>Feature sequence01 1052 96 gene locus_tag LOCUS_00010 gene mdh 1052 96 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_00010 3326 1089 gene locus_tag LOCUS_00020 3326 1089 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_00020 4259 3411 gene locus_tag LOCUS_00030 gene mltG 4259 3411 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859067.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00030 4291 6855 gene locus_tag LOCUS_00040 4291 6855 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858480.1 protein_id gnl|my_center|LOCUS_00040 7483 6845 gene locus_tag LOCUS_00050 7483 6845 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853160.1 protein_id gnl|my_center|LOCUS_00050 7986 7486 gene locus_tag LOCUS_00060 7986 7486 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 protein_id gnl|my_center|LOCUS_00060 8417 8070 gene locus_tag LOCUS_00070 gene hypA 8417 8070 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 protein_id gnl|my_center|LOCUS_00070 9421 8417 gene locus_tag LOCUS_00080 gene hypE 9421 8417 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880633.1 protein_id gnl|my_center|LOCUS_00080 10542 9418 gene locus_tag LOCUS_00090 gene hypD 10542 9418 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 protein_id gnl|my_center|LOCUS_00090 10804 10535 gene locus_tag LOCUS_00100 10804 10535 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776342.1 protein_id gnl|my_center|LOCUS_00100 11665 10814 gene locus_tag LOCUS_00110 gene hypB 11665 10814 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_00110 11761 12441 gene locus_tag LOCUS_00120 11761 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12712 13455 gene locus_tag LOCUS_00130 12712 13455 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807737.1 protein_id gnl|my_center|LOCUS_00130 14348 13935 gene locus_tag LOCUS_00140 gene nikR 14348 13935 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380787.1 protein_id gnl|my_center|LOCUS_00140 16638 14425 gene locus_tag LOCUS_00150 gene hypF 16638 14425 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_00150 18301 16628 gene locus_tag LOCUS_00160 18301 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826526.1 protein_id gnl|my_center|LOCUS_00160 18837 18298 gene locus_tag LOCUS_00170 18837 18298 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859319.1 protein_id gnl|my_center|LOCUS_00170 19520 18849 gene locus_tag LOCUS_00180 gene cybH 19520 18849 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853164.1 protein_id gnl|my_center|LOCUS_00180 21290 19542 gene locus_tag LOCUS_00190 21290 19542 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853190.1 protein_id gnl|my_center|LOCUS_00190 22468 21308 gene locus_tag LOCUS_00200 22468 21308 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853195.1 protein_id gnl|my_center|LOCUS_00200 24101 22758 gene locus_tag LOCUS_00210 24101 22758 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880487.1 protein_id gnl|my_center|LOCUS_00210 24984 24085 gene locus_tag LOCUS_00220 24984 24085 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880486.1 protein_id gnl|my_center|LOCUS_00220 25568 24981 gene locus_tag LOCUS_00230 25568 24981 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880156.1 protein_id gnl|my_center|LOCUS_00230 25678 26076 gene locus_tag LOCUS_00240 25678 26076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27358 26105 gene locus_tag LOCUS_00250 27358 26105 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855462.1 protein_id gnl|my_center|LOCUS_00250 27485 29203 gene locus_tag LOCUS_00260 27485 29203 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_00260 29213 29524 gene locus_tag LOCUS_00270 29213 29524 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_00270 29937 29560 gene locus_tag LOCUS_00280 29937 29560 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 protein_id gnl|my_center|LOCUS_00280 30031 30546 gene locus_tag LOCUS_00290 30031 30546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30571 31041 gene locus_tag LOCUS_00300 30571 31041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31066 32316 gene locus_tag LOCUS_00310 31066 32316 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_00310 32336 33013 gene locus_tag LOCUS_00320 32336 33013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33794 33018 gene locus_tag LOCUS_00330 33794 33018 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816432.1 protein_id gnl|my_center|LOCUS_00330 34017 35777 gene locus_tag LOCUS_00340 34017 35777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36486 35782 gene locus_tag LOCUS_00350 gene fliP 36486 35782 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_00350 36368 36610 gene locus_tag LOCUS_00360 36368 36610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36641 37927 gene locus_tag LOCUS_00370 gene glmU 36641 37927 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852530.1 protein_id gnl|my_center|LOCUS_00370 37924 39138 gene locus_tag LOCUS_00380 gene coaBC 37924 39138 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852470.1 protein_id gnl|my_center|LOCUS_00380 39135 39869 gene locus_tag LOCUS_00390 39135 39869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39877 40605 gene locus_tag LOCUS_00400 39877 40605 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_00400 40598 41623 gene locus_tag LOCUS_00410 40598 41623 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852624.1 protein_id gnl|my_center|LOCUS_00410 41634 42371 gene locus_tag LOCUS_00420 gene truA 41634 42371 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203260.1 protein_id gnl|my_center|LOCUS_00420 43588 42368 gene locus_tag LOCUS_00430 43588 42368 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864549.1 protein_id gnl|my_center|LOCUS_00430 44673 43585 gene locus_tag LOCUS_00440 44673 43585 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444586.1 protein_id gnl|my_center|LOCUS_00440 45560 44673 gene locus_tag LOCUS_00450 45560 44673 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 protein_id gnl|my_center|LOCUS_00450 47007 45580 gene locus_tag LOCUS_00460 gene gatB 47007 45580 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 protein_id gnl|my_center|LOCUS_00460 47574 47017 gene locus_tag LOCUS_00470 gene thiE 47574 47017 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880880.1 protein_id gnl|my_center|LOCUS_00470 47836 47549 gene locus_tag LOCUS_00480 47836 47549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 48532 47855 gene locus_tag LOCUS_00490 48532 47855 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858390.1 protein_id gnl|my_center|LOCUS_00490 48808 48605 gene locus_tag LOCUS_00500 48808 48605 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388926.1 protein_id gnl|my_center|LOCUS_00500 50460 48808 gene locus_tag LOCUS_00510 gene sulP 50460 48808 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_00510 51263 50511 gene locus_tag LOCUS_00520 51263 50511 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_00520 52065 51253 gene locus_tag LOCUS_00530 52065 51253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_00530 53912 52065 gene locus_tag LOCUS_00540 gene flgK 53912 52065 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851396.1 protein_id gnl|my_center|LOCUS_00540 54342 53914 gene locus_tag LOCUS_00550 54342 53914 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779263.1 protein_id gnl|my_center|LOCUS_00550 54567 54367 gene locus_tag LOCUS_00560 54567 54367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 54923 54633 gene locus_tag LOCUS_00570 54923 54633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609401.1 protein_id gnl|my_center|LOCUS_00570 55978 54923 gene locus_tag LOCUS_00580 55978 54923 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858049.1 protein_id gnl|my_center|LOCUS_00580 56604 56023 gene locus_tag LOCUS_00590 56604 56023 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 protein_id gnl|my_center|LOCUS_00590 56947 56594 gene locus_tag LOCUS_00600 56947 56594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851272.1 protein_id gnl|my_center|LOCUS_00600 57068 57433 gene locus_tag LOCUS_00610 57068 57433 CDS product FlaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776146.1 protein_id gnl|my_center|LOCUS_00610 57437 59887 gene locus_tag LOCUS_00620 57437 59887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 59915 60292 gene locus_tag LOCUS_00630 gene fliS 59915 60292 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776169.1 protein_id gnl|my_center|LOCUS_00630 60231 60497 gene locus_tag LOCUS_00640 60231 60497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 60696 62498 gene locus_tag LOCUS_00650 60696 62498 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545125.1 protein_id gnl|my_center|LOCUS_00650 62590 63126 gene locus_tag LOCUS_00660 62590 63126 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_00660 63123 64424 gene locus_tag LOCUS_00670 63123 64424 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_00670 64421 64855 gene locus_tag LOCUS_00680 64421 64855 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_00680 65030 65719 gene locus_tag LOCUS_00690 65030 65719 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207221.1 protein_id gnl|my_center|LOCUS_00690 65716 67641 gene locus_tag LOCUS_00700 65716 67641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 67634 69856 gene locus_tag LOCUS_00710 67634 69856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 69921 71324 gene locus_tag LOCUS_00720 69921 71324 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931874.1 protein_id gnl|my_center|LOCUS_00720 71378 72304 gene locus_tag LOCUS_00730 71378 72304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 72301 73002 gene locus_tag LOCUS_00740 72301 73002 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_00740 72993 73937 gene locus_tag LOCUS_00750 72993 73937 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943863.1 protein_id gnl|my_center|LOCUS_00750 73934 75295 gene locus_tag LOCUS_00760 73934 75295 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_00760 75351 75614 gene locus_tag LOCUS_00770 75351 75614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 75866 77149 gene locus_tag LOCUS_00780 75866 77149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 77762 77139 gene locus_tag LOCUS_00790 77762 77139 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069098.1 protein_id gnl|my_center|LOCUS_00790 77904 78449 gene locus_tag LOCUS_00800 77904 78449 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 protein_id gnl|my_center|LOCUS_00800 78446 79087 gene locus_tag LOCUS_00810 gene pdxH 78446 79087 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072804.1 protein_id gnl|my_center|LOCUS_00810 79258 80031 gene locus_tag LOCUS_00820 gene motA 79258 80031 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366185.1 protein_id gnl|my_center|LOCUS_00820 80043 80837 gene locus_tag LOCUS_00830 gene motB 80043 80837 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085308.1 protein_id gnl|my_center|LOCUS_00830 80877 82709 gene locus_tag LOCUS_00840 80877 82709 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_00840 82738 83037 gene locus_tag LOCUS_00850 82738 83037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 83784 83044 gene locus_tag LOCUS_00860 gene phnP 83784 83044 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104089.1 protein_id gnl|my_center|LOCUS_00860 84891 83797 gene locus_tag LOCUS_00870 84891 83797 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858516.1 protein_id gnl|my_center|LOCUS_00870 85662 85147 gene locus_tag LOCUS_00880 85662 85147 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_00880 86551 85736 gene locus_tag LOCUS_00890 gene thiM 86551 85736 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861269.1 protein_id gnl|my_center|LOCUS_00890 87741 86530 gene locus_tag LOCUS_00900 gene cytX 87741 86530 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_00900 88541 87738 gene locus_tag LOCUS_00910 gene thiD 88541 87738 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_00910 91712 88755 gene locus_tag LOCUS_00920 91712 88755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 92926 91748 gene locus_tag LOCUS_00930 92926 91748 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542869.1 protein_id gnl|my_center|LOCUS_00930 94380 93295 gene locus_tag LOCUS_00940 gene truD 94380 93295 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851259.1 protein_id gnl|my_center|LOCUS_00940 95320 94502 gene locus_tag LOCUS_00950 95320 94502 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130232873.1 protein_id gnl|my_center|LOCUS_00950 95471 96148 gene locus_tag LOCUS_00960 95471 96148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 96158 97003 gene locus_tag LOCUS_00970 96158 97003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 97107 97493 gene locus_tag LOCUS_00980 97107 97493 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870246.1 protein_id gnl|my_center|LOCUS_00980 98352 97531 gene locus_tag LOCUS_00990 98352 97531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 99739 98345 gene locus_tag LOCUS_01000 99739 98345 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 protein_id gnl|my_center|LOCUS_01000 100024 99815 gene locus_tag LOCUS_01010 100024 99815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 101673 100036 gene locus_tag LOCUS_01020 gene sdhA 101673 100036 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_01020 102792 101674 gene locus_tag LOCUS_01030 102792 101674 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_01030 104113 102839 gene locus_tag LOCUS_01040 104113 102839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 104232 105356 gene locus_tag LOCUS_01050 104232 105356 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880235.1 protein_id gnl|my_center|LOCUS_01050 105353 105823 gene locus_tag LOCUS_01060 105353 105823 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_01060 105844 106107 gene locus_tag LOCUS_01070 105844 106107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 106209 106727 gene locus_tag LOCUS_01080 106209 106727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 106888 107310 gene locus_tag LOCUS_01090 106888 107310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 107329 107505 gene locus_tag LOCUS_01100 107329 107505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 107582 108703 gene locus_tag LOCUS_01110 107582 108703 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_01110 109453 108731 gene locus_tag LOCUS_01120 gene blaOXA 109453 108731 CDS product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246349.1 protein_id gnl|my_center|LOCUS_01120 110019 109453 gene locus_tag LOCUS_01130 110019 109453 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_01130 110686 110222 gene locus_tag LOCUS_01140 110686 110222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 112252 110687 gene locus_tag LOCUS_01150 112252 110687 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_01150 113929 112379 gene locus_tag LOCUS_01160 gene nifK 113929 112379 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_01160 115394 113940 gene locus_tag LOCUS_01170 gene nifD 115394 113940 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_01170 115786 115427 gene locus_tag LOCUS_01180 115786 115427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 116815 115904 gene locus_tag LOCUS_01190 gene nifH 116815 115904 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084578.1 protein_id gnl|my_center|LOCUS_01190 116992 117456 gene locus_tag LOCUS_01200 116992 117456 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186668.1 protein_id gnl|my_center|LOCUS_01200 119178 117556 gene locus_tag LOCUS_01210 119178 117556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 119907 119260 gene locus_tag LOCUS_01220 119907 119260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 120657 119998 gene locus_tag LOCUS_01230 120657 119998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 121365 120736 gene locus_tag LOCUS_01240 121365 120736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 122251 121442 gene locus_tag LOCUS_01250 122251 121442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074291.1 protein_id gnl|my_center|LOCUS_01250 123135 122332 gene locus_tag LOCUS_01260 123135 122332 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 protein_id gnl|my_center|LOCUS_01260 123415 123837 gene locus_tag LOCUS_01270 123415 123837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 123858 124244 gene locus_tag LOCUS_01280 123858 124244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 124381 125235 gene locus_tag LOCUS_01290 124381 125235 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967356.1 protein_id gnl|my_center|LOCUS_01290 125882 125283 gene locus_tag LOCUS_01300 125882 125283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 125983 127371 gene locus_tag LOCUS_01310 125983 127371 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948365.1 protein_id gnl|my_center|LOCUS_01310 127992 127471 gene locus_tag LOCUS_01320 127992 127471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 128992 128042 gene locus_tag LOCUS_01330 128992 128042 CDS product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940923.1 protein_id gnl|my_center|LOCUS_01330 129167 130192 gene locus_tag LOCUS_01340 129167 130192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 130852 130253 gene locus_tag LOCUS_01350 130852 130253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 131289 130849 gene locus_tag LOCUS_01360 131289 130849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 131908 131405 gene locus_tag LOCUS_01370 131908 131405 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210404.1 protein_id gnl|my_center|LOCUS_01370 132813 131917 gene locus_tag LOCUS_01380 132813 131917 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480227.1 protein_id gnl|my_center|LOCUS_01380 133583 133254 gene locus_tag LOCUS_01390 133583 133254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 134818 133580 gene locus_tag LOCUS_01400 134818 133580 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996418.1 protein_id gnl|my_center|LOCUS_01400 135169 134873 gene locus_tag LOCUS_01410 gene fdxC 135169 134873 CDS product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_01410 135522 135184 gene locus_tag LOCUS_01420 135522 135184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 135906 135538 gene locus_tag LOCUS_01430 135906 135538 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153326.1 protein_id gnl|my_center|LOCUS_01430 136225 135896 gene locus_tag LOCUS_01440 136225 135896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 136751 136236 gene locus_tag LOCUS_01450 gene fldA 136751 136236 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855629.1 protein_id gnl|my_center|LOCUS_01450 137196 136765 gene locus_tag LOCUS_01460 137196 136765 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_01460 137551 137201 gene locus_tag LOCUS_01470 gene nifX 137551 137201 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533486.1 protein_id gnl|my_center|LOCUS_01470 137823 139250 gene locus_tag LOCUS_01480 137823 139250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 139243 139938 gene locus_tag LOCUS_01490 139243 139938 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_01490 140711 139935 gene locus_tag LOCUS_01500 140711 139935 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268243.1 protein_id gnl|my_center|LOCUS_01500 141966 140716 gene locus_tag LOCUS_01510 141966 140716 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_01510 142508 141945 gene locus_tag LOCUS_01520 142508 141945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 143473 142508 gene locus_tag LOCUS_01530 143473 142508 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401457.1 protein_id gnl|my_center|LOCUS_01530 143707 144363 gene locus_tag LOCUS_01540 143707 144363 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819982.1 protein_id gnl|my_center|LOCUS_01540 144391 144957 gene locus_tag LOCUS_01550 144391 144957 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286813.1 protein_id gnl|my_center|LOCUS_01550 145049 146866 gene locus_tag LOCUS_01560 145049 146866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 149408 146898 gene locus_tag LOCUS_01570 149408 146898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 150695 149430 gene locus_tag LOCUS_01580 gene nifN 150695 149430 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533487.1 protein_id gnl|my_center|LOCUS_01580 152050 150692 gene locus_tag LOCUS_01590 gene nifE 152050 150692 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_01590 152174 152551 gene locus_tag LOCUS_01600 152174 152551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 152553 152939 gene locus_tag LOCUS_01610 gene nifX 152553 152939 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545689.1 protein_id gnl|my_center|LOCUS_01610 152908 154134 gene locus_tag LOCUS_01620 152908 154134 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 protein_id gnl|my_center|LOCUS_01620 154277 155368 gene locus_tag LOCUS_01630 154277 155368 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545957.1 protein_id gnl|my_center|LOCUS_01630 157991 155358 gene locus_tag LOCUS_01640 157991 155358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 158114 159547 gene locus_tag LOCUS_01650 gene nifB 158114 159547 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_01650 159550 160665 gene locus_tag LOCUS_01660 gene nifV 159550 160665 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941605.1 protein_id gnl|my_center|LOCUS_01660 160666 160923 gene locus_tag LOCUS_01670 160666 160923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 160916 161911 gene locus_tag LOCUS_01680 160916 161911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 161956 162618 gene locus_tag LOCUS_01690 161956 162618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 162615 163868 gene locus_tag LOCUS_01700 162615 163868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 164223 163852 gene locus_tag LOCUS_01710 164223 163852 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_01710 164969 164271 gene locus_tag LOCUS_01720 164969 164271 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_01720 165304 166020 gene locus_tag LOCUS_01730 gene cas6 165304 166020 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986678.1 protein_id gnl|my_center|LOCUS_01730 166017 167702 gene locus_tag LOCUS_01740 166017 167702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 167704 168597 gene locus_tag LOCUS_01750 167704 168597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 168601 169353 gene locus_tag LOCUS_01760 168601 169353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 169340 171709 gene locus_tag LOCUS_01770 169340 171709 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_01770 171706 172200 gene locus_tag LOCUS_01780 gene cas4 171706 172200 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180703501.1 protein_id gnl|my_center|LOCUS_01780 172209 173213 gene locus_tag LOCUS_01790 gene cas1b 172209 173213 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_01790 173210 173521 gene locus_tag LOCUS_01800 gene cas2 173210 173521 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546411.1 protein_id gnl|my_center|LOCUS_01800 173689 177520 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaaccgacacaaaggttgtattgaaac 177687 178655 gene locus_tag LOCUS_01810 177687 178655 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_01810 178740 178907 gene locus_tag LOCUS_01820 178740 178907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 179511 178924 gene locus_tag LOCUS_01830 179511 178924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 179622 180023 gene locus_tag LOCUS_01840 179622 180023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 181009 180092 gene locus_tag LOCUS_01850 181009 180092 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_01850 181461 181024 gene locus_tag LOCUS_01860 181461 181024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 181596 182381 gene locus_tag LOCUS_01870 181596 182381 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937402.1 protein_id gnl|my_center|LOCUS_01870 182394 183203 gene locus_tag LOCUS_01880 182394 183203 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857898.1 protein_id gnl|my_center|LOCUS_01880 183215 183622 gene locus_tag LOCUS_01890 183215 183622 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113677.1 protein_id gnl|my_center|LOCUS_01890 184132 183626 gene locus_tag LOCUS_01900 184132 183626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 185855 184164 gene locus_tag LOCUS_01910 185855 184164 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884040.1 protein_id gnl|my_center|LOCUS_01910 186902 185880 gene locus_tag LOCUS_01920 186902 185880 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852104.1 protein_id gnl|my_center|LOCUS_01920 187027 187102 gene locus_tag LOCUS_t00010 187027 187102 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 187122 187196 gene locus_tag LOCUS_t00020 187122 187196 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 187431 187883 gene locus_tag LOCUS_01930 187431 187883 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203336.1 protein_id gnl|my_center|LOCUS_01930 187933 188499 gene locus_tag LOCUS_01940 187933 188499 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_01940 188564 189280 gene locus_tag LOCUS_01950 188564 189280 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399305.1 protein_id gnl|my_center|LOCUS_01950 189371 190549 gene locus_tag LOCUS_01960 189371 190549 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462380.1 protein_id gnl|my_center|LOCUS_01960 190639 192045 gene locus_tag LOCUS_01970 190639 192045 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963764.1 protein_id gnl|my_center|LOCUS_01970 192058 192537 gene locus_tag LOCUS_01980 gene ybaK 192058 192537 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_01980 192852 194066 gene locus_tag LOCUS_01990 192852 194066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 194068 196242 gene locus_tag LOCUS_02000 194068 196242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 196232 197959 gene locus_tag LOCUS_02010 196232 197959 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528391.1 protein_id gnl|my_center|LOCUS_02010 198645 197956 gene locus_tag LOCUS_02020 198645 197956 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_02020 198765 200054 gene locus_tag LOCUS_02030 198765 200054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 200030 202171 gene locus_tag LOCUS_02040 200030 202171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 202393 202887 gene locus_tag LOCUS_02050 202393 202887 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869004.1 protein_id gnl|my_center|LOCUS_02050 203010 203915 gene locus_tag LOCUS_02060 203010 203915 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 protein_id gnl|my_center|LOCUS_02060 204634 203975 gene locus_tag LOCUS_02070 204634 203975 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687969.1 protein_id gnl|my_center|LOCUS_02070 205421 204855 gene locus_tag LOCUS_02080 205421 204855 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856055.1 protein_id gnl|my_center|LOCUS_02080 206092 205430 gene locus_tag LOCUS_02090 206092 205430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 207885 206098 gene locus_tag LOCUS_02100 207885 206098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261885.1 protein_id gnl|my_center|LOCUS_02100 209496 207943 gene locus_tag LOCUS_02110 gene rny 209496 207943 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 protein_id gnl|my_center|LOCUS_02110 210133 210684 gene locus_tag LOCUS_02120 210133 210684 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858112.1 protein_id gnl|my_center|LOCUS_02120 210687 211574 gene locus_tag LOCUS_02130 gene ftsY 210687 211574 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864556.1 protein_id gnl|my_center|LOCUS_02130 211567 212919 gene locus_tag LOCUS_02140 gene radA 211567 212919 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858434.1 protein_id gnl|my_center|LOCUS_02140 212982 213527 gene locus_tag LOCUS_02150 gene fliL 212982 213527 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780442.1 protein_id gnl|my_center|LOCUS_02150 213524 213922 gene locus_tag LOCUS_02160 gene acpS 213524 213922 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579175.1 protein_id gnl|my_center|LOCUS_02160 214096 213899 gene locus_tag LOCUS_02170 214096 213899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 215131 214106 gene locus_tag LOCUS_02180 215131 214106 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256047.1 protein_id gnl|my_center|LOCUS_02180 216308 215121 gene locus_tag LOCUS_02190 216308 215121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 217473 216286 gene locus_tag LOCUS_02200 217473 216286 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_02200 218111 217503 gene locus_tag LOCUS_02210 218111 217503 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979664.1 protein_id gnl|my_center|LOCUS_02210 218500 218111 gene locus_tag LOCUS_02220 gene ruvX 218500 218111 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852281.1 protein_id gnl|my_center|LOCUS_02220 219053 218580 gene locus_tag LOCUS_02230 219053 218580 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_02230 219884 219078 gene locus_tag LOCUS_02240 219884 219078 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_02240 220668 219895 gene locus_tag LOCUS_02250 gene dprA 220668 219895 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077645213.1 protein_id gnl|my_center|LOCUS_02250 221831 220677 gene locus_tag LOCUS_02260 221831 220677 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873647.1 protein_id gnl|my_center|LOCUS_02260 222079 221840 gene locus_tag LOCUS_02270 222079 221840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 222885 222076 gene locus_tag LOCUS_02280 gene minD 222885 222076 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019069.1 protein_id gnl|my_center|LOCUS_02280 223984 222962 gene locus_tag LOCUS_02290 gene ilvC 223984 222962 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858483.1 protein_id gnl|my_center|LOCUS_02290 224146 224958 gene locus_tag LOCUS_02300 gene cheP 224146 224958 CDS product cheVAW transcriptional regulator CheP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851703.1 protein_id gnl|my_center|LOCUS_02300 224955 226901 gene locus_tag LOCUS_02310 224955 226901 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 protein_id gnl|my_center|LOCUS_02310 226894 227880 gene locus_tag LOCUS_02320 226894 227880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 228010 228432 gene locus_tag LOCUS_02330 228010 228432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 228446 228928 gene locus_tag LOCUS_02340 228446 228928 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482414.1 protein_id gnl|my_center|LOCUS_02340 228950 229216 gene locus_tag LOCUS_02350 gene rpsR 228950 229216 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 protein_id gnl|my_center|LOCUS_02350 231692 229269 gene locus_tag LOCUS_02360 gene lon 231692 229269 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868636.1 protein_id gnl|my_center|LOCUS_02360 232448 231804 gene locus_tag LOCUS_02370 232448 231804 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852961.1 protein_id gnl|my_center|LOCUS_02370 232616 233008 gene locus_tag LOCUS_02380 gene fliW 232616 233008 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852982.1 protein_id gnl|my_center|LOCUS_02380 233074 236949 gene locus_tag LOCUS_02390 233074 236949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 236946 237626 gene locus_tag LOCUS_02400 236946 237626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 237626 238522 gene locus_tag LOCUS_02410 237626 238522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 238540 238980 gene locus_tag LOCUS_02420 238540 238980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 239071 239586 gene locus_tag LOCUS_02430 gene raiA 239071 239586 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887725.1 protein_id gnl|my_center|LOCUS_02430 241433 239583 gene locus_tag LOCUS_02440 gene recG 241433 239583 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858588.1 protein_id gnl|my_center|LOCUS_02440 242673 241420 gene locus_tag LOCUS_02450 242673 241420 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714010.1 protein_id gnl|my_center|LOCUS_02450 243764 242715 gene locus_tag LOCUS_02460 243764 242715 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_02460 244261 243761 gene locus_tag LOCUS_02470 244261 243761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 244538 244254 gene locus_tag LOCUS_02480 244538 244254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 245824 244535 gene locus_tag LOCUS_02490 gene hemL 245824 244535 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421462.1 protein_id gnl|my_center|LOCUS_02490 246288 245905 gene locus_tag LOCUS_02500 246288 245905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 246359 247198 gene locus_tag LOCUS_02510 gene folD 246359 247198 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_02510 247215 248042 gene locus_tag LOCUS_02520 gene lepB 247215 248042 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_02520 248042 248695 gene locus_tag LOCUS_02530 248042 248695 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159394.1 protein_id gnl|my_center|LOCUS_02530 248757 249185 gene locus_tag LOCUS_02540 gene rpiB 248757 249185 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_02540 249188 249520 gene locus_tag LOCUS_02550 249188 249520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853247.1 protein_id gnl|my_center|LOCUS_02550 249617 250174 gene locus_tag LOCUS_02560 gene apt 249617 250174 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853297.1 protein_id gnl|my_center|LOCUS_02560 250175 251380 gene locus_tag LOCUS_02570 gene trpB 250175 251380 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_02570 251401 252000 gene locus_tag LOCUS_02580 251401 252000 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853249.1 protein_id gnl|my_center|LOCUS_02580 251978 253429 gene locus_tag LOCUS_02590 251978 253429 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853317.1 protein_id gnl|my_center|LOCUS_02590 253453 254022 gene locus_tag LOCUS_02600 253453 254022 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853263.1 protein_id gnl|my_center|LOCUS_02600 254022 254861 gene locus_tag LOCUS_02610 254022 254861 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853285.1 protein_id gnl|my_center|LOCUS_02610 254972 256207 gene locus_tag LOCUS_02620 254972 256207 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481619.1 protein_id gnl|my_center|LOCUS_02620 257096 256242 gene locus_tag LOCUS_02630 gene htpX 257096 256242 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_02630 258286 257096 gene locus_tag LOCUS_02640 258286 257096 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_02640 258651 258280 gene locus_tag LOCUS_02650 258651 258280 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_02650 259331 258720 gene locus_tag LOCUS_02660 259331 258720 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086891.1 protein_id gnl|my_center|LOCUS_02660 261153 259333 gene locus_tag LOCUS_02670 261153 259333 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388392.1 protein_id gnl|my_center|LOCUS_02670 261277 261528 gene locus_tag LOCUS_02680 261277 261528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 262071 261511 gene locus_tag LOCUS_02690 262071 261511 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691652.1 protein_id gnl|my_center|LOCUS_02690 262244 263152 gene locus_tag LOCUS_02700 262244 263152 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940340.1 protein_id gnl|my_center|LOCUS_02700 265327 263147 gene locus_tag LOCUS_02710 gene copA 265327 263147 CDS product copper-translocating P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877980.1 protein_id gnl|my_center|LOCUS_02710 265695 265336 gene locus_tag LOCUS_02720 265695 265336 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_02720 265907 265695 gene locus_tag LOCUS_02730 265907 265695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 266725 266141 gene locus_tag LOCUS_02740 266725 266141 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764615.1 protein_id gnl|my_center|LOCUS_02740 268098 266722 gene locus_tag LOCUS_02750 268098 266722 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_02750 268838 268095 gene locus_tag LOCUS_02760 268838 268095 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_02760 269624 268998 gene locus_tag LOCUS_02770 269624 268998 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192730530.1 protein_id gnl|my_center|LOCUS_02770 269721 270356 gene locus_tag LOCUS_02780 269721 270356 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 protein_id gnl|my_center|LOCUS_02780 270437 270958 gene locus_tag LOCUS_02790 270437 270958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 271952 271023 gene locus_tag LOCUS_02800 271952 271023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 272464 272039 gene locus_tag LOCUS_02810 272464 272039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 273236 272484 gene locus_tag LOCUS_02820 273236 272484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 273865 273233 gene locus_tag LOCUS_02830 gene thiE 273865 273233 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064930.1 protein_id gnl|my_center|LOCUS_02830 275793 274162 gene locus_tag LOCUS_02840 275793 274162 CDS product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650259.1 protein_id gnl|my_center|LOCUS_02840 276809 275790 gene locus_tag LOCUS_02850 gene mnmA 276809 275790 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686217.1 protein_id gnl|my_center|LOCUS_02850 278051 276813 gene locus_tag LOCUS_02860 278051 276813 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202226.1 protein_id gnl|my_center|LOCUS_02860 279329 278061 gene locus_tag LOCUS_02870 gene cysG 279329 278061 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707310.1 protein_id gnl|my_center|LOCUS_02870 281611 279326 gene locus_tag LOCUS_02880 281611 279326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 282006 281608 gene locus_tag LOCUS_02890 282006 281608 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_02890 282809 282003 gene locus_tag LOCUS_02900 gene moeB 282809 282003 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_02900 283012 282806 gene locus_tag LOCUS_02910 gene thiS 283012 282806 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_02910 284358 283027 gene locus_tag LOCUS_02920 284358 283027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 285236 284358 gene locus_tag LOCUS_02930 285236 284358 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_02930 286208 285522 gene locus_tag LOCUS_02940 286208 285522 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_02940 286432 286205 gene locus_tag LOCUS_02950 286432 286205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 286651 288024 gene locus_tag LOCUS_02960 286651 288024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 288021 288680 gene locus_tag LOCUS_02970 288021 288680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02970 288677 289627 gene locus_tag LOCUS_02980 288677 289627 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_02980 289624 290574 gene locus_tag LOCUS_02990 289624 290574 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_02990 291585 290680 gene locus_tag LOCUS_03000 291585 290680 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_03000 294077 291588 gene locus_tag LOCUS_03010 294077 291588 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105233.1 protein_id gnl|my_center|LOCUS_03010 297446 294081 gene locus_tag LOCUS_03020 297446 294081 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_03020 297595 297777 gene locus_tag LOCUS_03030 297595 297777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 297897 299195 gene locus_tag LOCUS_03040 gene dinB 297897 299195 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_03040 299267 299572 gene locus_tag LOCUS_03050 299267 299572 CDS product DUF6172 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275192.1 protein_id gnl|my_center|LOCUS_03050 300878 300285 gene locus_tag LOCUS_03060 300878 300285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 301032 301187 gene locus_tag LOCUS_03070 301032 301187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 301226 301849 gene locus_tag LOCUS_03080 301226 301849 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_03080 302881 301883 gene locus_tag LOCUS_03090 302881 301883 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971182.1 protein_id gnl|my_center|LOCUS_03090 302992 303378 gene locus_tag LOCUS_03100 302992 303378 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257301.1 protein_id gnl|my_center|LOCUS_03100 304289 303375 gene locus_tag LOCUS_03110 304289 303375 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_03110 306170 304359 gene locus_tag LOCUS_03120 306170 304359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880803.1 protein_id gnl|my_center|LOCUS_03120 308073 306229 gene locus_tag LOCUS_03130 308073 306229 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550684.1 protein_id gnl|my_center|LOCUS_03130 308615 308118 gene locus_tag LOCUS_03140 308615 308118 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927248.1 protein_id gnl|my_center|LOCUS_03140 308899 309912 gene locus_tag LOCUS_03150 308899 309912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 309931 310383 gene locus_tag LOCUS_03160 309931 310383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 310395 311927 gene locus_tag LOCUS_03170 310395 311927 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463023.1 protein_id gnl|my_center|LOCUS_03170 312017 313069 gene locus_tag LOCUS_03180 312017 313069 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_03180 313339 314709 gene locus_tag LOCUS_03190 gene tcuA 313339 314709 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208452.1 protein_id gnl|my_center|LOCUS_03190 314702 315814 gene locus_tag LOCUS_03200 gene tcuB 314702 315814 CDS product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085110.1 protein_id gnl|my_center|LOCUS_03200 315970 316953 gene locus_tag LOCUS_03210 315970 316953 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039572.1 protein_id gnl|my_center|LOCUS_03210 318301 316916 gene locus_tag LOCUS_03220 318301 316916 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972344.1 protein_id gnl|my_center|LOCUS_03220 318959 318291 gene locus_tag LOCUS_03230 318959 318291 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812947.1 protein_id gnl|my_center|LOCUS_03230 319148 321511 gene locus_tag LOCUS_03240 319148 321511 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_03240 322638 321565 gene locus_tag LOCUS_03250 322638 321565 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852104.1 protein_id gnl|my_center|LOCUS_03250 323316 322651 gene locus_tag LOCUS_03260 gene ribA 323316 322651 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_03260 325089 323380 gene locus_tag LOCUS_03270 325089 323380 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813627.1 