424 14547 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_71760 16806 16453 gene locus_tag LOCUS_71770 16806 16453 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_71770 17783 16869 gene locus_tag LOCUS_71780 17783 16869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71780 18991 17864 gene locus_tag LOCUS_71790 18991 17864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71790 19219 20841 gene locus_tag LOCUS_71800 19219 20841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71800 21491 20838 gene locus_tag LOCUS_71810 21491 20838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71810 22355 22089 gene locus_tag LOCUS_71820 22355 22089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71820 22675 23802 gene locus_tag LOCUS_71830 22675 23802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71830 24085 25254 gene locus_tag LOCUS_71840 24085 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71840 25981 25400 gene locus_tag LOCUS_71850 25981 25400 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_71850 26771 26046 gene locus_tag LOCUS_71860 26771 26046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71860 27532 26786 gene locus_tag LOCUS_71870 27532 26786 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224574.1 protein_id gnl|my_center|LOCUS_71870 29185 27533 gene locus_tag LOCUS_71880 gene ggt 29185 27533 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_71880 30144 29410 gene locus_tag LOCUS_71890 30144 29410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71890 30985 30209 gene locus_tag LOCUS_71900 30985 30209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71900 32006 31176 gene locus_tag LOCUS_71910 32006 31176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71910 >Feature sequence084 1013 282 gene locus_tag LOCUS_71920 gene bshB1 1013 282 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_71920 1623 1144 gene locus_tag LOCUS_71930 1623 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71930 3570 1852 gene locus_tag LOCUS_71940 3570 1852 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_71940 5459 3741 gene locus_tag LOCUS_71950 5459 3741 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_71950 6590 5646 gene locus_tag LOCUS_71960 6590 5646 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922574.1 protein_id gnl|my_center|LOCUS_71960 6673 6942 gene locus_tag LOCUS_71970 6673 6942 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404796.1 protein_id gnl|my_center|LOCUS_71970 7187 7642 gene locus_tag LOCUS_71980 7187 7642 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_71980 8926 7949 gene locus_tag LOCUS_71990 8926 7949 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_71990 9051 10040 gene locus_tag LOCUS_72000 9051 10040 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_72000 12404 10053 gene locus_tag LOCUS_72010 12404 10053 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_72010 12639 13622 gene locus_tag LOCUS_72020 12639 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72020 16051 13760 gene locus_tag LOCUS_72030 16051 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72030 18237 16492 gene locus_tag LOCUS_72040 18237 16492 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918535.1 protein_id gnl|my_center|LOCUS_72040 18615 19526 gene locus_tag LOCUS_72050 18615 19526 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096918.1 protein_id gnl|my_center|LOCUS_72050 20313 19627 gene locus_tag LOCUS_72060 gene aqpZ 20313 19627 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_72060 20731 20808 gene locus_tag LOCUS_t00430 20731 20808 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21022 23295 gene locus_tag LOCUS_72070 21022 23295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72070 25118 23625 gene locus_tag LOCUS_72080 25118 23625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72080 26731 25331 gene locus_tag LOCUS_72090 26731 25331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72090 27346 26873 gene locus_tag LOCUS_72100 27346 26873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72100 28136 27444 gene locus_tag LOCUS_72110 28136 27444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72110 >Feature sequence085 3285 850 gene locus_tag LOCUS_72120 3285 850 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_72120 3523 4236 gene locus_tag LOCUS_72130 3523 4236 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_72130 5265 4243 gene locus_tag LOCUS_72140 5265 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72140 7708 5282 gene locus_tag LOCUS_72150 7708 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72150 8344 7844 gene locus_tag LOCUS_72160 gene folA 8344 7844 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973535.1 protein_id gnl|my_center|LOCUS_72160 8634 8353 gene locus_tag LOCUS_72170 8634 8353 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_72170 9073 8693 gene locus_tag LOCUS_72180 gene ytxJ 9073 8693 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_72180 11133 9478 gene locus_tag LOCUS_72190 11133 9478 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_72190 11889 11146 gene locus_tag LOCUS_72200 11889 11146 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122200.1 protein_id gnl|my_center|LOCUS_72200 12083 12532 gene locus_tag LOCUS_72210 gene umuD 12083 12532 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_72210 12653 13903 gene locus_tag LOCUS_72220 12653 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72220 15315 14455 gene locus_tag LOCUS_72230 gene tesB 15315 14455 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105107.1 protein_id gnl|my_center|LOCUS_72230 17100 15433 gene locus_tag LOCUS_72240 17100 15433 