>Feature sequence001 2753 225 gene locus_tag LOCUS_00010 2753 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3979 2813 gene locus_tag LOCUS_00020 gene dprA 3979 2813 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_00020 5005 8631 gene locus_tag LOCUS_00030 5005 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 9915 8665 gene locus_tag LOCUS_00040 9915 8665 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921627.1 protein_id gnl|my_center|LOCUS_00040 12236 10383 gene locus_tag LOCUS_00050 12236 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 12780 12346 gene locus_tag LOCUS_00060 gene rlmH 12780 12346 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_00060 13958 12780 gene locus_tag LOCUS_00070 13958 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 15682 13955 gene locus_tag LOCUS_00080 15682 13955 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_00080 16415 15927 gene locus_tag LOCUS_00090 16415 15927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 16497 16422 gene locus_tag LOCUS_t00010 16497 16422 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17267 18151 gene locus_tag LOCUS_00100 17267 18151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 18246 18923 gene locus_tag LOCUS_00110 18246 18923 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_00110 18982 22230 gene locus_tag LOCUS_00120 18982 22230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 22470 22793 gene locus_tag LOCUS_00130 gene trxA 22470 22793 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 protein_id gnl|my_center|LOCUS_00130 22920 23183 gene locus_tag LOCUS_00140 gene rpsT 22920 23183 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274011.1 protein_id gnl|my_center|LOCUS_00140 23311 23961 gene locus_tag LOCUS_00150 gene lipB 23311 23961 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_00150 23961 24428 gene locus_tag LOCUS_00160 23961 24428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 24697 25527 gene locus_tag LOCUS_00170 gene accD 24697 25527 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_00170 25565 26377 gene locus_tag LOCUS_00180 25565 26377 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228903.1 protein_id gnl|my_center|LOCUS_00180 26532 27644 gene locus_tag LOCUS_00190 26532 27644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 27907 27722 gene locus_tag LOCUS_00200 27907 27722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28248 28484 gene locus_tag LOCUS_00210 28248 28484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29895 28585 gene locus_tag LOCUS_00220 29895 28585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30061 31542 gene locus_tag LOCUS_00230 gene rseP 30061 31542 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680259.1 protein_id gnl|my_center|LOCUS_00230 31539 32618 gene locus_tag LOCUS_00240 gene ispG 31539 32618 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_00240 33684 32833 gene locus_tag LOCUS_00250 33684 32833 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_00250 33940 34767 gene locus_tag LOCUS_00260 33940 34767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 34749 36077 gene locus_tag LOCUS_00270 34749 36077 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_00270 36074 37153 gene locus_tag LOCUS_00280 gene tsaD 36074 37153 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_00280 37239 38315 gene locus_tag LOCUS_00290 37239 38315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 38444 38707 gene locus_tag LOCUS_00300 38444 38707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 38776 39063 gene locus_tag LOCUS_00310 38776 39063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39117 39635 gene locus_tag LOCUS_00320 39117 39635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 39705 40319 gene locus_tag LOCUS_00330 39705 40319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40385 41944 gene locus_tag LOCUS_00340 40385 41944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 42052 42210 gene locus_tag LOCUS_00350 42052 42210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42432 43028 gene locus_tag LOCUS_00360 42432 43028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43021 43407 gene locus_tag LOCUS_00370 43021 43407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43404 44189 gene locus_tag LOCUS_00380 43404 44189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44529 46121 gene locus_tag LOCUS_00390 44529 46121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 46579 48348 gene locus_tag LOCUS_00400 46579 48348 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258273.1 protein_id gnl|my_center|LOCUS_00400 48679 49170 gene locus_tag LOCUS_00410 48679 49170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49749 52280 gene locus_tag LOCUS_00420 49749 52280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52315 55248 gene locus_tag LOCUS_00430 52315 55248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 55345 56679 gene locus_tag LOCUS_00440 55345 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 56712 57041 gene locus_tag LOCUS_00450 56712 57041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 57079 57495 gene locus_tag LOCUS_00460 57079 57495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 57686 57970 gene locus_tag LOCUS_00470 57686 57970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 57967 58386 gene locus_tag LOCUS_00480 57967 58386 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_00480 58853 60079 gene locus_tag LOCUS_00490 58853 60079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60137 61942 gene locus_tag LOCUS_00500 60137 61942 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_00500 62174 63514 gene locus_tag LOCUS_00510 gene gdhA 62174 63514 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_00510 63895 64878 gene locus_tag LOCUS_00520 63895 64878 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_00520 65263 64883 gene locus_tag LOCUS_00530 65263 64883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 66588 65266 gene locus_tag LOCUS_00540 66588 65266 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615609.1 protein_id gnl|my_center|LOCUS_00540 66956 66585 gene locus_tag LOCUS_00550 66956 66585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 70096 66956 gene locus_tag LOCUS_00560 70096 66956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 70712 70122 gene locus_tag LOCUS_00570 70712 70122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 73718 70827 gene locus_tag LOCUS_00580 73718 70827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 75099 73831 gene locus_tag LOCUS_00590 75099 73831 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_00590 76456 75749 gene locus_tag LOCUS_00600 76456 75749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 76610 77839 gene locus_tag LOCUS_00610 76610 77839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533119.1 protein_id gnl|my_center|LOCUS_00610 79404 78058 gene locus_tag LOCUS_00620 79404 78058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 81460 80078 gene locus_tag LOCUS_00630 81460 80078 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_00630 82037 85186 gene locus_tag LOCUS_00640 gene ileS 82037 85186 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_00640 85190 85492 gene locus_tag LOCUS_00650 85190 85492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 86103 85471 gene locus_tag LOCUS_00660 86103 85471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 86095 86277 gene locus_tag LOCUS_00670 86095 86277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 86695 87699 gene locus_tag LOCUS_00680 gene argF 86695 87699 