protein_id gnl|my_center|LOCUS_03270 325819 325181 gene locus_tag LOCUS_03280 325819 325181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 326304 325795 gene locus_tag LOCUS_03290 326304 325795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 327163 326471 gene locus_tag LOCUS_03300 327163 326471 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958089.1 protein_id gnl|my_center|LOCUS_03300 328325 327144 gene locus_tag LOCUS_03310 328325 327144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 328825 328433 gene locus_tag LOCUS_03320 328825 328433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 329587 328928 gene locus_tag LOCUS_03330 329587 328928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 331058 329787 gene locus_tag LOCUS_03340 331058 329787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 331837 332487 gene locus_tag LOCUS_03350 331837 332487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 332487 334427 gene locus_tag LOCUS_03360 gene hyfB 332487 334427 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_03360 334435 335352 gene locus_tag LOCUS_03370 334435 335352 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393677.1 protein_id gnl|my_center|LOCUS_03370 335354 336001 gene locus_tag LOCUS_03380 gene hyfE 335354 336001 CDS product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393676.1 protein_id gnl|my_center|LOCUS_03380 336003 337472 gene locus_tag LOCUS_03390 336003 337472 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_03390 337481 339220 gene locus_tag LOCUS_03400 337481 339220 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393673.1 protein_id gnl|my_center|LOCUS_03400 339217 339756 gene locus_tag LOCUS_03410 gene hyfH 339217 339756 CDS product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916059.1 protein_id gnl|my_center|LOCUS_03410 339753 340574 gene locus_tag LOCUS_03420 339753 340574 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393671.1 protein_id gnl|my_center|LOCUS_03420 340575 340925 gene locus_tag LOCUS_03430 340575 340925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 340947 341393 gene locus_tag LOCUS_03440 340947 341393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 341908 343029 gene locus_tag LOCUS_03450 341908 343029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 343131 344264 gene locus_tag LOCUS_03460 343131 344264 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_03460 346186 344510 gene locus_tag LOCUS_03470 346186 344510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 351425 346179 gene locus_tag LOCUS_03480 351425 346179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 354543 351604 gene locus_tag LOCUS_03490 354543 351604 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064929.1 protein_id gnl|my_center|LOCUS_03490 355535 354540 gene locus_tag LOCUS_03500 355535 354540 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_03500 356350 355535 gene locus_tag LOCUS_03510 356350 355535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688774.1 protein_id gnl|my_center|LOCUS_03510 356958 356347 gene locus_tag LOCUS_03520 356958 356347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002239757.1 protein_id gnl|my_center|LOCUS_03520 358244 356958 gene locus_tag LOCUS_03530 358244 356958 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167385843.1 protein_id gnl|my_center|LOCUS_03530 360594 358246 gene locus_tag LOCUS_03540 360594 358246 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_03540 362343 360595 gene locus_tag LOCUS_03550 362343 360595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 362629 362459 gene locus_tag LOCUS_03560 362629 362459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 362887 362714 gene locus_tag LOCUS_03570 362887 362714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 363902 362901 gene locus_tag LOCUS_03580 363902 362901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 364011 364262 gene locus_tag LOCUS_03590 364011 364262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 364954 364358 gene locus_tag LOCUS_03600 364954 364358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 365410 365255 gene locus_tag LOCUS_03610 365410 365255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 365715 365407 gene locus_tag LOCUS_03620 365715 365407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 366382 365717 gene locus_tag LOCUS_03630 366382 365717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 366978 366394 gene locus_tag LOCUS_03640 366978 366394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 367807 366989 gene locus_tag LOCUS_03650 367807 366989 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106971.1 protein_id gnl|my_center|LOCUS_03650 368288 368680 gene locus_tag LOCUS_03660 368288 368680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 368677 369381 gene locus_tag LOCUS_03670 368677 369381 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034375708.1 protein_id gnl|my_center|LOCUS_03670 369410 370744 gene locus_tag LOCUS_03680 369410 370744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 373197 370978 gene locus_tag LOCUS_03690 373197 370978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 373787 373197 gene locus_tag LOCUS_03700 373787 373197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 374029 373784 gene locus_tag LOCUS_03710 374029 373784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 376210 374300 gene locus_tag LOCUS_03720 376210 374300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 376441 376365 gene locus_tag LOCUS_t00030 376441 376365 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 376672 376938 gene locus_tag LOCUS_03730 gene groES 376672 376938 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 protein_id gnl|my_center|LOCUS_03730 376960 378600 gene locus_tag LOCUS_03740 gene groL 376960 378600 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858047.1 protein_id gnl|my_center|LOCUS_03740 378683 379213 gene locus_tag LOCUS_03750 378683 379213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 379328 380116 gene locus_tag LOCUS_03760 379328 380116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 380952 380113 gene locus_tag LOCUS_03770 380952 380113 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_03770 382165 380972 gene locus_tag LOCUS_03780 gene lhgO 382165 380972 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_03780 382763 382167 gene locus_tag LOCUS_03790 382763 382167 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_03790 382967 383986 gene locus_tag LOCUS_03800 382967 383986 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_03800 384041 386008 gene locus_tag LOCUS_03810 384041 386008 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560769.1 protein_id gnl|my_center|LOCUS_03810 386148 387101 gene locus_tag LOCUS_03820 386148 387101 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070810.1 protein_id gnl|my_center|LOCUS_03820 387175 389235 gene locus_tag LOCUS_03830 387175 389235 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070809.1 protein_id gnl|my_center|LOCUS_03830 389232 389609 gene locus_tag LOCUS_03840 389232 389609 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099655.1 protein_id gnl|my_center|LOCUS_03840 389677 390387 gene locus_tag LOCUS_03850 389677 390387 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_03850 391786 390470 gene locus_tag LOCUS_03860 gene leuA 391786 390470 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933761.1 protein_id gnl|my_center|LOCUS_03860 392544 394145 gene locus_tag LOCUS_03870 392544 394145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 395851 394475 gene locus_tag LOCUS_03880 gene dbpA 395851 394475 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704511.1 protein_id gnl|my_center|LOCUS_03880 397743 395854 gene locus_tag LOCUS_03890 397743 395854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 397872 398696 gene locus_tag LOCUS_03900 397872 398696 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226149.1 protein_id gnl|my_center|LOCUS_03900 398700 400685 gene locus_tag LOCUS_03910 398700 400685 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893374.1 protein_id gnl|my_center|LOCUS_03910 400760 401503 gene locus_tag LOCUS_03920 400760 401503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 402083 401517 gene locus_tag LOCUS_03930 402083 401517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 403262 402162 gene locus_tag LOCUS_03940 gene ychF 403262 402162 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 protein_id gnl|my_center|LOCUS_03940 403862 403326 gene locus_tag LOCUS_03950 403862 403326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 404218 403862 gene locus_tag LOCUS_03960 404218 403862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 405168 404215 gene locus_tag LOCUS_03970 405168 404215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 405575 405168 gene locus_tag LOCUS_03980 405575 405168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 406222 405698 gene locus_tag LOCUS_03990 406222 405698 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891887.1 protein_id gnl|my_center|LOCUS_03990 407090 406266 gene locus_tag LOCUS_04000 gene napH 407090 406266 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_04000 407908 407087 gene locus_tag LOCUS_04010 gene napG 407908 407087 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852504.1 protein_id gnl|my_center|LOCUS_04010 410738 407949 gene locus_tag LOCUS_04020 gene napA 410738 407949 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_04020 410921 411373 gene locus_tag LOCUS_04030 410921 411373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 412881 411520 gene locus_tag LOCUS_04040 412881 411520 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105421.1 protein_id gnl|my_center|LOCUS_04040 413137 413778 gene locus_tag LOCUS_04050 413137 413778 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390717.1 protein_id gnl|my_center|LOCUS_04050 414936 413848 gene locus_tag LOCUS_04060 414936 413848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809304.1 protein_id gnl|my_center|LOCUS_04060 415281 415493 gene locus_tag LOCUS_04070 415281 415493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 416723 415587 gene locus_tag LOCUS_04080 416723 415587 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_04080 419740 416834 gene locus_tag LOCUS_04090 419740 416834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 420434 419793 gene locus_tag LOCUS_04100 420434 419793 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405093.1 protein_id gnl|my_center|LOCUS_04100 421480 420437 gene locus_tag LOCUS_04110 421480 420437 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986923.1 protein_id gnl|my_center|LOCUS_04110 422204 421539 gene locus_tag LOCUS_04120 422204 421539 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_04120 422644 422204 gene locus_tag LOCUS_04130 422644 422204 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943155.1 protein_id gnl|my_center|LOCUS_04130 422854 423636 gene locus_tag LOCUS_04140 422854 423636 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729071.1 protein_id gnl|my_center|LOCUS_04140 423703 425880 gene locus_tag LOCUS_04150 423703 425880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 425883 426938 gene locus_tag LOCUS_04160 gene mtnK 425883 426938 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097617.1 protein_id gnl|my_center|LOCUS_04160 426935 428227 gene locus_tag LOCUS_04170 426935 428227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 429654 428371 gene locus_tag LOCUS_04180 429654 428371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 430607 429732 gene locus_tag LOCUS_04190 430607 429732 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216362.1 protein_id gnl|my_center|LOCUS_04190 432051 430675 gene locus_tag LOCUS_04200 432051 430675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 432726 432061 gene locus_tag LOCUS_04210 432726 432061 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433829.1 protein_id gnl|my_center|LOCUS_04210 433432 432779 gene locus_tag LOCUS_04220 433432 432779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_04220 435898 433472 gene locus_tag LOCUS_04230 gene ccsA 435898 433472 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793250.1 protein_id gnl|my_center|LOCUS_04230 437496 435970 gene locus_tag LOCUS_04240 gene nrfA 437496 435970 CDS product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073711.1 protein_id gnl|my_center|LOCUS_04240 438045 437512 gene locus_tag LOCUS_04250 gene nrfH 438045 437512 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201985.1 protein_id gnl|my_center|LOCUS_04250 438871 438227 gene locus_tag LOCUS_04260 gene nssR 438871 438227 CDS product nitrosative stress-sensitive transcriptional regulator NssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851096.1 protein_id gnl|my_center|LOCUS_04260 440640 438967 gene locus_tag LOCUS_04270 440640 438967 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_04270 444134 440649 gene locus_tag LOCUS_04280 444134 440649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 446155 444269 gene locus_tag LOCUS_04290 446155 444269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 446842 446159 gene locus_tag LOCUS_04300 446842 446159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 447049 449352 gene locus_tag LOCUS_04310 447049 449352 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404537.1 protein_id gnl|my_center|LOCUS_04310 449345 450532 gene locus_tag LOCUS_04320 gene gltX 449345 450532 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_04320 450529 450825 gene locus_tag LOCUS_04330 450529 450825 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 protein_id gnl|my_center|LOCUS_04330 450842 452455 gene locus_tag LOCUS_04340 450842 452455 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864855.1 protein_id gnl|my_center|LOCUS_04340 452882 452397 gene locus_tag LOCUS_04350 452882 452397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 453011 453508 gene locus_tag LOCUS_04360 gene mobB 453011 453508 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 protein_id gnl|my_center|LOCUS_04360 453513 454349 gene locus_tag LOCUS_04370 453513 454349 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_04370 454342 454536 gene locus_tag LOCUS_04380 454342 454536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 454686 456617 gene locus_tag LOCUS_04390 gene metG 454686 456617 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852639.1 protein_id gnl|my_center|LOCUS_04390 456653 457612 gene locus_tag LOCUS_04400 456653 457612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852449.1 protein_id gnl|my_center|LOCUS_04400 457623 458042 gene locus_tag LOCUS_04410 gene ybeY 457623 458042 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851664.1 protein_id gnl|my_center|LOCUS_04410 458046 458624 gene locus_tag LOCUS_04420 458046 458624 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_04420 460451 458637 gene locus_tag LOCUS_04430 gene mrdA 460451 458637 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 protein_id gnl|my_center|LOCUS_04430 460846 460448 gene locus_tag LOCUS_04440 460846 460448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 461346 460888 gene locus_tag LOCUS_04450 461346 460888 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944375.1 protein_id gnl|my_center|LOCUS_04450 461945 461343 gene locus_tag LOCUS_04460 gene yihA 461945 461343 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852258.1 protein_id gnl|my_center|LOCUS_04460 462409 461942 gene locus_tag LOCUS_04470 462409 461942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 462939 462406 gene locus_tag LOCUS_04480 462939 462406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 463427 462930 gene locus_tag LOCUS_04490 463427 462930 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858506.1 protein_id gnl|my_center|LOCUS_04490 463996 463424 gene locus_tag LOCUS_04500 gene hisB 463996 463424 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774805.1 protein_id gnl|my_center|LOCUS_04500 464746 464000 gene locus_tag LOCUS_04510 464746 464000 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852227.1 protein_id gnl|my_center|LOCUS_04510 466001 464769 gene locus_tag LOCUS_04520 466001 464769 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852087.1 protein_id gnl|my_center|LOCUS_04520 466840 466040 gene locus_tag LOCUS_04530 466840 466040 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858473.1 protein_id gnl|my_center|LOCUS_04530 468093 466840 gene locus_tag LOCUS_04540 gene cbrR 468093 466840 CDS product bile resistance response regulator CbrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858608.1 protein_id gnl|my_center|LOCUS_04540 469862 468213 gene locus_tag LOCUS_04550 469862 468213 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113903.1 protein_id gnl|my_center|LOCUS_04550 471506 469965 gene locus_tag LOCUS_04560 471506 469965 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871805.1 protein_id gnl|my_center|LOCUS_04560 472378 471503 gene locus_tag LOCUS_04570 472378 471503 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 protein_id gnl|my_center|LOCUS_04570 472466 473032 gene locus_tag LOCUS_04580 472466 473032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 473896 473057 gene locus_tag LOCUS_04590 473896 473057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 474034 475782 gene locus_tag LOCUS_04600 gene aspS 474034 475782 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871806.1 protein_id gnl|my_center|LOCUS_04600 475795 476367 gene locus_tag LOCUS_04610 475795 476367 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 protein_id gnl|my_center|LOCUS_04610 476370 477107 gene locus_tag LOCUS_04620 476370 477107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 478458 477094 gene locus_tag LOCUS_04630 478458 477094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 479665 478568 gene locus_tag LOCUS_04640 479665 478568 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857924.1 protein_id gnl|my_center|LOCUS_04640 480870 479665 gene locus_tag LOCUS_04650 gene tyrS 480870 479665 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_04650 483065 480897 gene locus_tag LOCUS_04660 483065 480897 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 protein_id gnl|my_center|LOCUS_04660 483289 483077 gene locus_tag LOCUS_04670 483289 483077 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853464.1 protein_id gnl|my_center|LOCUS_04670 484016 483291 gene locus_tag LOCUS_04680 gene pyrH 484016 483291 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858454.1 protein_id gnl|my_center|LOCUS_04680 485299 484079 gene locus_tag LOCUS_04690 485299 484079 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 protein_id gnl|my_center|LOCUS_04690 486045 485296 gene locus_tag LOCUS_04700 486045 485296 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853622.1 protein_id gnl|my_center|LOCUS_04700 486763 486092 gene locus_tag LOCUS_04710 486763 486092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 protein_id gnl|my_center|LOCUS_04710 487925 486747 gene locus_tag LOCUS_04720 gene trmB 487925 486747 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858203.1 protein_id gnl|my_center|LOCUS_04720 489166 487934 gene locus_tag LOCUS_04730 489166 487934 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891920.1 protein_id gnl|my_center|LOCUS_04730 490073 489093 gene locus_tag LOCUS_04740 490073 489093 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858282.1 protein_id gnl|my_center|LOCUS_04740 490131 491237 gene locus_tag LOCUS_04750 490131 491237 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 protein_id gnl|my_center|LOCUS_04750 491303 491379 gene locus_tag LOCUS_t00040 491303 491379 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 491466 491942 gene locus_tag LOCUS_04760 491466 491942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 492134 493474 gene locus_tag LOCUS_04770 gene trkA 492134 493474 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_04770 493484 494926 gene locus_tag LOCUS_04780 493484 494926 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_04780 495252 495581 gene locus_tag LOCUS_04790 495252 495581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 495578 496303 gene locus_tag LOCUS_04800 495578 496303 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945974.1 protein_id gnl|my_center|LOCUS_04800 497577 496300 gene locus_tag LOCUS_04810 497577 496300 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864147.1 protein_id gnl|my_center|LOCUS_04810 497665 498693 gene locus_tag LOCUS_04820 gene flgS 497665 498693 CDS product fla regulon two-component system sensor histidine kinase FlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852488.1 protein_id gnl|my_center|LOCUS_04820 498686 500191 gene locus_tag LOCUS_04830 498686 500191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 500188 500541 gene locus_tag LOCUS_04840 500188 500541 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_04840 500551 500949 gene locus_tag LOCUS_04850 500551 500949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 504502 500957 gene locus_tag LOCUS_04860 gene dnaE 504502 500957 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_04860 505071 504607 gene locus_tag LOCUS_04870 505071 504607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 505357 506619 gene locus_tag LOCUS_04880 505357 506619 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267712.1 protein_id gnl|my_center|LOCUS_04880 506616 509714 gene locus_tag LOCUS_04890 gene muxB 506616 509714 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_04890 509711 512809 gene locus_tag LOCUS_04900 gene mdtC 509711 512809 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 protein_id gnl|my_center|LOCUS_04900 512790 514202 gene locus_tag LOCUS_04910 512790 514202 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 protein_id gnl|my_center|LOCUS_04910 515941 514250 gene locus_tag LOCUS_04920 515941 514250 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975761.1 protein_id gnl|my_center|LOCUS_04920 516336 515941 gene locus_tag LOCUS_04930 516336 515941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 516519 517673 gene locus_tag LOCUS_04940 516519 517673 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406318.1 protein_id gnl|my_center|LOCUS_04940 517674 520802 gene locus_tag LOCUS_04950 gene cmeB 517674 520802 CDS product multidrug efflux RND transporter permease subunit CmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002872052.1 protein_id gnl|my_center|LOCUS_04950 520792 522192 gene locus_tag LOCUS_04960 gene cusC 520792 522192 CDS product Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074212.1 protein_id gnl|my_center|LOCUS_04960 522262 523230 gene locus_tag LOCUS_04970 522262 523230 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977723.1 protein_id gnl|my_center|LOCUS_04970 523356 523658 gene locus_tag LOCUS_04980 523356 523658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 523700 526072 gene locus_tag LOCUS_04990 523700 526072 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_04990 527296 526073 gene locus_tag LOCUS_05000 527296 526073 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_05000 528135 527293 gene locus_tag LOCUS_05010 528135 527293 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_05010 528551 528132 gene locus_tag LOCUS_05020 528551 528132 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_05020 528680 531613 gene locus_tag LOCUS_05030 gene mutS 528680 531613 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494923.1 protein_id gnl|my_center|LOCUS_05030 532041 531643 gene locus_tag LOCUS_05040 532041 531643 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_05040 533077 532529 gene locus_tag LOCUS_05050 533077 532529 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_05050 533655 533092 gene locus_tag LOCUS_05060 gene efp 533655 533092 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855210.1 protein_id gnl|my_center|LOCUS_05060 533877 534125 gene locus_tag LOCUS_05070 533877 534125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 535971 534310 gene locus_tag LOCUS_05080 535971 534310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05080 537557 535968 gene locus_tag LOCUS_05090 537557 535968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05090 538367 537567 gene locus_tag LOCUS_05100 538367 537567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 539731 538364 gene locus_tag LOCUS_05110 539731 538364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 541514 539928 gene locus_tag LOCUS_05120 gene serA 541514 539928 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 protein_id gnl|my_center|LOCUS_05120 541990 541511 gene locus_tag LOCUS_05130 541990 541511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 543670 541994 gene locus_tag LOCUS_05140 543670 541994 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852520.1 protein_id gnl|my_center|LOCUS_05140 544569 543736 gene locus_tag LOCUS_05150 544569 543736 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_05150 545846 544569 gene locus_tag LOCUS_05160 gene aroA 545846 544569 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852577.1 protein_id gnl|my_center|LOCUS_05160 548179 545843 gene locus_tag LOCUS_05170 gene pheT 548179 545843 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915726.1 protein_id gnl|my_center|LOCUS_05170 549168 548176 gene locus_tag LOCUS_05180 gene pheS 549168 548176 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 protein_id gnl|my_center|LOCUS_05180 549273 549629 gene locus_tag LOCUS_05190 549273 549629 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852408.1 protein_id gnl|my_center|LOCUS_05190 551054 549669 gene locus_tag LOCUS_05200 gene argH 551054 549669 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891895.1 protein_id gnl|my_center|LOCUS_05200 552695 551118 gene locus_tag LOCUS_05210 gene pckA 552695 551118 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence02 <1 818 gene locus_tag LOCUS_05220 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000657605.1:cytochrome c1 1101 2306 gene locus_tag LOCUS_05230 1101 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2438 3010 gene locus_tag LOCUS_05240 2438 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3007 5286 gene locus_tag LOCUS_05250 3007 5286 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064331.1 protein_id gnl|my_center|LOCUS_05250 5298 5936 gene locus_tag LOCUS_05260 5298 5936 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250378.1 protein_id gnl|my_center|LOCUS_05260 5940 6299 gene locus_tag LOCUS_05270 5940 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 6374 7066 gene locus_tag LOCUS_05280 6374 7066 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_05280 7014 8735 gene locus_tag LOCUS_05290 7014 8735 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023378.1 protein_id gnl|my_center|LOCUS_05290 8767 10404 gene locus_tag LOCUS_05300 8767 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 10487 10411 gene locus_tag LOCUS_t00050 10487 10411 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12630 10552 gene locus_tag LOCUS_05310 gene fusA 12630 10552 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779472.1 protein_id gnl|my_center|LOCUS_05310 13185 12715 gene locus_tag LOCUS_05320 gene rpsG 13185 12715 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779471.1 protein_id gnl|my_center|LOCUS_05320 13639 13262 gene locus_tag LOCUS_05330 gene rpsL 13639 13262 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782934.1 protein_id gnl|my_center|LOCUS_05330 18253 13730 gene locus_tag LOCUS_05340 gene rpoC 18253 13730 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858508.1 protein_id gnl|my_center|LOCUS_05340 22388 18231 gene locus_tag LOCUS_05350 gene rpoB 22388 18231 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891860.1 protein_id gnl|my_center|LOCUS_05350 22899 22528 gene locus_tag LOCUS_05360 gene rplL 22899 22528 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858569.1 protein_id gnl|my_center|LOCUS_05360 23519 23037 gene locus_tag LOCUS_05370 gene rplJ 23519 23037 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858610.1 protein_id gnl|my_center|LOCUS_05370 24329 23625 gene locus_tag LOCUS_05380 gene rplA 24329 23625 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854928.1 protein_id gnl|my_center|LOCUS_05380 24815 24390 gene locus_tag LOCUS_05390 gene rplK 24815 24390 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779452.1 protein_id gnl|my_center|LOCUS_05390 25362 24832 gene locus_tag LOCUS_05400 gene nusG 25362 24832 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851098.1 protein_id gnl|my_center|LOCUS_05400 25551 25372 gene locus_tag LOCUS_05410 gene secE 25551 25372 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854985.1 protein_id gnl|my_center|LOCUS_05410 25646 25571 gene locus_tag LOCUS_t00060 25646 25571 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 25831 25673 gene locus_tag LOCUS_05420 gene rpmG 25831 25673 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002793551.1 protein_id gnl|my_center|LOCUS_05420 27087 25888 gene locus_tag LOCUS_05430 gene tuf 27087 25888 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855271.1 protein_id gnl|my_center|LOCUS_05430 27237 27163 gene locus_tag LOCUS_t00070 27237 27163 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27459 27383 gene locus_tag LOCUS_t00080 27459 27383 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27550 27466 gene locus_tag LOCUS_t00090 27550 27466 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 27676 27601 gene locus_tag LOCUS_t00100 27676 27601 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27812 28555 gene locus_tag LOCUS_05440 27812 28555 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 protein_id gnl|my_center|LOCUS_05440 28608 28913 gene locus_tag LOCUS_05450 28608 28913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 32578 28976 gene locus_tag LOCUS_05460 32578 28976 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891940.1 protein_id gnl|my_center|LOCUS_05460 33698 32976 gene locus_tag LOCUS_05470 33698 32976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938017.1 protein_id gnl|my_center|LOCUS_05470 34473 33691 gene locus_tag LOCUS_05480 34473 33691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_05480 35420 34470 gene locus_tag LOCUS_05490 35420 34470 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938015.1 protein_id gnl|my_center|LOCUS_05490 36319 35417 gene locus_tag LOCUS_05500 36319 35417 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_05500 37537 36410 gene locus_tag LOCUS_05510 37537 36410 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_05510 38275 37607 gene locus_tag LOCUS_05520 38275 37607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 38492 38268 gene locus_tag LOCUS_05530 38492 38268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 38772 39524 gene locus_tag LOCUS_05540 38772 39524 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939072.1 protein_id gnl|my_center|LOCUS_05540 40383 39550 gene locus_tag LOCUS_05550 gene modD 40383 39550 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943594.1 protein_id gnl|my_center|LOCUS_05550 40515 40739 gene locus_tag LOCUS_05560 40515 40739 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 protein_id gnl|my_center|LOCUS_05560 40743 41609 gene locus_tag LOCUS_05570 40743 41609 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532275.1 protein_id gnl|my_center|LOCUS_05570 42009 41596 gene locus_tag LOCUS_05580 42009 41596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 42264 42010 gene locus_tag LOCUS_05590 42264 42010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 42464 43357 gene locus_tag LOCUS_05600 42464 43357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 44141 43374 gene locus_tag LOCUS_05610 44141 43374 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925131.1 protein_id gnl|my_center|LOCUS_05610 44240 45070 gene locus_tag LOCUS_05620 44240 45070 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011337.1 protein_id gnl|my_center|LOCUS_05620 45074 45496 gene locus_tag LOCUS_05630 gene trxC 45074 45496 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_05630 45721 45533 gene locus_tag LOCUS_05640 45721 45533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 45833 45675 gene locus_tag LOCUS_05650 45833 45675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 46559 45855 gene locus_tag LOCUS_05660 46559 45855 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 protein_id gnl|my_center|LOCUS_05660 46687 47040 gene locus_tag LOCUS_05670 46687 47040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 48322 47009 gene locus_tag LOCUS_05680 48322 47009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 48726 48349 gene locus_tag LOCUS_05690 48726 48349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 49521 48778 gene locus_tag LOCUS_05700 49521 48778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 49698 49624 gene locus_tag LOCUS_t00110 49698 49624 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 49925 49707 gene locus_tag LOCUS_05710 49925 49707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 50945 50031 gene locus_tag LOCUS_05720 50945 50031 CDS product DUF234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852402.1 protein_id gnl|my_center|LOCUS_05720 51090 51707 gene locus_tag LOCUS_05730 51090 51707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 51924 52901 gene locus_tag LOCUS_05740 51924 52901 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996787.1 protein_id gnl|my_center|LOCUS_05740 53663 53025 gene locus_tag LOCUS_05750 53663 53025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 55179 53695 gene locus_tag LOCUS_05760 55179 53695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 56185 55181 gene locus_tag LOCUS_05770 56185 55181 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_05770 57186 56386 gene locus_tag LOCUS_05780 57186 56386 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_05780 58253 57402 gene locus_tag LOCUS_05790 58253 57402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 61413 58246 gene locus_tag LOCUS_05800 61413 58246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 62417 61410 gene locus_tag LOCUS_05810 62417 61410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 63147 62407 gene locus_tag LOCUS_05820 63147 62407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 65538 63169 gene locus_tag LOCUS_05830 65538 63169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 66643 65525 gene locus_tag LOCUS_05840 66643 65525 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881231.1 protein_id gnl|my_center|LOCUS_05840 67009 67503 gene locus_tag LOCUS_05850 67009 67503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 67762 67538 gene locus_tag LOCUS_05860 67762 67538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 69231 68164 gene locus_tag LOCUS_05870 69231 68164 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143185615.1 protein_id gnl|my_center|LOCUS_05870 69811 69212 gene locus_tag LOCUS_05880 69811 69212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 70090 70983 gene locus_tag LOCUS_05890 70090 70983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 71121 71378 gene locus_tag LOCUS_05900 71121 71378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 71517 72872 gene locus_tag LOCUS_05910 71517 72872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 72883 73209 gene locus_tag LOCUS_05920 72883 73209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 73142 74209 gene locus_tag LOCUS_05930 73142 74209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 74361 74287 gene locus_tag LOCUS_t00120 74361 74287 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 74558 75508 gene locus_tag LOCUS_05940 74558 75508 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261092.1 protein_id gnl|my_center|LOCUS_05940 75576 77648 gene locus_tag LOCUS_05950 75576 77648 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_05950 78427 77681 gene locus_tag LOCUS_05960 78427 77681 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853222.1 protein_id gnl|my_center|LOCUS_05960 79669 78647 gene locus_tag LOCUS_05970 gene hemE 79669 78647 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 protein_id gnl|my_center|LOCUS_05970 80178 79666 gene locus_tag LOCUS_05980 80178 79666 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_05980 81206 80181 gene locus_tag LOCUS_05990 81206 80181 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 protein_id gnl|my_center|LOCUS_05990 82483 81326 gene locus_tag LOCUS_06000 gene flgR 82483 81326 CDS product fla regulon two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853038.1 protein_id gnl|my_center|LOCUS_06000 82862 82503 gene locus_tag LOCUS_06010 82862 82503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 83362 82874 gene locus_tag LOCUS_06020 gene flgP 83362 82874 CDS product flagellar assembly lipoprotein FlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852972.1 protein_id gnl|my_center|LOCUS_06020 85942 83411 gene locus_tag LOCUS_06030 gene gyrA 85942 83411 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153763.1 protein_id gnl|my_center|LOCUS_06030 86793 86035 gene locus_tag LOCUS_06040 86793 86035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 87012 86848 gene locus_tag LOCUS_06050 87012 86848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 87685 87113 gene locus_tag LOCUS_06060 87685 87113 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 protein_id gnl|my_center|LOCUS_06060 89486 87693 gene locus_tag LOCUS_06070 gene lepA 89486 87693 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002837927.1 protein_id gnl|my_center|LOCUS_06070 90415 89486 gene locus_tag LOCUS_06080 90415 89486 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853293.1 protein_id gnl|my_center|LOCUS_06080 90564 91400 gene locus_tag LOCUS_06090 90564 91400 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546502.1 protein_id gnl|my_center|LOCUS_06090 91523 91858 gene locus_tag LOCUS_06100 91523 91858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 92244 91879 gene locus_tag LOCUS_06110 92244 91879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 93377 92244 gene locus_tag LOCUS_06120 gene rffA 93377 92244 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612053.1 protein_id gnl|my_center|LOCUS_06120 94066 93374 gene locus_tag LOCUS_06130 94066 93374 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963400.1 protein_id gnl|my_center|LOCUS_06130 94992 94063 gene locus_tag LOCUS_06140 94992 94063 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_06140 96730 95015 gene locus_tag LOCUS_06150 96730 95015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 97464 96730 gene locus_tag LOCUS_06160 97464 96730 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881230.1 protein_id gnl|my_center|LOCUS_06160 98327 97470 gene locus_tag LOCUS_06170 gene fliY 98327 97470 CDS product flagellar motor switch protein FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851810.1 protein_id gnl|my_center|LOCUS_06170 99396 98338 gene locus_tag LOCUS_06180 gene fliM 99396 98338 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851710.1 protein_id gnl|my_center|LOCUS_06180 100084 99389 gene locus_tag LOCUS_06190 100084 99389 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859753.1 protein_id gnl|my_center|LOCUS_06190 100424 100056 gene locus_tag LOCUS_06200 100424 100056 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851727.1 protein_id gnl|my_center|LOCUS_06200 101320 100448 gene locus_tag LOCUS_06210 gene flhG 101320 100448 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_06210 102578 101301 gene locus_tag LOCUS_06220 102578 101301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 103051 102590 gene locus_tag LOCUS_06230 gene folK 103051 102590 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851803.1 protein_id gnl|my_center|LOCUS_06230 104076 103048 gene locus_tag LOCUS_06240 104076 103048 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677174.1 protein_id gnl|my_center|LOCUS_06240 104515 104078 gene locus_tag LOCUS_06250 gene aroQ 104515 104078 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_06250 104636 105865 gene locus_tag LOCUS_06260 104636 105865 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_06260 105859 106725 gene locus_tag LOCUS_06270 gene sppA 105859 106725 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851869.1 protein_id gnl|my_center|LOCUS_06270 107623 106766 gene locus_tag LOCUS_06280 107623 106766 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_06280 107753 108316 gene locus_tag LOCUS_06290 107753 108316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 108313 108672 gene locus_tag LOCUS_06300 108313 108672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 108669 109640 gene locus_tag LOCUS_06310 108669 109640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 109625 110581 gene locus_tag LOCUS_06320 109625 110581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 111517 110882 gene locus_tag LOCUS_06330 gene ribB 111517 110882 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939063.1 protein_id gnl|my_center|LOCUS_06330 112738 111821 gene locus_tag LOCUS_06340 112738 111821 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_06340 113505 112753 gene locus_tag LOCUS_06350 113505 112753 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_06350 114484 113603 gene locus_tag LOCUS_06360 114484 113603 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867793.1 protein_id gnl|my_center|LOCUS_06360 114554 115537 gene locus_tag LOCUS_06370 114554 115537 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_06370 116721 115534 gene locus_tag LOCUS_06380 116721 115534 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_06380 117257 116721 gene locus_tag LOCUS_06390 117257 116721 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532123.1 protein_id gnl|my_center|LOCUS_06390 119276 117327 gene locus_tag LOCUS_06400 119276 117327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 119436 119624 gene locus_tag LOCUS_06410 119436 119624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 120899 119646 gene locus_tag LOCUS_06420 gene xseA 120899 119646 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382848.1 protein_id gnl|my_center|LOCUS_06420 121612 120896 gene locus_tag LOCUS_06430 gene ubiE 121612 120896 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858648.1 protein_id gnl|my_center|LOCUS_06430 122522 121758 gene locus_tag LOCUS_06440 122522 121758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 123339 122902 gene locus_tag LOCUS_06450 123339 122902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 124357 123440 gene locus_tag LOCUS_06460 124357 123440 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263293.1 protein_id gnl|my_center|LOCUS_06460 125287 124409 gene locus_tag LOCUS_06470 125287 124409 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852976.1 protein_id gnl|my_center|LOCUS_06470 125391 126419 gene locus_tag LOCUS_06480 125391 126419 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_06480 128084 126402 gene locus_tag LOCUS_06490 128084 126402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 128401 128084 gene locus_tag LOCUS_06500 