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_72240 17342 19051 gene locus_tag LOCUS_72250 17342 19051 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_72250 19172 19693 gene locus_tag LOCUS_72260 gene ftnA 19172 19693 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467599.1 protein_id gnl|my_center|LOCUS_72260 19936 20763 gene locus_tag LOCUS_72270 19936 20763 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_72270 20932 22881 gene locus_tag LOCUS_72280 20932 22881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72280 24155 22971 gene locus_tag LOCUS_72290 24155 22971 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223912.1 protein_id gnl|my_center|LOCUS_72290 24837 24304 gene locus_tag LOCUS_72300 24837 24304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72300 24950 26473 gene locus_tag LOCUS_72310 24950 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72310 26599 27432 gene locus_tag LOCUS_72320 26599 27432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72320 27603 28901 gene locus_tag LOCUS_72330 27603 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173416272.1 protein_id gnl|my_center|LOCUS_72330 >Feature sequence086 163 1368 gene locus_tag LOCUS_72340 163 1368 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261016.1 protein_id gnl|my_center|LOCUS_72340 1729 3258 gene locus_tag LOCUS_72350 1729 3258 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_72350 3395 4660 gene locus_tag LOCUS_72360 3395 4660 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_72360 4666 5448 gene locus_tag LOCUS_72370 4666 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72370 6013 9201 gene locus_tag LOCUS_72380 6013 9201 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714627.1 protein_id gnl|my_center|LOCUS_72380 9223 10638 gene locus_tag LOCUS_72390 9223 10638 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_72390 10955 13819 gene locus_tag LOCUS_72400 10955 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72400 14307 15530 gene locus_tag LOCUS_72410 14307 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72410 17964 15601 gene locus_tag LOCUS_72420 17964 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72420 19158 18130 gene locus_tag LOCUS_72430 19158 18130 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017237.1 protein_id gnl|my_center|LOCUS_72430 19513 19163 gene locus_tag LOCUS_72440 19513 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72440 19911 20669 gene locus_tag LOCUS_72450 19911 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72450 20870 21883 gene locus_tag LOCUS_72460 20870 21883 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_72460 22327 21890 gene locus_tag LOCUS_72470 22327 21890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72470 22975 22337 gene locus_tag LOCUS_72480 22975 22337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72480 26144 23025 gene locus_tag LOCUS_72490 26144 23025 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_72490 26526 27764 gene locus_tag LOCUS_72500 26526 27764 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_72500 >Feature sequence087 636 1361 gene locus_tag LOCUS_72510 636 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72510 1363 1932 gene locus_tag LOCUS_72520 1363 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 2295 1942 gene locus_tag LOCUS_72530 2295 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72530 3841 2540 gene locus_tag LOCUS_72540 3841 2540 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_72540 4012 4476 gene locus_tag LOCUS_72550 4012 4476 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_72550 4482 5129 gene locus_tag LOCUS_72560 4482 5129 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_72560 5875 5279 gene locus_tag LOCUS_72570 5875 5279 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_72570 6130 7314 gene locus_tag LOCUS_72580 6130 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72580 7358 7930 gene locus_tag LOCUS_72590 7358 7930 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016900.1 protein_id gnl|my_center|LOCUS_72590 8014 9273 gene locus_tag LOCUS_72600 8014 9273 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243737.1 protein_id gnl|my_center|LOCUS_72600 9326 9970 gene locus_tag LOCUS_72610 9326 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72610 9979 10428 gene locus_tag LOCUS_72620 9979 10428 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_72620 13492 10634 gene locus_tag LOCUS_72630 13492 10634 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_72630 15132 13507 gene locus_tag LOCUS_72640 gene nrfD 15132 13507 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_72640 17164 15356 gene locus_tag LOCUS_72650 gene sulP 17164 15356 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_72650 17432 18241 gene locus_tag LOCUS_72660 17432 18241 CDS product Stf0 sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727079.1 protein_id gnl|my_center|LOCUS_72660 19449 18937 gene locus_tag LOCUS_72670 19449 18937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72670 19811 19422 gene locus_tag LOCUS_72680 19811 19422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_72680 20049 20627 gene locus_tag LOCUS_72690 20049 20627 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_72690 24533 20760 gene locus_tag LOCUS_72700 24533 20760 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_72700 24908 25465 gene locus_tag LOCUS_72710 24908 25465 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795316.1 protein_id gnl|my_center|LOCUS_72710 25650 26210 gene locus_tag LOCUS_72720 25650 26210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72720 26179 27498 gene locus_tag LOCUS_72730 26179 