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869677.1 protein_id gnl|my_center|LOCUS_00680 87854 88933 gene locus_tag LOCUS_00690 gene pyrB 87854 88933 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 protein_id gnl|my_center|LOCUS_00690 89118 89567 gene locus_tag LOCUS_00700 89118 89567 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_00700 89588 90148 gene locus_tag LOCUS_00710 gene nuoE 89588 90148 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00710 90145 93288 gene locus_tag LOCUS_00720 90145 93288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 93736 95529 gene locus_tag LOCUS_00730 93736 95529 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00730 97480 95861 gene locus_tag LOCUS_00740 97480 95861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 97796 99049 gene locus_tag LOCUS_00750 97796 99049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 99520 101106 gene locus_tag LOCUS_00760 99520 101106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 101239 102909 gene locus_tag LOCUS_00770 101239 102909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 102936 103442 gene locus_tag LOCUS_00780 102936 103442 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296548.1 protein_id gnl|my_center|LOCUS_00780 103626 103725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 104035 106206 gene locus_tag LOCUS_00790 104035 106206 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_00790 106523 108376 gene locus_tag LOCUS_00800 106523 108376 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_00800 108448 109272 gene locus_tag LOCUS_00810 108448 109272 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967055.1 protein_id gnl|my_center|LOCUS_00810 109889 110461 gene locus_tag LOCUS_00820 109889 110461 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674830.1 protein_id gnl|my_center|LOCUS_00820 111159 110551 gene locus_tag LOCUS_00830 gene pgsA 111159 110551 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419911.1 protein_id gnl|my_center|LOCUS_00830 111892 112344 gene locus_tag LOCUS_00840 111892 112344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 113050 112643 gene locus_tag LOCUS_00850 113050 112643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 113888 113022 gene locus_tag LOCUS_00860 113888 113022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 122387 113892 gene locus_tag LOCUS_00870 122387 113892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 123398 122400 gene locus_tag LOCUS_00880 123398 122400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 125211 123451 gene locus_tag LOCUS_00890 125211 123451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 125611 125336 gene locus_tag LOCUS_00900 125611 125336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 126098 125799 gene locus_tag LOCUS_00910 126098 125799 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_00910 126317 126102 gene locus_tag LOCUS_00920 126317 126102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 127004 126504 gene locus_tag LOCUS_00930 127004 126504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 134432 127548 gene locus_tag LOCUS_00940 134432 127548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 134679 135293 gene locus_tag LOCUS_00950 134679 135293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 135293 136717 gene locus_tag LOCUS_00960 135293 136717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 136821 138194 gene locus_tag LOCUS_00970 136821 138194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 138194 138865 gene locus_tag LOCUS_00980 138194 138865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 138868 140361 gene locus_tag LOCUS_00990 138868 140361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 140641 141885 gene locus_tag LOCUS_01000 140641 141885 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460314.1 protein_id gnl|my_center|LOCUS_01000 142401 142889 gene locus_tag LOCUS_01010 142401 142889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 142897 144564 gene locus_tag LOCUS_01020 142897 144564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 144819 145856 gene locus_tag LOCUS_01030 144819 145856 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_01030 146887 146123 gene locus_tag LOCUS_01040 146887 146123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 147849 146884 gene locus_tag LOCUS_01050 147849 146884 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926960.1 protein_id gnl|my_center|LOCUS_01050 148922 148164 gene locus_tag LOCUS_01060 148922 148164 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932610.1 protein_id gnl|my_center|LOCUS_01060 149973 149014 gene locus_tag LOCUS_01070 149973 149014 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_01070 152481 150079 gene locus_tag LOCUS_01080 152481 150079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 152622 152825 gene locus_tag LOCUS_01090 152622 152825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 153774 152857 gene locus_tag LOCUS_01100 gene epmA 153774 152857 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_01100 155384 153984 gene locus_tag LOCUS_01110 155384 153984 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence002 566 1726 gene locus_tag LOCUS_01120 566 1726 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143816.1 protein_id gnl|my_center|LOCUS_01120 2001 2783 gene locus_tag LOCUS_01130 2001 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 3595 2939 gene locus_tag LOCUS_01140 3595 2939 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_01140 4887 3592 gene locus_tag LOCUS_01150 4887 3592 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_01150 5258 6586 gene locus_tag LOCUS_01160 gene xylA 5258 6586 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_01160 7019 9103 gene locus_tag LOCUS_01170 gene fusA 7019 9103 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_01170 10738 9503 gene locus_tag LOCUS_01180 gene hydF 10738 9503 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964958.1 protein_id gnl|my_center|LOCUS_01180 11595 10741 gene locus_tag LOCUS_01190 11595 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 12697 14511 gene locus_tag LOCUS_01200 gene yidC 12697 14511 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_01200 14523 15971 gene locus_tag LOCUS_01210 14523 15971 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393930.1 protein_id gnl|my_center|LOCUS_01210 16290 17072 gene locus_tag LOCUS_01220 16290 17072 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_01220 17211 20897 gene locus_tag LOCUS_01230 17211 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 21790 22929 gene locus_tag LOCUS_01240 21790 22929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_01240 23128 23826 gene locus_tag LOCUS_01250 23128 23826 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_01250 23823 24863 gene locus_tag LOCUS_01260 23823 24863 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_01260 24904 25524 gene locus_tag LOCUS_01270 24904 25524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 26037 26543 gene locus_tag LOCUS_01280 26037 26543 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970153.1 protein_id gnl|my_center|LOCUS_01280 26791 27108 gene locus_tag LOCUS_01290 26791 27108 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 protein_id gnl|my_center|LOCUS_01290 28430 27552 gene locus_tag LOCUS_01300 28430 27552 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108351.1 protein_id gnl|my_center|LOCUS_01300 30071 28629 gene locus_tag LOCUS_01310 30071 28629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 30825 30235 gene locus_tag LOCUS_01320 