128401 128084 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760150.1 protein_id gnl|my_center|LOCUS_06500 128783 128568 gene locus_tag LOCUS_06510 128783 128568 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 protein_id gnl|my_center|LOCUS_06510 129017 129331 gene locus_tag LOCUS_06520 129017 129331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 130556 129336 gene locus_tag LOCUS_06530 130556 129336 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973796.1 protein_id gnl|my_center|LOCUS_06530 131314 130568 gene locus_tag LOCUS_06540 131314 130568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 132296 131307 gene locus_tag LOCUS_06550 gene ribD 132296 131307 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891948.1 protein_id gnl|my_center|LOCUS_06550 132745 132317 gene locus_tag LOCUS_06560 gene rimP 132745 132317 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 protein_id gnl|my_center|LOCUS_06560 133118 132738 gene locus_tag LOCUS_06570 gene rbfA 133118 132738 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778650.1 protein_id gnl|my_center|LOCUS_06570 135772 133115 gene locus_tag LOCUS_06580 gene infB 135772 133115 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864659.1 protein_id gnl|my_center|LOCUS_06580 136016 135765 gene locus_tag LOCUS_06590 136016 135765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 136935 136051 gene locus_tag LOCUS_06600 gene thrB 136935 136051 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888538.1 protein_id gnl|my_center|LOCUS_06600 137383 136946 gene locus_tag LOCUS_06610 137383 136946 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851789.1 protein_id gnl|my_center|LOCUS_06610 138288 137404 gene locus_tag LOCUS_06620 gene lpxC 138288 137404 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859351.1 protein_id gnl|my_center|LOCUS_06620 138887 138285 gene locus_tag LOCUS_06630 gene minC 138887 138285 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921052.1 protein_id gnl|my_center|LOCUS_06630 140251 138884 gene locus_tag LOCUS_06640 140251 138884 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 protein_id gnl|my_center|LOCUS_06640 141192 140248 gene locus_tag LOCUS_06650 141192 140248 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_06650 142338 141280 gene locus_tag LOCUS_06660 gene flhB 142338 141280 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_06660 143187 142357 gene locus_tag LOCUS_06670 gene nadC 143187 142357 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405980.1 protein_id gnl|my_center|LOCUS_06670 144176 143184 gene locus_tag LOCUS_06680 gene nadA 144176 143184 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141770.1 protein_id gnl|my_center|LOCUS_06680 144274 144900 gene locus_tag LOCUS_06690 gene plsY 144274 144900 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 protein_id gnl|my_center|LOCUS_06690 144901 145227 gene locus_tag LOCUS_06700 144901 145227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 145315 145986 gene locus_tag LOCUS_06710 gene hsrA 145315 145986 CDS product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 protein_id gnl|my_center|LOCUS_06710 145965 147275 gene locus_tag LOCUS_06720 145965 147275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 147342 147593 gene locus_tag LOCUS_06730 147342 147593 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854647.1 protein_id gnl|my_center|LOCUS_06730 147593 149059 gene locus_tag LOCUS_06740 147593 149059 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857605.1 protein_id gnl|my_center|LOCUS_06740 151338 149113 gene locus_tag LOCUS_06750 gene bamA 151338 149113 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_06750 151444 152271 gene locus_tag LOCUS_06760 151444 152271 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_06760 153681 152254 gene locus_tag LOCUS_06770 153681 152254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 155284 153653 gene locus_tag LOCUS_06780 155284 153653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 156192 155281 gene locus_tag LOCUS_06790 156192 155281 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263515.1 protein_id gnl|my_center|LOCUS_06790 156565 156185 gene locus_tag LOCUS_06800 156565 156185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 157341 156565 gene locus_tag LOCUS_06810 157341 156565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 158354 157407 gene locus_tag LOCUS_06820 158354 157407 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_06820 159389 158397 gene locus_tag LOCUS_06830 159389 158397 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_06830 160393 159392 gene locus_tag LOCUS_06840 gene plsX 160393 159392 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 protein_id gnl|my_center|LOCUS_06840 160546 160394 gene locus_tag LOCUS_06850 gene rpmF 160546 160394 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858674.1 protein_id gnl|my_center|LOCUS_06850 160916 160548 gene locus_tag LOCUS_06860 160916 160548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858727.1 protein_id gnl|my_center|LOCUS_06860 161333 160920 gene locus_tag LOCUS_06870 gene ndk 161333 160920 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_06870 161768 161484 gene locus_tag LOCUS_06880 161768 161484 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_06880 161969 163939 gene locus_tag LOCUS_06890 161969 163939 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073164.1 protein_id gnl|my_center|LOCUS_06890 164046 164642 gene locus_tag LOCUS_06900 164046 164642 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_06900 165089 164673 gene locus_tag LOCUS_06910 gene perR 165089 164673 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 protein_id gnl|my_center|LOCUS_06910 167011 165170 gene locus_tag LOCUS_06920 gene dxs 167011 165170 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858717.1 protein_id gnl|my_center|LOCUS_06920 167823 167020 gene locus_tag LOCUS_06930 gene fliH 167823 167020 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858748.1 protein_id gnl|my_center|LOCUS_06930 168850 167825 gene locus_tag LOCUS_06940 gene fliG 168850 167825 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_06940 170574 168850 gene locus_tag LOCUS_06950 gene fliF 170574 168850 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859425.1 protein_id gnl|my_center|LOCUS_06950 171686 170586 gene locus_tag LOCUS_06960 gene hisC 171686 170586 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 protein_id gnl|my_center|LOCUS_06960 172757 171690 gene locus_tag LOCUS_06970 gene pheA 172757 171690 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_06970 173524 172745 gene locus_tag LOCUS_06980 173524 172745 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858702.1 protein_id gnl|my_center|LOCUS_06980 174726 173521 gene locus_tag LOCUS_06990 gene lysA 174726 173521 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858733.1 protein_id gnl|my_center|LOCUS_06990 175864 174806 gene locus_tag LOCUS_07000 175864 174806 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858697.1 protein_id gnl|my_center|LOCUS_07000 176433 175861 gene locus_tag LOCUS_07010 gene pth 176433 175861 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858659.1 protein_id gnl|my_center|LOCUS_07010 176980 176444 gene locus_tag LOCUS_07020 176980 176444 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002791314.1 protein_id gnl|my_center|LOCUS_07020 178234 177044 gene locus_tag LOCUS_07030 178234 177044 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_07030 179252 178251 gene locus_tag LOCUS_07040 179252 178251 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851728.1 protein_id gnl|my_center|LOCUS_07040 179884 179264 gene locus_tag LOCUS_07050 gene serB 179884 179264 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_07050 179944 180867 gene locus_tag LOCUS_07060 179944 180867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 181405 180911 gene locus_tag LOCUS_07070 181405 180911 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826355.1 protein_id gnl|my_center|LOCUS_07070 183716 181419 gene locus_tag LOCUS_07080 183716 181419 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_07080 184677 183727 gene locus_tag LOCUS_07090 184677 183727 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851778.1 protein_id gnl|my_center|LOCUS_07090 185410 184670 gene locus_tag LOCUS_07100 185410 184670 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858657.1 protein_id gnl|my_center|LOCUS_07100 186416 185400 gene locus_tag LOCUS_07110 gene argC 186416 185400 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_07110 186908 186417 gene locus_tag LOCUS_07120 gene greA 186908 186417 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858660.1 protein_id gnl|my_center|LOCUS_07120 187964 186936 gene locus_tag LOCUS_07130 gene lpxB 187964 186936 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858730.1 protein_id gnl|my_center|LOCUS_07130 188066 188857 gene locus_tag LOCUS_07140 gene surE 188066 188857 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854555.1 protein_id gnl|my_center|LOCUS_07140 188847 189491 gene locus_tag LOCUS_07150 188847 189491 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860322.1 protein_id gnl|my_center|LOCUS_07150 190071 189520 gene locus_tag LOCUS_07160 190071 189520 CDS product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704661.1 protein_id gnl|my_center|LOCUS_07160 190786 190130 gene locus_tag LOCUS_07170 190786 190130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 protein_id gnl|my_center|LOCUS_07170 191046 191939 gene locus_tag LOCUS_07180 191046 191939 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071366.1 protein_id gnl|my_center|LOCUS_07180 192060 191985 gene locus_tag LOCUS_t00130 192060 191985 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 192573 192130 gene locus_tag LOCUS_07190 192573 192130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851686.1 protein_id gnl|my_center|LOCUS_07190 195835 192578 gene locus_tag LOCUS_07200 gene carB 195835 192578 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858661.1 protein_id gnl|my_center|LOCUS_07200 196650 195901 gene locus_tag LOCUS_07210 gene mreC 196650 195901 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213296.1 protein_id gnl|my_center|LOCUS_07210 197677 196643 gene locus_tag LOCUS_07220 197677 196643 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_07220 198919 197693 gene locus_tag LOCUS_07230 gene clpX 198919 197693 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_07230 199703 198909 gene locus_tag LOCUS_07240 gene lpxA 199703 198909 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851756.1 protein_id gnl|my_center|LOCUS_07240 200151 199705 gene locus_tag LOCUS_07250 gene fabZ 200151 199705 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 protein_id gnl|my_center|LOCUS_07250 201213 200182 gene locus_tag LOCUS_07260 201213 200182 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 protein_id gnl|my_center|LOCUS_07260 201404 204259 gene locus_tag LOCUS_07270 201404 204259 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766460.1 protein_id gnl|my_center|LOCUS_07270 204737 204270 gene locus_tag LOCUS_07280 gene bcp 204737 204270 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_07280 206176 204758 gene locus_tag LOCUS_07290 206176 204758 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 protein_id gnl|my_center|LOCUS_07290 206281 207195 gene locus_tag LOCUS_07300 gene ilvE 206281 207195 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 protein_id gnl|my_center|LOCUS_07300 207217 208308 gene locus_tag LOCUS_07310 207217 208308 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_07310 208305 208997 gene locus_tag LOCUS_07320 gene hisIE 208305 208997 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208235.1 protein_id gnl|my_center|LOCUS_07320 208978 209514 gene locus_tag LOCUS_07330 208978 209514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 209525 210064 gene locus_tag LOCUS_07340 209525 210064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 211020 210061 gene locus_tag LOCUS_07350 211020 210061 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132720.1 protein_id gnl|my_center|LOCUS_07350 212357 211020 gene locus_tag LOCUS_07360 gene purF 212357 211020 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 protein_id gnl|my_center|LOCUS_07360 213139 212372 gene locus_tag LOCUS_07370 gene dapB 213139 212372 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_07370 214089 213154 gene locus_tag LOCUS_07380 gene trxB 214089 213154 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851648.1 protein_id gnl|my_center|LOCUS_07380 214564 214247 gene locus_tag LOCUS_07390 gene trxA 214564 214247 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 protein_id gnl|my_center|LOCUS_07390 214988 214662 gene locus_tag LOCUS_07400 214988 214662 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851874.1 protein_id gnl|my_center|LOCUS_07400 216260 214989 gene locus_tag LOCUS_07410 216260 214989 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851705.1 protein_id gnl|my_center|LOCUS_07410 217477 216266 gene locus_tag LOCUS_07420 217477 216266 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851675.1 protein_id gnl|my_center|LOCUS_07420 218308 217490 gene locus_tag LOCUS_07430 218308 217490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792823.1 protein_id gnl|my_center|LOCUS_07430 219258 218302 gene locus_tag LOCUS_07440 219258 218302 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851924.1 protein_id gnl|my_center|LOCUS_07440 219934 219251 gene locus_tag LOCUS_07450 gene rlmB 219934 219251 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851944.1 protein_id gnl|my_center|LOCUS_07450 220828 220016 gene locus_tag LOCUS_07460 gene rsmI 220828 220016 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_07460 221046 220846 gene locus_tag LOCUS_07470 gene rpmE 221046 220846 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_07470 221812 221144 gene locus_tag LOCUS_07480 221812 221144 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213204.1 protein_id gnl|my_center|LOCUS_07480 222228 221818 gene locus_tag LOCUS_07490 222228 221818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 222308 223462 gene locus_tag LOCUS_07500 222308 223462 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_07500 224431 223463 gene locus_tag LOCUS_07510 gene moaA 224431 223463 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868437.1 protein_id gnl|my_center|LOCUS_07510 224554 225066 gene locus_tag LOCUS_07520 224554 225066 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_07520 225032 226465 gene locus_tag LOCUS_07530 225032 226465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 227007 226501 gene locus_tag LOCUS_07540 227007 226501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851715.1 protein_id gnl|my_center|LOCUS_07540 227527 226997 gene locus_tag LOCUS_07550 227527 226997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851641.1 protein_id gnl|my_center|LOCUS_07550 228399 227530 gene locus_tag LOCUS_07560 228399 227530 CDS product 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851905.1 protein_id gnl|my_center|LOCUS_07560 228493 229398 gene locus_tag LOCUS_07570 gene miaA 228493 229398 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851982.1 protein_id gnl|my_center|LOCUS_07570 231788 229395 gene locus_tag LOCUS_07580 231788 229395 CDS product paralyzed flagella protein PflA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851328.1 protein_id gnl|my_center|LOCUS_07580 233350 231863 gene locus_tag LOCUS_07590 gene nuoN 233350 231863 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904307.1 protein_id gnl|my_center|LOCUS_07590 234876 233350 gene locus_tag LOCUS_07600 234876 233350 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 protein_id gnl|my_center|LOCUS_07600 236742 234886 gene locus_tag LOCUS_07610 gene nuoL 236742 234886 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200192.1 protein_id gnl|my_center|LOCUS_07610 237048 236746 gene locus_tag LOCUS_07620 gene nuoK 237048 236746 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_07620 237596 237045 gene locus_tag LOCUS_07630 237596 237045 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464208.1 protein_id gnl|my_center|LOCUS_07630 238218 237604 gene locus_tag LOCUS_07640 gene nuoI 238218 237604 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851456.1 protein_id gnl|my_center|LOCUS_07640 239222 238230 gene locus_tag LOCUS_07650 gene nuoH 239222 238230 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277308.1 protein_id gnl|my_center|LOCUS_07650 241692 239215 gene locus_tag LOCUS_07660 241692 239215 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 protein_id gnl|my_center|LOCUS_07660 242552 241701 gene locus_tag LOCUS_07670 242552 241701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851266.1 protein_id gnl|my_center|LOCUS_07670 242788 242549 gene locus_tag LOCUS_07680 242788 242549 CDS product NADH-ubiquinone oxidoreductase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824979.1 protein_id gnl|my_center|LOCUS_07680 244023 242797 gene locus_tag LOCUS_07690 gene nuoD 244023 242797 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864417.1 protein_id gnl|my_center|LOCUS_07690 244827 244027 gene locus_tag LOCUS_07700 244827 244027 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864416.1 protein_id gnl|my_center|LOCUS_07700 245333 244824 gene locus_tag LOCUS_07710 245333 244824 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851253.1 protein_id gnl|my_center|LOCUS_07710 245704 245315 gene locus_tag LOCUS_07720 245704 245315 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183543.1 protein_id gnl|my_center|LOCUS_07720 247400 245778 gene locus_tag LOCUS_07730 247400 245778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858720.1 protein_id gnl|my_center|LOCUS_07730 249188 247626 gene locus_tag LOCUS_07740 249188 247626 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244146.1 protein_id gnl|my_center|LOCUS_07740 250420 249191 gene locus_tag LOCUS_07750 250420 249191 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_07750 251280 250438 gene locus_tag LOCUS_07760 gene nfo 251280 250438 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097964.1 protein_id gnl|my_center|LOCUS_07760 251767 251291 gene locus_tag LOCUS_07770 251767 251291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 252135 251764 gene locus_tag LOCUS_07780 252135 251764 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_07780 252254 253108 gene locus_tag LOCUS_07790 252254 253108 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864655.1 protein_id gnl|my_center|LOCUS_07790 253121 253891 gene locus_tag LOCUS_07800 253121 253891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891839.1 protein_id gnl|my_center|LOCUS_07800 253891 254694 gene locus_tag LOCUS_07810 253891 254694 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891838.1 protein_id gnl|my_center|LOCUS_07810 255590 254691 gene locus_tag LOCUS_07820 255590 254691 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_07820 255786 256103 gene locus_tag LOCUS_07830 255786 256103 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939104.1 protein_id gnl|my_center|LOCUS_07830 256128 256448 gene locus_tag LOCUS_07840 256128 256448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 256560 257300 gene locus_tag LOCUS_07850 256560 257300 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233691.1 protein_id gnl|my_center|LOCUS_07850 257322 258122 gene locus_tag LOCUS_07860 257322 258122 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 protein_id gnl|my_center|LOCUS_07860 258126 259091 gene locus_tag LOCUS_07870 258126 259091 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041213497.1 protein_id gnl|my_center|LOCUS_07870 260254 259115 gene locus_tag LOCUS_07880 260254 259115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 260901 260287 gene locus_tag LOCUS_07890 260901 260287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 261796 261131 gene locus_tag LOCUS_07900 gene dccR 261796 261131 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_07900 262793 261786 gene locus_tag LOCUS_07910 gene pyrC 262793 261786 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258604.1 protein_id gnl|my_center|LOCUS_07910 262921 263889 gene locus_tag LOCUS_07920 262921 263889 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_07920 265171 263879 gene locus_tag LOCUS_07930 265171 263879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 266448 265267 gene locus_tag LOCUS_07940 266448 265267 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_07940 266885 266547 gene locus_tag LOCUS_07950 gene glnB 266885 266547 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717795.1 protein_id gnl|my_center|LOCUS_07950 267448 266930 gene locus_tag LOCUS_07960 267448 266930 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566814.1 protein_id gnl|my_center|LOCUS_07960 268108 267452 gene locus_tag LOCUS_07970 268108 267452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 269714 268098 gene locus_tag LOCUS_07980 269714 268098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 270867 269707 gene locus_tag LOCUS_07990 270867 269707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 270992 271642 gene locus_tag LOCUS_08000 270992 271642 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_08000 272002 271664 gene locus_tag LOCUS_08010 272002 271664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 273246 272062 gene locus_tag LOCUS_08020 273246 272062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858477.1 protein_id gnl|my_center|LOCUS_08020 273351 275042 gene locus_tag LOCUS_08030 gene tlpB 273351 275042 CDS product methyl-accepting chemotaxis protein TlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971620.1 protein_id gnl|my_center|LOCUS_08030 275054 275656 gene locus_tag LOCUS_08040 275054 275656 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010896122.1 protein_id gnl|my_center|LOCUS_08040 276214 275687 gene locus_tag LOCUS_08050 gene msrA 276214 275687 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_08050 276356 277492 gene locus_tag LOCUS_08060 276356 277492 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 protein_id gnl|my_center|LOCUS_08060 277489 278217 gene locus_tag LOCUS_08070 277489 278217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851414.1 protein_id gnl|my_center|LOCUS_08070 278225 279199 gene locus_tag LOCUS_08080 278225 279199 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851168.1 protein_id gnl|my_center|LOCUS_08080 279209 279811 gene locus_tag LOCUS_08090 279209 279811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 279882 280040 gene locus_tag LOCUS_08100 279882 280040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 280027 280701 gene locus_tag LOCUS_08110 gene dccR 280027 280701 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_08110 280658 281845 gene locus_tag LOCUS_08120 280658 281845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 281839 282171 gene locus_tag LOCUS_08130 281839 282171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 282260 282556 gene locus_tag LOCUS_08140 282260 282556 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852762.1 protein_id gnl|my_center|LOCUS_08140 284771 282597 gene locus_tag LOCUS_08150 284771 282597 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_08150 285345 284992 gene locus_tag LOCUS_08160 285345 284992 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851707.1 protein_id gnl|my_center|LOCUS_08160 286943 285354 gene locus_tag LOCUS_08170 286943 285354 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 protein_id gnl|my_center|LOCUS_08170 287275 287715 gene locus_tag LOCUS_08180 287275 287715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 288039 287743 gene locus_tag LOCUS_08190 288039 287743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 288538 288041 gene locus_tag LOCUS_08200 288538 288041 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858699.1 protein_id gnl|my_center|LOCUS_08200 289485 288553 gene locus_tag LOCUS_08210 289485 288553 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_08210 290668 289487 gene locus_tag LOCUS_08220 290668 289487 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197179.1 protein_id gnl|my_center|LOCUS_08220 291301 290672 gene locus_tag LOCUS_08230 291301 290672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 292017 291307 gene locus_tag LOCUS_08240 292017 291307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 292410 292198 gene locus_tag LOCUS_08250 gene rpsU 292410 292198 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780697.1 protein_id gnl|my_center|LOCUS_08250 292587 293282 gene locus_tag LOCUS_08260 292587 293282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 293272 294645 gene locus_tag LOCUS_08270 gene ccoG 293272 294645 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_08270 294710 295114 gene locus_tag LOCUS_08280 294710 295114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 295523 295170 gene locus_tag LOCUS_08290 gene rplT 295523 295170 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_08290 295827 295633 gene locus_tag LOCUS_08300 gene rpmI 295827 295633 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851822.1 protein_id gnl|my_center|LOCUS_08300 296455 295940 gene locus_tag LOCUS_08310 gene infC 296455 295940 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 protein_id gnl|my_center|LOCUS_08310 298269 296452 gene locus_tag LOCUS_08320 gene thrS 298269 296452 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 protein_id gnl|my_center|LOCUS_08320 298397 298322 gene locus_tag LOCUS_t00140 298397 298322 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 298924 298478 gene locus_tag LOCUS_08330 gene lspA 298924 298478 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921378.1 protein_id gnl|my_center|LOCUS_08330 300257 298917 gene locus_tag LOCUS_08340 gene glmM 300257 298917 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860288.1 protein_id gnl|my_center|LOCUS_08340 300390 300767 gene locus_tag LOCUS_08350 300390 300767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 300801 302480 gene locus_tag LOCUS_08360 300801 302480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 302593 302868 gene locus_tag LOCUS_08370 gene rpsT 302593 302868 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_08370 302898 303965 gene locus_tag LOCUS_08380 gene prfA 302898 303965 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851189.1 protein_id gnl|my_center|LOCUS_08380 304696 303968 gene locus_tag LOCUS_08390 304696 303968 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851407.1 protein_id gnl|my_center|LOCUS_08390 305445 304693 gene locus_tag LOCUS_08400 gene dapF 305445 304693 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_08400 306031 305432 gene locus_tag LOCUS_08410 gene coaE 306031 305432 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 protein_id gnl|my_center|LOCUS_08410 306125 307120 gene locus_tag LOCUS_08420 gene purM 306125 307120 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 protein_id gnl|my_center|LOCUS_08420 307264 307905 gene locus_tag LOCUS_08430 307264 307905 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545555.1 protein_id gnl|my_center|LOCUS_08430 308188 307910 gene locus_tag LOCUS_08440 308188 307910 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 protein_id gnl|my_center|LOCUS_08440 309861 308185 gene locus_tag LOCUS_08450 309861 308185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 311210 309876 gene locus_tag LOCUS_08460 gene hemG 311210 309876 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_08460 312444 311245 gene locus_tag LOCUS_08470 312444 311245 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851835.1 protein_id gnl|my_center|LOCUS_08470 313219 312434 gene locus_tag LOCUS_08480 313219 312434 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853086.1 protein_id gnl|my_center|LOCUS_08480 314184 313219 gene locus_tag LOCUS_08490 314184 313219 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121932.1 protein_id gnl|my_center|LOCUS_08490 316208 314193 gene locus_tag LOCUS_08500 316208 314193 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864793.1 protein_id gnl|my_center|LOCUS_08500 316941 316165 gene locus_tag LOCUS_08510 gene rsmA 316941 316165 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_08510 317167 317925 gene locus_tag LOCUS_08520 gene hisF 317167 317925 CDS product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880108.1 protein_id gnl|my_center|LOCUS_08520 317922 318464 gene locus_tag LOCUS_08530 317922 318464 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853142.1 protein_id gnl|my_center|LOCUS_08530 318472 319548 gene locus_tag LOCUS_08540 gene rlmN 318472 319548 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_08540 320275 319664 gene locus_tag LOCUS_08550 320275 319664 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461913.1 protein_id gnl|my_center|LOCUS_08550 321190 320285 gene locus_tag LOCUS_08560 321190 320285 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_08560 321310 322638 gene locus_tag LOCUS_08570 gene purB 321310 322638 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865088.1 protein_id gnl|my_center|LOCUS_08570 322639 325005 gene locus_tag LOCUS_08580 322639 325005 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865087.1 protein_id gnl|my_center|LOCUS_08580 325021 325998 gene locus_tag LOCUS_08590 325021 325998 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_08590 325995 326699 gene locus_tag LOCUS_08600 325995 326699 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 protein_id gnl|my_center|LOCUS_08600 326926 329040 gene locus_tag LOCUS_08610 326926 329040 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111559.1 protein_id gnl|my_center|LOCUS_08610 329027 329191 gene locus_tag LOCUS_08620 329027 329191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 329166 329861 gene locus_tag LOCUS_08630 329166 329861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 329905 330927 gene locus_tag LOCUS_08640 329905 330927 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851758.1 protein_id gnl|my_center|LOCUS_08640 330917 331648 gene locus_tag LOCUS_08650 330917 331648 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880005.1 protein_id gnl|my_center|LOCUS_08650 331649 332308 gene locus_tag LOCUS_08660 331649 332308 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851780.1 protein_id gnl|my_center|LOCUS_08660 333888 332305 gene locus_tag LOCUS_08670 gene recJ 333888 332305 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 protein_id gnl|my_center|LOCUS_08670 335518 333881 gene locus_tag LOCUS_08680 335518 333881 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853102.1 protein_id gnl|my_center|LOCUS_08680 336452 335586 gene locus_tag LOCUS_08690 gene galU 336452 335586 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088639.1 protein_id gnl|my_center|LOCUS_08690 336624 338291 gene locus_tag LOCUS_08700 336624 338291 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268314.1 protein_id gnl|my_center|LOCUS_08700 338804 339568 gene locus_tag LOCUS_08710 338804 339568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851750.1 protein_id gnl|my_center|LOCUS_08710 339774 339574 gene locus_tag LOCUS_08720 339774 339574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 340425 339787 gene locus_tag LOCUS_08730 340425 339787 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_08730 342104 340425 gene locus_tag LOCUS_08740 gene ilvD 342104 340425 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 protein_id gnl|my_center|LOCUS_08740 342233 342307 gene locus_tag LOCUS_t00150 342233 342307 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 342335 342422 gene locus_tag LOCUS_t00160 342335 342422 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 342466 342539 gene locus_tag LOCUS_t00170 342466 342539 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 342565 342652 gene locus_tag LOCUS_t00180 342565 342652 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 343304 343047 gene locus_tag LOCUS_08750 343304 343047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 343195 344502 gene locus_tag LOCUS_08760 343195 344502 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 protein_id gnl|my_center|LOCUS_08760 344591 345601 gene locus_tag LOCUS_08770 344591 345601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 346992 345583 gene locus_tag LOCUS_08780 346992 345583 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969887.1 protein_id gnl|my_center|LOCUS_08780 347662 347000 gene locus_tag LOCUS_08790 347662 347000 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812947.1 protein_id gnl|my_center|LOCUS_08790 348869 347814 gene locus_tag LOCUS_08800 gene arsB 348869 347814 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948469.1 protein_id gnl|my_center|LOCUS_08800 349657 349217 gene locus_tag LOCUS_08810 349657 349217 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_08810 351805 349742 gene locus_tag LOCUS_08820 gene fdhF 351805 349742 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_08820 351905 352468 gene locus_tag LOCUS_08830 gene yqiA 351905 352468 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262650.1 protein_id gnl|my_center|LOCUS_08830 352767 352495 gene locus_tag LOCUS_08840 352767 352495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 353722 352823 gene locus_tag LOCUS_08850 353722 352823 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_08850 354700 353807 gene locus_tag LOCUS_08860 354700 353807 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869215.1 protein_id gnl|my_center|LOCUS_08860 355540 354737 gene locus_tag LOCUS_08870 355540 354737 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207243.1 protein_id gnl|my_center|LOCUS_08870 355988 355590 gene locus_tag LOCUS_08880 355988 355590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 356216 356629 gene locus_tag LOCUS_08890 356216 356629 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097334.1 protein_id gnl|my_center|LOCUS_08890 356653 357195 gene locus_tag LOCUS_08900 356653 357195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 357195 358187 gene locus_tag LOCUS_08910 gene amrS 357195 358187 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_08910 358177 358977 gene locus_tag LOCUS_08920 358177 358977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 359008 359616 gene locus_tag LOCUS_08930 359008 359616 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_08930 360982 359648 gene locus_tag LOCUS_08940 360982 359648 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 protein_id gnl|my_center|LOCUS_08940 361624 361058 gene locus_tag LOCUS_08950 361624 361058 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228192.1 protein_id gnl|my_center|LOCUS_08950 361742 362302 gene locus_tag LOCUS_08960 361742 362302 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941232.1 protein_id gnl|my_center|LOCUS_08960 362302 362835 gene locus_tag LOCUS_08970 362302 362835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 362951 364534 gene locus_tag LOCUS_08980 362951 364534 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788346.1 protein_id gnl|my_center|LOCUS_08980 364537 365013 gene locus_tag LOCUS_08990 gene cheQ 364537 365013 CDS product cheVAW transcriptional regulator CheQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851877.1 protein_id gnl|my_center|LOCUS_08990 366387 365581 gene locus_tag LOCUS_09000 366387 365581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 367029 368453 gene locus_tag LOCUS_09010 367029 368453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 368441 368830 gene locus_tag LOCUS_09020 368441 368830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 368841 369767 gene locus_tag LOCUS_09030 368841 369767 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_09030 369918 369831 gene locus_tag LOCUS_t00190 369918 369831 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 370156 370287 gene locus_tag LOCUS_09040 370156 370287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 370406 371692 gene locus_tag LOCUS_09050 370406 371692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 371901 373241 gene locus_tag LOCUS_09060 371901 373241 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071896.1 protein_id gnl|my_center|LOCUS_09060 373280 374725 gene locus_tag LOCUS_09070 gene pyk 373280 374725 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_09070 375786 374779 gene locus_tag LOCUS_09080 gene proX 375786 374779 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477761.1 protein_id gnl|my_center|LOCUS_09080 376814 375783 gene locus_tag LOCUS_09090 gene proW 376814 375783 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370072.1 protein_id gnl|my_center|LOCUS_09090 378013 376814 gene locus_tag LOCUS_09100 gene proV 378013 376814 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 protein_id gnl|my_center|LOCUS_09100 379187 378243 gene locus_tag LOCUS_09110 gene mutY 379187 378243 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851465.1 protein_id gnl|my_center|LOCUS_09110 379864 379190 gene locus_tag LOCUS_09120 379864 379190 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 protein_id gnl|my_center|LOCUS_09120 381234 380023 gene locus_tag LOCUS_09130 381234 380023 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_09130 381617 381228 gene locus_tag LOCUS_09140 gene queF 381617 381228 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 protein_id gnl|my_center|LOCUS_09140 383029 381614 gene locus_tag LOCUS_09150 383029 381614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 385341 383029 gene locus_tag LOCUS_09160 gene gyrB 385341 383029 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858833.1 protein_id gnl|my_center|LOCUS_09160 386439 385372 gene locus_tag LOCUS_09170 gene dnaN 386439 385372 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_09170 387922 386597 gene locus_tag LOCUS_09180 gene dnaA 387922 386597 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 protein_id gnl|my_center|LOCUS_09180 388082 388552 gene locus_tag LOCUS_09190 gene ruvC 388082 388552 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 protein_id gnl|my_center|LOCUS_09190 389163 388549 gene locus_tag LOCUS_09200 gene thyX 389163 388549 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853111.1 protein_id gnl|my_center|LOCUS_09200 392155 389219 gene locus_tag LOCUS_09210 392155 389219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 394032 392269 gene locus_tag LOCUS_09220 394032 392269 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805291.1 protein_id gnl|my_center|LOCUS_09220 394725 394042 gene locus_tag LOCUS_09230 394725 394042 CDS product flagellar basal body rod modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805290.1 protein_id gnl|my_center|LOCUS_09230 396351 394738 gene locus_tag LOCUS_09240 396351 394738 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891831.1 protein_id gnl|my_center|LOCUS_09240 396582 398381 gene locus_tag LOCUS_09250 gene typA 396582 398381 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_09250 398465 399022 gene locus_tag LOCUS_09260 398465 399022 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_09260 399030 399995 gene locus_tag LOCUS_09270 399030 399995 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_09270 400001 400453 gene locus_tag LOCUS_09280 400001 400453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 401534 400440 gene locus_tag LOCUS_09290 401534 400440 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207024.1 protein_id gnl|my_center|LOCUS_09290 402011 401541 gene locus_tag LOCUS_09300 402011 401541 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851998.1 protein_id gnl|my_center|LOCUS_09300 402622 402014 gene locus_tag LOCUS_09310 gene pyrE 402622 402014 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 protein_id gnl|my_center|LOCUS_09310 403191 402631 gene locus_tag LOCUS_09320 gene frr 403191 402631 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938332.1 protein_id gnl|my_center|LOCUS_09320 404158 403220 gene locus_tag LOCUS_09330 404158 403220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 404524 404180 gene locus_tag LOCUS_09340 gene secG 404524 404180 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851915.1 protein_id gnl|my_center|LOCUS_09340 404695 405438 gene locus_tag LOCUS_09350 404695 405438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 405441 405953 gene locus_tag LOCUS_09360 405441 405953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 408307 405950 gene locus_tag LOCUS_09370 408307 405950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 410527 408311 gene locus_tag LOCUS_09380 410527 408311 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_09380 411855 410530 gene locus_tag LOCUS_09390 411855 410530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 413518 411866 gene locus_tag LOCUS_09400 413518 411866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 413668 414375 gene locus_tag LOCUS_09410 413668 414375 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376795.1 protein_id gnl|my_center|LOCUS_09410 414808 417150 gene locus_tag LOCUS_09420 414808 417150 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_09420 417153 417716 gene locus_tag LOCUS_09430 417153 417716 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073773.1 protein_id gnl|my_center|LOCUS_09430 417726 418892 gene locus_tag LOCUS_09440 gene nrfD 417726 418892 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762020.1 protein_id gnl|my_center|LOCUS_09440 418921 419238 gene locus_tag LOCUS_09450 418921 419238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 419332 419784 gene locus_tag LOCUS_09460 419332 419784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 420148 422574 gene locus_tag LOCUS_09470 420148 422574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 422577 423239 gene locus_tag LOCUS_09480 422577 423239 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461975.1 protein_id gnl|my_center|LOCUS_09480 423227 424492 gene locus_tag LOCUS_09490 423227 424492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 424671 425891 gene locus_tag LOCUS_09500 424671 425891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 425997 426314 gene locus_tag LOCUS_09510 425997 426314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 427134 426427 gene locus_tag LOCUS_09520 427134 426427 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence03 925 116 gene locus_tag LOCUS_09530 925 116 CDS product plasminogen-binding N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852692.1 protein_id gnl|my_center|LOCUS_09530 1073 2248 gene locus_tag LOCUS_09540 1073 2248 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 protein_id gnl|my_center|LOCUS_09540 2313 3272 gene locus_tag LOCUS_09550 gene corA 2313 3272 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_09550 3275 3850 gene locus_tag LOCUS_09560 3275 3850 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119978.1 protein_id gnl|my_center|LOCUS_09560 4716 3874 gene locus_tag LOCUS_09570 4716 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963669.1 protein_id gnl|my_center|LOCUS_09570 6257 4713 gene locus_tag LOCUS_09580 6257 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 7185 6313 gene