27498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72730 >Feature sequence088 639 1304 gene locus_tag LOCUS_72740 639 1304 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_72740 2499 1357 gene locus_tag LOCUS_72750 gene aar 2499 1357 CDS product bifunctional L-alanine/L-glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_72750 3517 2729 gene locus_tag LOCUS_72760 3517 2729 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_72760 4895 3624 gene locus_tag LOCUS_72770 gene tyrS 4895 3624 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_72770 5203 6402 gene locus_tag LOCUS_72780 5203 6402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_72780 6823 7560 gene locus_tag LOCUS_72790 6823 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72790 7738 8685 gene locus_tag LOCUS_72800 7738 8685 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_72800 9157 10761 gene locus_tag LOCUS_72810 9157 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72810 12053 10767 gene locus_tag LOCUS_72820 12053 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72820 12856 12161 gene locus_tag LOCUS_72830 12856 12161 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_72830 14582 13074 gene locus_tag LOCUS_72840 14582 13074 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_72840 14770 15483 gene locus_tag LOCUS_72850 14770 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72850 15550 15981 gene locus_tag LOCUS_72860 15550 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72860 16652 16125 gene locus_tag LOCUS_72870 16652 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72870 17298 16834 gene locus_tag LOCUS_72880 17298 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72880 18623 17310 gene locus_tag LOCUS_72890 gene rimO 18623 17310 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_72890 18778 19560 gene locus_tag LOCUS_72900 18778 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72900 19550 19765 gene locus_tag LOCUS_72910 19550 19765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72910 19945 21630 gene locus_tag LOCUS_72920 gene ilvD 19945 21630 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_72920 21642 23381 gene locus_tag LOCUS_72930 gene ilvB 21642 23381 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_72930 23492 24034 gene locus_tag LOCUS_72940 gene ilvN 23492 24034 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_72940 24092 25597 gene locus_tag LOCUS_72950 24092 25597 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108446.1 protein_id gnl|my_center|LOCUS_72950 25654 26952 gene locus_tag LOCUS_72960 25654 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72960 >Feature sequence089 521 802 gene locus_tag LOCUS_72970 521 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72970 805 1272 gene locus_tag LOCUS_72980 805 1272 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142427.1 protein_id gnl|my_center|LOCUS_72980 1372 1911 gene locus_tag LOCUS_72990 1372 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72990 2602 3342 gene locus_tag LOCUS_73000 2602 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73000 3476 4312 gene locus_tag LOCUS_73010 3476 4312 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869940.1 protein_id gnl|my_center|LOCUS_73010 4436 4759 gene locus_tag LOCUS_73020 4436 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73020 4858 5622 gene locus_tag LOCUS_73030 4858 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73030 6206 5691 gene locus_tag LOCUS_73040 6206 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73040 6448 6846 gene locus_tag LOCUS_73050 6448 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73050 7823 6942 gene locus_tag LOCUS_73060 7823 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73060 8192 9346 gene locus_tag LOCUS_73070 8192 9346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73070 9850 10890 gene locus_tag LOCUS_73080 9850 10890 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970070.1 protein_id gnl|my_center|LOCUS_73080 10975 12312 gene locus_tag LOCUS_73090 10975 12312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73090 12539 13630 gene locus_tag LOCUS_73100 12539 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73100 13663 13911 gene locus_tag LOCUS_73110 13663 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73110 14289 14810 gene locus_tag LOCUS_73120 14289 14810 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_73120 15143 16612 gene locus_tag LOCUS_73130 15143 16612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73130 16827 18170 gene locus_tag LOCUS_73140 16827 18170 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070484.1 protein_id gnl|my_center|LOCUS_73140 18262 19068 gene locus_tag LOCUS_73150 18262 19068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73150 19554 20378 gene locus_tag LOCUS_73160 19554 20378 CDS product DUF4437 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616129.1 protein_id gnl|my_center|LOCUS_73160 20580 21680 gene locus_tag LOCUS_73170 20580 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73170 24128 22107 gene locus_tag LOCUS_73180 24128 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73180 24352 24197 gene locus_tag LOCUS_73190 24352 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73190 24750 25451 gene locus_tag LOCUS_73200 24750 25451 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_73200 25509 26069 gene locus_tag LOCUS_73210 25509 26069 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_73210 26369 26695 gene locus_tag LOCUS_73220 26369 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73220 >Feature sequence090 121 996 gene locus_tag LOCUS_73230 121 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73230 