30825 30235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 32584 31136 gene locus_tag LOCUS_01330 gene htrA 32584 31136 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873435.1 protein_id gnl|my_center|LOCUS_01330 33078 33278 gene locus_tag LOCUS_01340 33078 33278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 35373 34342 gene locus_tag LOCUS_01350 gene lpxD 35373 34342 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191858.1 protein_id gnl|my_center|LOCUS_01350 35955 35377 gene locus_tag LOCUS_01360 35955 35377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 38575 36227 gene locus_tag LOCUS_01370 gene bamA 38575 36227 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_01370 38917 39906 gene locus_tag LOCUS_01380 38917 39906 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_01380 40201 40422 gene locus_tag LOCUS_01390 40201 40422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 42276 41260 gene locus_tag LOCUS_01400 42276 41260 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392580.1 protein_id gnl|my_center|LOCUS_01400 43935 42352 gene locus_tag LOCUS_01410 43935 42352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 44354 43956 gene locus_tag LOCUS_01420 44354 43956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 45785 45111 gene locus_tag LOCUS_01430 gene lolD 45785 45111 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033709.1 protein_id gnl|my_center|LOCUS_01430 47070 45844 gene locus_tag LOCUS_01440 47070 45844 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_01440 48930 47347 gene locus_tag LOCUS_01450 48930 47347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 49355 48951 gene locus_tag LOCUS_01460 49355 48951 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_01460 49813 49376 gene locus_tag LOCUS_01470 49813 49376 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_01470 50700 49972 gene locus_tag LOCUS_01480 50700 49972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 51635 50859 gene locus_tag LOCUS_01490 51635 50859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 54746 51708 gene locus_tag LOCUS_01500 54746 51708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 55964 57100 gene locus_tag LOCUS_01510 55964 57100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 57754 58983 gene locus_tag LOCUS_01520 57754 58983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 62280 59185 gene locus_tag LOCUS_01530 62280 59185 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108144.1 protein_id gnl|my_center|LOCUS_01530 67465 62711 gene locus_tag LOCUS_01540 67465 62711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 67715 67467 gene locus_tag LOCUS_01550 67715 67467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 69810 67843 gene locus_tag LOCUS_01560 69810 67843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 70117 78771 gene locus_tag LOCUS_01570 70117 78771 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_01570 80477 79461 gene locus_tag LOCUS_01580 gene galE 80477 79461 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_01580 83148 80626 gene locus_tag LOCUS_01590 gene hrpB 83148 80626 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968081.1 protein_id gnl|my_center|LOCUS_01590 84980 83655 gene locus_tag LOCUS_01600 84980 83655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 86353 85052 gene locus_tag LOCUS_01610 86353 85052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 87280 86357 gene locus_tag LOCUS_01620 87280 86357 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_01620 88422 87727 gene locus_tag LOCUS_01630 88422 87727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 90019 88466 gene locus_tag LOCUS_01640 90019 88466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 90002 90628 gene locus_tag LOCUS_01650 gene lexA 90002 90628 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036298.1 protein_id gnl|my_center|LOCUS_01650 91416 92690 gene locus_tag LOCUS_01660 gene dinB 91416 92690 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_01660 92815 93996 gene locus_tag LOCUS_01670 92815 93996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 94809 94402 gene locus_tag LOCUS_01680 94809 94402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 96666 95263 gene locus_tag LOCUS_01690 gene orpR 96666 95263 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_01690 97278 98426 gene locus_tag LOCUS_01700 97278 98426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 98971 100557 gene locus_tag LOCUS_01710 98971 100557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 100763 101038 gene locus_tag LOCUS_01720 100763 101038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 101157 103727 gene locus_tag LOCUS_01730 101157 103727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 103866 104312 gene locus_tag LOCUS_01740 103866 104312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 104425 104883 gene locus_tag LOCUS_01750 104425 104883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 105549 105473 gene locus_tag LOCUS_t00020 105549 105473 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 105643 105567 gene locus_tag LOCUS_t00030 105643 105567 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 107541 105691 gene locus_tag LOCUS_01760 107541 105691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 109034 107541 gene locus_tag LOCUS_01770 109034 107541 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_01770 109794 109054 gene locus_tag LOCUS_01780 109794 109054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 110552 109791 gene locus_tag LOCUS_01790 110552 109791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 112515 111169 gene locus_tag LOCUS_01800 112515 111169 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_01800 112955 112533 gene locus_tag LOCUS_01810 112955 112533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 115604 113550 gene locus_tag LOCUS_01820 gene feoB 115604 113550 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_01820 116464 115604 gene locus_tag LOCUS_01830 116464 115604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 119687 117042 gene locus_tag LOCUS_01840 119687 117042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 125744 119919 gene locus_tag LOCUS_01850 125744 119919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 126755 125937 gene locus_tag LOCUS_01860 gene truA 126755 125937 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_01860 127003 128097 gene locus_tag LOCUS_01870 127003 128097 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_01870 128162 129484 gene locus_tag LOCUS_01880 128162 129484 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_01880 129658 132024 gene locus_tag LOCUS_01890 129658 132024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 132298 133914 gene locus_tag LOCUS_01900 gene pgi 132298 133914 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_01900 133938 134489 gene locus_tag LOCUS_01910 gene rfbC 133938 134489 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 protein_id gnl|my_center|LOCUS_01910 134606 136384 gene locus_tag LOCUS_01920 gene iorA 134606 136384 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_01920 136407 136997 gene locus_tag LOCUS_01930 136407 136997 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_01930 137206 137727 gene locus_tag LOCUS_01940 137206 137727 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_01940 137984 138688 gene locus_tag LOCUS_01950 137984 138688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 138940 138749 gene locus_tag LOCUS_01960 138940 138749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence003 2383 