locus_tag LOCUS_09590 7185 6313 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853261.1 protein_id gnl|my_center|LOCUS_09590 7300 7527 gene locus_tag LOCUS_09600 7300 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7524 9620 gene locus_tag LOCUS_09610 gene feoB 7524 9620 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_09610 10524 9637 gene locus_tag LOCUS_09620 10524 9637 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853697.1 protein_id gnl|my_center|LOCUS_09620 11516 10521 gene locus_tag LOCUS_09630 11516 10521 CDS product agamatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855829.1 protein_id gnl|my_center|LOCUS_09630 11636 13138 gene locus_tag LOCUS_09640 11636 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 13119 13799 gene locus_tag LOCUS_09650 gene dccR 13119 13799 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_09650 13923 14237 gene locus_tag LOCUS_09660 13923 14237 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_09660 14234 15880 gene locus_tag LOCUS_09670 gene actP 14234 15880 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705923.1 protein_id gnl|my_center|LOCUS_09670 15922 17868 gene locus_tag LOCUS_09680 gene acs 15922 17868 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851288.1 protein_id gnl|my_center|LOCUS_09680 18606 17923 gene locus_tag LOCUS_09690 18606 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 20465 18612 gene locus_tag LOCUS_09700 gene rpoD 20465 18612 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 protein_id gnl|my_center|LOCUS_09700 20639 21442 gene locus_tag LOCUS_09710 20639 21442 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858501.1 protein_id gnl|my_center|LOCUS_09710 21455 22243 gene locus_tag LOCUS_09720 gene flgG 21455 22243 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852142.1 protein_id gnl|my_center|LOCUS_09720 22251 22421 gene locus_tag LOCUS_09730 22251 22421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 22443 23117 gene locus_tag LOCUS_09740 22443 23117 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_09740 23107 23430 gene locus_tag LOCUS_09750 23107 23430 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065708.1 protein_id gnl|my_center|LOCUS_09750 23914 23432 gene locus_tag LOCUS_09760 23914 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 24013 24429 gene locus_tag LOCUS_09770 24013 24429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 24440 24895 gene locus_tag LOCUS_09780 24440 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 24892 25995 gene locus_tag LOCUS_09790 24892 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 26004 26381 gene locus_tag LOCUS_09800 26004 26381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 26378 27049 gene locus_tag LOCUS_09810 26378 27049 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963885.1 protein_id gnl|my_center|LOCUS_09810 27058 28272 gene locus_tag LOCUS_09820 27058 28272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 30098 28278 gene locus_tag LOCUS_09830 30098 28278 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388392.1 protein_id gnl|my_center|LOCUS_09830 32190 30292 gene locus_tag LOCUS_09840 32190 30292 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_09840 32455 32201 gene locus_tag LOCUS_09850 32455 32201 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 protein_id gnl|my_center|LOCUS_09850 32736 33278 gene locus_tag LOCUS_09860 32736 33278 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_09860 34812 33358 gene locus_tag LOCUS_09870 34812 33358 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_09870 35947 34826 gene locus_tag LOCUS_09880 gene prpC 35947 34826 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947259.1 protein_id gnl|my_center|LOCUS_09880 36838 35957 gene locus_tag LOCUS_09890 gene prpB 36838 35957 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224930.1 protein_id gnl|my_center|LOCUS_09890 38748 36835 gene locus_tag LOCUS_09900 38748 36835 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 protein_id gnl|my_center|LOCUS_09900 38890 39831 gene locus_tag LOCUS_09910 38890 39831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 39907 40530 gene locus_tag LOCUS_09920 39907 40530 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205912.1 protein_id gnl|my_center|LOCUS_09920 40540 41169 gene locus_tag LOCUS_09930 40540 41169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 43119 41164 gene locus_tag LOCUS_09940 43119 41164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 43949 43119 gene locus_tag LOCUS_09950 43949 43119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 44748 44032 gene locus_tag LOCUS_09960 44748 44032 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_09960 45053 46174 gene locus_tag LOCUS_09970 45053 46174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 46185 48701 gene locus_tag LOCUS_09980 46185 48701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 48711 49769 gene locus_tag LOCUS_09990 48711 49769 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 protein_id gnl|my_center|LOCUS_09990 49866 50849 gene locus_tag LOCUS_10000 49866 50849 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_10000 51083 50871 gene locus_tag LOCUS_10010 51083 50871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 51777 51214 gene locus_tag LOCUS_10020 51777 51214 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132255.1 protein_id gnl|my_center|LOCUS_10020 51876 53366 gene locus_tag LOCUS_10030 51876 53366 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268799.1 protein_id gnl|my_center|LOCUS_10030 53476 54765 gene locus_tag LOCUS_10040 gene rhlE 53476 54765 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007058.1 protein_id gnl|my_center|LOCUS_10040 54762 55226 gene locus_tag LOCUS_10050 54762 55226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 55236 55739 gene locus_tag LOCUS_10060 55236 55739 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437086.1 protein_id gnl|my_center|LOCUS_10060 55740 57536 gene locus_tag LOCUS_10070 gene recQ 55740 57536 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211484.1 protein_id gnl|my_center|LOCUS_10070 57665 58744 gene locus_tag LOCUS_10080 57665 58744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 59437 58796 gene locus_tag LOCUS_10090 59437 58796 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966752.1 protein_id gnl|my_center|LOCUS_10090 59956 59714 gene locus_tag LOCUS_10100 59956 59714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 60071 60170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60354 60175 gene locus_tag LOCUS_10110 60354 60175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 60950 60414 gene locus_tag LOCUS_10120 60950 60414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 61882 60947 gene locus_tag LOCUS_10130 gene msrP 61882 60947 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858649.1 protein_id gnl|my_center|LOCUS_10130 62093 64174 gene locus_tag LOCUS_10140 62093 64174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 64185 66008 gene locus_tag LOCUS_10150 64185 66008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 66005 66454 gene locus_tag LOCUS_10160 gene exbB 66005 66454 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881140.1 protein_id gnl|my_center|LOCUS_10160 66444 66821 gene locus_tag LOCUS_10170 66444 66821 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881197.1 protein_id gnl|my_center|LOCUS_10170 66818 67507 gene locus_tag LOCUS_10180 66818 67507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 67695 67504 gene locus_tag LOCUS_10190 67695 67504 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_10190 67802 69094 gene locus_tag LOCUS_10200 67802 69094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 69095 69676 gene locus_tag LOCUS_10210 69095 69676 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_10210 71508 69712 gene locus_tag LOCUS_10220 71508 69712 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064637.1 protein_id gnl|my_center|LOCUS_10220 72471 71518 gene locus_tag LOCUS_10230 72471 71518 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_10230 73336 72572 gene locus_tag LOCUS_10240 73336 72572 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851821.1 protein_id gnl|my_center|LOCUS_10240 73782 73333 gene locus_tag LOCUS_10250 73782 73333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 74549 73785 gene locus_tag LOCUS_10260 74549 73785 CDS product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418960.1 protein_id gnl|my_center|LOCUS_10260 75433 74621 gene locus_tag LOCUS_10270 75433 74621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 76814 75561 gene locus_tag LOCUS_10280 76814 75561 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_10280 77125 76811 gene locus_tag LOCUS_10290 77125 76811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 77504 78097 gene locus_tag LOCUS_10300 77504 78097 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_10300 78157 78732 gene locus_tag LOCUS_10310 78157 78732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 78732 79526 gene locus_tag LOCUS_10320 78732 79526 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482609.1 protein_id gnl|my_center|LOCUS_10320 82680 79564 gene locus_tag LOCUS_10330 82680 79564 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_10330 82877 84136 gene locus_tag LOCUS_10340 82877 84136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 84148 85422 gene locus_tag LOCUS_10350 84148 85422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 86131 85460 gene locus_tag LOCUS_10360 86131 85460 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_10360 86364 86134 gene locus_tag LOCUS_10370 86364 86134 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_10370 86636 86361 gene locus_tag LOCUS_10380 86636 86361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 87091 86633 gene locus_tag LOCUS_10390 87091 86633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 88060 87101 gene locus_tag LOCUS_10400 88060 87101 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_10400 88991 88053 gene locus_tag LOCUS_10410 88991 88053 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_10410 89389 88991 gene locus_tag LOCUS_10420 89389 88991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 89559 89386 gene locus_tag LOCUS_10430 89559 89386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 90586 89480 gene locus_tag LOCUS_10440 90586 89480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 91303 90587 gene locus_tag LOCUS_10450 91303 90587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 92547 91312 gene locus_tag LOCUS_10460 92547 91312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_10460 93230 92544 gene locus_tag LOCUS_10470 93230 92544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669611.1 protein_id gnl|my_center|LOCUS_10470 94685 93300 gene locus_tag LOCUS_10480 gene gnfM 94685 93300 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_10480 96095 94722 gene locus_tag LOCUS_10490 96095 94722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 96961 96092 gene locus_tag LOCUS_10500 96961 96092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 97084 97920 gene locus_tag LOCUS_10510 gene nrfD 97084 97920 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461605.1 protein_id gnl|my_center|LOCUS_10510 97931 100492 gene locus_tag LOCUS_10520 97931 100492 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272623.1 protein_id gnl|my_center|LOCUS_10520 100507 101205 gene locus_tag LOCUS_10530 100507 101205 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461607.1 protein_id gnl|my_center|LOCUS_10530 101284 101916 gene locus_tag LOCUS_10540 101284 101916 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 protein_id gnl|my_center|LOCUS_10540 101918 102706 gene locus_tag LOCUS_10550 101918 102706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_10550 102767 103255 gene locus_tag LOCUS_10560 gene leuD 102767 103255 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_10560 103252 104325 gene locus_tag LOCUS_10570 gene leuB 103252 104325 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812648.1 protein_id gnl|my_center|LOCUS_10570 104322 104570 gene locus_tag LOCUS_10580 104322 104570 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891888.1 protein_id gnl|my_center|LOCUS_10580 104546 104947 gene locus_tag LOCUS_10590 104546 104947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852635.1 protein_id gnl|my_center|LOCUS_10590 104928 106043 gene locus_tag LOCUS_10600 104928 106043 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868507.1 protein_id gnl|my_center|LOCUS_10600 106034 106876 gene locus_tag LOCUS_10610 gene purU 106034 106876 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852510.1 protein_id gnl|my_center|LOCUS_10610 107025 107495 gene locus_tag LOCUS_10620 107025 107495 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_10620 107492 108628 gene locus_tag LOCUS_10630 107492 108628 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260957.1 protein_id gnl|my_center|LOCUS_10630 108673 111267 gene locus_tag LOCUS_10640 108673 111267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 111557 111243 gene locus_tag LOCUS_10650 111557 111243 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_10650 111694 112338 gene locus_tag LOCUS_10660 111694 112338 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851887.1 protein_id gnl|my_center|LOCUS_10660 112335 113273 gene locus_tag LOCUS_10670 112335 113273 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986870.1 protein_id gnl|my_center|LOCUS_10670 113347 113550 gene locus_tag LOCUS_10680 113347 113550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 113640 115691 gene locus_tag LOCUS_10690 gene glyS 113640 115691 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858294.1 protein_id gnl|my_center|LOCUS_10690 115843 117537 gene locus_tag LOCUS_10700 115843 117537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 117573 118373 gene locus_tag LOCUS_10710 117573 118373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 118373 120115 gene locus_tag LOCUS_10720 118373 120115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 120116 120829 gene locus_tag LOCUS_10730 120116 120829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 121189 120851 gene locus_tag LOCUS_10740 gene glnB 121189 120851 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_10740 122521 121208 gene locus_tag LOCUS_10750 122521 121208 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545822.1 protein_id gnl|my_center|LOCUS_10750 122695 124623 gene locus_tag LOCUS_10760 gene opgB 122695 124623 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704310.1 protein_id gnl|my_center|LOCUS_10760 124690 126621 gene locus_tag LOCUS_10770 gene opgB 124690 126621 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095459.1 protein_id gnl|my_center|LOCUS_10770 128520 126637 gene locus_tag LOCUS_10780 128520 126637 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706983.1 protein_id gnl|my_center|LOCUS_10780 128839 128630 gene locus_tag LOCUS_10790 128839 128630 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327668.1 protein_id gnl|my_center|LOCUS_10790 128920 132390 gene locus_tag LOCUS_10800 gene metH 128920 132390 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140480.1 protein_id gnl|my_center|LOCUS_10800 132412 133200 gene locus_tag LOCUS_10810 132412 133200 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_10810 133210 133905 gene locus_tag LOCUS_10820 133210 133905 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864286.1 protein_id gnl|my_center|LOCUS_10820 134800 133940 gene locus_tag LOCUS_10830 134800 133940 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262779.1 protein_id gnl|my_center|LOCUS_10830 135886 135161 gene locus_tag LOCUS_10840 gene dccR 135886 135161 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_10840 137192 136116 gene locus_tag LOCUS_10850 137192 136116 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_10850 137673 137308 gene locus_tag LOCUS_10860 137673 137308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 138349 137675 gene locus_tag LOCUS_10870 138349 137675 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880976.1 protein_id gnl|my_center|LOCUS_10870 139677 138346 gene locus_tag LOCUS_10880 139677 138346 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864101.1 protein_id gnl|my_center|LOCUS_10880 139774 141771 gene locus_tag LOCUS_10890 139774 141771 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016727.1 protein_id gnl|my_center|LOCUS_10890 141852 142343 gene locus_tag LOCUS_10900 141852 142343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 142399 144291 gene locus_tag LOCUS_10910 142399 144291 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416237.1 protein_id gnl|my_center|LOCUS_10910 144313 145710 gene locus_tag LOCUS_10920 144313 145710 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582858.1 protein_id gnl|my_center|LOCUS_10920 145831 148722 gene locus_tag LOCUS_10930 145831 148722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 148715 149734 gene locus_tag LOCUS_10940 148715 149734 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_10940 149731 150420 gene locus_tag LOCUS_10950 149731 150420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 150496 150777 gene locus_tag LOCUS_10960 150496 150777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 151708 150770 gene locus_tag LOCUS_10970 gene queA 151708 150770 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_10970 152563 151793 gene locus_tag LOCUS_10980 gene tatC 152563 151793 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852171.1 protein_id gnl|my_center|LOCUS_10980 153000 152563 gene locus_tag LOCUS_10990 153000 152563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 153790 153074 gene locus_tag LOCUS_11000 153790 153074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 154119 155801 gene locus_tag LOCUS_11010 154119 155801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 155859 158060 gene locus_tag LOCUS_11020 gene purL 155859 158060 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858406.1 protein_id gnl|my_center|LOCUS_11020 158248 159291 gene locus_tag LOCUS_11030 158248 159291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 160133 159405 gene locus_tag LOCUS_11040 160133 159405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 160755 160138 gene locus_tag LOCUS_11050 160755 160138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 161663 160800 gene locus_tag LOCUS_11060 161663 160800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 162596 161712 gene locus_tag LOCUS_11070 162596 161712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 163752 162607 gene locus_tag LOCUS_11080 163752 162607 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_11080 163848 164600 gene locus_tag LOCUS_11090 163848 164600 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853334.1 protein_id gnl|my_center|LOCUS_11090 165280 164642 gene locus_tag LOCUS_11100 165280 164642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 165714 165277 gene locus_tag LOCUS_11110 165714 165277 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_11110 165836 167368 gene locus_tag LOCUS_11120 gene purH 165836 167368 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853339.1 protein_id gnl|my_center|LOCUS_11120 167446 167802 gene locus_tag LOCUS_11130 167446 167802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 167804 169075 gene locus_tag LOCUS_11140 167804 169075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_11140 169072 169368 gene locus_tag LOCUS_11150 169072 169368 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101428.1 protein_id gnl|my_center|LOCUS_11150 169464 169769 gene locus_tag LOCUS_11160 169464 169769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 169771 171360 gene locus_tag LOCUS_11170 169771 171360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 173324 171375 gene locus_tag LOCUS_11180 173324 171375 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 protein_id gnl|my_center|LOCUS_11180 173410 174648 gene locus_tag LOCUS_11190 173410 174648 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884428.1 protein_id gnl|my_center|LOCUS_11190 174636 175463 gene locus_tag LOCUS_11200 174636 175463 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176078.1 protein_id gnl|my_center|LOCUS_11200 175460 175933 gene locus_tag LOCUS_11210 175460 175933 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858582.1 protein_id gnl|my_center|LOCUS_11210 177102 175984 gene locus_tag LOCUS_11220 gene ftsZ 177102 175984 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 protein_id gnl|my_center|LOCUS_11220 178482 177118 gene locus_tag LOCUS_11230 gene ftsA 178482 177118 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_11230 179943 178483 gene locus_tag LOCUS_11240 179943 178483 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852128.1 protein_id gnl|my_center|LOCUS_11240 180033 181343 gene locus_tag LOCUS_11250 180033 181343 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816247.1 protein_id gnl|my_center|LOCUS_11250 181379 182305 gene locus_tag LOCUS_11260 gene rsmH 181379 182305 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891880.1 protein_id gnl|my_center|LOCUS_11260 182295 182579 gene locus_tag LOCUS_11270 182295 182579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 182606 185704 gene locus_tag LOCUS_11280 182606 185704 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_11280 185694 186983 gene locus_tag LOCUS_11290 185694 186983 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895536.1 protein_id gnl|my_center|LOCUS_11290 188226 187000 gene locus_tag LOCUS_11300 188226 187000 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_11300 188743 188183 gene locus_tag LOCUS_11310 gene tpx 188743 188183 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_11310 188883 189071 gene locus_tag LOCUS_11320 188883 189071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 189617 189090 gene locus_tag LOCUS_11330 189617 189090 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704905.1 protein_id gnl|my_center|LOCUS_11330 191625 189628 gene locus_tag LOCUS_11340 191625 189628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 191683 193011 gene locus_tag LOCUS_11350 gene pif1 191683 193011 CDS product ATP-dependent DNA helicase Pif1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853306.1 protein_id gnl|my_center|LOCUS_11350 193044 193547 gene locus_tag LOCUS_11360 193044 193547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858686.1 protein_id gnl|my_center|LOCUS_11360 193556 194035 gene locus_tag LOCUS_11370 193556 194035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 194403 194032 gene locus_tag LOCUS_11380 194403 194032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 194521 198516 gene locus_tag LOCUS_11390 194521 198516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 198513 199148 gene locus_tag LOCUS_11400 198513 199148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 199148 200086 gene locus_tag LOCUS_11410 199148 200086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 200086 200535 gene locus_tag LOCUS_11420 200086 200535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 200532 201008 gene locus_tag LOCUS_11430 200532 201008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 201028 202518 gene locus_tag LOCUS_11440 201028 202518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 202515 203123 gene locus_tag LOCUS_11450 202515 203123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 203120 203515 gene locus_tag LOCUS_11460 203120 203515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 203512 204984 gene locus_tag LOCUS_11470 gene mshL 203512 204984 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_11470 204981 205781 gene locus_tag LOCUS_11480 204981 205781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 205771 206535 gene locus_tag LOCUS_11490 205771 206535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 206532 207074 gene locus_tag LOCUS_11500 206532 207074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 207074 208741 gene locus_tag LOCUS_11510 207074 208741 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_11510 208759 210003 gene locus_tag LOCUS_11520 208759 210003 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456304.1 protein_id gnl|my_center|LOCUS_11520 210700 210095 gene locus_tag LOCUS_11530 210700 210095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 211113 210718 gene locus_tag LOCUS_11540 211113 210718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 211404 211195 gene locus_tag LOCUS_11550 211404 211195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 211540 213567 gene locus_tag LOCUS_11560 211540 213567 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852419.1 protein_id gnl|my_center|LOCUS_11560 213636 214031 gene locus_tag LOCUS_11570 213636 214031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 214037 215773 gene locus_tag LOCUS_11580 214037 215773 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_11580 216112 215801 gene locus_tag LOCUS_11590 216112 215801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 216229 216897 gene locus_tag LOCUS_11600 216229 216897 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398700.1 protein_id gnl|my_center|LOCUS_11600 218815 216944 gene locus_tag LOCUS_11610 gene htpG 218815 216944 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858566.1 protein_id gnl|my_center|LOCUS_11610 219315 218914 gene locus_tag LOCUS_11620 gene crcB 219315 218914 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858490.1 protein_id gnl|my_center|LOCUS_11620 219970 219269 gene locus_tag LOCUS_11630 219970 219269 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858620.1 protein_id gnl|my_center|LOCUS_11630 220976 219948 gene locus_tag LOCUS_11640 220976 219948 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858517.1 protein_id gnl|my_center|LOCUS_11640 221727 221056 gene locus_tag LOCUS_11650 gene purQ 221727 221056 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858528.1 protein_id gnl|my_center|LOCUS_11650 221966 221721 gene locus_tag LOCUS_11660 gene purS 221966 221721 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858611.1 protein_id gnl|my_center|LOCUS_11660 222695 221982 gene locus_tag LOCUS_11670 222695 221982 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858572.1 protein_id gnl|my_center|LOCUS_11670 224029 222710 gene locus_tag LOCUS_11680 224029 222710 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856815.1 protein_id gnl|my_center|LOCUS_11680 224288 226861 gene locus_tag LOCUS_11690 224288 226861 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858618.1 protein_id gnl|my_center|LOCUS_11690 227330 226908 gene locus_tag LOCUS_11700 227330 226908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 227393 227824 gene locus_tag LOCUS_11710 227393 227824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 228292 227813 gene locus_tag LOCUS_11720 gene rraA 228292 227813 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765718.1 protein_id gnl|my_center|LOCUS_11720 228663 228304 gene locus_tag LOCUS_11730 228663 228304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 228748 229155 gene locus_tag LOCUS_11740 228748 229155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 229152 230516 gene locus_tag LOCUS_11750 229152 230516 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583700.1 protein_id gnl|my_center|LOCUS_11750 230513 231703 gene locus_tag LOCUS_11760 230513 231703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 231705 233279 gene locus_tag LOCUS_11770 231705 233279 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548106.1 protein_id gnl|my_center|LOCUS_11770 233370 233504 gene locus_tag LOCUS_11780 233370 233504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 233585 233827 gene locus_tag LOCUS_11790 233585 233827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 234176 235780 gene locus_tag LOCUS_11800 gene yidC 234176 235780 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853384.1 protein_id gnl|my_center|LOCUS_11800 235777 236742 gene locus_tag LOCUS_11810 235777 236742 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 protein_id gnl|my_center|LOCUS_11810 236922 238076 gene locus_tag LOCUS_11820 gene mnmE 236922 238076 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853397.1 protein_id gnl|my_center|LOCUS_11820 238142 239305 gene locus_tag LOCUS_11830 gene nhaA 238142 239305 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 protein_id gnl|my_center|LOCUS_11830 239359 241935 gene locus_tag LOCUS_11840 239359 241935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 242455 241940 gene locus_tag LOCUS_11850 gene lolA 242455 241940 CDS product LolA-like outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201065.1 protein_id gnl|my_center|LOCUS_11850 242577 245162 gene locus_tag LOCUS_11860 gene secA 242577 245162 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858134.1 protein_id gnl|my_center|LOCUS_11860 245173 246375 gene locus_tag LOCUS_11870 245173 246375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 protein_id gnl|my_center|LOCUS_11870 246778 246377 gene locus_tag LOCUS_11880 246778 246377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 248082 246823 gene locus_tag LOCUS_11890 248082 246823 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_11890 248759 248079 gene locus_tag LOCUS_11900 248759 248079 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853196.1 protein_id gnl|my_center|LOCUS_11900 250250 248832 gene locus_tag LOCUS_11910 gene htrA 250250 248832 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853235.1 protein_id gnl|my_center|LOCUS_11910 250449 251345 gene locus_tag LOCUS_11920 250449 251345 CDS product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853234.1 protein_id gnl|my_center|LOCUS_11920 251356 251730 gene locus_tag LOCUS_11930 gene hspR 251356 251730 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_11930 251733 253343 gene locus_tag LOCUS_11940 251733 253343 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_11940 254385 253330 gene locus_tag LOCUS_11950 gene hemW 254385 253330 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852262.1 protein_id gnl|my_center|LOCUS_11950 254455 254925 gene locus_tag LOCUS_11960 254455 254925 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_11960 254927 256129 gene locus_tag LOCUS_11970 254927 256129 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891865.1 protein_id gnl|my_center|LOCUS_11970 256130 256684 gene locus_tag LOCUS_11980 256130 256684 CDS product HobA family DNA replication regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852154.1 protein_id gnl|my_center|LOCUS_11980 256677 257297 gene locus_tag LOCUS_11990 256677 257297 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 protein_id gnl|my_center|LOCUS_11990 257294 258436 gene locus_tag LOCUS_12000 gene folP 257294 258436 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858587.1 protein_id gnl|my_center|LOCUS_12000 258445 259092 gene locus_tag LOCUS_12010 258445 259092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 259082 259843 gene locus_tag LOCUS_12020 259082 259843 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851426.1 protein_id gnl|my_center|LOCUS_12020 259840 261789 gene locus_tag LOCUS_12030 gene ligA 259840 261789 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852062.1 protein_id gnl|my_center|LOCUS_12030 261786 262499 gene locus_tag LOCUS_12040 261786 262499 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852328.1 protein_id gnl|my_center|LOCUS_12040 262465 263328 gene locus_tag LOCUS_12050 262465 263328 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852206.1 protein_id gnl|my_center|LOCUS_12050 264089 263307 gene locus_tag LOCUS_12060 264089 263307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 264199 264915 gene locus_tag LOCUS_12070 gene cmoA 264199 264915 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_12070 265198 264932 gene locus_tag LOCUS_12080 265198 264932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 266232 265201 gene locus_tag LOCUS_12090 266232 265201 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852576.1 protein_id gnl|my_center|LOCUS_12090 268447 266255 gene locus_tag LOCUS_12100 gene flhA 268447 266255 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852599.1 protein_id gnl|my_center|LOCUS_12100 268861 268457 gene locus_tag LOCUS_12110 268861 268457 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852609.1 protein_id gnl|my_center|LOCUS_12110 269064 269336 gene locus_tag LOCUS_12120 gene rpsO 269064 269336 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852579.1 protein_id gnl|my_center|LOCUS_12120 269630 269878 gene locus_tag LOCUS_12130 269630 269878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 269875 270027 gene locus_tag LOCUS_12140 269875 270027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 270205 271008 gene locus_tag LOCUS_12150 270205 271008 CDS product HrcA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891884.1 protein_id gnl|my_center|LOCUS_12150 271012 271560 gene locus_tag LOCUS_12160 gene grpE 271012 271560 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780052.1 protein_id gnl|my_center|LOCUS_12160 271582 273471 gene locus_tag LOCUS_12170 gene dnaK 271582 273471 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826316.1 protein_id gnl|my_center|LOCUS_12170 274503 273574 gene locus_tag LOCUS_12180 gene ppk2 274503 273574 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_12180 274610 276355 gene locus_tag LOCUS_12190 274610 276355 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852245.1 protein_id gnl|my_center|LOCUS_12190 276356 276646 gene locus_tag LOCUS_12200 276356 276646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 277368 276643 gene locus_tag LOCUS_12210 gene kdsB 277368 276643 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852502.1 protein_id gnl|my_center|LOCUS_12210 278858 277365 gene locus_tag LOCUS_12220 gene thrC 278858 277365 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117321.1 protein_id gnl|my_center|LOCUS_12220 279718 278867 gene locus_tag LOCUS_12230 gene argB 279718 278867 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_12230 280575 279754 gene locus_tag LOCUS_12240 280575 279754 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833936.1 protein_id gnl|my_center|LOCUS_12240 281818 280685 gene locus_tag LOCUS_12250 gene pseC 281818 280685 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_12250 282599 281832 gene locus_tag LOCUS_12260 282599 281832 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903173.1 protein_id gnl|my_center|LOCUS_12260 282715 283308 gene locus_tag LOCUS_12270 282715 283308 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852433.1 protein_id gnl|my_center|LOCUS_12270 283860 283303 gene locus_tag LOCUS_12280 283860 283303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 284814 283915 gene locus_tag LOCUS_12290 gene cmoB 284814 283915 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_12290 285048 284818 gene locus_tag LOCUS_12300 285048 284818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 285111 286379 gene locus_tag LOCUS_12310 285111 286379 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853369.1 protein_id gnl|my_center|LOCUS_12310 286383 286946 gene locus_tag LOCUS_12320 286383 286946 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054459.1 protein_id gnl|my_center|LOCUS_12320 287591 286947 gene locus_tag LOCUS_12330 gene nth 287591 286947 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852225.1 protein_id gnl|my_center|LOCUS_12330 287763 288575 gene locus_tag LOCUS_12340 gene peb4 287763 288575 CDS product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 protein_id gnl|my_center|LOCUS_12340 288709 289785 gene locus_tag LOCUS_12350 gene fbaA 288709 289785 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_12350 290025 290711 gene locus_tag LOCUS_12360 290025 290711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 290738 292030 gene locus_tag LOCUS_12370 gene hisD 290738 292030 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_12370 292035 292976 gene locus_tag LOCUS_12380 292035 292976 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963695.1 protein_id gnl|my_center|LOCUS_12380 292973 293500 gene locus_tag LOCUS_12390 gene mog 292973 293500 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_12390 294610 293549 gene locus_tag LOCUS_12400 294610 293549 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123234.1 protein_id gnl|my_center|LOCUS_12400 297348 294718 gene locus_tag LOCUS_12410 297348 294718 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864150.1 protein_id gnl|my_center|LOCUS_12410 298196 297408 gene locus_tag LOCUS_12420 298196 297408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 299221 298292 gene locus_tag LOCUS_12430 gene cysK 299221 298292 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_12430 299646 299233 gene locus_tag LOCUS_12440 299646 299233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 300918 299656 gene locus_tag LOCUS_12450 300918 299656 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853122.1 protein_id gnl|my_center|LOCUS_12450 301349 301636 gene locus_tag LOCUS_12460 301349 301636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 301629 302096 gene locus_tag LOCUS_12470 301629 302096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 302098 302994 gene locus_tag LOCUS_12480 302098 302994 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_12480 302994 304298 gene locus_tag LOCUS_12490 gene hemA 302994 304298 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878972.1 protein_id gnl|my_center|LOCUS_12490 304295 305998 gene locus_tag LOCUS_12500 304295 305998 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891863.1 protein_id gnl|my_center|LOCUS_12500 305995 306420 gene locus_tag LOCUS_12510 305995 306420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 306368 307228 gene locus_tag LOCUS_12520 306368 307228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 307225 308169 gene locus_tag LOCUS_12530 gene hemC 307225 308169 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856753.1 protein_id gnl|my_center|LOCUS_12530 308188 309999 gene locus_tag LOCUS_12540 308188 309999 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865770.1 protein_id gnl|my_center|LOCUS_12540 310138 310737 gene locus_tag LOCUS_12550 310138 310737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 310870 311520 gene locus_tag LOCUS_12560 310870 311520 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853081.1 protein_id gnl|my_center|LOCUS_12560 311796 312560 gene locus_tag LOCUS_12570 311796 312560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 312726 312998 gene locus_tag LOCUS_12580 312726 312998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 313800 313141 gene locus_tag LOCUS_12590 313800 313141 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 protein_id gnl|my_center|LOCUS_12590 314797 313793 gene locus_tag LOCUS_12600 gene sfbB 314797 313793 CDS product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 protein_id gnl|my_center|LOCUS_12600 315683 314850 gene locus_tag LOCUS_12610 315683 314850 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 protein_id gnl|my_center|LOCUS_12610 316206 317573 gene locus_tag LOCUS_12620 316206 317573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 317560 319689 gene locus_tag LOCUS_12630 317560 319689 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356916.1 protein_id gnl|my_center|LOCUS_12630 319689 320858 gene locus_tag LOCUS_12640 319689 320858 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940949.1 protein_id gnl|my_center|LOCUS_12640 330332 320910 gene locus_tag LOCUS_12650 330332 320910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 330647 330868 gene locus_tag LOCUS_12660 330647 330868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 331105 330899 gene locus_tag LOCUS_12670 331105 330899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 331438 331142 gene locus_tag LOCUS_12680 331438 331142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 331532 332467 gene locus_tag LOCUS_12690 gene mmuM 331532 332467 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_12690 334377 332488 gene locus_tag LOCUS_12700 334377 332488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 337635 334606 gene locus_tag LOCUS_12710 gene cmeF 337635 334606 CDS product multidrug efflux RND transporter permease subunit CmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891901.1 protein_id gnl|my_center|LOCUS_12710 338337 337639 gene locus_tag LOCUS_12720 gene cmeE 338337 337639 CDS product multidrug efflux RND transporter periplasmic adaptor subunit CmeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858463.1 protein_id gnl|my_center|LOCUS_12720 339563 338334 gene locus_tag LOCUS_12730 gene cmeD 339563 338334 CDS product multidrug efflux RND transporter outer membrane subunit CmeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852947.1 protein_id gnl|my_center|LOCUS_12730 340174 339563 gene locus_tag LOCUS_12740 340174 339563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 341180 340263 gene locus_tag LOCUS_12750 341180 340263 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184594.1 protein_id gnl|my_center|LOCUS_12750 341809 341258 gene locus_tag LOCUS_12760 gene def 341809 341258 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071316.1 protein_id gnl|my_center|LOCUS_12760 341889 342359 gene locus_tag LOCUS_12770 341889 342359 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_12770 342945 342364 gene locus_tag LOCUS_12780 342945 342364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 343646 342996 gene locus_tag LOCUS_12790 343646 342996 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_12790 343763 344728 gene locus_tag LOCUS_12800 343763 344728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459067.1 protein_id gnl|my_center|LOCUS_12800 345695 344820 gene locus_tag LOCUS_12810 345695 344820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 345961 346959 gene locus_tag LOCUS_12820 345961 346959 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811009.1 protein_id gnl|my_center|LOCUS_12820 347474 347115 gene locus_tag LOCUS_12830 347474 347115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 347983 347474 gene locus_tag LOCUS_12840 347983 347474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 349628 347970 gene locus_tag LOCUS_12850 349628 347970 CDS product ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852990.1 protein_id gnl|my_center|LOCUS_12850 350859 349615 gene locus_tag LOCUS_12860 gene mtaB 350859 349615 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_12860 352469 350856 gene locus_tag LOCUS_12870 352469 350856 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852957.1 protein_id gnl|my_center|LOCUS_12870 353511 352462 gene locus_tag LOCUS_12880 gene aroB 353511 352462 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852978.1 protein_id gnl|my_center|LOCUS_12880 355008 353605 gene locus_tag LOCUS_12890 355008 353605 CDS product COG3400 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857878.1 protein_id gnl|my_center|LOCUS_12890 355056 356177 gene locus_tag LOCUS_12900 gene tgt 355056 