1077 2855 gene locus_tag LOCUS_73240 1077 2855 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_73240 2996 4405 gene locus_tag LOCUS_73250 2996 4405 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_73250 4519 5856 gene locus_tag LOCUS_73260 4519 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73260 8536 5951 gene locus_tag LOCUS_73270 8536 5951 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_73270 9729 8605 gene locus_tag LOCUS_73280 9729 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73280 11153 10233 gene locus_tag LOCUS_73290 11153 10233 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_73290 12747 11191 gene locus_tag LOCUS_73300 12747 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73300 13982 13077 gene locus_tag LOCUS_73310 13982 13077 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_73310 14543 14028 gene locus_tag LOCUS_73320 14543 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73320 14978 17095 gene locus_tag LOCUS_73330 14978 17095 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_73330 18046 17297 gene locus_tag LOCUS_73340 18046 17297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73340 18975 21242 gene locus_tag LOCUS_73350 18975 21242 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_73350 >Feature sequence091 199 684 gene locus_tag LOCUS_73360 199 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73360 1159 722 gene locus_tag LOCUS_73370 1159 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73370 2554 1253 gene locus_tag LOCUS_73380 2554 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73380 2653 3765 gene locus_tag LOCUS_73390 2653 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73390 5599 3902 gene locus_tag LOCUS_73400 5599 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73400 6645 5695 gene locus_tag LOCUS_73410 6645 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73410 7073 6642 gene locus_tag LOCUS_73420 7073 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 9374 7239 gene locus_tag LOCUS_73430 9374 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73430 9922 9461 gene locus_tag LOCUS_73440 9922 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73440 10189 9947 gene locus_tag LOCUS_73450 10189 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73450 10690 10292 gene locus_tag LOCUS_73460 10690 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73460 15680 10800 gene locus_tag LOCUS_73470 15680 10800 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_73470 17953 15863 gene locus_tag LOCUS_73480 17953 15863 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_73480 18708 18055 gene locus_tag LOCUS_73490 18708 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 18974 18762 gene locus_tag LOCUS_73500 18974 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73500 20297 19443 gene locus_tag LOCUS_73510 20297 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73510 <21140 20299 gene locus_tag LOCUS_73520 <21140 20299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:TonB-dependent receptor >Feature sequence092 384 2732 gene locus_tag LOCUS_73530 384 2732 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_73530 2743 3126 gene locus_tag LOCUS_73540 2743 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73540 4333 3194 gene locus_tag LOCUS_73550 4333 3194 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 protein_id gnl|my_center|LOCUS_73550 5425 4403 gene locus_tag LOCUS_73560 5425 4403 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_73560 6278 5430 gene locus_tag LOCUS_73570 6278 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73570 6608 6297 gene locus_tag LOCUS_73580 6608 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73580 7363 8037 gene locus_tag LOCUS_73590 7363 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73590 8216 9256 gene locus_tag LOCUS_73600 8216 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73600 9568 9350 gene locus_tag LOCUS_73610 9568 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73610 9770 11821 gene locus_tag LOCUS_73620 9770 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73620 11887 12912 gene locus_tag LOCUS_73630 11887 12912 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839725.1 protein_id gnl|my_center|LOCUS_73630 12909 13655 gene locus_tag LOCUS_73640 12909 13655 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_73640 15481 13661 gene locus_tag LOCUS_73650 15481 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73650 19802 15678 gene locus_tag LOCUS_73660 19802 15678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73660 20230 20565 gene locus_tag LOCUS_73670 20230 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73670 >Feature sequence093 948 1322 gene locus_tag LOCUS_73680 948 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73680 1337 1672 gene locus_tag LOCUS_73690 1337 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73690 1672 2448 gene locus_tag LOCUS_73700 1672 2448 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114245.1 protein_id gnl|my_center|LOCUS_73700 2699 3040 gene locus_tag LOCUS_73710 2699 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73710 3062 3904 gene locus_tag LOCUS_73720 3062 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73720 3934 4878 gene locus_tag LOCUS_73730 3934 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73730 5152 6882 gene locus_tag LOCUS_73740 5152 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73740 7178 8530 gene locus_tag LOCUS_73750 7178 8530 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001976156.1 protein_id gnl|my_center|LOCUS_73750 9470 8646 gene locus_tag LOCUS_73760 gene lgt 9470 8646 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_73760 