1832 gene locus_tag LOCUS_01970 2383 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 2619 2398 gene locus_tag LOCUS_01980 2619 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2855 2637 gene locus_tag LOCUS_01990 2855 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 3804 2830 gene locus_tag LOCUS_02000 3804 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 10690 4055 gene locus_tag LOCUS_02010 10690 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 13046 11367 gene locus_tag LOCUS_02020 13046 11367 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_02020 18849 13057 gene locus_tag LOCUS_02030 18849 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 19281 22919 gene locus_tag LOCUS_02040 gene smc 19281 22919 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_02040 23422 24042 gene locus_tag LOCUS_02050 23422 24042 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_02050 24039 25913 gene locus_tag LOCUS_02060 24039 25913 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_02060 26082 26537 gene locus_tag LOCUS_02070 26082 26537 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556692.1 protein_id gnl|my_center|LOCUS_02070 26649 27542 gene locus_tag LOCUS_02080 26649 27542 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_02080 27920 28162 gene locus_tag LOCUS_02090 27920 28162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 29955 29137 gene locus_tag LOCUS_02100 29955 29137 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403116.1 protein_id gnl|my_center|LOCUS_02100 30059 29983 gene locus_tag LOCUS_t00040 30059 29983 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 31153 30221 gene locus_tag LOCUS_02110 31153 30221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 31569 31709 gene locus_tag LOCUS_02120 31569 31709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 31813 33006 gene locus_tag LOCUS_02130 31813 33006 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933548.1 protein_id gnl|my_center|LOCUS_02130 33159 35891 gene locus_tag LOCUS_02140 33159 35891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 35947 37533 gene locus_tag LOCUS_02150 35947 37533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 37753 38049 gene locus_tag LOCUS_02160 37753 38049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 38064 38414 gene locus_tag LOCUS_02170 38064 38414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 38641 40104 gene locus_tag LOCUS_02180 38641 40104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 40462 42984 gene locus_tag LOCUS_02190 40462 42984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 43018 44136 gene locus_tag LOCUS_02200 43018 44136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 44516 45688 gene locus_tag LOCUS_02210 44516 45688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 45778 46620 gene locus_tag LOCUS_02220 gene tsf 45778 46620 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_02220 49047 47338 gene locus_tag LOCUS_02230 49047 47338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 50021 49149 gene locus_tag LOCUS_02240 gene cpdA 50021 49149 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693770.1 protein_id gnl|my_center|LOCUS_02240 51495 50113 gene locus_tag LOCUS_02250 51495 50113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 54914 51492 gene locus_tag LOCUS_02260 54914 51492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 56597 55143 gene locus_tag LOCUS_02270 56597 55143 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_02270 57093 57019 gene locus_tag LOCUS_t00050 57093 57019 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 58445 57150 gene locus_tag LOCUS_02280 gene pcnB 58445 57150 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612395.1 protein_id gnl|my_center|LOCUS_02280 59470 58505 gene locus_tag LOCUS_02290 59470 58505 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_02290 60263 59535 gene locus_tag LOCUS_02300 60263 59535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 60628 60260 gene locus_tag LOCUS_02310 60628 60260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 63275 60660 gene locus_tag LOCUS_02320 63275 60660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 64550 63282 gene locus_tag LOCUS_02330 64550 63282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 67824 65335 gene locus_tag LOCUS_02340 67824 65335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 69589 68753 gene locus_tag LOCUS_02350 69589 68753 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_02350 69945 70826 gene locus_tag LOCUS_02360 69945 70826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 70714 71319 gene locus_tag LOCUS_02370 70714 71319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 72853 71708 gene locus_tag LOCUS_02380 gene nspC 72853 71708 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_02380 73330 72935 gene locus_tag LOCUS_02390 73330 72935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 74607 73408 gene locus_tag LOCUS_02400 74607 73408 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_02400 75515 74661 gene locus_tag LOCUS_02410 gene speB 75515 74661 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_02410 77764 75848 gene locus_tag LOCUS_02420 gene speA 77764 75848 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_02420 81194 78180 gene locus_tag LOCUS_02430 81194 78180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 82111 81296 gene locus_tag LOCUS_02440 82111 81296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 83499 82108 gene locus_tag LOCUS_02450 83499 82108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 84618 83509 gene locus_tag LOCUS_02460 84618 83509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 85918 84899 gene locus_tag LOCUS_02470 85918 84899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 86629 86246 gene locus_tag LOCUS_02480 86629 86246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 87306 86626 gene locus_tag LOCUS_02490 87306 86626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 87694 87290 gene locus_tag LOCUS_02500 87694 87290 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325029.1 protein_id gnl|my_center|LOCUS_02500 89353 88109 gene locus_tag LOCUS_02510 89353 88109 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938567.1 protein_id gnl|my_center|LOCUS_02510 91180 89486 gene locus_tag LOCUS_02520 91180 89486 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence004 88 471 gene locus_tag LOCUS_02530 88 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 854 1618 gene locus_tag LOCUS_02540 854 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 1755 3803 gene locus_tag LOCUS_02550 1755 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 4244 3885 gene locus_tag LOCUS_02560 4244 3885 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297874.1 protein_id gnl|my_center|LOCUS_02560 6711 4570 gene locus_tag LOCUS_02570 6711 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 7552 8361 gene locus_tag LOCUS_02580 7552 8361 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_02580 8931 11861 gene locus_tag LOCUS_02590 8931 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 11903 17386 gene locus_tag LOCUS_02600 11903 17386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 17966 18691 gene locus_tag LOCUS_02610 17966 18691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 18791 18976 gene locus_tag LOCUS_02620 18791 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 19424 20341 gene locus_tag LOCUS_02630 19424 20341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 20484 21752 gene locus_tag LOCUS_02640 20484 21752 