356177 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853029.1 protein_id gnl|my_center|LOCUS_12900 356177 357238 gene locus_tag LOCUS_12910 356177 357238 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852607.1 protein_id gnl|my_center|LOCUS_12910 357240 358019 gene locus_tag LOCUS_12920 357240 358019 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852995.1 protein_id gnl|my_center|LOCUS_12920 358514 358014 gene locus_tag LOCUS_12930 358514 358014 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_12930 358872 358594 gene locus_tag LOCUS_12940 358872 358594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 360026 358872 gene locus_tag LOCUS_12950 360026 358872 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390244.1 protein_id gnl|my_center|LOCUS_12950 360666 360016 gene locus_tag LOCUS_12960 gene dccR 360666 360016 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_12960 362842 360647 gene locus_tag LOCUS_12970 362842 360647 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545732.1 protein_id gnl|my_center|LOCUS_12970 362997 364358 gene locus_tag LOCUS_12980 gene dcuB 362997 364358 CDS product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence04 494 201 gene locus_tag LOCUS_12990 494 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 660 1226 gene locus_tag LOCUS_13000 660 1226 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853249.1 protein_id gnl|my_center|LOCUS_13000 2049 1210 gene locus_tag LOCUS_13010 2049 1210 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946265.1 protein_id gnl|my_center|LOCUS_13010 2262 3197 gene locus_tag LOCUS_13020 gene yedA 2262 3197 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168169.1 protein_id gnl|my_center|LOCUS_13020 4133 3204 gene locus_tag LOCUS_13030 4133 3204 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479617.1 protein_id gnl|my_center|LOCUS_13030 4684 4199 gene locus_tag LOCUS_13040 4684 4199 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_13040 4840 6105 gene locus_tag LOCUS_13050 4840 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 6666 6106 gene locus_tag LOCUS_13060 6666 6106 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_13060 8014 6677 gene locus_tag LOCUS_13070 8014 6677 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930455.1 protein_id gnl|my_center|LOCUS_13070 8260 10806 gene locus_tag LOCUS_13080 gene torA 8260 10806 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389042.1 protein_id gnl|my_center|LOCUS_13080 10806 11369 gene locus_tag LOCUS_13090 10806 11369 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851702.1 protein_id gnl|my_center|LOCUS_13090 11518 12204 gene locus_tag LOCUS_13100 11518 12204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_13100 12380 13777 gene locus_tag LOCUS_13110 12380 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 13774 15366 gene locus_tag LOCUS_13120 13774 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 15363 17030 gene locus_tag LOCUS_13130 15363 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 18482 17040 gene locus_tag LOCUS_13140 18482 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 18960 18457 gene locus_tag LOCUS_13150 18960 18457 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 protein_id gnl|my_center|LOCUS_13150 19571 19092 gene locus_tag LOCUS_13160 19571 19092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 19721 21241 gene locus_tag LOCUS_13170 19721 21241 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_13170 21238 22521 gene locus_tag LOCUS_13180 21238 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 22523 23023 gene locus_tag LOCUS_13190 gene nuoI 22523 23023 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_13190 23020 23520 gene locus_tag LOCUS_13200 23020 23520 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_13200 23517 23837 gene locus_tag LOCUS_13210 gene nuoK 23517 23837 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015281.1 protein_id gnl|my_center|LOCUS_13210 23834 25717 gene locus_tag LOCUS_13220 gene nuoL 23834 25717 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_13220 25721 27205 gene locus_tag LOCUS_13230 25721 27205 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_13230 27202 28701 gene locus_tag LOCUS_13240 27202 28701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 30703 28694 gene locus_tag LOCUS_13250 30703 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 31554 30706 gene locus_tag LOCUS_13260 31554 30706 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_13260 34228 31544 gene locus_tag LOCUS_13270 34228 31544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 35591 34347 gene locus_tag LOCUS_13280 gene nuoF 35591 34347 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838122.1 protein_id gnl|my_center|LOCUS_13280 36067 35588 gene locus_tag LOCUS_13290 gene nuoE 36067 35588 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_13290 37734 36064 gene locus_tag LOCUS_13300 37734 36064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 38248 37724 gene locus_tag LOCUS_13310 38248 37724 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_13310 38697 38239 gene locus_tag LOCUS_13320 38697 38239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 38833 39882 gene locus_tag LOCUS_13330 gene csd6 38833 39882 CDS product cell shape-determining L,D-carboxypeptidase Csd6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757130.1 protein_id gnl|my_center|LOCUS_13330 39892 40125 gene locus_tag LOCUS_13340 39892 40125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 40128 41156 gene locus_tag LOCUS_13350 40128 41156 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852617.1 protein_id gnl|my_center|LOCUS_13350 42402 41164 gene locus_tag LOCUS_13360 42402 41164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 42794 42417 gene locus_tag LOCUS_13370 42794 42417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853267.1 protein_id gnl|my_center|LOCUS_13370 43583 43011 gene locus_tag LOCUS_13380 gene rsmG 43583 43011 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068828.1 protein_id gnl|my_center|LOCUS_13380 44221 43796 gene locus_tag LOCUS_13390 44221 43796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 44913 44473 gene locus_tag LOCUS_13400 gene mscL 44913 44473 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_13400 48769 44906 gene locus_tag LOCUS_13410 48769 44906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 49378 48815 gene locus_tag LOCUS_13420 gene ribA 49378 48815 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_13420 49453 50427 gene locus_tag LOCUS_13430 gene hemB 49453 50427 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 protein_id gnl|my_center|LOCUS_13430 50429 51355 gene locus_tag LOCUS_13440 gene argF 50429 51355 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858026.1 protein_id gnl|my_center|LOCUS_13440 51385 51846 gene locus_tag LOCUS_13450 51385 51846 CDS product DUF2603 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853412.1 protein_id gnl|my_center|LOCUS_13450 51857 53230 gene locus_tag LOCUS_13460 gene hemN 51857 53230 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 protein_id gnl|my_center|LOCUS_13460 53232 54494 gene locus_tag LOCUS_13470 53232 54494 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 protein_id gnl|my_center|LOCUS_13470 54653 57490 gene locus_tag LOCUS_13480 54653 57490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 57490 57888 gene locus_tag LOCUS_13490 57490 57888 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_13490 57893 58549 gene locus_tag LOCUS_13500 57893 58549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 58625 59059 gene locus_tag LOCUS_13510 58625 59059 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_13510 59148 61430 gene locus_tag LOCUS_13520 59148 61430 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267441.1 protein_id gnl|my_center|LOCUS_13520 61517 62335 gene locus_tag LOCUS_13530 gene lgt 61517 62335 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854600.1 protein_id gnl|my_center|LOCUS_13530 62509 63291 gene locus_tag LOCUS_13540 62509 63291 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854660.1 protein_id gnl|my_center|LOCUS_13540 63294 65279 gene locus_tag LOCUS_13550 63294 65279 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854193.1 protein_id gnl|my_center|LOCUS_13550 65276 65995 gene locus_tag LOCUS_13560 65276 65995 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854302.1 protein_id gnl|my_center|LOCUS_13560 66097 68466 gene locus_tag LOCUS_13570 66097 68466 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857319.1 protein_id gnl|my_center|LOCUS_13570 68463 70487 gene locus_tag LOCUS_13580 68463 70487 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858743.1 protein_id gnl|my_center|LOCUS_13580 71539 70499 gene locus_tag LOCUS_13590 71539 70499 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 protein_id gnl|my_center|LOCUS_13590 72567 71536 gene locus_tag LOCUS_13600 gene ruvB 72567 71536 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856258.1 protein_id gnl|my_center|LOCUS_13600 73360 72572 gene locus_tag LOCUS_13610 gene panB 73360 72572 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062669.1 protein_id gnl|my_center|LOCUS_13610 73456 73866 gene locus_tag LOCUS_13620 73456 73866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859649.1 protein_id gnl|my_center|LOCUS_13620 73863 74603 gene locus_tag LOCUS_13630 gene trpA 73863 74603 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_13630 77052 74593 gene locus_tag LOCUS_13640 77052 74593 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_13640 77649 77053 gene locus_tag LOCUS_13650 77649 77053 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 protein_id gnl|my_center|LOCUS_13650 78417 77653 gene locus_tag LOCUS_13660 78417 77653 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 protein_id gnl|my_center|LOCUS_13660 78649 79440 gene locus_tag LOCUS_13670 gene rpsB 78649 79440 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002892710.1 protein_id gnl|my_center|LOCUS_13670 79440 80507 gene locus_tag LOCUS_13680 gene tsf 79440 80507 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864836.1 protein_id gnl|my_center|LOCUS_13680 80565 81209 gene locus_tag LOCUS_13690 80565 81209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891917.1 protein_id gnl|my_center|LOCUS_13690 81210 81986 gene locus_tag LOCUS_13700 gene fliR 81210 81986 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852712.1 protein_id gnl|my_center|LOCUS_13700 82079 83443 gene locus_tag LOCUS_13710 82079 83443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852900.1 protein_id gnl|my_center|LOCUS_13710 83446 84060 gene locus_tag LOCUS_13720 gene gmk 83446 84060 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860253.1 protein_id gnl|my_center|LOCUS_13720 84143 84373 gene locus_tag LOCUS_13730 gene tatA 84143 84373 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508588.1 protein_id gnl|my_center|LOCUS_13730 84383 85969 gene locus_tag LOCUS_13740 gene argS 84383 85969 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891916.1 protein_id gnl|my_center|LOCUS_13740 86371 86024 gene locus_tag LOCUS_13750 gene rsfS 86371 86024 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858238.1 protein_id gnl|my_center|LOCUS_13750 86909 86364 gene locus_tag LOCUS_13760 gene nadD 86909 86364 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780449.1 protein_id gnl|my_center|LOCUS_13760 87037 88038 gene locus_tag LOCUS_13770 gene gap 87037 88038 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780453.1 protein_id gnl|my_center|LOCUS_13770 88050 89249 gene locus_tag LOCUS_13780 88050 89249 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891932.1 protein_id gnl|my_center|LOCUS_13780 89252 89965 gene locus_tag LOCUS_13790 89252 89965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 89982 90803 gene locus_tag LOCUS_13800 gene fabI 89982 90803 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780456.1 protein_id gnl|my_center|LOCUS_13800 90810 91775 gene locus_tag LOCUS_13810 90810 91775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_13810 91796 91945 gene locus_tag LOCUS_13820 91796 91945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 93101 91986 gene locus_tag LOCUS_13830 gene nusA 93101 91986 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 protein_id gnl|my_center|LOCUS_13830 93349 93591 gene locus_tag LOCUS_13840 93349 93591 CDS product HP0268 family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859022.1 protein_id gnl|my_center|LOCUS_13840 93652 94914 gene locus_tag LOCUS_13850 gene miaB 93652 94914 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 protein_id gnl|my_center|LOCUS_13850 95069 95530 gene locus_tag LOCUS_13860 95069 95530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 95651 96715 gene locus_tag LOCUS_13870 95651 96715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 96712 97236 gene locus_tag LOCUS_13880 96712 97236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 97229 97786 gene locus_tag LOCUS_13890 97229 97786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 98750 97737 gene locus_tag LOCUS_13900 gene tilS 98750 97737 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851521.1 protein_id gnl|my_center|LOCUS_13900 100038 98725 gene locus_tag LOCUS_13910 gene rimO 100038 98725 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 protein_id gnl|my_center|LOCUS_13910 100868 100047 gene locus_tag LOCUS_13920 gene panC 100868 100047 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264323.1 protein_id gnl|my_center|LOCUS_13920 100950 102044 gene locus_tag LOCUS_13930 gene prfB 100950 102044 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851475.1 protein_id gnl|my_center|LOCUS_13930 102056 102379 gene locus_tag LOCUS_13940 102056 102379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 102394 103785 gene locus_tag LOCUS_13950 102394 103785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 103785 104522 gene locus_tag LOCUS_13960 103785 104522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 105020 104508 gene locus_tag LOCUS_13970 105020 104508 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_13970 106648 105023 gene locus_tag LOCUS_13980 106648 105023 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891914.1 protein_id gnl|my_center|LOCUS_13980 107552 106674 gene locus_tag LOCUS_13990 107552 106674 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_13990 108931 107576 gene locus_tag LOCUS_14000 gene rho 108931 107576 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852852.1 protein_id gnl|my_center|LOCUS_14000 109244 109930 gene locus_tag LOCUS_14010 109244 109930 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_14010 110031 111362 gene locus_tag LOCUS_14020 gene hcp 110031 111362 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098308124.1 protein_id gnl|my_center|LOCUS_14020 111614 112756 gene locus_tag LOCUS_14030 111614 112756 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878829.1 protein_id gnl|my_center|LOCUS_14030 112897 113121 gene locus_tag LOCUS_14040 112897 113121 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_14040 113197 113445 gene locus_tag LOCUS_14050 113197 113445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14050 113442 113618 gene locus_tag LOCUS_14060 113442 113618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 113795 116200 gene locus_tag LOCUS_14070 113795 116200 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209627475.1 protein_id gnl|my_center|LOCUS_14070 116209 116835 gene locus_tag LOCUS_14080 116209 116835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 116832 117446 gene locus_tag LOCUS_14090 116832 117446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 117443 119014 gene locus_tag LOCUS_14100 117443 119014 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963679.1 protein_id gnl|my_center|LOCUS_14100 119933 119058 gene locus_tag LOCUS_14110 119933 119058 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_14110 121339 120053 gene locus_tag LOCUS_14120 121339 120053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 121571 122176 gene locus_tag LOCUS_14130 121571 122176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 122471 122232 gene locus_tag LOCUS_14140 gene ybcJ 122471 122232 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 protein_id gnl|my_center|LOCUS_14140 122710 123264 gene locus_tag LOCUS_14150 122710 123264 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_14150 124779 123343 gene locus_tag LOCUS_14160 124779 123343 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929776.1 protein_id gnl|my_center|LOCUS_14160 125904 124963 gene locus_tag LOCUS_14170 gene mvaB 125904 124963 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775436.1 protein_id gnl|my_center|LOCUS_14170 127099 125915 gene locus_tag LOCUS_14180 127099 125915 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256088.1 protein_id gnl|my_center|LOCUS_14180 127251 127988 gene locus_tag LOCUS_14190 127251 127988 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_14190 128730 128056 gene locus_tag LOCUS_14200 128730 128056 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857885.1 protein_id gnl|my_center|LOCUS_14200 128916 130154 gene locus_tag LOCUS_14210 128916 130154 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_14210 130147 130464 gene locus_tag LOCUS_14220 130147 130464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 131356 130418 gene locus_tag LOCUS_14230 131356 130418 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_14230 131862 131356 gene locus_tag LOCUS_14240 131862 131356 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_14240 133129 131876 gene locus_tag LOCUS_14250 gene hacA 133129 131876 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061104.1 protein_id gnl|my_center|LOCUS_14250 133220 134053 gene locus_tag LOCUS_14260 133220 134053 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351696.1 protein_id gnl|my_center|LOCUS_14260 134442 134069 gene locus_tag LOCUS_tm00010 134442 134069 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 134530 135045 gene locus_tag LOCUS_14270 134530 135045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 136915 135347 gene locus_tag LOCUS_14280 136915 135347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 137013 137687 gene locus_tag LOCUS_14290 137013 137687 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_14290 137849 138835 gene locus_tag LOCUS_14300 137849 138835 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_14300 138861 139427 gene locus_tag LOCUS_14310 138861 139427 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243841.1 protein_id gnl|my_center|LOCUS_14310 139414 140697 gene locus_tag LOCUS_14320 gene dctM 139414 140697 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_14320 140978 142255 gene locus_tag LOCUS_14330 140978 142255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 143197 142868 gene locus_tag LOCUS_14340 143197 142868 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677634.1 protein_id gnl|my_center|LOCUS_14340 143450 143172 gene locus_tag LOCUS_14350 143450 143172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 143623 144285 gene locus_tag LOCUS_14360 143623 144285 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_14360 144566 145765 gene locus_tag LOCUS_14370 144566 145765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 145914 147032 gene locus_tag LOCUS_14380 145914 147032 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858428.1 protein_id gnl|my_center|LOCUS_14380 147131 148027 gene locus_tag LOCUS_14390 147131 148027 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852952.1 protein_id gnl|my_center|LOCUS_14390 148029 149066 gene locus_tag LOCUS_14400 148029 149066 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853049.1 protein_id gnl|my_center|LOCUS_14400 149063 149830 gene locus_tag LOCUS_14410 149063 149830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852992.1 protein_id gnl|my_center|LOCUS_14410 149823 150518 gene locus_tag LOCUS_14420 149823 150518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852965.1 protein_id gnl|my_center|LOCUS_14420 150668 153808 gene locus_tag LOCUS_14430 gene ccsA 150668 153808 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852963.1 protein_id gnl|my_center|LOCUS_14430 153893 154336 gene locus_tag LOCUS_14440 153893 154336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 154415 154341 gene locus_tag LOCUS_t00200 154415 154341 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 154518 154443 gene locus_tag LOCUS_t00210 154518 154443 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 154644 154568 gene locus_tag LOCUS_t00220 154644 154568 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 154726 154651 gene locus_tag LOCUS_t00230 154726 154651 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 154825 154750 gene locus_tag LOCUS_t00240 154825 154750 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 154914 154839 gene locus_tag LOCUS_t00250 154914 154839 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 156077 154980 gene locus_tag LOCUS_14450 156077 154980 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853490.1 protein_id gnl|my_center|LOCUS_14450 156230 158992 gene locus_tag LOCUS_14460 gene ileS 156230 158992 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907389.1 protein_id gnl|my_center|LOCUS_14460 159109 160467 gene locus_tag LOCUS_14470 gene gatA 159109 160467 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853884.1 protein_id gnl|my_center|LOCUS_14470 160477 161925 gene locus_tag LOCUS_14480 gene guaB 160477 161925 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852968.1 protein_id gnl|my_center|LOCUS_14480 161967 163076 gene locus_tag LOCUS_14490 161967 163076 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_14490 163089 163295 gene locus_tag LOCUS_14500 163089 163295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 163292 164086 gene locus_tag LOCUS_14510 163292 164086 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853489.1 protein_id gnl|my_center|LOCUS_14510 164083 164748 gene locus_tag LOCUS_14520 164083 164748 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791496.1 protein_id gnl|my_center|LOCUS_14520 164812 165942 gene locus_tag LOCUS_14530 164812 165942 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142409.1 protein_id gnl|my_center|LOCUS_14530 165939 167249 gene locus_tag LOCUS_14540 gene murC 165939 167249 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891904.1 protein_id gnl|my_center|LOCUS_14540 167249 167593 gene locus_tag LOCUS_14550 167249 167593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 167593 169800 gene locus_tag LOCUS_14560 167593 169800 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 protein_id gnl|my_center|LOCUS_14560 169854 171491 gene locus_tag LOCUS_14570 169854 171491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 171508 172608 gene locus_tag LOCUS_14580 gene dapE 171508 172608 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854067.1 protein_id gnl|my_center|LOCUS_14580 172605 172976 gene locus_tag LOCUS_14590 172605 172976 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869815.1 protein_id gnl|my_center|LOCUS_14590 173089 174429 gene locus_tag LOCUS_14600 173089 174429 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854402.1 protein_id gnl|my_center|LOCUS_14600 174476 175162 gene locus_tag LOCUS_14610 174476 175162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 175626 175168 gene locus_tag LOCUS_14620 175626 175168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 175731 176174 gene locus_tag LOCUS_14630 175731 176174 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926982.1 protein_id gnl|my_center|LOCUS_14630 176293 177444 gene locus_tag LOCUS_14640 176293 177444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 178493 177456 gene locus_tag LOCUS_14650 178493 177456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 178613 179044 gene locus_tag LOCUS_14660 178613 179044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 179139 180584 gene locus_tag LOCUS_14670 gene pyk 179139 180584 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858708.1 protein_id gnl|my_center|LOCUS_14670 180683 180991 gene locus_tag LOCUS_14680 gene rplU 180683 180991 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778820.1 protein_id gnl|my_center|LOCUS_14680 181026 181286 gene locus_tag LOCUS_14690 gene rpmA 181026 181286 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_14690 181406 182512 gene locus_tag LOCUS_14700 gene obgE 181406 182512 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851611.1 protein_id gnl|my_center|LOCUS_14700 182493 183257 gene locus_tag LOCUS_14710 gene proB 182493 183257 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851769.1 protein_id gnl|my_center|LOCUS_14710 183338 184255 gene locus_tag LOCUS_14720 gene fmt 183338 184255 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851657.1 protein_id gnl|my_center|LOCUS_14720 184236 184871 gene locus_tag LOCUS_14730 184236 184871 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 protein_id gnl|my_center|LOCUS_14730 184868 185653 gene locus_tag LOCUS_14740 184868 185653 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_14740 185688 186512 gene locus_tag LOCUS_14750 185688 186512 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034353519.1 protein_id gnl|my_center|LOCUS_14750 186711 186520 gene locus_tag LOCUS_14760 186711 186520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 186641 187063 gene locus_tag LOCUS_14770 186641 187063 CDS product FoF1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851812.1 protein_id gnl|my_center|LOCUS_14770 187076 187591 gene locus_tag LOCUS_14780 187076 187591 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 protein_id gnl|my_center|LOCUS_14780 187591 188121 gene locus_tag LOCUS_14790 187591 188121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 188153 189670 gene locus_tag LOCUS_14800 gene atpA 188153 189670 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_14800 189680 190567 gene locus_tag LOCUS_14810 gene atpG 189680 190567 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 protein_id gnl|my_center|LOCUS_14810 190600 191997 gene locus_tag LOCUS_14820 gene atpD 190600 191997 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 protein_id gnl|my_center|LOCUS_14820 192021 192416 gene locus_tag LOCUS_14830 gene atpC 192021 192416 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851752.1 protein_id gnl|my_center|LOCUS_14830 192422 193009 gene locus_tag LOCUS_14840 192422 193009 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854361.1 protein_id gnl|my_center|LOCUS_14840 193009 193401 gene locus_tag LOCUS_14850 193009 193401 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105106.1 protein_id gnl|my_center|LOCUS_14850 193446 194189 gene locus_tag LOCUS_14860 193446 194189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 194192 195460 gene locus_tag LOCUS_14870 gene tolB 194192 195460 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_14870 195525 196031 gene locus_tag LOCUS_14880 gene pal 195525 196031 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851617.1 protein_id gnl|my_center|LOCUS_14880 196040 196951 gene locus_tag LOCUS_14890 196040 196951 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851738.1 protein_id gnl|my_center|LOCUS_14890 197062 197712 gene locus_tag LOCUS_14900 197062 197712 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851661.1 protein_id gnl|my_center|LOCUS_14900 197654 198460 gene locus_tag LOCUS_14910 197654 198460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 198521 199450 gene locus_tag LOCUS_14920 gene fabD 198521 199450 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 protein_id gnl|my_center|LOCUS_14920 199459 200154 gene locus_tag LOCUS_14930 gene pfs 199459 200154 CDS product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859787.1 protein_id gnl|my_center|LOCUS_14930 200147 200902 gene locus_tag LOCUS_14940 200147 200902 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 protein_id gnl|my_center|LOCUS_14940 201057 201374 gene locus_tag LOCUS_14950 201057 201374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 202047 201430 gene locus_tag LOCUS_14960 gene recO 202047 201430 CDS product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 protein_id gnl|my_center|LOCUS_14960 202278 206702 gene locus_tag LOCUS_14970 gene gltB 202278 206702 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461215.1 protein_id gnl|my_center|LOCUS_14970 206704 208086 gene locus_tag LOCUS_14980 gene gltD 206704 208086 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081674.1 protein_id gnl|my_center|LOCUS_14980 208097 208825 gene locus_tag LOCUS_14990 208097 208825 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851687.1 protein_id gnl|my_center|LOCUS_14990 208840 209715 gene locus_tag LOCUS_15000 gene accD 208840 209715 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 protein_id gnl|my_center|LOCUS_15000 209715 210170 gene locus_tag LOCUS_15010 209715 210170 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869860.1 protein_id gnl|my_center|LOCUS_15010 210212 210571 gene locus_tag LOCUS_15020 gene dksA 210212 210571 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_15020 210589 211605 gene locus_tag LOCUS_15030 210589 211605 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213490.1 protein_id gnl|my_center|LOCUS_15030 211602 212540 gene locus_tag LOCUS_15040 211602 212540 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851926.1 protein_id gnl|my_center|LOCUS_15040 212921 212553 gene locus_tag LOCUS_15050 212921 212553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 213844 212918 gene locus_tag LOCUS_15060 213844 212918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 214706 213858 gene locus_tag LOCUS_15070 214706 213858 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889661.1 protein_id gnl|my_center|LOCUS_15070 215014 214703 gene locus_tag LOCUS_15080 gene fliN 215014 214703 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824739.1 protein_id gnl|my_center|LOCUS_15080 215205 215393 gene locus_tag LOCUS_15090 215205 215393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 215418 215843 gene locus_tag LOCUS_15100 215418 215843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_15100 215828 216127 gene locus_tag LOCUS_15110 215828 216127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 217050 216124 gene locus_tag LOCUS_15120 217050 216124 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_15120 217152 217634 gene locus_tag LOCUS_15130 gene hutZ 217152 217634 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073462.1 protein_id gnl|my_center|LOCUS_15130 219628 218018 gene locus_tag LOCUS_15140 219628 218018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 221687 219819 gene locus_tag LOCUS_15150 gene thiC 221687 219819 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_15150 221686 221865 gene locus_tag LOCUS_15160 221686 221865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 221958 222701 gene locus_tag LOCUS_15170 221958 222701 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858695.1 protein_id gnl|my_center|LOCUS_15170 222708 225518 gene locus_tag LOCUS_15180 gene uvrA 222708 225518 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858721.1 protein_id gnl|my_center|LOCUS_15180 225651 226979 gene locus_tag LOCUS_15190 225651 226979 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852850.1 protein_id gnl|my_center|LOCUS_15190 227072 227881 gene locus_tag LOCUS_15200 227072 227881 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_15200 227906 230563 gene locus_tag LOCUS_15210 gene polA 227906 230563 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858644.1 protein_id gnl|my_center|LOCUS_15210 230563 231102 gene locus_tag LOCUS_15220 230563 231102 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_15220 231111 231806 gene locus_tag LOCUS_15230 231111 231806 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_15230 231796 233550 gene locus_tag LOCUS_15240 231796 233550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 233612 234610 gene locus_tag LOCUS_15250 233612 234610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 234737 235534 gene locus_tag LOCUS_15260 gene ttrB 234737 235534 CDS product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170783.1 protein_id gnl|my_center|LOCUS_15260 235536 236705 gene locus_tag LOCUS_15270 gene nrfD 235536 236705 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462220.1 protein_id gnl|my_center|LOCUS_15270 236695 239718 gene locus_tag LOCUS_15280 gene ttrA 236695 239718 CDS product tetrathionate reductase subunit TtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816071.1 protein_id gnl|my_center|LOCUS_15280 240334 239723 gene locus_tag LOCUS_15290 240334 239723 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_15290 241471 240338 gene locus_tag LOCUS_15300 gene dnaJ 241471 240338 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423848.1 protein_id gnl|my_center|LOCUS_15300 241630 242136 gene locus_tag LOCUS_15310 241630 242136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 242229 242900 gene locus_tag LOCUS_15320 242229 242900 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853168.1 protein_id gnl|my_center|LOCUS_15320 242897 244144 gene locus_tag LOCUS_15330 242897 244144 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857920.1 protein_id gnl|my_center|LOCUS_15330 244141 244710 gene locus_tag LOCUS_15340 gene recR 244141 244710 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853214.1 protein_id gnl|my_center|LOCUS_15340 244778 245947 gene locus_tag LOCUS_15350 244778 245947 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_15350 245937 247709 gene locus_tag LOCUS_15360 245937 247709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 249362 247719 gene locus_tag LOCUS_15370 249362 247719 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_15370 250169 249378 gene locus_tag LOCUS_15380 250169 249378 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 protein_id gnl|my_center|LOCUS_15380 251584 250172 gene locus_tag LOCUS_15390 gene trpE 251584 250172 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_15390 252289 251585 gene locus_tag LOCUS_15400 252289 251585 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864776.1 protein_id gnl|my_center|LOCUS_15400 252868 252326 gene locus_tag LOCUS_15410 252868 252326 CDS product DUF1882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859481.1 protein_id gnl|my_center|LOCUS_15410 254124 252877 gene locus_tag LOCUS_15420 254124 252877 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_15420 255648 254128 gene locus_tag LOCUS_15430 gene lysS 255648 254128 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858694.1 protein_id gnl|my_center|LOCUS_15430 256133 255651 gene locus_tag LOCUS_15440 256133 255651 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_15440 256684 256148 gene locus_tag LOCUS_15450 256684 256148 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858643.1 protein_id gnl|my_center|LOCUS_15450 257631 256684 gene locus_tag LOCUS_15460 257631 256684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 258873 257806 gene locus_tag LOCUS_15470 258873 257806 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_15470 259184 258894 gene locus_tag LOCUS_15480 gene gatC 259184 258894 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858734.1 protein_id gnl|my_center|LOCUS_15480 259218 259346 gene locus_tag LOCUS_15490 259218 259346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 259358 259939 gene locus_tag LOCUS_15500 259358 259939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851102.1 protein_id gnl|my_center|LOCUS_15500 259939 260949 gene locus_tag LOCUS_15510 259939 260949 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858656.1 protein_id gnl|my_center|LOCUS_15510 260900 261286 gene locus_tag LOCUS_15520 260900 261286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 261283 261909 gene locus_tag LOCUS_15530 261283 261909 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864777.1 protein_id gnl|my_center|LOCUS_15530 261923 262531 gene locus_tag LOCUS_15540 gene hisG 261923 262531 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_15540 262924 262544 gene locus_tag LOCUS_15550 262924 262544 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_15550 266136 262936 gene locus_tag LOCUS_15560 266136 262936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 266550 266152 gene locus_tag LOCUS_15570 266550 266152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 267701 266547 gene locus_tag LOCUS_15580 267701 266547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 269562 267763 gene locus_tag LOCUS_15590 gene uvrC 269562 267763 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864614.1 protein_id gnl|my_center|LOCUS_15590 270002 269553 gene locus_tag LOCUS_15600 270002 269553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 270116 271579 gene locus_tag LOCUS_15610 gene nadB 270116 271579 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_15610 271576 272931 gene locus_tag LOCUS_15620 gene nhaD 271576 272931 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_15620 272948 274483 gene locus_tag LOCUS_15630 gene guaA 272948 274483 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853189.1 protein_id gnl|my_center|LOCUS_15630 274487 275113 gene locus_tag LOCUS_15640 274487 275113 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862414.1 protein_id gnl|my_center|LOCUS_15640 275394 276668 gene locus_tag LOCUS_15650 gene purD 275394 276668 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853212.1 protein_id gnl|my_center|LOCUS_15650 276661 277113 gene locus_tag LOCUS_15660 276661 277113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 277106 279199 gene locus_tag LOCUS_15670 277106 279199 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 protein_id gnl|my_center|LOCUS_15670 279202 279468 gene locus_tag LOCUS_15680 279202 279468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 279491 281749 gene locus_tag LOCUS_15690 279491 281749 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853182.1 protein_id gnl|my_center|LOCUS_15690 281852 282151 gene locus_tag LOCUS_15700 281852 282151 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853292.1 protein_id gnl|my_center|LOCUS_15700 282189 282273 gene locus_tag LOCUS_t00260 282189 282273 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 282707 282252 gene locus_tag LOCUS_15710 282707 282252 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019973.1 protein_id gnl|my_center|LOCUS_15710 283684 282704 gene locus_tag LOCUS_15720 283684 282704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 283806 284066 gene locus_tag LOCUS_15730 283806 284066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 284124 286262 gene locus_tag LOCUS_15740 284124 286262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15740 286271 286912 gene locus_tag LOCUS_15750 gene crdR 286271 286912 CDS product copper response regulator transcription factor CrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_15750 287051 288115 gene locus_tag LOCUS_15760 287051 288115 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 protein_id gnl|my_center|LOCUS_15760 288224 288754 gene locus_tag LOCUS_15770 288224 288754 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_15770 288756 290108 gene locus_tag LOCUS_15780 288756 290108 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_15780 290285 293125 gene locus_tag LOCUS_15790 290285 293125 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460038.1 protein_id gnl|my_center|LOCUS_15790 293284 293523 gene locus_tag LOCUS_15800 293284 293523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence05 269 607 gene locus_tag LOCUS_15810 269 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 852 1190 gene locus_tag LOCUS_15820 852 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1221 2729 gene locus_tag LOCUS_15830 1221 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3574 2765 gene locus_tag LOCUS_15840 3574 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3929 3561 gene locus_tag LOCUS_15850 3929 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4496 3933 gene locus_tag LOCUS_15860 4496 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4667 5695 gene locus_tag LOCUS_15870 4667 5695 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_15870 5705 8578 gene locus_tag LOCUS_15880 5705 8578 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_15880 8582 9688 gene locus_tag LOCUS_15890 8582 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 9685 10872 gene locus_tag LOCUS_15900 9685 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 10872 11267 gene locus_tag LOCUS_15910 10872 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 11286 11849 gene locus_tag LOCUS_15920 11286 11849 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763704.1 protein_id gnl|my_center|LOCUS_15920 11842 12897 gene locus_tag LOCUS_15930 11842 12897 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510947.1 protein_id gnl|my_center|LOCUS_15930 13108 14760 gene locus_tag LOCUS_15940 13108 14760 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_15940 14776 16710 gene locus_tag LOCUS_15950 14776 16710 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979843.1 protein_id gnl|my_center|LOCUS_15950 16726 18963 gene locus_tag LOCUS_15960 16726 18963 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202231.1 protein_id gnl|my_center|LOCUS_15960 19071 19580 gene locus_tag LOCUS_15970 19071 19580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 20887 19631 gene locus_tag LOCUS_15980 20887 19631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 21156 20899 gene locus_tag LOCUS_15990 21156 20899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 21607 21134 gene locus_tag LOCUS_16000 gene moaC 21607 21134 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851725.1 protein_id gnl|my_center|LOCUS_16000 21776 22150 gene locus_tag LOCUS_16010 21776 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 23245 22202 gene locus_tag LOCUS_16020 23245 22202 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 protein_id gnl|my_center|LOCUS_16020 23656 23369 gene locus_tag LOCUS_16030 23656 23369 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_16030 23791 24738 gene locus_tag LOCUS_16040 23791 24738 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_16040 24746 25576 gene locus_tag LOCUS_16050 24746 25576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 25578 25964 gene locus_tag LOCUS_16060 25578 25964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 25957 26838 gene locus_tag LOCUS_16070 25957 26838 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011139.1 protein_id gnl|my_center|LOCUS_16070 26842 27810 gene locus_tag LOCUS_16080 26842 27810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 27803 28669 gene locus_tag LOCUS_16090 27803 28669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 28647 30176 gene locus_tag LOCUS_16100 28647 30176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 30296 31006 gene locus_tag LOCUS_16110 30296 31006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 31184 31023 gene locus_tag LOCUS_16120 31184 31023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 