10686 9484 gene locus_tag LOCUS_73770 10686 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73770 11913 10702 gene locus_tag LOCUS_73780 11913 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73780 12344 12583 gene locus_tag LOCUS_73790 12344 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73790 13460 12732 gene locus_tag LOCUS_73800 13460 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73800 13582 14550 gene locus_tag LOCUS_73810 13582 14550 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974978.1 protein_id gnl|my_center|LOCUS_73810 18544 14594 gene locus_tag LOCUS_73820 18544 14594 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_73820 19204 19725 gene locus_tag LOCUS_73830 19204 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73830 >Feature sequence094 2203 770 gene locus_tag LOCUS_73840 2203 770 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928742.1 protein_id gnl|my_center|LOCUS_73840 3929 2289 gene locus_tag LOCUS_73850 3929 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73850 4194 5888 gene locus_tag LOCUS_73860 4194 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73860 6031 8481 gene locus_tag LOCUS_73870 6031 8481 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_73870 8596 8856 gene locus_tag LOCUS_73880 8596 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73880 10214 9102 gene locus_tag LOCUS_73890 10214 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73890 10352 10915 gene locus_tag LOCUS_73900 10352 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73900 11693 10968 gene locus_tag LOCUS_73910 11693 10968 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_73910 12718 11690 gene locus_tag LOCUS_73920 12718 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73920 13030 13851 gene locus_tag LOCUS_73930 13030 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73930 13873 15021 gene locus_tag LOCUS_73940 13873 15021 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204630977.1 protein_id gnl|my_center|LOCUS_73940 16029 15142 gene locus_tag LOCUS_73950 16029 15142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73950 17300 16101 gene locus_tag LOCUS_73960 17300 16101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73960 17814 17446 gene locus_tag LOCUS_73970 17814 17446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 17914 18909 gene locus_tag LOCUS_73980 17914 18909 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_73980 >Feature sequence095 6355 5342 gene locus_tag LOCUS_73990 6355 5342 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213225.1 protein_id gnl|my_center|LOCUS_73990 6884 8263 gene locus_tag LOCUS_74000 6884 8263 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_74000 10194 8365 gene locus_tag LOCUS_74010 10194 8365 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066403458.1 protein_id gnl|my_center|LOCUS_74010 14197 10310 gene locus_tag LOCUS_74020 14197 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74020 14573 15790 gene locus_tag LOCUS_74030 14573 15790 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928471.1 protein_id gnl|my_center|LOCUS_74030 >Feature sequence096 3413 1005 gene locus_tag LOCUS_74040 3413 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74040 3689 4033 gene locus_tag LOCUS_74050 3689 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74050 4030 5115 gene locus_tag LOCUS_74060 4030 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74060 5984 5112 gene locus_tag LOCUS_74070 5984 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74070 6936 5992 gene locus_tag LOCUS_74080 6936 5992 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948477.1 protein_id gnl|my_center|LOCUS_74080 7468 7112 gene locus_tag LOCUS_74090 7468 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74090 7655 8725 gene locus_tag LOCUS_74100 7655 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74100 8952 10166 gene locus_tag LOCUS_74110 8952 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74110 11339 10344 gene locus_tag LOCUS_74120 11339 10344 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_74120 12105 11392 gene locus_tag LOCUS_74130 12105 11392 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_74130 12779 12102 gene locus_tag LOCUS_74140 12779 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74140 13393 14676 gene locus_tag LOCUS_74150 13393 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74150 15581 16117 gene locus_tag LOCUS_74160 15581 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74160 >Feature sequence097 9661 5429 gene locus_tag LOCUS_74170 9661 5429 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_74170 10589 9765 gene locus_tag LOCUS_74180 10589 9765 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 protein_id gnl|my_center|LOCUS_74180 12048 11224 gene locus_tag LOCUS_74190 12048 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74190 13322 12264 gene locus_tag LOCUS_74200 13322 12264 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_74200 13540 17550 gene locus_tag LOCUS_74210 13540 17550 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_74210 >Feature sequence098 368 2365 gene locus_tag LOCUS_74220 368 2365 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_74220 2372 3538 gene locus_tag LOCUS_74230 2372 3538 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839763.1 protein_id gnl|my_center|LOCUS_74230 4435 3587 gene locus_tag LOCUS_74240 4435 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74240 4824 5612 gene locus_tag LOCUS_74250 4824 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74250 5919 6512 gene locus_tag LOCUS_74260 5919 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74260 