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_02640 23887 21836 gene locus_tag LOCUS_02650 23887 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 24231 24007 gene locus_tag LOCUS_02660 24231 24007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 26382 24706 gene locus_tag LOCUS_02670 gene ade 26382 24706 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_02670 27001 26723 gene locus_tag LOCUS_02680 27001 26723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_02680 28720 27116 gene locus_tag LOCUS_02690 28720 27116 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_02690 30031 29204 gene locus_tag LOCUS_02700 gene mutM 30031 29204 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355756.1 protein_id gnl|my_center|LOCUS_02700 31727 30348 gene locus_tag LOCUS_02710 31727 30348 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_02710 32125 32052 gene locus_tag LOCUS_t00060 32125 32052 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 32389 33603 gene locus_tag LOCUS_02720 gene tgt 32389 33603 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_02720 33724 34053 gene locus_tag LOCUS_02730 gene yajC 33724 34053 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_02730 34182 36683 gene locus_tag LOCUS_02740 gene secDF 34182 36683 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_02740 37540 36833 gene locus_tag LOCUS_02750 gene fabG 37540 36833 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706106.1 protein_id gnl|my_center|LOCUS_02750 38610 37606 gene locus_tag LOCUS_02760 38610 37606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 39004 40845 gene locus_tag LOCUS_02770 gene mutL 39004 40845 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_02770 41041 41706 gene locus_tag LOCUS_02780 41041 41706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 41706 43394 gene locus_tag LOCUS_02790 41706 43394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 43391 44344 gene locus_tag LOCUS_02800 43391 44344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 44353 45411 gene locus_tag LOCUS_02810 44353 45411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 45549 48425 gene locus_tag LOCUS_02820 45549 48425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 49142 49741 gene locus_tag LOCUS_02830 gene coaE 49142 49741 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_02830 49738 51402 gene locus_tag LOCUS_02840 gene rho 49738 51402 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883248.1 protein_id gnl|my_center|LOCUS_02840 51584 52873 gene locus_tag LOCUS_02850 gene tig 51584 52873 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_02850 52954 53565 gene locus_tag LOCUS_02860 gene clpP 52954 53565 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_02860 53583 54830 gene locus_tag LOCUS_02870 gene clpX 53583 54830 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_02870 55428 58124 gene locus_tag LOCUS_02880 55428 58124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 58144 58983 gene locus_tag LOCUS_02890 58144 58983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 62106 59056 gene locus_tag LOCUS_02900 62106 59056 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 protein_id gnl|my_center|LOCUS_02900 63452 62496 gene locus_tag LOCUS_02910 63452 62496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 65519 63513 gene locus_tag LOCUS_02920 65519 63513 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_02920 66329 65700 gene locus_tag LOCUS_02930 66329 65700 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_02930 66652 66287 gene locus_tag LOCUS_02940 66652 66287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 67038 66787 gene locus_tag LOCUS_02950 67038 66787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 67903 66989 gene locus_tag LOCUS_02960 67903 66989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 68027 67878 gene locus_tag LOCUS_02970 68027 67878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 68102 69322 gene locus_tag LOCUS_02980 gene trpB 68102 69322 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_02980 69516 73049 gene locus_tag LOCUS_02990 69516 73049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 73097 74122 gene locus_tag LOCUS_03000 73097 74122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 74119 76056 gene locus_tag LOCUS_03010 74119 76056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 78071 77391 gene locus_tag LOCUS_03020 78071 77391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 78470 79051 gene locus_tag LOCUS_03030 78470 79051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 79338 80306 gene locus_tag LOCUS_03040 gene fmt 79338 80306 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_03040 80413 81168 gene locus_tag LOCUS_03050 80413 81168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 81592 83844 gene locus_tag LOCUS_03060 gene priA 81592 83844 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_03060 84290 84640 gene locus_tag LOCUS_03070 84290 84640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence005 1741 620 gene locus_tag LOCUS_03080 1741 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2585 1860 gene locus_tag LOCUS_03090 2585 1860 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_03090 3964 2600 gene locus_tag LOCUS_03100 3964 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4096 4314 gene locus_tag LOCUS_03110 4096 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5392 6459 gene locus_tag LOCUS_03120 5392 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6618 7715 gene locus_tag LOCUS_03130 6618 7715 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_03130 8105 8803 gene locus_tag LOCUS_03140 8105 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 9100 10302 gene locus_tag LOCUS_03150 9100 10302 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_03150 10490 10858 gene locus_tag LOCUS_03160 10490 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10882 12426 gene locus_tag LOCUS_03170 gene glgA 10882 12426 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_03170 12555 14588 gene locus_tag LOCUS_03180 12555 14588 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_03180 14786 16447 gene locus_tag LOCUS_03190 14786 16447 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615418.1 protein_id gnl|my_center|LOCUS_03190 16444 18195 gene locus_tag LOCUS_03200 16444 18195 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340030.1 protein_id gnl|my_center|LOCUS_03200 18292 19641 gene locus_tag LOCUS_03210 18292 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 19638 20309 gene locus_tag LOCUS_03220 19638 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 21013 20588 gene locus_tag LOCUS_03230 21013 20588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 21960 21055 gene locus_tag LOCUS_03240 gene rbsK 21960 21055 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_03240 23489 22479 gene locus_tag LOCUS_03250 23489 22479 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_03250 25665 23851 gene locus_tag LOCUS_03260 25665 23851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 27074 25668 gene locus_tag LOCUS_03270 27074 25668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 30135 27886 gene locus_tag LOCUS_03280 30135 27886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 30397 30215 gene locus_tag LOCUS_03290 30397 30215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 32290 30437 gene locus_tag LOCUS_03300 32290 30437 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183761824.1 protein_id gnl|my_center|LOCUS_03300 32449 33603 gene locus_tag LOCUS_03310 32449 33603 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545976.1 