31529 32662 gene locus_tag LOCUS_16130 31529 32662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 34014 32848 gene locus_tag LOCUS_16140 34014 32848 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399507.1 protein_id gnl|my_center|LOCUS_16140 34589 34011 gene locus_tag LOCUS_16150 34589 34011 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867312.1 protein_id gnl|my_center|LOCUS_16150 35854 34589 gene locus_tag LOCUS_16160 gene leuC 35854 34589 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_16160 36183 35965 gene locus_tag LOCUS_16170 36183 35965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 36377 37033 gene locus_tag LOCUS_16180 36377 37033 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703621.1 protein_id gnl|my_center|LOCUS_16180 37644 37030 gene locus_tag LOCUS_16190 gene ttdB 37644 37030 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077020.1 protein_id gnl|my_center|LOCUS_16190 38540 37641 gene locus_tag LOCUS_16200 gene ttdA 38540 37641 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986797.1 protein_id gnl|my_center|LOCUS_16200 40110 38701 gene locus_tag LOCUS_16210 40110 38701 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097758.1 protein_id gnl|my_center|LOCUS_16210 40921 40307 gene locus_tag LOCUS_16220 40921 40307 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_16220 41377 40973 gene locus_tag LOCUS_16230 41377 40973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 41481 41936 gene locus_tag LOCUS_16240 41481 41936 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_16240 41936 42388 gene locus_tag LOCUS_16250 41936 42388 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956700.1 protein_id gnl|my_center|LOCUS_16250 42385 43530 gene locus_tag LOCUS_16260 42385 43530 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_16260 43538 43699 gene locus_tag LOCUS_16270 43538 43699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 43839 45170 gene locus_tag LOCUS_16280 43839 45170 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864240.1 protein_id gnl|my_center|LOCUS_16280 45229 45549 gene locus_tag LOCUS_16290 45229 45549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 45599 46363 gene locus_tag LOCUS_16300 45599 46363 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656886.1 protein_id gnl|my_center|LOCUS_16300 46364 47434 gene locus_tag LOCUS_16310 gene dxr 46364 47434 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260724.1 protein_id gnl|my_center|LOCUS_16310 47541 48791 gene locus_tag LOCUS_16320 47541 48791 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_16320 48815 50143 gene locus_tag LOCUS_16330 48815 50143 CDS product AGCS family amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447623.1 protein_id gnl|my_center|LOCUS_16330 50159 51280 gene locus_tag LOCUS_16340 50159 51280 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908758.1 protein_id gnl|my_center|LOCUS_16340 51277 51819 gene locus_tag LOCUS_16350 51277 51819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 52417 51809 gene locus_tag LOCUS_16360 52417 51809 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041261.1 protein_id gnl|my_center|LOCUS_16360 52517 53119 gene locus_tag LOCUS_16370 52517 53119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_16370 53137 56031 gene locus_tag LOCUS_16380 53137 56031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 56063 56806 gene locus_tag LOCUS_16390 56063 56806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 56822 57817 gene locus_tag LOCUS_16400 gene tsaD 56822 57817 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864246.1 protein_id gnl|my_center|LOCUS_16400 58587 57814 gene locus_tag LOCUS_16410 58587 57814 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894903.1 protein_id gnl|my_center|LOCUS_16410 58853 58587 gene locus_tag LOCUS_16420 gene fliQ 58853 58587 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 protein_id gnl|my_center|LOCUS_16420 59716 58853 gene locus_tag LOCUS_16430 59716 58853 CDS product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626212.1 protein_id gnl|my_center|LOCUS_16430 59869 60912 gene locus_tag LOCUS_16440 gene recA 59869 60912 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963128.1 protein_id gnl|my_center|LOCUS_16440 60909 62180 gene locus_tag LOCUS_16450 gene eno 60909 62180 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955673.1 protein_id gnl|my_center|LOCUS_16450 62177 62458 gene locus_tag LOCUS_16460 62177 62458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 62460 63167 gene locus_tag LOCUS_16470 gene cgpA 62460 63167 CDS product glycoprotein CgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851387.1 protein_id gnl|my_center|LOCUS_16470 64490 63213 gene locus_tag LOCUS_16480 64490 63213 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851494.1 protein_id gnl|my_center|LOCUS_16480 65043 64651 gene locus_tag LOCUS_16490 65043 64651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 66089 65040 gene locus_tag LOCUS_16500 66089 65040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 66708 66073 gene locus_tag LOCUS_16510 gene dccR 66708 66073 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_16510 67601 66756 gene locus_tag LOCUS_16520 67601 66756 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851400.1 protein_id gnl|my_center|LOCUS_16520 69685 67616 gene locus_tag LOCUS_16530 gene topA 69685 67616 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851268.1 protein_id gnl|my_center|LOCUS_16530 69847 72261 gene locus_tag LOCUS_16540 69847 72261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 74305 72302 gene locus_tag LOCUS_16550 74305 72302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 74929 74306 gene locus_tag LOCUS_16560 74929 74306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 76020 74983 gene locus_tag LOCUS_16570 gene pseI 76020 74983 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002870258.1 protein_id gnl|my_center|LOCUS_16570 76571 76026 gene locus_tag LOCUS_16580 gene pseH 76571 76026 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919339.1 protein_id gnl|my_center|LOCUS_16580 77200 76568 gene locus_tag LOCUS_16590 77200 76568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 78012 77197 gene locus_tag LOCUS_16600 gene pseG 78012 77197 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002830499.1 protein_id gnl|my_center|LOCUS_16600 78751 78044 gene locus_tag LOCUS_16610 gene pseF 78751 78044 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_16610 79869 78748 gene locus_tag LOCUS_16620 gene pseC 79869 78748 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856503.1 protein_id gnl|my_center|LOCUS_16620 80855 79866 gene locus_tag LOCUS_16630 gene pseB 80855 79866 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858028.1 protein_id gnl|my_center|LOCUS_16630 80967 81686 gene locus_tag LOCUS_16640 80967 81686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 81686 82270 gene locus_tag LOCUS_16650 81686 82270 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018676.1 protein_id gnl|my_center|LOCUS_16650 82282 83061 gene locus_tag LOCUS_16660 82282 83061 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445395.1 protein_id gnl|my_center|LOCUS_16660 83054 84226 gene locus_tag LOCUS_16670 83054 84226 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881355.1 protein_id gnl|my_center|LOCUS_16670 84684 84229 gene locus_tag LOCUS_16680 84684 84229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 85332 84694 gene locus_tag LOCUS_16690 85332 84694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 85898 85338 gene locus_tag LOCUS_16700 gene dcd 85898 85338 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854086.1 protein_id gnl|my_center|LOCUS_16700 85975 86433 gene locus_tag LOCUS_16710 gene accB 85975 86433 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853623.1 protein_id gnl|my_center|LOCUS_16710 86433 87764 gene locus_tag LOCUS_16720 86433 87764 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858001.1 protein_id gnl|my_center|LOCUS_16720 88663 87812 gene locus_tag LOCUS_16730 88663 87812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 88860 90257 gene locus_tag LOCUS_16740 gene gltX 88860 90257 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 protein_id gnl|my_center|LOCUS_16740 90254 91531 gene locus_tag LOCUS_16750 90254 91531 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854063.1 protein_id gnl|my_center|LOCUS_16750 91532 92161 gene locus_tag LOCUS_16760 gene upp 91532 92161 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858427.1 protein_id gnl|my_center|LOCUS_16760 93558 92197 gene locus_tag LOCUS_16770 gene gdhA 93558 92197 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 protein_id gnl|my_center|LOCUS_16770 94004 95923 gene locus_tag LOCUS_16780 94004 95923 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_16780 95977 96717 gene locus_tag LOCUS_16790 95977 96717 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693866.1 protein_id gnl|my_center|LOCUS_16790 96717 97715 gene locus_tag LOCUS_16800 96717 97715 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_16800 97789 99126 gene locus_tag LOCUS_16810 97789 99126 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858451.1 protein_id gnl|my_center|LOCUS_16810 99449 99365 gene locus_tag LOCUS_t00270 99449 99365 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 99571 99495 gene locus_tag LOCUS_t00280 99571 99495 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 99668 99592 gene locus_tag LOCUS_t00290 99668 99592 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 99766 99690 gene locus_tag LOCUS_t00300 99766 99690 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 99865 99789 gene locus_tag LOCUS_t00310 99865 99789 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 100744 99956 gene locus_tag LOCUS_16820 100744 99956 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881431.1 protein_id gnl|my_center|LOCUS_16820 101324 100734 gene locus_tag LOCUS_16830 gene purN 101324 100734 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864335.1 protein_id gnl|my_center|LOCUS_16830 102712 101315 gene locus_tag LOCUS_16840 102712 101315 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954017.1 protein_id gnl|my_center|LOCUS_16840 104260 102722 gene locus_tag LOCUS_16850 104260 102722 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851902.1 protein_id gnl|my_center|LOCUS_16850 104778 104263 gene locus_tag LOCUS_16860 gene def 104778 104263 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185845.1 protein_id gnl|my_center|LOCUS_16860 105857 104775 gene locus_tag LOCUS_16870 105857 104775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 106471 105881 gene locus_tag LOCUS_16880 gene clpP 106471 105881 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806309.1 protein_id gnl|my_center|LOCUS_16880 107766 106471 gene locus_tag LOCUS_16890 gene tig 107766 106471 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 protein_id gnl|my_center|LOCUS_16890 107906 108481 gene locus_tag LOCUS_16900 gene folE 107906 108481 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 protein_id gnl|my_center|LOCUS_16900 108481 109110 gene locus_tag LOCUS_16910 108481 109110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16910 109107 109772 gene locus_tag LOCUS_16920 109107 109772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16920 109903 111093 gene locus_tag LOCUS_16930 109903 111093 CDS product NifS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941691.1 protein_id gnl|my_center|LOCUS_16930 111120 112109 gene locus_tag LOCUS_16940 111120 112109 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002840050.1 protein_id gnl|my_center|LOCUS_16940 112167 112388 gene locus_tag LOCUS_16950 112167 112388 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_16950 112391 112837 gene locus_tag LOCUS_16960 112391 112837 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 protein_id gnl|my_center|LOCUS_16960 112834 114045 gene locus_tag LOCUS_16970 112834 114045 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_16970 114087 114335 gene locus_tag LOCUS_16980 gene bamE 114087 114335 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095983.1 protein_id gnl|my_center|LOCUS_16980 114570 114379 gene locus_tag LOCUS_16990 114570 114379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 115028 114606 gene locus_tag LOCUS_17000 115028 114606 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941021.1 protein_id gnl|my_center|LOCUS_17000 116346 115030 gene locus_tag LOCUS_17010 116346 115030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_17010 116489 116653 gene locus_tag LOCUS_17020 116489 116653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 116860 117798 gene locus_tag LOCUS_17030 116860 117798 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770915.1 protein_id gnl|my_center|LOCUS_17030 117867 118457 gene locus_tag LOCUS_17040 gene rdgB 117867 118457 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_17040 118509 119723 gene locus_tag LOCUS_17050 118509 119723 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852026.1 protein_id gnl|my_center|LOCUS_17050 119868 120206 gene locus_tag LOCUS_17060 119868 120206 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762354.1 protein_id gnl|my_center|LOCUS_17060 120203 121030 gene locus_tag LOCUS_17070 120203 121030 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_17070 123184 121055 gene locus_tag LOCUS_17080 123184 121055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 123924 123220 gene locus_tag LOCUS_17090 gene dccR 123924 123220 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_17090 124434 124054 gene locus_tag LOCUS_17100 124434 124054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 126004 124544 gene locus_tag LOCUS_17110 126004 124544 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 protein_id gnl|my_center|LOCUS_17110 126412 127098 gene locus_tag LOCUS_17120 126412 127098 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_17120 128654 127083 gene locus_tag LOCUS_17130 128654 127083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 128761 129906 gene locus_tag LOCUS_17140 gene nspC 128761 129906 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858431.1 protein_id gnl|my_center|LOCUS_17140 130069 130761 gene locus_tag LOCUS_17150 130069 130761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 130758 131300 gene locus_tag LOCUS_17160 130758 131300 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938122.1 protein_id gnl|my_center|LOCUS_17160 132035 131547 gene locus_tag LOCUS_17170 132035 131547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 132714 132136 gene locus_tag LOCUS_17180 132714 132136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 132823 133062 gene locus_tag LOCUS_17190 132823 133062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 133418 133059 gene locus_tag LOCUS_17200 133418 133059 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 protein_id gnl|my_center|LOCUS_17200 133615 133821 gene locus_tag LOCUS_17210 133615 133821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 134004 135092 gene locus_tag LOCUS_17220 134004 135092 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 protein_id gnl|my_center|LOCUS_17220 135093 135419 gene locus_tag LOCUS_17230 135093 135419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 135422 135697 gene locus_tag LOCUS_17240 135422 135697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 137442 135694 gene locus_tag LOCUS_17250 137442 135694 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 protein_id gnl|my_center|LOCUS_17250 137925 137683 gene locus_tag LOCUS_17260 137925 137683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 138020 138640 gene locus_tag LOCUS_17270 138020 138640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 140024 138795 gene locus_tag LOCUS_17280 140024 138795 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_17280 140704 140021 gene locus_tag LOCUS_17290 140704 140021 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853168.1 protein_id gnl|my_center|LOCUS_17290 141892 140744 gene locus_tag LOCUS_17300 141892 140744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 142671 141952 gene locus_tag LOCUS_17310 142671 141952 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858436.1 protein_id gnl|my_center|LOCUS_17310 142767 142973 gene locus_tag LOCUS_17320 142767 142973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 145032 143038 gene locus_tag LOCUS_17330 145032 143038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 146888 145047 gene locus_tag LOCUS_17340 gene selB 146888 145047 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857930.1 protein_id gnl|my_center|LOCUS_17340 148225 146885 gene locus_tag LOCUS_17350 gene selA 148225 146885 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858009.1 protein_id gnl|my_center|LOCUS_17350 148896 148222 gene locus_tag LOCUS_17360 148896 148222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 150505 148889 gene locus_tag LOCUS_17370 150505 148889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 151544 150507 gene locus_tag LOCUS_17380 151544 150507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_17380 151851 153539 gene locus_tag LOCUS_17390 151851 153539 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857979.1 protein_id gnl|my_center|LOCUS_17390 153544 154251 gene locus_tag LOCUS_17400 153544 154251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 154393 154611 gene locus_tag LOCUS_17410 154393 154611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 154625 157465 gene locus_tag LOCUS_17420 154625 157465 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891941.1 transl_except (pos:155183..155185,aa:Sec) note codon on position 187 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_17420 157477 158040 gene locus_tag LOCUS_17430 gene fdh3B 157477 158040 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851264.1 protein_id gnl|my_center|LOCUS_17430 158054 158953 gene locus_tag LOCUS_17440 158054 158953 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851174.1 protein_id gnl|my_center|LOCUS_17440 159848 159006 gene locus_tag LOCUS_17450 159848 159006 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_17450 160785 159946 gene locus_tag LOCUS_17460 160785 159946 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_17460 161447 160965 gene locus_tag LOCUS_17470 161447 160965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 162720 161464 gene locus_tag LOCUS_17480 162720 161464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 163624 162812 gene locus_tag LOCUS_17490 163624 162812 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966201.1 protein_id gnl|my_center|LOCUS_17490 164187 164933 gene locus_tag LOCUS_17500 164187 164933 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851502.1 protein_id gnl|my_center|LOCUS_17500 165018 165218 gene locus_tag LOCUS_17510 165018 165218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 165238 168096 gene locus_tag LOCUS_17520 165238 168096 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891941.1 transl_except (pos:165796..165798,aa:Sec) note codon on position 187 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_17520 168107 168706 gene locus_tag LOCUS_17530 gene fdh3B 168107 168706 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851264.1 protein_id gnl|my_center|LOCUS_17530 168721 169620 gene locus_tag LOCUS_17540 168721 169620 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851174.1 protein_id gnl|my_center|LOCUS_17540 169710 170492 gene locus_tag LOCUS_17550 gene fdhD 169710 170492 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851178.1 protein_id gnl|my_center|LOCUS_17550 170485 171222 gene locus_tag LOCUS_17560 170485 171222 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002822570.1 protein_id gnl|my_center|LOCUS_17560 171401 172351 gene locus_tag LOCUS_17570 gene wtpA 171401 172351 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870699.1 protein_id gnl|my_center|LOCUS_17570 172348 173331 gene locus_tag LOCUS_17580 172348 173331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 173328 174095 gene locus_tag LOCUS_17590 gene wtpB 173328 174095 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_17590 174435 174674 gene locus_tag LOCUS_17600 174435 174674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 174688 175938 gene locus_tag LOCUS_17610 174688 175938 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288576.1 protein_id gnl|my_center|LOCUS_17610 177631 175952 gene locus_tag LOCUS_17620 177631 175952 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064852.1 protein_id gnl|my_center|LOCUS_17620 178728 177640 gene locus_tag LOCUS_17630 178728 177640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_17630 179866 178883 gene locus_tag LOCUS_17640 179866 178883 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 protein_id gnl|my_center|LOCUS_17640 180069 180251 gene locus_tag LOCUS_17650 180069 180251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 180331 180921 gene locus_tag LOCUS_17660 gene yedF 180331 180921 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851218.1 protein_id gnl|my_center|LOCUS_17660 180929 181960 gene locus_tag LOCUS_17670 gene selD 180929 181960 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081427416.1 protein_id gnl|my_center|LOCUS_17670 182091 184088 gene locus_tag LOCUS_17680 182091 184088 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_17680 184462 184136 gene locus_tag LOCUS_17690 184462 184136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 187694 184578 gene locus_tag LOCUS_17700 187694 184578 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_17700 188837 187695 gene locus_tag LOCUS_17710 gene cmeA 188837 187695 CDS product multidrug efflux RND transporter periplasmic adaptor subunit CmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858646.1 protein_id gnl|my_center|LOCUS_17710 190060 188834 gene locus_tag LOCUS_17720 190060 188834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 190666 190070 gene locus_tag LOCUS_17730 190666 190070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 190868 191788 gene locus_tag LOCUS_17740 190868 191788 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_17740 192227 191793 gene locus_tag LOCUS_17750 192227 191793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 194440 192326 gene locus_tag LOCUS_17760 194440 192326 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966127.1 protein_id gnl|my_center|LOCUS_17760 195372 194548 gene locus_tag LOCUS_17770 195372 194548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 196030 195473 gene locus_tag LOCUS_17780 196030 195473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 197315 196083 gene locus_tag LOCUS_17790 197315 196083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 198371 197379 gene locus_tag LOCUS_17800 198371 197379 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_17800 199182 198451 gene locus_tag LOCUS_17810 199182 198451 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_17810 199540 199187 gene locus_tag LOCUS_17820 199540 199187 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_17820 199829 200176 gene locus_tag LOCUS_17830 199829 200176 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770109.1 protein_id gnl|my_center|LOCUS_17830 200173 200883 gene locus_tag LOCUS_17840 200173 200883 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_17840 200983 201948 gene locus_tag LOCUS_17850 200983 201948 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707119.1 protein_id gnl|my_center|LOCUS_17850 202013 202510 gene locus_tag LOCUS_17860 202013 202510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 203302 202547 gene locus_tag LOCUS_17870 gene nfsA 203302 202547 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234479.1 protein_id gnl|my_center|LOCUS_17870 203604 203311 gene locus_tag LOCUS_17880 203604 203311 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193694.1 protein_id gnl|my_center|LOCUS_17880 204201 203608 gene locus_tag LOCUS_17890 204201 203608 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098727.1 protein_id gnl|my_center|LOCUS_17890 204433 204807 gene locus_tag LOCUS_17900 204433 204807 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_17900 205438 204824 gene locus_tag LOCUS_17910 205438 204824 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072781.1 protein_id gnl|my_center|LOCUS_17910 205824 206399 gene locus_tag LOCUS_17920 205824 206399 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262237.1 protein_id gnl|my_center|LOCUS_17920 207048 206551 gene locus_tag LOCUS_17930 207048 206551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 207714 207106 gene locus_tag LOCUS_17940 207714 207106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 208369 207740 gene locus_tag LOCUS_17950 208369 207740 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705371.1 protein_id gnl|my_center|LOCUS_17950 208454 209206 gene locus_tag LOCUS_17960 208454 209206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 210181 209249 gene locus_tag LOCUS_17970 210181 209249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 210328 211245 gene locus_tag LOCUS_17980 210328 211245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 211339 212391 gene locus_tag LOCUS_17990 211339 212391 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881326.1 protein_id gnl|my_center|LOCUS_17990 215523 212422 gene locus_tag LOCUS_18000 215523 212422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 216577 215528 gene locus_tag LOCUS_18010 216577 215528 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545648.1 protein_id gnl|my_center|LOCUS_18010 216903 217379 gene locus_tag LOCUS_18020 216903 217379 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419480.1 protein_id gnl|my_center|LOCUS_18020 217473 217982 gene locus_tag LOCUS_18030 217473 217982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 218098 218985 gene locus_tag LOCUS_18040 218098 218985 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_18040 219304 219044 gene locus_tag LOCUS_18050 219304 219044 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083053.1 protein_id gnl|my_center|LOCUS_18050 219415 219561 gene locus_tag LOCUS_18060 219415 219561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 219612 221528 gene locus_tag LOCUS_18070 219612 221528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207299.1 protein_id gnl|my_center|LOCUS_18070 221785 221579 gene locus_tag LOCUS_18080 221785 221579 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_18080 222075 221782 gene locus_tag LOCUS_18090 222075 221782 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_18090 222279 222142 gene locus_tag LOCUS_18100 222279 222142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18100 223772 222354 gene locus_tag LOCUS_18110 223772 222354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 224437 223769 gene locus_tag LOCUS_18120 224437 223769 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943577.1 protein_id gnl|my_center|LOCUS_18120 224559 225593 gene locus_tag LOCUS_18130 224559 225593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 225605 226312 gene locus_tag LOCUS_18140 225605 226312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_18140 229582 226511 gene locus_tag LOCUS_18150 229582 226511 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570460.1 protein_id gnl|my_center|LOCUS_18150 230568 229579 gene locus_tag LOCUS_18160 230568 229579 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946829.1 protein_id gnl|my_center|LOCUS_18160 231755 230565 gene locus_tag LOCUS_18170 231755 230565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 232143 231757 gene locus_tag LOCUS_18180 gene crdA 232143 231757 CDS product copper resistance determinant CrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731617.1 protein_id gnl|my_center|LOCUS_18180 232247 232531 gene locus_tag LOCUS_18190 232247 232531 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141715.1 protein_id gnl|my_center|LOCUS_18190 233049 232540 gene locus_tag LOCUS_18200 233049 232540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 233253 235973 gene locus_tag LOCUS_18210 233253 235973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 236841 235975 gene locus_tag LOCUS_18220 gene ygiD 236841 235975 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920795.1 protein_id gnl|my_center|LOCUS_18220 238035 236854 gene locus_tag LOCUS_18230 gene dccS 238035 236854 CDS product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 protein_id gnl|my_center|LOCUS_18230 238666 238010 gene locus_tag LOCUS_18240 gene dccR 238666 238010 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_18240 239137 238700 gene locus_tag LOCUS_18250 239137 238700 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206314.1 protein_id gnl|my_center|LOCUS_18250 239823 239134 gene locus_tag LOCUS_18260 239823 239134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 240637 239816 gene locus_tag LOCUS_18270 240637 239816 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 protein_id gnl|my_center|LOCUS_18270 240915 240649 gene locus_tag LOCUS_18280 240915 240649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 241008 241670 gene locus_tag LOCUS_18290 gene dccR 241008 241670 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_18290 241651 242826 gene locus_tag LOCUS_18300 241651 242826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence06 915 229 gene locus_tag LOCUS_18310 915 229 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_18310 1008 2657 gene locus_tag LOCUS_18320 1008 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2842 5439 gene locus_tag LOCUS_18330 2842 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5578 6360 gene locus_tag LOCUS_18340 5578 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 6357 7661 gene locus_tag LOCUS_18350 6357 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 7674 8414 gene locus_tag LOCUS_18360 7674 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 8411 8971 gene locus_tag LOCUS_18370 8411 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 8974 9465 gene locus_tag LOCUS_18380 8974 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 9476 10381 gene locus_tag LOCUS_18390 gene napH 9476 10381 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925622.1 protein_id gnl|my_center|LOCUS_18390 10378 11016 gene locus_tag LOCUS_18400 10378 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 11003 11443 gene locus_tag LOCUS_18410 11003 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 11443 11760 gene locus_tag LOCUS_18420 11443 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 11750 12937 gene locus_tag LOCUS_18430 11750 12937 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_18430 12934 13602 gene locus_tag LOCUS_18440 12934 13602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_18440 13599 14561 gene locus_tag LOCUS_18450 13599 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 14558 15064 gene locus_tag LOCUS_18460 14558 15064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 15066 15893 gene locus_tag LOCUS_18470 15066 15893 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808202.1 protein_id gnl|my_center|LOCUS_18470 15903 16370 gene locus_tag LOCUS_18480 15903 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 16388 17206 gene locus_tag LOCUS_18490 16388 17206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 17760 17203 gene locus_tag LOCUS_18500 17760 17203 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236662.1 protein_id gnl|my_center|LOCUS_18500 17642 17869 gene locus_tag LOCUS_18510 17642 17869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 18047 19231 gene locus_tag LOCUS_18520 18047 19231 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963645.1 protein_id gnl|my_center|LOCUS_18520 19488 19270 gene locus_tag LOCUS_18530 19488 19270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 19615 19540 gene locus_tag LOCUS_t00320 19615 19540 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20182 19667 gene locus_tag LOCUS_18540 20182 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 20348 20734 gene locus_tag LOCUS_18550 20348 20734 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072183.1 protein_id gnl|my_center|LOCUS_18550 20737 21240 gene locus_tag LOCUS_18560 20737 21240 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_18560 21244 23229 gene locus_tag LOCUS_18570 21244 23229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 23336 23605 gene locus_tag LOCUS_18580 23336 23605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 23598 25649 gene locus_tag LOCUS_18590 gene cheA 23598 25649 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 protein_id gnl|my_center|LOCUS_18590 25649 26467 gene locus_tag LOCUS_18600 25649 26467 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_18600 26479 27375 gene locus_tag LOCUS_18610 26479 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 27375 27848 gene locus_tag LOCUS_18620 27375 27848 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389161.1 protein_id gnl|my_center|LOCUS_18620 27841 28869 gene locus_tag LOCUS_18630 gene cheB 27841 28869 CDS product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036391.1 protein_id gnl|my_center|LOCUS_18630 28876 30384 gene locus_tag LOCUS_18640 28876 30384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 30388 31668 gene locus_tag LOCUS_18650 30388 31668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 31668 33845 gene locus_tag LOCUS_18660 31668 33845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 34660 33872 gene locus_tag LOCUS_18670 34660 33872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 35681 34662 gene locus_tag LOCUS_18680 35681 34662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 36283 35678 gene locus_tag LOCUS_18690 36283 35678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 36665 36285 gene locus_tag LOCUS_18700 36665 36285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 37715 36732 gene locus_tag LOCUS_18710 37715 36732 CDS product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851386.1 protein_id gnl|my_center|LOCUS_18710 39351 37693 gene locus_tag LOCUS_18720 gene dnaG 39351 37693 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601638.1 protein_id gnl|my_center|LOCUS_18720 39428 40471 gene locus_tag LOCUS_18730 39428 40471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851401.1 protein_id gnl|my_center|LOCUS_18730 40446 40868 gene locus_tag LOCUS_18740 gene rnhA 40446 40868 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108269329.1 protein_id gnl|my_center|LOCUS_18740 40873 41562 gene locus_tag LOCUS_18750 gene rnc 40873 41562 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_18750 41559 42632 gene locus_tag LOCUS_18760 gene aroC 41559 42632 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094036.1 protein_id gnl|my_center|LOCUS_18760 43699 42650 gene locus_tag LOCUS_18770 43699 42650 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_18770 45847 43739 gene locus_tag LOCUS_18780 gene feoB 45847 43739 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_18780 46071 45844 gene locus_tag LOCUS_18790 46071 45844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 46853 46308 gene locus_tag LOCUS_18800 46853 46308 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853153.1 protein_id gnl|my_center|LOCUS_18800 46920 48170 gene locus_tag LOCUS_18810 46920 48170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 49232 48159 gene locus_tag LOCUS_18820 49232 48159 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851155.1 protein_id gnl|my_center|LOCUS_18820 49402 49713 gene locus_tag LOCUS_18830 gene rpsJ 49402 49713 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_18830 49723 50301 gene locus_tag LOCUS_18840 gene rplC 49723 50301 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_18840 50298 50912 gene locus_tag LOCUS_18850 gene rplD 50298 50912 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 protein_id gnl|my_center|LOCUS_18850 50915 51196 gene locus_tag LOCUS_18860 50915 51196 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851441.1 protein_id gnl|my_center|LOCUS_18860 51198 52028 gene locus_tag LOCUS_18870 gene rplB 51198 52028 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 protein_id gnl|my_center|LOCUS_18870 52029 52310 gene locus_tag LOCUS_18880 gene rpsS 52029 52310 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_18880 52318 52650 gene locus_tag LOCUS_18890 gene rplV 52318 52650 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851214.1 protein_id gnl|my_center|LOCUS_18890 52652 53359 gene locus_tag LOCUS_18900 gene rpsC 52652 53359 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851138.1 protein_id gnl|my_center|LOCUS_18900 53359 53784 gene locus_tag LOCUS_18910 gene rplP 53359 53784 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779441.1 protein_id gnl|my_center|LOCUS_18910 53771 53959 gene locus_tag LOCUS_18920 gene rpmC 53771 53959 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851566.1 protein_id gnl|my_center|LOCUS_18920 53969 54220 gene locus_tag LOCUS_18930 gene rpsQ 53969 54220 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851549.1 protein_id gnl|my_center|LOCUS_18930 54220 54588 gene locus_tag LOCUS_18940 gene rplN 54220 54588 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_18940 54588 54824 gene locus_tag LOCUS_18950 54588 54824 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779437.1 protein_id gnl|my_center|LOCUS_18950 54824 55369 gene locus_tag LOCUS_18960 gene rplE 54824 55369 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851453.1 protein_id gnl|my_center|LOCUS_18960 55371 55556 gene locus_tag LOCUS_18970 55371 55556 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851478.1 protein_id gnl|my_center|LOCUS_18970 55568 55963 gene locus_tag LOCUS_18980 gene rpsH 55568 55963 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851353.1 protein_id gnl|my_center|LOCUS_18980 56040 56576 gene locus_tag LOCUS_18990 gene rplF 56040 56576 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_18990 56586 56942 gene locus_tag LOCUS_19000 gene rplR 56586 56942 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851411.1 protein_id gnl|my_center|LOCUS_19000 56967 57410 gene locus_tag LOCUS_19010 gene rpsE 56967 57410 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779428.1 protein_id gnl|my_center|LOCUS_19010 57424 57828 gene locus_tag LOCUS_19020 gene rplO 57424 57828 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851292.1 protein_id gnl|my_center|LOCUS_19020 57897 59087 gene locus_tag LOCUS_19030 gene secY 57897 59087 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864789.1 protein_id gnl|my_center|LOCUS_19030 59093 59851 gene locus_tag LOCUS_19040 gene map 59093 59851 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858416.1 protein_id gnl|my_center|LOCUS_19040 60000 60218 gene locus_tag LOCUS_19050 gene infA 60000 60218 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781436.1 protein_id gnl|my_center|LOCUS_19050 60497 60865 gene locus_tag LOCUS_19060 gene rpsM 60497 60865 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 protein_id gnl|my_center|LOCUS_19060 60887 61279 gene locus_tag LOCUS_19070 gene rpsK 60887 61279 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779544.1 protein_id gnl|my_center|LOCUS_19070 61356 61982 gene locus_tag LOCUS_19080 gene rpsD 61356 61982 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 protein_id gnl|my_center|LOCUS_19080 61998 63011 gene locus_tag LOCUS_19090 61998 63011 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851403.1 protein_id gnl|my_center|LOCUS_19090 63015 63365 gene locus_tag LOCUS_19100 gene rplQ 63015 63365 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_19100 63511 63792 gene locus_tag LOCUS_19110 63511 63792 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858971.1 protein_id gnl|my_center|LOCUS_19110 63792 64355 gene locus_tag LOCUS_19120 63792 64355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168588.1 protein_id gnl|my_center|LOCUS_19120 64365 65669 gene locus_tag LOCUS_19130 64365 65669 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 protein_id gnl|my_center|LOCUS_19130 65725 66090 gene locus_tag LOCUS_19140 gene panD 65725 66090 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 protein_id gnl|my_center|LOCUS_19140 66090 66407 gene locus_tag LOCUS_19150 66090 66407 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851172.1 protein_id gnl|my_center|LOCUS_19150 66418 67506 gene locus_tag LOCUS_19160 66418 67506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 67521 68384 gene locus_tag LOCUS_19170 67521 68384 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 protein_id gnl|my_center|LOCUS_19170 68393 70369 gene locus_tag LOCUS_19180 gene tkt 68393 70369 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_19180 70371 71021 gene locus_tag LOCUS_19190 70371 71021 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_19190 72912 71032 gene locus_tag LOCUS_19200 72912 71032 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458057.1 protein_id gnl|my_center|LOCUS_19200 73082 74185 gene locus_tag LOCUS_19210 73082 74185 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924085.1 protein_id gnl|my_center|LOCUS_19210 74194 75045 gene locus_tag LOCUS_19220 74194 75045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 75050 76297 gene locus_tag LOCUS_19230 75050 76297 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 protein_id gnl|my_center|LOCUS_19230 76321 76752 gene locus_tag LOCUS_19240 76321 76752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 76752 77279 gene locus_tag LOCUS_19250 76752 77279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 77356 77910 gene locus_tag LOCUS_19260 77356 77910 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851269.1 protein_id gnl|my_center|LOCUS_19260 77907 79043 gene locus_tag LOCUS_19270 gene carA 77907 79043 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851156.1 protein_id gnl|my_center|LOCUS_19270 79157 79750 gene locus_tag LOCUS_19280 79157 79750 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851528.1 protein_id gnl|my_center|LOCUS_19280 79747 80988 gene locus_tag LOCUS_19290 79747 80988 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 protein_id gnl|my_center|LOCUS_19290 80981 81661 gene locus_tag LOCUS_19300 80981 81661 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_19300 81844 83310 gene locus_tag LOCUS_19310 gene ccoN 81844 83310 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_19310 83326 83991 gene locus_tag LOCUS_19320 gene ccoO 83326 83991 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 protein_id gnl|my_center|LOCUS_19320 84002 84217 gene locus_tag LOCUS_19330 84002 84217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 84231 85079 gene locus_tag LOCUS_19340 84231 85079 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851306.1 protein_id gnl|my_center|LOCUS_19340 85088 85300 gene locus_tag LOCUS_19350 85088 85300 CDS product DUF4006 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864471.1 protein_id gnl|my_center|LOCUS_19350 85438 86010 gene locus_tag LOCUS_19360 85438 86010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851454.1 protein_id gnl|my_center|LOCUS_19360 86003 86500 gene locus_tag LOCUS_19370 86003 