6632 7120 gene locus_tag LOCUS_74270 6632 7120 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120910.1 protein_id gnl|my_center|LOCUS_74270 7306 7671 gene locus_tag LOCUS_74280 7306 7671 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261019.1 protein_id gnl|my_center|LOCUS_74280 11538 7726 gene locus_tag LOCUS_74290 11538 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74290 13050 12109 gene locus_tag LOCUS_74300 gene queG 13050 12109 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_74300 13292 14236 gene locus_tag LOCUS_74310 13292 14236 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790660.1 protein_id gnl|my_center|LOCUS_74310 16635 14353 gene locus_tag LOCUS_74320 16635 14353 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_74320 17183 16836 gene locus_tag LOCUS_74330 17183 16836 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_74330 >Feature sequence099 1016 5197 gene locus_tag LOCUS_74340 1016 5197 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_74340 5435 9514 gene locus_tag LOCUS_74350 5435 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74350 9726 16694 gene locus_tag LOCUS_74360 9726 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74360 >Feature sequence100 13 1155 gene locus_tag LOCUS_74370 13 1155 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110021.1 protein_id gnl|my_center|LOCUS_74370 1212 2750 gene locus_tag LOCUS_74380 1212 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74380 2774 3304 gene locus_tag LOCUS_74390 2774 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74390 3537 3887 gene locus_tag LOCUS_74400 3537 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74400 4770 4054 gene locus_tag LOCUS_74410 4770 4054 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_74410 6031 5102 gene locus_tag LOCUS_74420 6031 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74420 8749 6089 gene locus_tag LOCUS_74430 8749 6089 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_74430 10060 9068 gene locus_tag LOCUS_74440 10060 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74440 10883 10305 gene locus_tag LOCUS_74450 10883 10305 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_74450 11332 12882 gene locus_tag LOCUS_74460 11332 12882 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_74460 13873 12929 gene locus_tag LOCUS_74470 13873 12929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74470 14468 13884 gene locus_tag LOCUS_74480 14468 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74480 15732 14533 gene locus_tag LOCUS_74490 15732 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74490 >Feature sequence101 2930 291 gene locus_tag LOCUS_74500 2930 291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_74500 3279 2938 gene locus_tag LOCUS_74510 3279 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74510 3606 4613 gene locus_tag LOCUS_74520 gene oruR 3606 4613 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_74520 5858 4665 gene locus_tag LOCUS_74530 5858 4665 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968044.1 protein_id gnl|my_center|LOCUS_74530 6012 6440 gene locus_tag LOCUS_74540 6012 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74540 7022 6489 gene locus_tag LOCUS_74550 7022 6489 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_74550 8339 8650 gene locus_tag LOCUS_74560 8339 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74560 8736 9281 gene locus_tag LOCUS_74570 8736 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74570 9311 9889 gene locus_tag LOCUS_74580 9311 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74580 12430 9977 gene locus_tag LOCUS_74590 12430 9977 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_74590 14041 12701 gene locus_tag LOCUS_74600 14041 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74600 15449 14235 gene locus_tag LOCUS_74610 15449 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74610 >Feature sequence102 1152 5348 gene locus_tag LOCUS_74620 1152 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74620 5598 6341 gene locus_tag LOCUS_74630 5598 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74630 6400 12006 gene locus_tag LOCUS_74640 6400 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74640 >Feature sequence103 8388 2815 gene locus_tag LOCUS_74650 8388 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74650 9475 8516 gene locus_tag LOCUS_74660 9475 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74660 11409 10159 gene locus_tag LOCUS_74670 11409 10159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_74670 11654 12718 gene locus_tag LOCUS_74680 gene queA 11654 12718 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_74680 12986 14128 gene locus_tag LOCUS_74690 12986 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74690 >Feature sequence104 985 188 gene locus_tag LOCUS_74700 985 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74700 1532 1119 gene locus_tag LOCUS_74710 1532 1119 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_74710 2174 1581 gene locus_tag LOCUS_74720 2174 1581 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_74720 2581 2276 gene locus_tag LOCUS_74730 gene trxA 2581 2276 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_74730 2851 4506 gene locus_tag LOCUS_74740 2851 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74740 5433 4552 gene locus_tag LOCUS_74750 5433 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74750 7109 5904 gene locus_tag LOCUS_74760 7109 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74760 8279 7329 gene locus_tag LOCUS_74770 8279 7329 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_74770 8734 10407 gene locus_tag LOCUS_74780 8734 