protein_id gnl|my_center|LOCUS_03310 34800 34078 gene locus_tag LOCUS_03320 34800 34078 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081476.1 protein_id gnl|my_center|LOCUS_03320 35676 38198 gene locus_tag LOCUS_03330 35676 38198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 38203 39795 gene locus_tag LOCUS_03340 38203 39795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 39870 40673 gene locus_tag LOCUS_03350 39870 40673 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_03350 40851 41060 gene locus_tag LOCUS_03360 40851 41060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 42561 41005 gene locus_tag LOCUS_03370 42561 41005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 42695 42934 gene locus_tag LOCUS_03380 42695 42934 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_03380 42894 43199 gene locus_tag LOCUS_03390 42894 43199 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_03390 43396 43779 gene locus_tag LOCUS_03400 gene rpsL 43396 43779 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118744.1 protein_id gnl|my_center|LOCUS_03400 43832 44302 gene locus_tag LOCUS_03410 gene rpsG 43832 44302 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_03410 44377 46512 gene locus_tag LOCUS_03420 gene fusA 44377 46512 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_03420 46520 46828 gene locus_tag LOCUS_03430 gene rpsJ 46520 46828 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_03430 46843 47469 gene locus_tag LOCUS_03440 gene rplC 46843 47469 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_03440 47486 48127 gene locus_tag LOCUS_03450 gene rplD 47486 48127 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938599.1 protein_id gnl|my_center|LOCUS_03450 48124 48402 gene locus_tag LOCUS_03460 gene rplW 48124 48402 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_03460 48423 49247 gene locus_tag LOCUS_03470 gene rplB 48423 49247 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_03470 49251 49517 gene locus_tag LOCUS_03480 gene rpsS 49251 49517 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933838.1 protein_id gnl|my_center|LOCUS_03480 49531 49866 gene locus_tag LOCUS_03490 gene rplV 49531 49866 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_03490 49906 50583 gene locus_tag LOCUS_03500 gene rpsC 49906 50583 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536533.1 protein_id gnl|my_center|LOCUS_03500 50567 50989 gene locus_tag LOCUS_03510 gene rplP 50567 50989 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 protein_id gnl|my_center|LOCUS_03510 50995 51189 gene locus_tag LOCUS_03520 gene rpmC 50995 51189 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_03520 51191 51454 gene locus_tag LOCUS_03530 gene rpsQ 51191 51454 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_03530 51456 51821 gene locus_tag LOCUS_03540 gene rplN 51456 51821 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670011.1 protein_id gnl|my_center|LOCUS_03540 51906 52223 gene locus_tag LOCUS_03550 gene rplX 51906 52223 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427723.1 protein_id gnl|my_center|LOCUS_03550 52236 52775 gene locus_tag LOCUS_03560 gene rplE 52236 52775 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_03560 52991 53383 gene locus_tag LOCUS_03570 gene rpsH 52991 53383 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_03570 53397 53936 gene locus_tag LOCUS_03580 gene rplF 53397 53936 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_03580 53960 54343 gene locus_tag LOCUS_03590 gene rplR 53960 54343 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_03590 54340 54831 gene locus_tag LOCUS_03600 gene rpsE 54340 54831 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129922.1 protein_id gnl|my_center|LOCUS_03600 54946 55398 gene locus_tag LOCUS_03610 gene rplO 54946 55398 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_03610 55410 56798 gene locus_tag LOCUS_03620 gene secY 55410 56798 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_03620 57858 63653 gene locus_tag LOCUS_03630 57858 63653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 63696 66488 gene locus_tag LOCUS_03640 63696 66488 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_03640 66530 66973 gene locus_tag LOCUS_03650 66530 66973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 67224 67003 gene locus_tag LOCUS_03660 gene infA 67224 67003 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_03660 67578 68063 gene locus_tag LOCUS_03670 67578 68063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 68060 68812 gene locus_tag LOCUS_03680 gene map 68060 68812 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_03680 69019 69414 gene locus_tag LOCUS_03690 gene rpsM 69019 69414 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883266.1 protein_id gnl|my_center|LOCUS_03690 69499 70137 gene locus_tag LOCUS_03700 69499 70137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 70139 70768 gene locus_tag LOCUS_03710 gene rpsD 70139 70768 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_03710 70845 71837 gene locus_tag LOCUS_03720 70845 71837 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_03720 71922 72272 gene locus_tag LOCUS_03730 gene rplQ 71922 72272 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280529.1 protein_id gnl|my_center|LOCUS_03730 72522 73172 gene locus_tag LOCUS_03740 72522 73172 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_03740 73558 76629 gene locus_tag LOCUS_03750 73558 76629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 76734 81149 gene locus_tag LOCUS_03760 76734 81149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence006 2 226 gene locus_tag LOCUS_03770 2 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 825 529 gene locus_tag LOCUS_03780 825 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2510 1038 gene locus_tag LOCUS_03790 2510 1038 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_03790 2779 4239 gene locus_tag LOCUS_03800 2779 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 4495 4809 gene locus_tag LOCUS_03810 gene rplU 4495 4809 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_03810 4847 5092 gene locus_tag LOCUS_03820 gene rpmA 4847 5092 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419086.1 protein_id gnl|my_center|LOCUS_03820 5134 6321 gene locus_tag LOCUS_03830 gene obgE 5134 6321 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_03830 6686 8089 gene locus_tag LOCUS_03840 6686 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 8010 8273 gene locus_tag LOCUS_03850 8010 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 9874 8663 gene locus_tag LOCUS_03860 9874 8663 CDS product IS4-like element ISLpn5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947782.