86500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 88551 86545 gene locus_tag LOCUS_19380 88551 86545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 88673 91021 gene locus_tag LOCUS_19390 88673 91021 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891938.1 protein_id gnl|my_center|LOCUS_19390 91018 93741 gene locus_tag LOCUS_19400 91018 93741 CDS product RecB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864468.1 protein_id gnl|my_center|LOCUS_19400 93832 94263 gene locus_tag LOCUS_19410 gene rplM 93832 94263 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 protein_id gnl|my_center|LOCUS_19410 94265 94657 gene locus_tag LOCUS_19420 gene rpsI 94265 94657 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851459.1 protein_id gnl|my_center|LOCUS_19420 94795 95226 gene locus_tag LOCUS_19430 94795 95226 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206190.1 protein_id gnl|my_center|LOCUS_19430 95500 95216 gene locus_tag LOCUS_19440 95500 95216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 95631 96791 gene locus_tag LOCUS_19450 gene purT 95631 96791 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496844.1 protein_id gnl|my_center|LOCUS_19450 96792 97259 gene locus_tag LOCUS_19460 96792 97259 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 protein_id gnl|my_center|LOCUS_19460 98422 97277 gene locus_tag LOCUS_19470 98422 97277 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545883.1 protein_id gnl|my_center|LOCUS_19470 98949 98521 gene locus_tag LOCUS_19480 98949 98521 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083908.1 protein_id gnl|my_center|LOCUS_19480 100063 98972 gene locus_tag LOCUS_19490 100063 98972 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276805.1 protein_id gnl|my_center|LOCUS_19490 100704 100138 gene locus_tag LOCUS_19500 100704 100138 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166586.1 protein_id gnl|my_center|LOCUS_19500 100923 102440 gene locus_tag LOCUS_19510 100923 102440 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_19510 102505 103527 gene locus_tag LOCUS_19520 102505 103527 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382460.1 protein_id gnl|my_center|LOCUS_19520 103536 104330 gene locus_tag LOCUS_19530 103536 104330 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_19530 105135 104332 gene locus_tag LOCUS_19540 105135 104332 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_19540 105214 105852 gene locus_tag LOCUS_19550 105214 105852 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851542.1 protein_id gnl|my_center|LOCUS_19550 106025 109582 gene locus_tag LOCUS_19560 gene nifJ 106025 109582 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851382.1 protein_id gnl|my_center|LOCUS_19560 109859 109665 gene locus_tag LOCUS_19570 109859 109665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 110702 109929 gene locus_tag LOCUS_19580 110702 109929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 110931 110695 gene locus_tag LOCUS_19590 110931 110695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 112751 110928 gene locus_tag LOCUS_19600 112751 110928 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_19600 112836 113336 gene locus_tag LOCUS_19610 gene luxS 112836 113336 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857890.1 protein_id gnl|my_center|LOCUS_19610 113758 113333 gene locus_tag LOCUS_19620 113758 113333 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380404.1 protein_id gnl|my_center|LOCUS_19620 114867 113761 gene locus_tag LOCUS_19630 114867 113761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966542.1 protein_id gnl|my_center|LOCUS_19630 115801 114851 gene locus_tag LOCUS_19640 115801 114851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_19640 116754 115798 gene locus_tag LOCUS_19650 gene hlyD 116754 115798 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976409.1 protein_id gnl|my_center|LOCUS_19650 116921 117619 gene locus_tag LOCUS_19660 116921 117619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 118041 117616 gene locus_tag LOCUS_19670 118041 117616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 119632 118127 gene locus_tag LOCUS_19680 119632 118127 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727111.1 protein_id gnl|my_center|LOCUS_19680 120920 119748 gene locus_tag LOCUS_19690 120920 119748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966748.1 protein_id gnl|my_center|LOCUS_19690 122004 121105 gene locus_tag LOCUS_19700 122004 121105 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_19700 122107 123501 gene locus_tag LOCUS_19710 122107 123501 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245272.1 protein_id gnl|my_center|LOCUS_19710 123498 124271 gene locus_tag LOCUS_19720 123498 124271 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088645.1 protein_id gnl|my_center|LOCUS_19720 124268 125056 gene locus_tag LOCUS_19730 124268 125056 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930865.1 protein_id gnl|my_center|LOCUS_19730 125053 125745 gene locus_tag LOCUS_19740 gene dut 125053 125745 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_19740 126292 125756 gene locus_tag LOCUS_19750 126292 125756 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880124.1 protein_id gnl|my_center|LOCUS_19750 126403 126981 gene locus_tag LOCUS_19760 126403 126981 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_19760 126981 127646 gene locus_tag LOCUS_19770 gene queC 126981 127646 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435648.1 protein_id gnl|my_center|LOCUS_19770 127723 129759 gene locus_tag LOCUS_19780 127723 129759 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545732.1 protein_id gnl|my_center|LOCUS_19780 130166 129741 gene locus_tag LOCUS_19790 130166 129741 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853315.1 protein_id gnl|my_center|LOCUS_19790 131620 130241 gene locus_tag LOCUS_19800 131620 130241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 132288 131614 gene locus_tag LOCUS_19810 132288 131614 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860529.1 protein_id gnl|my_center|LOCUS_19810 132960 132292 gene locus_tag LOCUS_19820 132960 132292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 133094 134803 gene locus_tag LOCUS_19830 133094 134803 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_19830 135590 134820 gene locus_tag LOCUS_19840 gene ygiD 135590 134820 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184346.1 protein_id gnl|my_center|LOCUS_19840 136426 135635 gene locus_tag LOCUS_19850 gene pstB 136426 135635 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546432.1 protein_id gnl|my_center|LOCUS_19850 137282 136440 gene locus_tag LOCUS_19860 gene pstA 137282 136440 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546243.1 protein_id gnl|my_center|LOCUS_19860 138141 137275 gene locus_tag LOCUS_19870 gene pstC 138141 137275 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545177.1 protein_id gnl|my_center|LOCUS_19870 139221 138226 gene locus_tag LOCUS_19880 gene pstS 139221 138226 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881320.1 protein_id gnl|my_center|LOCUS_19880 139389 141296 gene locus_tag LOCUS_19890 139389 141296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 141293 141709 gene locus_tag LOCUS_19900 141293 141709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 141785 142861 gene locus_tag LOCUS_19910 141785 142861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 142984 143700 gene locus_tag LOCUS_19920 142984 143700 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_19920 143685 145238 gene locus_tag LOCUS_19930 143685 145238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 145352 146734 gene locus_tag LOCUS_19940 145352 146734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940069.1 protein_id gnl|my_center|LOCUS_19940 146750 147916 gene locus_tag LOCUS_19950 146750 147916 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940070.1 protein_id gnl|my_center|LOCUS_19950 147970 149781 gene locus_tag LOCUS_19960 147970 149781 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940071.1 protein_id gnl|my_center|LOCUS_19960 150518 149787 gene locus_tag LOCUS_19970 150518 149787 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_19970 151750 150518 gene locus_tag LOCUS_19980 151750 150518 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943942.1 protein_id gnl|my_center|LOCUS_19980 153978 151897 gene locus_tag LOCUS_19990 153978 151897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 154961 154044 gene locus_tag LOCUS_20000 154961 154044 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_20000 156155 155013 gene locus_tag LOCUS_20010 156155 155013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246471.1 protein_id gnl|my_center|LOCUS_20010 157151 156159 gene locus_tag LOCUS_20020 157151 156159 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202721.1 protein_id gnl|my_center|LOCUS_20020 157832 157377 gene locus_tag LOCUS_20030 157832 157377 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945850.1 protein_id gnl|my_center|LOCUS_20030 159085 157829 gene locus_tag LOCUS_20040 gene rhlE 159085 157829 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_20040 160933 159323 gene locus_tag LOCUS_20050 160933 159323 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_20050 162157 161030 gene locus_tag LOCUS_20060 162157 161030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 163450 162176 gene locus_tag LOCUS_20070 163450 162176 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943062.1 protein_id gnl|my_center|LOCUS_20070 163563 165422 gene locus_tag LOCUS_20080 gene ciaB 163563 165422 CDS product invasion protein CiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858322.1 protein_id gnl|my_center|LOCUS_20080 165506 166945 gene locus_tag LOCUS_20090 gene accC 165506 166945 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880952.1 protein_id gnl|my_center|LOCUS_20090 167005 167691 gene locus_tag LOCUS_20100 gene fetB 167005 167691 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926980.1 protein_id gnl|my_center|LOCUS_20100 167757 168917 gene locus_tag LOCUS_20110 167757 168917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 168917 170074 gene locus_tag LOCUS_20120 168917 170074 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858561.1 protein_id gnl|my_center|LOCUS_20120 170134 170730 gene locus_tag LOCUS_20130 170134 170730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880404.1 protein_id gnl|my_center|LOCUS_20130 170815 172599 gene locus_tag LOCUS_20140 170815 172599 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974769.1 protein_id gnl|my_center|LOCUS_20140 173766 172594 gene locus_tag LOCUS_20150 173766 172594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 174421 173792 gene locus_tag LOCUS_20160 gene dauR 174421 173792 CDS product transcriptional regulator DauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113779.1 protein_id gnl|my_center|LOCUS_20160 174495 175346 gene locus_tag LOCUS_20170 174495 175346 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842785.1 protein_id gnl|my_center|LOCUS_20170 177579 175378 gene locus_tag LOCUS_20180 177579 175378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence07 2270 192 gene locus_tag LOCUS_20190 2270 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 5003 2343 gene locus_tag LOCUS_20200 gene flgL 5003 2343 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266636.1 protein_id gnl|my_center|LOCUS_20200 5171 5449 gene locus_tag LOCUS_20210 5171 5449 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859562.1 protein_id gnl|my_center|LOCUS_20210 5531 5615 gene locus_tag LOCUS_t00330 5531 5615 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5981 5709 gene locus_tag LOCUS_20220 5981 5709 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_20220 6229 5978 gene locus_tag LOCUS_20230 6229 5978 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258569.1 protein_id gnl|my_center|LOCUS_20230 7613 6321 gene locus_tag LOCUS_20240 7613 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 8523 7606 gene locus_tag LOCUS_20250 8523 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 9469 8549 gene locus_tag LOCUS_20260 9469 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 9635 9883 gene locus_tag LOCUS_20270 9635 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 10036 10677 gene locus_tag LOCUS_20280 10036 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 10680 10883 gene locus_tag LOCUS_20290 10680 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 10874 13003 gene locus_tag LOCUS_20300 10874 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 13025 13312 gene locus_tag LOCUS_20310 13025 13312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 13309 13938 gene locus_tag LOCUS_20320 13309 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 13935 14279 gene locus_tag LOCUS_20330 13935 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 14283 14573 gene locus_tag LOCUS_20340 14283 14573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 14587 15411 gene locus_tag LOCUS_20350 14587 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 15551 18442 gene locus_tag LOCUS_20360 gene mobF 15551 18442 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_20360 18444 18644 gene locus_tag LOCUS_20370 18444 18644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 18641 20509 gene locus_tag LOCUS_20380 18641 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 20525 21616 gene locus_tag LOCUS_20390 20525 21616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 22647 21661 gene locus_tag LOCUS_20400 22647 21661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 27446 22734 gene locus_tag LOCUS_20410 27446 22734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077139241.1 protein_id gnl|my_center|LOCUS_20410 28287 27595 gene locus_tag LOCUS_20420 28287 27595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 29234 28296 gene locus_tag LOCUS_20430 29234 28296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 29552 29283 gene locus_tag LOCUS_20440 29552 29283 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_20440 29751 29536 gene locus_tag LOCUS_20450 29751 29536 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_20450 30955 29801 gene locus_tag LOCUS_20460 30955 29801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 31342 32577 gene locus_tag LOCUS_20470 31342 32577 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_20470 34251 33187 gene locus_tag LOCUS_20480 34251 33187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 35799 34327 gene locus_tag LOCUS_20490 35799 34327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 37211 35805 gene locus_tag LOCUS_20500 37211 35805 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_20500 38247 37264 gene locus_tag LOCUS_20510 38247 37264 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 protein_id gnl|my_center|LOCUS_20510 39442 38312 gene locus_tag LOCUS_20520 39442 38312 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228500.1 protein_id gnl|my_center|LOCUS_20520 39852 39481 gene locus_tag LOCUS_20530 39852 39481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 40123 39857 gene locus_tag LOCUS_20540 40123 39857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 40430 40116 gene locus_tag LOCUS_20550 40430 40116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 40673 40443 gene locus_tag LOCUS_20560 40673 40443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 41389 40910 gene locus_tag LOCUS_20570 41389 40910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 42318 41383 gene locus_tag LOCUS_20580 gene dprA 42318 41383 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922314.1 protein_id gnl|my_center|LOCUS_20580 42896 42330 gene locus_tag LOCUS_20590 42896 42330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 43201 42941 gene locus_tag LOCUS_20600 43201 42941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 43302 47147 gene locus_tag LOCUS_20610 43302 47147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 47405 47148 gene locus_tag LOCUS_20620 47405 47148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 47529 47810 gene locus_tag LOCUS_20630 47529 47810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 47879 48373 gene locus_tag LOCUS_20640 47879 48373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 48387 49712 gene locus_tag LOCUS_20650 48387 49712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 50621 51202 gene locus_tag LOCUS_20660 50621 51202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 52159 51281 gene locus_tag LOCUS_20670 52159 51281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 52771 52163 gene locus_tag LOCUS_20680 52771 52163 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975272.1 protein_id gnl|my_center|LOCUS_20680 53576 52869 gene locus_tag LOCUS_20690 53576 52869 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_20690 54326 53580 gene locus_tag LOCUS_20700 54326 53580 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_20700 56190 54310 gene locus_tag LOCUS_20710 56190 54310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 56507 56208 gene locus_tag LOCUS_20720 56507 56208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 56976 56476 gene locus_tag LOCUS_20730 56976 56476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 57863 56988 gene locus_tag LOCUS_20740 57863 56988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 58038 58769 gene locus_tag LOCUS_20750 58038 58769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 63953 58776 gene locus_tag LOCUS_20760 63953 58776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 64444 64022 gene locus_tag LOCUS_20770 64444 64022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 64690 64454 gene locus_tag LOCUS_20780 64690 64454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 65244 64687 gene locus_tag LOCUS_20790 65244 64687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 protein_id gnl|my_center|LOCUS_20790 69062 65244 gene locus_tag LOCUS_20800 69062 65244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_20800 72054 69064 gene locus_tag LOCUS_20810 gene drmD 72054 69064 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_20810 73409 72279 gene locus_tag LOCUS_20820 73409 72279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 74001 73402 gene locus_tag LOCUS_20830 74001 73402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 74336 74001 gene locus_tag LOCUS_20840 74336 74001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 75325 74411 gene locus_tag LOCUS_20850 75325 74411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 76806 75322 gene locus_tag LOCUS_20860 76806 75322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 79159 76808 gene locus_tag LOCUS_20870 79159 76808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 79853 79149 gene locus_tag LOCUS_20880 79853 79149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 81087 79846 gene locus_tag LOCUS_20890 81087 79846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 83463 81109 gene locus_tag LOCUS_20900 83463 81109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 84571 83453 gene locus_tag LOCUS_20910 gene mre11 84571 83453 CDS product DNA double-strand break repair protein Mre11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980186.1 protein_id gnl|my_center|LOCUS_20910 87705 84634 gene locus_tag LOCUS_20920 87705 84634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 88841 88059 gene locus_tag LOCUS_20930 88841 88059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 89612 88851 gene locus_tag LOCUS_20940 89612 88851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 89937 89614 gene locus_tag LOCUS_20950 89937 89614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 90667 89951 gene locus_tag LOCUS_20960 90667 89951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 90872 90690 gene locus_tag LOCUS_20970 90872 90690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 91056 90865 gene locus_tag LOCUS_20980 91056 90865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 91275 91892 gene locus_tag LOCUS_20990 91275 91892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 92370 92008 gene locus_tag LOCUS_21000 92370 92008 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_21000 92666 92373 gene locus_tag LOCUS_21010 92666 92373 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_21010 94074 93502 gene locus_tag LOCUS_21020 94074 93502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310171.1 protein_id gnl|my_center|LOCUS_21020 94232 95515 gene locus_tag LOCUS_21030 94232 95515 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878157.1 protein_id gnl|my_center|LOCUS_21030 95594 95761 gene locus_tag LOCUS_21040 95594 95761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 95878 96495 gene locus_tag LOCUS_21050 95878 96495 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853863.1 protein_id gnl|my_center|LOCUS_21050 96551 97384 gene locus_tag LOCUS_21060 96551 97384 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852998.1 protein_id gnl|my_center|LOCUS_21060 98658 97387 gene locus_tag LOCUS_21070 98658 97387 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852268.1 protein_id gnl|my_center|LOCUS_21070 99408 98686 gene locus_tag LOCUS_21080 gene lptB 99408 98686 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855252.1 protein_id gnl|my_center|LOCUS_21080 99817 99395 gene locus_tag LOCUS_21090 gene tsaE 99817 99395 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852319.1 protein_id gnl|my_center|LOCUS_21090 100804 99821 gene locus_tag LOCUS_21100 gene trpD 100804 99821 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_21100 101049 100801 gene locus_tag LOCUS_21110 101049 100801 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 protein_id gnl|my_center|LOCUS_21110 101208 102434 gene locus_tag LOCUS_21120 101208 102434 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 protein_id gnl|my_center|LOCUS_21120 102442 102861 gene locus_tag LOCUS_21130 102442 102861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 102874 103320 gene locus_tag LOCUS_21140 gene rplI 102874 103320 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781628.1 protein_id gnl|my_center|LOCUS_21140 103323 103868 gene locus_tag LOCUS_21150 gene hslV 103323 103868 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 protein_id gnl|my_center|LOCUS_21150 103865 105190 gene locus_tag LOCUS_21160 gene hslU 103865 105190 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 protein_id gnl|my_center|LOCUS_21160 105200 106096 gene locus_tag LOCUS_21170 gene era 105200 106096 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862438.1 protein_id gnl|my_center|LOCUS_21170 106164 107690 gene locus_tag LOCUS_21180 106164 107690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 107683 108330 gene locus_tag LOCUS_21190 107683 108330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 108327 108752 gene locus_tag LOCUS_21200 108327 108752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 108721 110244 gene locus_tag LOCUS_21210 gene mshL 108721 110244 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_21210 110237 111046 gene locus_tag LOCUS_21220 110237 111046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 111039 111902 gene locus_tag LOCUS_21230 111039 111902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 111964 113715 gene locus_tag LOCUS_21240 111964 113715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 113712 114953 gene locus_tag LOCUS_21250 113712 114953 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_21250 115443 114997 gene locus_tag LOCUS_21260 115443 114997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 116167 115460 gene locus_tag LOCUS_21270 gene flgH 116167 115460 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864738.1 protein_id gnl|my_center|LOCUS_21270 116249 116695 gene locus_tag LOCUS_21280 116249 116695 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_21280 117945 116740 gene locus_tag LOCUS_21290 117945 116740 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891878.1 protein_id gnl|my_center|LOCUS_21290 120050 117942 gene locus_tag LOCUS_21300 gene pta 120050 117942 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_21300 121591 120158 gene locus_tag LOCUS_21310 121591 120158 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852462.1 protein_id gnl|my_center|LOCUS_21310 121869 121597 gene locus_tag LOCUS_21320 121869 121597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 122585 121866 gene locus_tag LOCUS_21330 122585 121866 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852645.1 protein_id gnl|my_center|LOCUS_21330 122804 122586 gene locus_tag LOCUS_21340 122804 122586 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852622.1 protein_id gnl|my_center|LOCUS_21340 123890 122856 gene locus_tag LOCUS_21350 123890 122856 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852516.1 protein_id gnl|my_center|LOCUS_21350 124454 123900 gene locus_tag LOCUS_21360 gene ruvA 124454 123900 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852492.1 protein_id gnl|my_center|LOCUS_21360 126379 124451 gene locus_tag LOCUS_21370 126379 124451 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852626.1 protein_id gnl|my_center|LOCUS_21370 126877 126488 gene locus_tag LOCUS_21380 126877 126488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 126765 127916 gene locus_tag LOCUS_21390 gene murJ 126765 127916 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611242.1 protein_id gnl|my_center|LOCUS_21390 127903 129303 gene locus_tag LOCUS_21400 gene cysS 127903 129303 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471359.1 protein_id gnl|my_center|LOCUS_21400 129305 131023 gene locus_tag LOCUS_21410 129305 131023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858782.1 protein_id gnl|my_center|LOCUS_21410 131081 132142 gene locus_tag LOCUS_21420 131081 132142 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_21420 132191 133450 gene locus_tag LOCUS_21430 132191 133450 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 protein_id gnl|my_center|LOCUS_21430 133452 134345 gene locus_tag LOCUS_21440 gene dapA 133452 134345 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852574.1 protein_id gnl|my_center|LOCUS_21440 134345 135112 gene locus_tag LOCUS_21450 134345 135112 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891889.1 protein_id gnl|my_center|LOCUS_21450 135109 135651 gene locus_tag LOCUS_21460 gene pgsA 135109 135651 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_21460 135651 136709 gene locus_tag LOCUS_21470 gene rseP 135651 136709 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_21470 136711 137379 gene locus_tag LOCUS_21480 136711 137379 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888213.1 protein_id gnl|my_center|LOCUS_21480 138772 137402 gene locus_tag LOCUS_21490 138772 137402 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925621.1 protein_id gnl|my_center|LOCUS_21490 139390 138785 gene locus_tag LOCUS_21500 139390 138785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 139491 140096 gene locus_tag LOCUS_21510 139491 140096 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941463.1 protein_id gnl|my_center|LOCUS_21510 140558 140115 gene locus_tag LOCUS_21520 140558 140115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 141055 140558 gene locus_tag LOCUS_21530 141055 140558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 142568 141177 gene locus_tag LOCUS_21540 gene fumC 142568 141177 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 protein_id gnl|my_center|LOCUS_21540 143536 142664 gene locus_tag LOCUS_21550 143536 142664 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584032.1 protein_id gnl|my_center|LOCUS_21550 143733 143536 gene locus_tag LOCUS_21560 143733 143536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 144744 144187 gene locus_tag LOCUS_21570 144744 144187 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_21570 145585 144755 gene locus_tag LOCUS_21580 145585 144755 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_21580 146718 145585 gene locus_tag LOCUS_21590 146718 145585 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_21590 147048 146731 gene locus_tag LOCUS_21600 147048 146731 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851088.1 protein_id gnl|my_center|LOCUS_21600 148006 147134 gene locus_tag LOCUS_21610 gene sucD 148006 147134 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002872006.1 protein_id gnl|my_center|LOCUS_21610 149178 148003 gene locus_tag LOCUS_21620 gene sucC 149178 148003 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858590.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence08 <1 1449 gene locus_tag LOCUS_21630 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022302.1:nucleoside-diphosphate sugar epimerase/dehydratase 1453 2580 gene locus_tag LOCUS_21640 1453 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2567 4699 gene locus_tag LOCUS_21650 gene pglB 2567 4699 CDS product undecaprenyl-diphosphooligosaccharide--protein glycotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852780.1 protein_id gnl|my_center|LOCUS_21650 4743 5648 gene locus_tag LOCUS_21660 4743 5648 CDS product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 protein_id gnl|my_center|LOCUS_21660 5645 6256 gene locus_tag LOCUS_21670 gene hisH 5645 6256 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_21670 6257 6991 gene locus_tag LOCUS_21680 gene hisA 6257 6991 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_21680 7059 7424 gene locus_tag LOCUS_21690 7059 7424 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 protein_id gnl|my_center|LOCUS_21690 7430 8257 gene locus_tag LOCUS_21700 7430 8257 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852657.1 protein_id gnl|my_center|LOCUS_21700 8258 10222 gene locus_tag LOCUS_21710 gene ftsH 8258 10222 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852796.1 protein_id gnl|my_center|LOCUS_21710 10222 10875 gene locus_tag LOCUS_21720 10222 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 10865 11602 gene locus_tag LOCUS_21730 gene pssA 10865 11602 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_21730 11831 13384 gene locus_tag LOCUS_21740 11831 13384 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_21740 15764 13425 gene locus_tag LOCUS_21750 gene pflB 15764 13425 CDS product motility protein PflB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858651.1 protein_id gnl|my_center|LOCUS_21750 17010 15766 gene locus_tag LOCUS_21760 gene serS 17010 15766 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858681.1 protein_id gnl|my_center|LOCUS_21760 17984 17019 gene locus_tag LOCUS_21770 gene trpS 17984 17019 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_21770 18525 17998 gene locus_tag LOCUS_21780 18525 17998 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904001.1 protein_id gnl|my_center|LOCUS_21780 19933 18518 gene locus_tag LOCUS_21790 gene der 19933 18518 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858744.1 protein_id gnl|my_center|LOCUS_21790 21069 19999 gene locus_tag LOCUS_21800 21069 19999 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_21800 21153 22049 gene locus_tag LOCUS_21810 21153 22049 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 protein_id gnl|my_center|LOCUS_21810 22046 22846 gene locus_tag LOCUS_21820 gene kdsA 22046 22846 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858652.1 protein_id gnl|my_center|LOCUS_21820 22850 24943 gene locus_tag LOCUS_21830 gene ovoA 22850 24943 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_21830 25071 25535 gene locus_tag LOCUS_21840 gene ribE 25071 25535 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 protein_id gnl|my_center|LOCUS_21840 25545 25952 gene locus_tag LOCUS_21850 gene nusB 25545 25952 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_21850 25952 26635 gene locus_tag LOCUS_21860 gene pyrF 25952 26635 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_21860 26653 28104 gene locus_tag LOCUS_21870 26653 28104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 28155 28298 gene locus_tag LOCUS_21880 28155 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 28379 28469 gene locus_tag LOCUS_t00340 28379 28469 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29829 28648 gene locus_tag LOCUS_21890 29829 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 30470 30138 gene locus_tag LOCUS_21900 30470 30138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 31005 30451 gene locus_tag LOCUS_21910 31005 30451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 31509 31012 gene locus_tag LOCUS_21920 31509 31012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 32241 31624 gene locus_tag LOCUS_21930 32241 31624 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 protein_id gnl|my_center|LOCUS_21930 33111 32287 gene locus_tag LOCUS_21940 33111 32287 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151652833.1 protein_id gnl|my_center|LOCUS_21940 33158 33844 gene locus_tag LOCUS_21950 33158 33844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 36629 33855 gene locus_tag LOCUS_21960 36629 33855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 36756 37583 gene locus_tag LOCUS_21970 gene mscS 36756 37583 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_21970 37580 37807 gene locus_tag LOCUS_21980 37580 37807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 40980 37861 gene locus_tag LOCUS_21990 40980 37861 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_21990 42167 40980 gene locus_tag LOCUS_22000 42167 40980 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_22000 43533 42157 gene locus_tag LOCUS_22010 43533 42157 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_22010 43760 44506 gene locus_tag LOCUS_22020 gene proC 43760 44506 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_22020 45476 44553 gene locus_tag LOCUS_22030 45476 44553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 45891 45682 gene locus_tag LOCUS_22040 45891 45682 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545599.1 protein_id gnl|my_center|LOCUS_22040 46056 46838 gene locus_tag LOCUS_22050 46056 46838 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933208.1 protein_id gnl|my_center|LOCUS_22050 46849 47598 gene locus_tag LOCUS_22060 gene modA 46849 47598 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_22060 47591 47992 gene locus_tag LOCUS_22070 47591 47992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 47985 48683 gene locus_tag LOCUS_22080 gene modB 47985 48683 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_22080 48680 49540 gene locus_tag LOCUS_22090 48680 49540 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_22090 49550 50263 gene locus_tag LOCUS_22100 gene modA 49550 50263 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881043.1 protein_id gnl|my_center|LOCUS_22100 50253 50924 gene locus_tag LOCUS_22110 gene modB 50253 50924 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_22110 51055 51639 gene locus_tag LOCUS_22120 51055 51639 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858665.1 protein_id gnl|my_center|LOCUS_22120 52200 51634 gene locus_tag LOCUS_22130 52200 51634 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_22130 52735 52283 gene locus_tag LOCUS_22140 52735 52283 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851418.1 protein_id gnl|my_center|LOCUS_22140 53934 52744 gene locus_tag LOCUS_22150 53934 52744 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851486.1 protein_id gnl|my_center|LOCUS_22150 54799 53912 gene locus_tag LOCUS_22160 54799 53912 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_22160 55920 54796 gene locus_tag LOCUS_22170 55920 54796 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_22170 56027 57184 gene locus_tag LOCUS_22180 56027 57184 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 protein_id gnl|my_center|LOCUS_22180 57224 58441 gene locus_tag LOCUS_22190 57224 58441 CDS product 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851311.1 protein_id gnl|my_center|LOCUS_22190 58682 58467 gene locus_tag LOCUS_22200 58682 58467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 59948 58731 gene locus_tag LOCUS_22210 59948 58731 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054775797.1 protein_id gnl|my_center|LOCUS_22210 60757 59972 gene locus_tag LOCUS_22220 60757 59972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 60799 61083 gene locus_tag LOCUS_22230 60799 61083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 61303 63306 gene locus_tag LOCUS_22240 61303 63306 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086964.1 protein_id gnl|my_center|LOCUS_22240 64033 63359 gene locus_tag LOCUS_22250 gene dccR 64033 63359 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_22250 65919 64030 gene locus_tag LOCUS_22260 65919 64030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 66370 69093 gene locus_tag LOCUS_22270 66370 69093 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459977.1 protein_id gnl|my_center|LOCUS_22270 69186 71543 gene locus_tag LOCUS_22280 69186 71543 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459976.1 protein_id gnl|my_center|LOCUS_22280 71545 71751 gene locus_tag LOCUS_22290 71545 71751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944419.1 protein_id gnl|my_center|LOCUS_22290 71751 72476 gene locus_tag LOCUS_22300 71751 72476 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272344.1 protein_id gnl|my_center|LOCUS_22300 72476 72922 gene locus_tag LOCUS_22310 72476 72922 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272844.1 protein_id gnl|my_center|LOCUS_22310 72926 74269 gene locus_tag LOCUS_22320 72926 74269 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065079778.1 protein_id gnl|my_center|LOCUS_22320 74266 75561 gene locus_tag LOCUS_22330 74266 75561 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135545807.1 protein_id gnl|my_center|LOCUS_22330 75565 76602 gene locus_tag LOCUS_22340 75565 76602 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_22340 76603 77715 gene locus_tag LOCUS_22350 76603 77715 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204617516.1 protein_id gnl|my_center|LOCUS_22350 77708 78298 gene locus_tag LOCUS_22360 gene cobC 77708 78298 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812873.1 protein_id gnl|my_center|LOCUS_22360 78572 78342 gene locus_tag LOCUS_22370 78572 78342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 80308 78572 gene locus_tag LOCUS_22380 80308 78572 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_22380 83009 80466 gene locus_tag LOCUS_22390 83009 80466 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087385.1 protein_id gnl|my_center|LOCUS_22390 83436 83101 gene locus_tag LOCUS_22400 83436 83101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22400 85388 83562 gene locus_tag LOCUS_22410 85388 83562 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477305.