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 10700 11554 gene locus_tag LOCUS_74790 10700 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74790 11610 13499 gene locus_tag LOCUS_74800 11610 13499 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_74800 >Feature sequence105 257 1681 gene locus_tag LOCUS_74810 257 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74810 2025 3851 gene locus_tag LOCUS_74820 2025 3851 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942091.1 protein_id gnl|my_center|LOCUS_74820 4226 4654 gene locus_tag LOCUS_74830 4226 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74830 5527 4760 gene locus_tag LOCUS_74840 5527 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74840 6312 8411 gene locus_tag LOCUS_74850 6312 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74850 >Feature sequence106 1243 272 gene locus_tag LOCUS_74860 gene pfkA 1243 272 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_74860 2107 1358 gene locus_tag LOCUS_74870 2107 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74870 2429 3043 gene locus_tag LOCUS_74880 2429 3043 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_74880 3126 4112 gene locus_tag LOCUS_74890 3126 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74890 4188 6149 gene locus_tag LOCUS_74900 4188 6149 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444445.1 protein_id gnl|my_center|LOCUS_74900 6267 6986 gene locus_tag LOCUS_74910 gene purQ 6267 6986 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880691.1 protein_id gnl|my_center|LOCUS_74910 7072 7536 gene locus_tag LOCUS_74920 7072 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74920 7538 8413 gene locus_tag LOCUS_74930 7538 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74930 8642 9490 gene locus_tag LOCUS_74940 8642 9490 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832657.1 protein_id gnl|my_center|LOCUS_74940 9751 10173 gene locus_tag LOCUS_74950 9751 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74950 10277 12769 gene locus_tag LOCUS_74960 10277 12769 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_74960 >Feature sequence107 3362 3652 gene locus_tag LOCUS_74970 3362 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74970 5478 3826 gene locus_tag LOCUS_74980 5478 3826 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265821.1 protein_id gnl|my_center|LOCUS_74980 5712 6068 gene locus_tag LOCUS_74990 5712 6068 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_74990 6281 9508 gene locus_tag LOCUS_75000 6281 9508 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_75000 10673 9627 gene locus_tag LOCUS_75010 10673 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75010 11393 10758 gene locus_tag LOCUS_75020 gene queE 11393 10758 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_75020 12696 11572 gene locus_tag LOCUS_75030 12696 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75030 >Feature sequence108 441 2633 gene locus_tag LOCUS_75040 441 2633 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_75040 3073 4566 gene locus_tag LOCUS_75050 3073 4566 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208888955.1 protein_id gnl|my_center|LOCUS_75050 4670 5077 gene locus_tag LOCUS_75060 4670 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75060 5175 7334 gene locus_tag LOCUS_75070 5175 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75070 8368 7331 gene locus_tag LOCUS_75080 8368 7331 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903063.1 protein_id gnl|my_center|LOCUS_75080 9473 8379 gene locus_tag LOCUS_75090 9473 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75090 10990 9476 gene locus_tag LOCUS_75100 10990 9476 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_75100 11730 11011 gene locus_tag LOCUS_75110 11730 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75110 12426 11986 gene locus_tag LOCUS_75120 12426 11986 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_75120 >Feature sequence109 371 817 gene locus_tag LOCUS_75130 371 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75130 1841 918 gene locus_tag LOCUS_75140 1841 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75140 2990 4012 gene locus_tag LOCUS_75150 2990 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75150 4052 6661 gene locus_tag LOCUS_75160 4052 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75160 >Feature sequence110 668 129 gene locus_tag LOCUS_75170 668 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75170 1862 1368 gene locus_tag LOCUS_75180 1862 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75180 2829 2029 gene locus_tag LOCUS_75190 2829 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75190 3279 2917 gene locus_tag LOCUS_75200 3279 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75200 4559 3285 gene locus_tag LOCUS_75210 4559 3285 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_75210 4891 4556 gene locus_tag LOCUS_75220 4891 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75220 5120 6013 gene locus_tag LOCUS_75230 5120 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75230 8178 6028 gene locus_tag LOCUS_75240 8178 6028 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_75240 10695 8314 gene locus_tag LOCUS_75250 10695 8314 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_75250 >Feature sequence111 512 3988 gene locus_tag LOCUS_75260 512 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75260 3985 5958 gene locus_tag LOCUS_75270 3985 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75270 >Feature sequence112 <1 1248 gene locus_tag LOCUS_75280 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029446868.1:two-component regulator propeller