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 10896 9946 gene locus_tag LOCUS_03870 10896 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 11426 10959 gene locus_tag LOCUS_03880 11426 10959 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_03880 12102 12548 gene locus_tag LOCUS_03890 12102 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 12674 15871 gene locus_tag LOCUS_03900 12674 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 15982 19818 gene locus_tag LOCUS_03910 15982 19818 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108747.1 protein_id gnl|my_center|LOCUS_03910 19903 20640 gene locus_tag LOCUS_03920 gene pdxJ 19903 20640 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772027.1 protein_id gnl|my_center|LOCUS_03920 20655 21731 gene locus_tag LOCUS_03930 20655 21731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 22023 23597 gene locus_tag LOCUS_03940 22023 23597 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_03940 24148 25308 gene locus_tag LOCUS_03950 24148 25308 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_03950 25788 26642 gene locus_tag LOCUS_03960 25788 26642 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383265.1 protein_id gnl|my_center|LOCUS_03960 28075 27263 gene locus_tag LOCUS_03970 28075 27263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 28883 28062 gene locus_tag LOCUS_03980 28883 28062 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_03980 29905 28946 gene locus_tag LOCUS_03990 gene trpS 29905 28946 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_03990 31517 30756 gene locus_tag LOCUS_04000 31517 30756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 32833 31514 gene locus_tag LOCUS_04010 gene larC 32833 31514 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_04010 33195 33767 gene locus_tag LOCUS_04020 gene pyrE 33195 33767 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_04020 33846 35045 gene locus_tag LOCUS_04030 33846 35045 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_04030 36410 35577 gene locus_tag LOCUS_04040 36410 35577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 37195 37851 gene locus_tag LOCUS_04050 gene hisH 37195 37851 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_04050 37888 38667 gene locus_tag LOCUS_04060 gene hisF 37888 38667 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_04060 38805 39017 gene locus_tag LOCUS_04070 38805 39017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 39213 40238 gene locus_tag LOCUS_04080 gene ruvB 39213 40238 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_04080 42047 41010 gene locus_tag LOCUS_04090 42047 41010 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_04090 42273 45887 gene locus_tag LOCUS_04100 42273 45887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 46588 47667 gene locus_tag LOCUS_04110 46588 47667 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_04110 47672 48862 gene locus_tag LOCUS_04120 47672 48862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 48859 49365 gene locus_tag LOCUS_04130 48859 49365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 49394 51049 gene locus_tag LOCUS_04140 49394 51049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 51056 51592 gene locus_tag LOCUS_04150 51056 51592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 54281 51915 gene locus_tag LOCUS_04160 54281 51915 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_04160 54848 54354 gene locus_tag LOCUS_04170 54848 54354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 55771 54845 gene locus_tag LOCUS_04180 gene lipA 55771 54845 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_04180 57191 56469 gene locus_tag LOCUS_04190 57191 56469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 60231 57319 gene locus_tag LOCUS_04200 60231 57319 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_04200 61147 60272 gene locus_tag LOCUS_04210 61147 60272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 62062 61172 gene locus_tag LOCUS_04220 62062 61172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 62335 63273 gene locus_tag LOCUS_04230 62335 63273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 66366 63871 gene locus_tag LOCUS_04240 gene mutS 66366 63871 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_04240 67065 67271 gene locus_tag LOCUS_04250 67065 67271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 68697 67771 gene locus_tag LOCUS_04260 68697 67771 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016325.1 protein_id gnl|my_center|LOCUS_04260 68809 70146 gene locus_tag LOCUS_04270 68809 70146 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_04270 70231 73251 gene locus_tag LOCUS_04280 70231 73251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_04280 74244 76397 gene locus_tag LOCUS_04290 74244 76397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 77940 76651 gene locus_tag LOCUS_04300 gene thiC 77940 76651 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902492.1 protein_id gnl|my_center|LOCUS_04300 78794 77937 gene locus_tag LOCUS_04310 gene thiD 78794 77937 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_04310 79275 79769 gene locus_tag LOCUS_04320 79275 79769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence007 410 619 gene locus_tag LOCUS_04330 410 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1920 1552 gene locus_tag LOCUS_04340 1920 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3427 2096 gene locus_tag LOCUS_04350 3427 2096 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_04350 4317 3442 gene locus_tag LOCUS_04360 4317 3442 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066267.1 protein_id gnl|my_center|LOCUS_04360 4366 4584 gene locus_tag LOCUS_04370 4366 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7636 5693 gene locus_tag LOCUS_04380 7636 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 8550 7690 gene locus_tag LOCUS_04390 8550 7690 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672775.1 protein_id gnl|my_center|LOCUS_04390 10810 8708 gene locus_tag LOCUS_04400 10810 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 13118 11052 gene locus_tag LOCUS_04410 13118 11052 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_04410 13355 13143 gene locus_tag LOCUS_04420 13355 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 13497 13252 gene locus_tag LOCUS_04430 13497 13252 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_04430 13646 14227 gene locus_tag LOCUS_04440 13646 14227 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_04440 14217 16706 gene locus_tag LOCUS_04450 14217 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 17326 17538 gene locus_tag LOCUS_04460 17326 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 19197 17548 gene locus_tag LOCUS_04470 19197 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 20123 19341 gene locus_tag LOCUS_04480 20123 19341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 20437 21270 gene locus_tag LOCUS_04490 20437 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04490 21285 22442 gene locus_tag LOCUS_04500 21285 22442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 22560 23324 gene locus_tag LOCUS_04510 22560 23324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 23408 23632 gene locus_tag LOCUS_04520 23408 23632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 23725 25773 gene locus_tag LOCUS_04530 23725 25773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 26008 25766 gene locus_tag LOCUS_04540 26008 25766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 28776 26008 gene locus_tag LOCUS_04550 28776 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 29829 28972 gene locus_tag LOCUS_04560 29829 28972 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019697.1 protein_id gnl|my_center|LOCUS_04560 30755 29826 gene locus_tag LOCUS_04570 30755 29826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 31999 30812 gene locus_tag LOCUS_04580 gene rlmI 31999 30812 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116288.1 protein_id gnl|my_center|LOCUS_04580 32388 32543 gene locus_tag LOCUS_04590 32388 32543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 35102 32601 gene locus_tag LOCUS_04600 35102 32601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 37301 35841 gene locus_tag LOCUS_04610 37301 35841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 37616 37861 gene locus_tag LOCUS_04620 37616 37861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 41638 38945 gene locus_tag LOCUS_04630 