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22410 85627 87222 gene locus_tag LOCUS_22420 85627 87222 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942070.1 protein_id gnl|my_center|LOCUS_22420 87212 87544 gene locus_tag LOCUS_22430 87212 87544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 87547 88458 gene locus_tag LOCUS_22440 87547 88458 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_22440 89145 88453 gene locus_tag LOCUS_22450 89145 88453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 90734 89142 gene locus_tag LOCUS_22460 90734 89142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 90992 90786 gene locus_tag LOCUS_22470 90992 90786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 92279 91041 gene locus_tag LOCUS_22480 92279 91041 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_22480 93121 92330 gene locus_tag LOCUS_22490 93121 92330 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770472.1 protein_id gnl|my_center|LOCUS_22490 93978 93118 gene locus_tag LOCUS_22500 93978 93118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599885.1 protein_id gnl|my_center|LOCUS_22500 94847 93975 gene locus_tag LOCUS_22510 94847 93975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443358.1 protein_id gnl|my_center|LOCUS_22510 95851 94847 gene locus_tag LOCUS_22520 95851 94847 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947999.1 protein_id gnl|my_center|LOCUS_22520 97557 95965 gene locus_tag LOCUS_22530 97557 95965 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028045.1 protein_id gnl|my_center|LOCUS_22530 98967 97654 gene locus_tag LOCUS_22540 98967 97654 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940453.1 protein_id gnl|my_center|LOCUS_22540 99405 99028 gene locus_tag LOCUS_22550 99405 99028 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_22550 100279 99386 gene locus_tag LOCUS_22560 100279 99386 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_22560 101034 100339 gene locus_tag LOCUS_22570 101034 100339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 101839 101027 gene locus_tag LOCUS_22580 gene fdxH 101839 101027 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070510.1 protein_id gnl|my_center|LOCUS_22580 104388 101836 gene locus_tag LOCUS_22590 104388 101836 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_22590 104925 104512 gene locus_tag LOCUS_22600 104925 104512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 107053 105089 gene locus_tag LOCUS_22610 107053 105089 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893345.1 protein_id gnl|my_center|LOCUS_22610 108942 107176 gene locus_tag LOCUS_22620 108942 107176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 109628 108939 gene locus_tag LOCUS_22630 109628 108939 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_22630 110470 109775 gene locus_tag LOCUS_22640 110470 109775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 111272 110460 gene locus_tag LOCUS_22650 111272 110460 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_22650 113821 111269 gene locus_tag LOCUS_22660 113821 111269 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_22660 114781 114299 gene locus_tag LOCUS_22670 114781 114299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 116603 114771 gene locus_tag LOCUS_22680 116603 114771 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880333.1 protein_id gnl|my_center|LOCUS_22680 118438 116627 gene locus_tag LOCUS_22690 gene glmS 118438 116627 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858421.1 protein_id gnl|my_center|LOCUS_22690 120984 118459 gene locus_tag LOCUS_22700 120984 118459 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858387.1 protein_id gnl|my_center|LOCUS_22700 121077 122288 gene locus_tag LOCUS_22710 gene trpB 121077 122288 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_22710 122960 122355 gene locus_tag LOCUS_22720 122960 122355 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_22720 123386 123027 gene locus_tag LOCUS_22730 123386 123027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 123529 124593 gene locus_tag LOCUS_22740 gene mqnE 123529 124593 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858079.1 protein_id gnl|my_center|LOCUS_22740 124616 125896 gene locus_tag LOCUS_22750 124616 125896 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505472.1 protein_id gnl|my_center|LOCUS_22750 125907 126356 gene locus_tag LOCUS_22760 125907 126356 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 protein_id gnl|my_center|LOCUS_22760 126394 127551 gene locus_tag LOCUS_22770 126394 127551 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 protein_id gnl|my_center|LOCUS_22770 128109 127537 gene locus_tag LOCUS_22780 128109 127537 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_22780 128554 128111 gene locus_tag LOCUS_22790 128554 128111 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423235.1 protein_id gnl|my_center|LOCUS_22790 128821 129510 gene locus_tag LOCUS_22800 128821 129510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 129507 131177 gene locus_tag LOCUS_22810 gene ctaD 129507 131177 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939102.1 protein_id gnl|my_center|LOCUS_22810 131170 131820 gene locus_tag LOCUS_22820 131170 131820 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792207.1 protein_id gnl|my_center|LOCUS_22820 131830 132171 gene locus_tag LOCUS_22830 131830 132171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 132175 133443 gene locus_tag LOCUS_22840 gene coxB 132175 133443 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939099.1 protein_id gnl|my_center|LOCUS_22840 133445 134332 gene locus_tag LOCUS_22850 133445 134332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 134533 135510 gene locus_tag LOCUS_22860 134533 135510 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085519.1 protein_id gnl|my_center|LOCUS_22860 135507 135953 gene locus_tag LOCUS_22870 135507 135953 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 protein_id gnl|my_center|LOCUS_22870 135953 137470 gene locus_tag LOCUS_22880 135953 137470 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382837.1 protein_id gnl|my_center|LOCUS_22880 137561 138274 gene locus_tag LOCUS_22890 137561 138274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 138356 139135 gene locus_tag LOCUS_22900 138356 139135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22900 139835 139152 gene locus_tag LOCUS_22910 139835 139152 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857631.1 protein_id gnl|my_center|LOCUS_22910 141420 139828 gene locus_tag LOCUS_22920 141420 139828 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025277.1 protein_id gnl|my_center|LOCUS_22920 141604 142794 gene locus_tag LOCUS_22930 141604 142794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 142818 143588 gene locus_tag LOCUS_22940 142818 143588 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 protein_id gnl|my_center|LOCUS_22940 143588 144964 gene locus_tag LOCUS_22950 143588 144964 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114178.1 protein_id gnl|my_center|LOCUS_22950 145948 144953 gene locus_tag LOCUS_22960 145948 144953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 146255 147214 gene locus_tag LOCUS_22970 146255 147214 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064590.1 protein_id gnl|my_center|LOCUS_22970 147588 147827 gene locus_tag LOCUS_22980 147588 147827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence09 126 938 gene locus_tag LOCUS_22990 126 938 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_22990 1127 3103 gene locus_tag LOCUS_23000 1127 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 4385 3129 gene locus_tag LOCUS_23010 4385 3129 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873165.1 protein_id gnl|my_center|LOCUS_23010 5814 4387 gene locus_tag LOCUS_23020 5814 4387 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858532.1 protein_id gnl|my_center|LOCUS_23020 6875 5811 gene locus_tag LOCUS_23030 gene ispG 6875 5811 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852250.1 protein_id gnl|my_center|LOCUS_23030 8708 6960 gene locus_tag LOCUS_23040 8708 6960 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852169.1 protein_id gnl|my_center|LOCUS_23040 9301 8801 gene locus_tag LOCUS_23050 9301 8801 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852324.1 protein_id gnl|my_center|LOCUS_23050 9816 9295 gene locus_tag LOCUS_23060 9816 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 10111 9893 gene locus_tag LOCUS_23070 10111 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 10341 10108 gene locus_tag LOCUS_23080 10341 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852327.1 protein_id gnl|my_center|LOCUS_23080 10403 12379 gene locus_tag LOCUS_23090 gene uvrB 10403 12379 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855027.1 protein_id gnl|my_center|LOCUS_23090 12449 12988 gene locus_tag LOCUS_23100 12449 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 13060 15171 gene locus_tag LOCUS_23110 13060 15171 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860421.1 protein_id gnl|my_center|LOCUS_23110 15172 15696 gene locus_tag LOCUS_23120 15172 15696 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851622.1 protein_id gnl|my_center|LOCUS_23120 16501 15677 gene locus_tag LOCUS_23130 16501 15677 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858535.1 protein_id gnl|my_center|LOCUS_23130 17085 16498 gene locus_tag LOCUS_23140 17085 16498 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545776.1 protein_id gnl|my_center|LOCUS_23140 17730 17089 gene locus_tag LOCUS_23150 gene rpe 17730 17089 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858571.1 protein_id gnl|my_center|LOCUS_23150 17865 18053 gene locus_tag LOCUS_23160 gene rpmB 17865 18053 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_23160 18147 19337 gene locus_tag LOCUS_23170 gene argJ 18147 19337 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546755.1 protein_id gnl|my_center|LOCUS_23170 19400 19627 gene locus_tag LOCUS_23180 19400 19627 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855201.1 protein_id gnl|my_center|LOCUS_23180 20302 19640 gene locus_tag LOCUS_23190 20302 19640 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887243.1 protein_id gnl|my_center|LOCUS_23190 21104 20295 gene locus_tag LOCUS_23200 21104 20295 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545500.1 protein_id gnl|my_center|LOCUS_23200 23968 21101 gene locus_tag LOCUS_23210 23968 21101 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858240.1 protein_id gnl|my_center|LOCUS_23210 24466 24086 gene locus_tag LOCUS_23220 24466 24086 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859143.1 protein_id gnl|my_center|LOCUS_23220 25305 24406 gene locus_tag LOCUS_23230 25305 24406 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852904.1 protein_id gnl|my_center|LOCUS_23230 26449 25295 gene locus_tag LOCUS_23240 26449 25295 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891906.1 protein_id gnl|my_center|LOCUS_23240 27993 26449 gene locus_tag LOCUS_23250 27993 26449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 28462 27974 gene locus_tag LOCUS_23260 gene lptE 28462 27974 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852685.1 protein_id gnl|my_center|LOCUS_23260 30944 28497 gene locus_tag LOCUS_23270 gene leuS 30944 28497 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_23270 31957 30986 gene locus_tag LOCUS_23280 gene secF 31957 30986 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_23280 33537 31957 gene locus_tag LOCUS_23290 gene secD 33537 31957 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_23290 33805 33530 gene locus_tag LOCUS_23300 gene yajC 33805 33530 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 protein_id gnl|my_center|LOCUS_23300 33970 35046 gene locus_tag LOCUS_23310 33970 35046 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237964.1 protein_id gnl|my_center|LOCUS_23310 36412 35075 gene locus_tag LOCUS_23320 gene metK 36412 35075 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852836.1 protein_id gnl|my_center|LOCUS_23320 37385 36492 gene locus_tag LOCUS_23330 37385 36492 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880900.1 protein_id gnl|my_center|LOCUS_23330 38058 37387 gene locus_tag LOCUS_23340 gene aat 38058 37387 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816030.1 protein_id gnl|my_center|LOCUS_23340 40260 38062 gene locus_tag LOCUS_23350 gene clpA 40260 38062 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_23350 40580 40272 gene locus_tag LOCUS_23360 40580 40272 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852892.1 protein_id gnl|my_center|LOCUS_23360 41192 40590 gene locus_tag LOCUS_23370 41192 40590 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852711.1 protein_id gnl|my_center|LOCUS_23370 41713 41249 gene locus_tag LOCUS_23380 gene smpB 41713 41249 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_23380 42482 41706 gene locus_tag LOCUS_23390 42482 41706 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 protein_id gnl|my_center|LOCUS_23390 42710 42483 gene locus_tag LOCUS_23400 42710 42483 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906447.1 protein_id gnl|my_center|LOCUS_23400 43539 42712 gene locus_tag LOCUS_23410 gene truB 43539 42712 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 protein_id gnl|my_center|LOCUS_23410 45588 43540 gene locus_tag LOCUS_23420 45588 43540 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_23420 45760 46671 gene locus_tag LOCUS_23430 45760 46671 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 protein_id gnl|my_center|LOCUS_23430 47127 46675 gene locus_tag LOCUS_23440 47127 46675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852822.1 protein_id gnl|my_center|LOCUS_23440 48841 47120 gene locus_tag LOCUS_23450 48841 47120 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891907.1 protein_id gnl|my_center|LOCUS_23450 49955 49083 gene locus_tag LOCUS_23460 49955 49083 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852714.1 protein_id gnl|my_center|LOCUS_23460 50066 50596 gene locus_tag LOCUS_23470 50066 50596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 51232 50558 gene locus_tag LOCUS_23480 gene bioD 51232 50558 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897490.1 protein_id gnl|my_center|LOCUS_23480 52080 51259 gene locus_tag LOCUS_23490 52080 51259 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 protein_id gnl|my_center|LOCUS_23490 52223 53386 gene locus_tag LOCUS_23500 52223 53386 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567842.1 protein_id gnl|my_center|LOCUS_23500 54242 53379 gene locus_tag LOCUS_23510 54242 53379 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_23510 54677 54321 gene locus_tag LOCUS_23520 gene rplS 54677 54321 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852307.1 protein_id gnl|my_center|LOCUS_23520 55392 54697 gene locus_tag LOCUS_23530 gene trmD 55392 54697 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868040.1 protein_id gnl|my_center|LOCUS_23530 55925 55389 gene locus_tag LOCUS_23540 gene rimM 55925 55389 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_23540 56163 55918 gene locus_tag LOCUS_23550 56163 55918 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852144.1 protein_id gnl|my_center|LOCUS_23550 56396 56166 gene locus_tag LOCUS_23560 gene rpsP 56396 56166 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852274.1 protein_id gnl|my_center|LOCUS_23560 57826 56486 gene locus_tag LOCUS_23570 gene ffh 57826 56486 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852163.1 protein_id gnl|my_center|LOCUS_23570 58647 57919 gene locus_tag LOCUS_23580 58647 57919 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852134.1 protein_id gnl|my_center|LOCUS_23580 59803 58631 gene locus_tag LOCUS_23590 gene waaA 59803 58631 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852277.1 protein_id gnl|my_center|LOCUS_23590 60527 59808 gene locus_tag LOCUS_23600 60527 59808 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_23600 61264 60542 gene locus_tag LOCUS_23610 61264 60542 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_23610 62117 61251 gene locus_tag LOCUS_23620 gene glyQ 62117 61251 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852069.1 protein_id gnl|my_center|LOCUS_23620 62637 62146 gene locus_tag LOCUS_23630 62637 62146 CDS product DUF3972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852251.1 protein_id gnl|my_center|LOCUS_23630 63143 62649 gene locus_tag LOCUS_23640 gene purE 63143 62649 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_23640 64414 63146 gene locus_tag LOCUS_23650 64414 63146 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077422.1 protein_id gnl|my_center|LOCUS_23650 65191 64415 gene locus_tag LOCUS_23660 65191 64415 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852254.1 protein_id gnl|my_center|LOCUS_23660 65314 66093 gene locus_tag LOCUS_23670 65314 66093 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_23670 66163 67593 gene locus_tag LOCUS_23680 gene glnA 66163 67593 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858636.1 protein_id gnl|my_center|LOCUS_23680 69571 67649 gene locus_tag LOCUS_23690 69571 67649 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858576.1 protein_id gnl|my_center|LOCUS_23690 70263 69568 gene locus_tag LOCUS_23700 70263 69568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 71351 70260 gene locus_tag LOCUS_23710 71351 70260 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491853.1 protein_id gnl|my_center|LOCUS_23710 71912 71361 gene locus_tag LOCUS_23720 71912 71361 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530196.1 protein_id gnl|my_center|LOCUS_23720 72412 71915 gene locus_tag LOCUS_23730 72412 71915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 74961 72412 gene locus_tag LOCUS_23740 gene alaS 74961 72412 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858583.1 protein_id gnl|my_center|LOCUS_23740 76956 75010 gene locus_tag LOCUS_23750 76956 75010 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_23750 77727 77035 gene locus_tag LOCUS_23760 77727 77035 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_23760 77842 78933 gene locus_tag LOCUS_23770 gene wlbC 77842 78933 CDS product O-antigen biosynthesis protein WlbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807112.1 protein_id gnl|my_center|LOCUS_23770 78937 79836 gene locus_tag LOCUS_23780 78937 79836 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088659.1 protein_id gnl|my_center|LOCUS_23780 79840 80775 gene locus_tag LOCUS_23790 gene hemH 79840 80775 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364269.1 protein_id gnl|my_center|LOCUS_23790 82553 80772 gene locus_tag LOCUS_23800 82553 80772 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858598.1 protein_id gnl|my_center|LOCUS_23800 82865 82566 gene locus_tag LOCUS_23810 82865 82566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 83363 82869 gene locus_tag LOCUS_23820 gene flgC 83363 82869 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858484.1 protein_id gnl|my_center|LOCUS_23820 83807 83373 gene locus_tag LOCUS_23830 gene flgB 83807 83373 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858492.1 protein_id gnl|my_center|LOCUS_23830 83978 85138 gene locus_tag LOCUS_23840 gene ftsW 83978 85138 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858324.1 protein_id gnl|my_center|LOCUS_23840 85135 86151 gene locus_tag LOCUS_23850 gene murG 85135 86151 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_23850 86162 86620 gene locus_tag LOCUS_23860 86162 86620 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_23860 86701 86625 gene locus_tag LOCUS_t00350 86701 86625 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 86768 87652 gene locus_tag LOCUS_23870 86768 87652 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_23870 88037 87645 gene locus_tag LOCUS_23880 88037 87645 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881179.1 protein_id gnl|my_center|LOCUS_23880 88417 88037 gene locus_tag LOCUS_23890 88417 88037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence10 1389 418 gene locus_tag LOCUS_23900 1389 418 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_23900 2225 1386 gene locus_tag LOCUS_23910 2225 1386 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015764.1 protein_id gnl|my_center|LOCUS_23910 3350 2229 gene locus_tag LOCUS_23920 3350 2229 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_23920 4344 3496 gene locus_tag LOCUS_23930 4344 3496 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015764.1 protein_id gnl|my_center|LOCUS_23930 5087 4341 gene locus_tag LOCUS_23940 5087 4341 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_23940 6157 5087 gene locus_tag LOCUS_23950 6157 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 6663 6160 gene locus_tag LOCUS_23960 gene wcaB 6663 6160 CDS product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097879.1 protein_id gnl|my_center|LOCUS_23960 6979 6665 gene locus_tag LOCUS_23970 6979 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 8220 6976 gene locus_tag LOCUS_23980 8220 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 9418 8225 gene locus_tag LOCUS_23990 9418 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 10983 9427 gene locus_tag LOCUS_24000 10983 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 11092 10973 gene locus_tag LOCUS_24010 11092 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 11877 11089 gene locus_tag LOCUS_24020 gene ptmA 11877 11089 CDS product flagellin modification protein PtmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857935.1 protein_id gnl|my_center|LOCUS_24020 12571 11870 gene locus_tag LOCUS_24030 gene legF 12571 11870 CDS product CMP-N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864263.1 protein_id gnl|my_center|LOCUS_24030 13476 12568 gene locus_tag LOCUS_24040 gene ptmF 13476 12568 CDS product L-glutamine-D-fructose-6-phosphate isomerase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860798.1 protein_id gnl|my_center|LOCUS_24040 14523 13477 gene locus_tag LOCUS_24050 14523 13477 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_24050 15688 14525 gene locus_tag LOCUS_24060 gene neuC 15688 14525 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_24060 16683 15685 gene locus_tag LOCUS_24070 gene legI 16683 15685 CDS product N,N'-diacetyllegionaminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864265.1 protein_id gnl|my_center|LOCUS_24070 17258 16680 gene locus_tag LOCUS_24080 17258 16680 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516588.1 protein_id gnl|my_center|LOCUS_24080 18391 17255 gene locus_tag LOCUS_24090 18391 17255 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 protein_id gnl|my_center|LOCUS_24090 19583 18393 gene locus_tag LOCUS_24100 19583 18393 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261000.1 protein_id gnl|my_center|LOCUS_24100 20012 19689 gene locus_tag LOCUS_24110 20012 19689 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340715.1 protein_id gnl|my_center|LOCUS_24110 21026 20046 gene locus_tag LOCUS_24120 21026 20046 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_24120 22137 21019 gene locus_tag LOCUS_24130 gene gmd 22137 21019 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036868.1 protein_id gnl|my_center|LOCUS_24130 23465 22134 gene locus_tag LOCUS_24140 23465 22134 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694809.1 protein_id gnl|my_center|LOCUS_24140 24477 23458 gene locus_tag LOCUS_24150 gene galE 24477 23458 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858414.1 protein_id gnl|my_center|LOCUS_24150 25483 24467 gene locus_tag LOCUS_24160 25483 24467 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_24160 26635 25559 gene locus_tag LOCUS_24170 26635 25559 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_24170 27611 26658 gene locus_tag LOCUS_24180 27611 26658 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202927.1 protein_id gnl|my_center|LOCUS_24180 28465 27608 gene locus_tag LOCUS_24190 28465 27608 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_24190 29190 28462 gene locus_tag LOCUS_24200 29190 28462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 29995 29201 gene locus_tag LOCUS_24210 29995 29201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 30867 29992 gene locus_tag LOCUS_24220 gene wapR 30867 29992 CDS product alpha-1,3-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_24220 32050 30854 gene locus_tag LOCUS_24230 32050 30854 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036849.1 protein_id gnl|my_center|LOCUS_24230 33410 32151 gene locus_tag LOCUS_24240 gene tviB 33410 32151 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_24240 34126 33419 gene locus_tag LOCUS_24250 34126 33419 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851175.1 protein_id gnl|my_center|LOCUS_24250 35253 34237 gene locus_tag LOCUS_24260 gene rfbB 35253 34237 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946495.1 protein_id gnl|my_center|LOCUS_24260 36118 35255 gene locus_tag LOCUS_24270 gene rfbA 36118 35255 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 protein_id gnl|my_center|LOCUS_24270 37490 36120 gene locus_tag LOCUS_24280 37490 36120 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355104.1 protein_id gnl|my_center|LOCUS_24280 38275 37487 gene locus_tag LOCUS_24290 38275 37487 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853812.1 protein_id gnl|my_center|LOCUS_24290 38474 39229 gene locus_tag LOCUS_24300 38474 39229 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_24300 39226 40119 gene locus_tag LOCUS_24310 39226 40119 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_24310 40116 41201 gene locus_tag LOCUS_24320 40116 41201 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_24320 41198 42190 gene locus_tag LOCUS_24330 41198 42190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 42202 43422 gene locus_tag LOCUS_24340 42202 43422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 43423 44490 gene locus_tag LOCUS_24350 43423 44490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 44487 44885 gene locus_tag LOCUS_24360 44487 44885 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_24360 44882 46087 gene locus_tag LOCUS_24370 44882 46087 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203397.1 protein_id gnl|my_center|LOCUS_24370 46084 47193 gene locus_tag LOCUS_24380 46084 47193 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679043.1 protein_id gnl|my_center|LOCUS_24380 47223 48662 gene locus_tag LOCUS_24390 47223 48662 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_24390 48671 49648 gene locus_tag LOCUS_24400 48671 49648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 49675 50649 gene locus_tag LOCUS_24410 49675 50649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 50651 51520 gene locus_tag LOCUS_24420 gene rfbD 50651 51520 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_24420 51517 52068 gene locus_tag LOCUS_24430 gene rfbC 51517 52068 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761514.1 protein_id gnl|my_center|LOCUS_24430 52069 53511 gene locus_tag LOCUS_24440 52069 53511 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_24440 53521 54585 gene locus_tag LOCUS_24450 53521 54585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963531.1 protein_id gnl|my_center|LOCUS_24450 54683 55435 gene locus_tag LOCUS_24460 54683 55435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395772.1 protein_id gnl|my_center|LOCUS_24460 56459 55440 gene locus_tag LOCUS_24470 56459 55440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 57018 56491 gene locus_tag LOCUS_24480 gene gmhA 57018 56491 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351733.1 protein_id gnl|my_center|LOCUS_24480 57726 57019 gene locus_tag LOCUS_24490 57726 57019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 57874 58170 gene locus_tag LOCUS_24500 57874 58170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 58460 58221 gene locus_tag LOCUS_24510 gene ccoS 58460 58221 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090949.1 protein_id gnl|my_center|LOCUS_24510 60892 58460 gene locus_tag LOCUS_24520 60892 58460 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891913.1 protein_id gnl|my_center|LOCUS_24520 61096 62550 gene locus_tag LOCUS_24530 61096 62550 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_24530 62562 62723 gene locus_tag LOCUS_24540 62562 62723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 62833 64260 gene locus_tag LOCUS_24550 62833 64260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 65128 64247 gene locus_tag LOCUS_24560 65128 64247 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_24560 65200 67677 gene locus_tag LOCUS_24570 65200 67677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 67754 68287 gene locus_tag LOCUS_24580 gene tpx 67754 68287 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852593.1 protein_id gnl|my_center|LOCUS_24580 68592 68332 gene locus_tag LOCUS_24590 68592 68332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 69263 68589 gene locus_tag LOCUS_24600 gene pgeF 69263 68589 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080213.1 protein_id gnl|my_center|LOCUS_24600 69871 69263 gene locus_tag LOCUS_24610 69871 69263 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 protein_id gnl|my_center|LOCUS_24610 70024 71976 gene locus_tag LOCUS_24620 70024 71976 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073766.1 protein_id gnl|my_center|LOCUS_24620 72883 71966 gene locus_tag LOCUS_24630 72883 71966 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479770.1 protein_id gnl|my_center|LOCUS_24630 73563 72880 gene locus_tag LOCUS_24640 73563 72880 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_24640 74291 73560 gene locus_tag LOCUS_24650 74291 73560 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 protein_id gnl|my_center|LOCUS_24650 75622 74288 gene locus_tag LOCUS_24660 75622 74288 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089911.1 protein_id gnl|my_center|LOCUS_24660 76100 75612 gene locus_tag LOCUS_24670 76100 75612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 77056 76100 gene locus_tag LOCUS_24680 77056 76100 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811594.1 protein_id gnl|my_center|LOCUS_24680 77817 77137 gene locus_tag LOCUS_24690 77817 77137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 79698 77821 gene locus_tag LOCUS_24700 79698 77821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 79806 81671 gene locus_tag LOCUS_24710 gene mnmG 79806 81671 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864546.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence11 798 1676 gene locus_tag LOCUS_24720 798 1676 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_24720 1676 3007 gene locus_tag LOCUS_24730 1676 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24730 3004 3396 gene locus_tag LOCUS_24740 3004 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24740 3539 3417 gene locus_tag LOCUS_24750 3539 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 4672 3548 gene locus_tag LOCUS_24760 gene cydB 4672 3548 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851984.1 protein_id gnl|my_center|LOCUS_24760 6200 4665 gene locus_tag LOCUS_24770 6200 4665 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_24770 6421 6212 gene locus_tag LOCUS_24780 6421 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 6589 7203 gene locus_tag LOCUS_24790 6589 7203 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528636.1 protein_id gnl|my_center|LOCUS_24790 7806 7228 gene locus_tag LOCUS_24800 7806 7228 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393578.1 protein_id gnl|my_center|LOCUS_24800 8334 7882 gene locus_tag LOCUS_24810 8334 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 8768 8331 gene locus_tag LOCUS_24820 8768 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 8982 10478 gene locus_tag LOCUS_24830 8982 10478 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_24830 10533 10898 gene locus_tag LOCUS_24840 10533 10898 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_24840 11281 11745 gene locus_tag LOCUS_24850 11281 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 13762 12806 gene locus_tag LOCUS_24860 13762 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 14020 13763 gene locus_tag LOCUS_24870 14020 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 14337 14020 gene locus_tag LOCUS_24880 14337 14020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 14582 14334 gene locus_tag LOCUS_24890 14582 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 14972 14769 gene locus_tag LOCUS_24900 14972 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 15956 15078 gene locus_tag LOCUS_24910 15956 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 17203 15953 gene locus_tag LOCUS_24920 17203 15953 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129562.1 protein_id gnl|my_center|LOCUS_24920 17491 17395 gene locus_tag LOCUS_t00360 17491 17395 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 17584 18183 gene locus_tag LOCUS_24930 17584 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 18833 18180 gene locus_tag LOCUS_24940 gene dccR 18833 18180 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_24940 20680 18830 gene locus_tag LOCUS_24950 20680 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 21850 20801 gene locus_tag LOCUS_24960 gene ansB 21850 20801 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707533.1 protein_id gnl|my_center|LOCUS_24960 23193 21892 gene locus_tag LOCUS_24970 23193 21892 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 protein_id gnl|my_center|LOCUS_24970 24688 23258 gene locus_tag LOCUS_24980 gene aspA 24688 23258 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_24980 26265 24841 gene locus_tag LOCUS_24990 gene aspA 26265 24841 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_24990 27027 26353 gene locus_tag LOCUS_25000 27027 26353 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_25000 28045 27020 gene locus_tag LOCUS_25010 28045 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 28381 29706 gene locus_tag LOCUS_25020 28381 29706 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_25020 29948 30592 gene locus_tag LOCUS_25030 29948 30592 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073981.1 protein_id gnl|my_center|LOCUS_25030 30589 32544 gene locus_tag LOCUS_25040 30589 32544 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_25040 32548 34707 gene locus_tag LOCUS_25050 32548 34707 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_25050 34704 36032 gene locus_tag LOCUS_25060 34704 36032 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_25060 36035 36646 gene locus_tag LOCUS_25070 36035 36646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 36729 47036 gene locus_tag LOCUS_25080 36729 47036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 47159 47770 gene locus_tag LOCUS_25090 47159 47770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 47767 48423 gene locus_tag LOCUS_25100 47767 48423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 49261 48503 gene locus_tag LOCUS_25110 49261 48503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25110 50580 49261 gene locus_tag LOCUS_25120 50580 49261 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943575.1 protein_id gnl|my_center|LOCUS_25120 50834 51601 gene locus_tag LOCUS_25130 50834 51601 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002836742.1 protein_id gnl|my_center|LOCUS_25130 51654 53435 gene locus_tag LOCUS_25140 51654 53435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 53432 53770 gene locus_tag LOCUS_25150 53432 53770 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532857.1 protein_id gnl|my_center|LOCUS_25150 54390 53767 gene locus_tag LOCUS_25160 gene rhtB 54390 53767 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351233.1 protein_id gnl|my_center|LOCUS_25160 55161 54451 gene locus_tag LOCUS_25170 55161 54451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_25170 56299 55163 gene locus_tag LOCUS_25180 56299 55163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_25180 57441 56296 gene locus_tag LOCUS_25190 57441 56296 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_25190 58715 57438 gene locus_tag LOCUS_25200 58715 57438 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930700.1 protein_id gnl|my_center|LOCUS_25200 59440 58781 gene locus_tag LOCUS_25210 gene nssR 59440 58781 CDS product nitrosative stress-sensitive transcriptional regulator NssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851096.1 protein_id gnl|my_center|LOCUS_25210 59791 59495 gene locus_tag LOCUS_25220 59791 59495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 60357 59923 gene locus_tag LOCUS_25230 60357 59923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence12 243 713 gene locus_tag LOCUS_25240 243 713 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_25240 798 721 gene locus_tag LOCUS_t00370 798 721 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 885 2396 gene locus_tag LOCUS_25250 885 2396 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 protein_id gnl|my_center|LOCUS_25250 2423 3133 gene locus_tag LOCUS_25260 2423 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882802.1 protein_id gnl|my_center|LOCUS_25260 3188 4291 gene locus_tag LOCUS_25270 gene trmA 3188 4291 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224986.1 protein_id gnl|my_center|LOCUS_25270 5497 4316 gene locus_tag LOCUS_25280 5497 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 5631 6068 gene locus_tag LOCUS_25290 5631 6068 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858783.1 protein_id gnl|my_center|LOCUS_25290 6065 7276 gene locus_tag LOCUS_25300 gene ilvA 6065 7276 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_25300 7739 7293 gene locus_tag LOCUS_25310 7739 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 8509 7763 gene locus_tag LOCUS_25320 8509 7763 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262110.1 protein_id gnl|my_center|LOCUS_25320 9603 8518 gene locus_tag LOCUS_25330 9603 8518 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_25330 10763 9606 gene locus_tag LOCUS_25340 10763 9606 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103488.1 protein_id gnl|my_center|LOCUS_25340 11868 10843 gene locus_tag LOCUS_25350 11868 10843 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_25350 12872 11988 gene locus_tag LOCUS_25360 gene rarD 12872 11988 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012532645.1 protein_id gnl|my_center|LOCUS_25360 12951 14315 gene locus_tag LOCUS_25370 12951 14315 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104160.1 protein_id gnl|my_center|LOCUS_25370 14457 14873 gene locus_tag LOCUS_25380 14457 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 15448 14879 gene locus_tag LOCUS_25390 15448 14879 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272311.1 protein_id gnl|my_center|LOCUS_25390 16680 15445 gene locus_tag LOCUS_25400 16680 15445 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_25400 16795 17748 gene locus_tag LOCUS_25410 16795 17748 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856867.1 protein_id gnl|my_center|LOCUS_25410 17763 20633 gene locus_tag LOCUS_25420 17763 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 20638 21342 gene locus_tag LOCUS_25430 20638 21342 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864161.1 protein_id gnl|my_center|LOCUS_25430 21324 21707 gene locus_tag LOCUS_25440 21324 21707 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864630.1 protein_id gnl|my_center|LOCUS_25440 21746 22945 gene locus_tag LOCUS_25450 21746 22945 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855132.1 protein_id gnl|my_center|LOCUS_25450 22942 23730 gene locus_tag LOCUS_25460 gene trpC 22942 23730 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854779.1 protein_id gnl|my_center|LOCUS_25460 23730 24221 gene locus_tag LOCUS_25470 23730 24221 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 protein_id gnl|my_center|LOCUS_25470 24215 25231 gene locus_tag LOCUS_25480 gene mnmH 24215 25231 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858496.1 protein_id gnl|my_center|LOCUS_25480 25369 27225 gene locus_tag LOCUS_25490 25369 27225 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073602.1 protein_id gnl|my_center|LOCUS_25490 28140 27388 gene locus_tag LOCUS_25500 28140 27388 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023915.1 protein_id gnl|my_center|LOCUS_25500 28612 28133 gene locus_tag LOCUS_25510 28612 28133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 28952 28671 gene locus_tag LOCUS_25520 28952 28671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 29599 28949 gene locus_tag LOCUS_25530 gene cbiM 29599 28949 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584114.1 protein_id gnl|my_center|LOCUS_25530 30635 29703 gene locus_tag LOCUS_25540 gene pdxA 30635 29703 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075036.1 protein_id gnl|my_center|LOCUS_25540 31411 30632 gene locus_tag LOCUS_25550 31411 30632 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_25550 31539 31907 gene locus_tag LOCUS_25560 31539 31907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 32313 31909 gene locus_tag LOCUS_25570 32313 31909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 33345 32431 gene locus_tag LOCUS_25580 33345 32431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 33995 33621 gene locus_tag LOCUS_25590 33995 33621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 35501 34032 gene locus_tag LOCUS_25600 35501 34032 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_25600 35705 35926 gene locus_tag LOCUS_25610 35705 35926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 35933 36838 gene locus_tag LOCUS_25620 35933 36838 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853555.1 protein_id gnl|my_center|LOCUS_25620 36952 38643 gene locus_tag LOCUS_25630 36952 38643 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852093.1 protein_id gnl|my_center|LOCUS_25630 38647 39117 gene locus_tag LOCUS_25640 gene ilvN 38647 39117 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852211.1 protein_id gnl|my_center|LOCUS_25640 39117 40070 gene locus_tag LOCUS_25650 gene lpxD 39117 40070 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852180.1 protein_id gnl|my_center|LOCUS_25650 40082 40330 gene locus_tag LOCUS_25660 40082 40330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 41564 40368 gene locus_tag LOCUS_25670 41564 40368 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_25670 42850 41672 gene locus_tag LOCUS_25680 42850 41672 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852601.1 protein_id gnl|my_center|LOCUS_25680 43630 42914 gene locus_tag LOCUS_25690 43630 42914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 45471 43627 gene locus_tag LOCUS_25700 gene speA 45471 43627 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891885.1 protein_id gnl|my_center|LOCUS_25700 46691 45483 gene locus_tag LOCUS_25710 gene hisS 46691 45483 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 protein_id gnl|my_center|LOCUS_25710 47268 46684 gene locus_tag LOCUS_25720 gene tmk 47268 46684 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852526.1 protein_id gnl|my_center|LOCUS_25720 47744 47259 gene locus_tag LOCUS_25730 gene coaD 47744 47259 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852633.1 protein_id gnl|my_center|LOCUS_25730 48274 47732 gene locus_tag LOCUS_25740 48274 47732 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780126.1 protein_id gnl|my_center|LOCUS_25740 49275 48271 gene locus_tag LOCUS_25750 49275 48271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 49253 49179 gene locus_tag LOCUS_t00380 49253 49179 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50976 49351 gene locus_tag LOCUS_25760 50976 49351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 52282 51044 gene locus_tag LOCUS_25770 52282 51044 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856962.1 protein_id gnl|my_center|LOCUS_25770 53548 52286 gene locus_tag LOCUS_25780 gene murA 53548 52286 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857102.1 protein_id gnl|my_center|LOCUS_25780 53664 55562 gene locus_tag LOCUS_25790 53664 55562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence13 381 1430 gene locus_tag LOCUS_25800 381 1430 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_25800 1431 2441 gene locus_tag LOCUS_25810 gene citC 1431 2441 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227743.1 protein_id gnl|my_center|LOCUS_25810 2487 2786 gene locus_tag LOCUS_25820 gene citD 2487 2786 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684015.1 protein_id gnl|my_center|LOCUS_25820 2783 3682 gene locus_tag LOCUS_25830 gene citE 2783 3682 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164137.1 protein_id gnl|my_center|LOCUS_25830 3679 5178 gene locus_tag LOCUS_25840 gene citF 3679 5178 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192347.1 protein_id gnl|my_center|LOCUS_25840 5236 6516 gene locus_tag LOCUS_25850 gene citG 5236 6516 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_25850 6591 7160 gene locus_tag LOCUS_25860 6591 7160 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 protein_id gnl|my_center|LOCUS_25860 7157 8347 gene locus_tag LOCUS_25870 7157 8347 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_25870 8360 9052 gene locus_tag LOCUS_25880 8360 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence14 79 4 gene locus_tag LOCUS_t00390 79 4 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1312 122 gene locus_tag LOCUS_25890 gene murD 1312 122 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_25890 2422 1358 gene locus_tag LOCUS_25900 gene mraY 2422 1358 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 protein_id gnl|my_center|LOCUS_25900 2514 3995 gene locus_tag LOCUS_25910 gene gpmI 2514 3995 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057737.1 protein_id gnl|my_center|LOCUS_25910 4014 4757 gene locus_tag LOCUS_25920 gene fabG 4014 4757 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_25920 4837 5067 gene locus_tag LOCUS_25930 gene acpP 4837 5067 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854831.1 protein_id gnl|my_center|LOCUS_25930 5146 6354 gene locus_tag LOCUS_25940 5146 6354 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 protein_id gnl|my_center|LOCUS_25940 6364 7302 gene locus_tag LOCUS_25950 gene accA 6364 7302 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_25950 7747 7340 gene locus_tag LOCUS_25960 7747 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence15 1434 172 gene locus_tag LOCUS_25970 1434 172 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 protein_id gnl|my_center|LOCUS_25970 2981 1554 gene locus_tag LOCUS_25980 2981 1554 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431748.1 protein_id gnl|my_center|LOCUS_25980 4100 3099 gene locus_tag LOCUS_25990 4100 3099 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_25990 4263 5822 gene locus_tag LOCUS_26000 4263 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 6499 5819 gene locus_tag LOCUS_26010 6499 5819 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence16 <1 561 gene locus_tag LOCUS_26020 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038439.1:glycosyltransferase 558 1550 gene locus_tag LOCUS_26030 558 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1622 2782 gene locus_tag LOCUS_26040 1622 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040