domain-containing protein 1477 7806 gene locus_tag LOCUS_75290 1477 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75290 >Feature sequence113 342 1442 gene locus_tag LOCUS_75300 342 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75300 1493 1921 gene locus_tag LOCUS_75310 1493 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75310 1921 2352 gene locus_tag LOCUS_75320 1921 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75320 2847 2650 gene locus_tag LOCUS_75330 2847 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75330 2831 7132 gene locus_tag LOCUS_75340 2831 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75340 7353 10595 gene locus_tag LOCUS_75350 7353 10595 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_75350 >Feature sequence114 <1 1142 gene locus_tag LOCUS_75360 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094146567.1:histidine kinase 1168 1914 gene locus_tag LOCUS_75370 1168 1914 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_75370 2004 2795 gene locus_tag LOCUS_75380 2004 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75380 3146 4753 gene locus_tag LOCUS_75390 3146 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75390 4846 5613 gene locus_tag LOCUS_75400 4846 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75400 5623 6915 gene locus_tag LOCUS_75410 5623 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75410 6967 7542 gene locus_tag LOCUS_75420 6967 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75420 >Feature sequence115 358 939 gene locus_tag LOCUS_75430 358 939 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_75430 936 1448 gene locus_tag LOCUS_75440 936 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75440 2787 1453 gene locus_tag LOCUS_75450 2787 1453 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_75450 3126 4862 gene locus_tag LOCUS_75460 3126 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75460 4966 6111 gene locus_tag LOCUS_75470 4966 6111 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_75470 7697 6291 gene locus_tag LOCUS_75480 7697 6291 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_75480 8189 8572 gene locus_tag LOCUS_75490 8189 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75490 8602 9480 gene locus_tag LOCUS_75500 8602 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75500 9804 10091 gene locus_tag LOCUS_75510 9804 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75510 >Feature sequence116 381 4508 gene locus_tag LOCUS_75520 381 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75520 >Feature sequence117 635 829 gene locus_tag LOCUS_75530 635 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75530 931 5178 gene locus_tag LOCUS_75540 931 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75540 5362 6177 gene locus_tag LOCUS_75550 5362 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75550 >Feature sequence118 2 553 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaccaaatcaacaaaattgaaaac 5334 2902 gene locus_tag LOCUS_75560 5334 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75560 6052 5336 gene locus_tag LOCUS_75570 6052 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75570 6198 6392 gene locus_tag LOCUS_75580 6198 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75580 6468 7775 gene locus_tag LOCUS_75590 6468 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75590 7889 8488 gene locus_tag LOCUS_75600 7889 8488 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704795.1 protein_id gnl|my_center|LOCUS_75600 >Feature sequence119 >Feature sequence120 7597 3551 gene locus_tag LOCUS_75610 7597 3551 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_75610 >Feature sequence121 123 1325 gene locus_tag LOCUS_75620 123 1325 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_75620 2379 1420 gene locus_tag LOCUS_75630 2379 1420 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_75630 3196 2852 gene locus_tag LOCUS_75640 3196 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75640 4337 3342 gene locus_tag LOCUS_75650 4337 3342 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_75650 5261 4533 gene locus_tag LOCUS_75660 5261 4533 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_75660 <7214 5277 gene locus_tag LOCUS_75670 <7214 5277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022280.1:COR domain-containing protein >Feature sequence122 <1 3814 gene locus_tag LOCUS_75680 <1 3814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029446868.1:two-component regulator propeller domain-containing protein 4111 4560 gene locus_tag LOCUS_75690 4111 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75690 >Feature sequence123 <1 666 gene locus_tag LOCUS_75700 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108607.1:hybrid sensor histidine kinase/response regulator transcription factor >Feature sequence124 >Feature sequence125 223 3660 gene locus_tag LOCUS_75710 223 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75710 >Feature sequence126 196 1332 gene locus_tag LOCUS_75720 gene hisC 196 1332 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_75720 2250 1405 gene locus_tag LOCUS_75730 2250 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75730 2430 2981 gene locus_tag LOCUS_75740 2430 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75740 >Feature sequence127 >Feature sequence128 <2723 291 gene locus_tag LOCUS_75750 <2723 291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121811552.1:ABC transporter permease >Feature sequence129 955 536 gene locus_tag LOCUS_75760 955 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75760 2053 968 gene locus_tag LOCUS_75770 2053 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75770