41638 38945 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_04630 43598 41712 gene locus_tag LOCUS_04640 43598 41712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 44226 43777 gene locus_tag LOCUS_04650 44226 43777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 45659 44700 gene locus_tag LOCUS_04660 45659 44700 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074276.1 protein_id gnl|my_center|LOCUS_04660 46570 45821 gene locus_tag LOCUS_04670 46570 45821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329496.1 protein_id gnl|my_center|LOCUS_04670 47669 46971 gene locus_tag LOCUS_04680 47669 46971 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_04680 48041 49387 gene locus_tag LOCUS_04690 gene trkA 48041 49387 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_04690 49384 50847 gene locus_tag LOCUS_04700 49384 50847 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_04700 50911 52029 gene locus_tag LOCUS_04710 50911 52029 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_04710 52925 52422 gene locus_tag LOCUS_04720 52925 52422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 53198 54583 gene locus_tag LOCUS_04730 53198 54583 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_04730 54664 55329 gene locus_tag LOCUS_04740 54664 55329 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256116.1 protein_id gnl|my_center|LOCUS_04740 55676 56779 gene locus_tag LOCUS_04750 gene ilvC 55676 56779 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_04750 57387 59885 gene locus_tag LOCUS_04760 57387 59885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 59902 60513 gene locus_tag LOCUS_04770 59902 60513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 60527 61021 gene locus_tag LOCUS_04780 60527 61021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 61053 61763 gene locus_tag LOCUS_04790 61053 61763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 61760 62872 gene locus_tag LOCUS_04800 61760 62872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 62869 63549 gene locus_tag LOCUS_04810 62869 63549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_04810 64001 64738 gene locus_tag LOCUS_04820 64001 64738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 65602 65090 gene locus_tag LOCUS_04830 65602 65090 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_04830 66086 65685 gene locus_tag LOCUS_04840 66086 65685 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_04840 66568 66110 gene locus_tag LOCUS_04850 66568 66110 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_04850 67193 68038 gene locus_tag LOCUS_04860 67193 68038 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582866.1 protein_id gnl|my_center|LOCUS_04860 68101 70230 gene locus_tag LOCUS_04870 68101 70230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 70742 71719 gene locus_tag LOCUS_04880 70742 71719 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_04880 71716 72174 gene locus_tag LOCUS_04890 71716 72174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 72174 73658 gene locus_tag LOCUS_04900 72174 73658 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 protein_id gnl|my_center|LOCUS_04900 73738 74445 gene locus_tag LOCUS_04910 73738 74445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04910 74420 79042 gene locus_tag LOCUS_04920 74420 79042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence008 2997 244 gene locus_tag LOCUS_04930 2997 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3331 6024 gene locus_tag LOCUS_04940 3331 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6866 7039 gene locus_tag LOCUS_04950 6866 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 7705 7172 gene locus_tag LOCUS_04960 7705 7172 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583110.1 protein_id gnl|my_center|LOCUS_04960 7926 8120 gene locus_tag LOCUS_04970 7926 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8056 8313 gene locus_tag LOCUS_04980 8056 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459999.1 protein_id gnl|my_center|LOCUS_04980 8716 8495 gene locus_tag LOCUS_04990 8716 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9115 9288 gene locus_tag LOCUS_05000 9115 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 9270 9518 gene locus_tag LOCUS_05010 9270 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 9515 9907 gene locus_tag LOCUS_05020 9515 9907 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_05020 9949 10128 gene locus_tag LOCUS_05030 9949 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 10602 10285 gene locus_tag LOCUS_05040 10602 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 11357 11869 gene locus_tag LOCUS_05050 11357 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 11890 12126 gene locus_tag LOCUS_05060 11890 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 12378 12992 gene locus_tag LOCUS_05070 12378 12992 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 protein_id gnl|my_center|LOCUS_05070 12989 13600 gene locus_tag LOCUS_05080 12989 13600 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_05080 13615 17217 gene locus_tag LOCUS_05090 gene brxC 13615 17217 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_05090 17214 18278 gene locus_tag LOCUS_05100 17214 18278 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_05100 18275 18499 gene locus_tag LOCUS_05110 18275 18499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 18504 20441 gene locus_tag LOCUS_05120 18504 20441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 20425 20577 gene locus_tag LOCUS_05130 20425 20577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 20564 23554 gene locus_tag LOCUS_05140 20564 23554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 23547 23834 gene locus_tag LOCUS_05150 23547 23834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 23845 25719 gene locus_tag LOCUS_05160 23845 25719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 25768 26838 gene locus_tag LOCUS_05170 25768 26838 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_05170 26831 29398 gene locus_tag LOCUS_05180 gene pglZ 26831 29398 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 protein_id gnl|my_center|LOCUS_05180 29579 29734 gene locus_tag LOCUS_05190 29579 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 29766 30149 gene locus_tag LOCUS_05200 29766 30149 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_05200 30545 32605 gene locus_tag LOCUS_05210 gene brxL 30545 32605 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939301.1 protein_id gnl|my_center|LOCUS_05210 34184 34525 gene locus_tag LOCUS_05220 34184 34525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 34509 35717 gene locus_tag LOCUS_05230 34509 35717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 36055 36387 gene locus_tag LOCUS_05240 36055 36387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 36930 38330 gene locus_tag LOCUS_05250 36930 38330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 38323 39735 gene locus_tag LOCUS_05260 38323 39735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 39732 40151 gene locus_tag LOCUS_05270 39732 40151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 40144 40656 gene locus_tag LOCUS_05280 40144 40656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 40844 41293 gene locus_tag LOCUS_05290 40844 41293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 41383 43275 gene locus_tag LOCUS_05300 41383 43275 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_05300 43279 44070 gene locus_tag LOCUS_05310 43279 44070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 45434 46171 gene locus_tag LOCUS_05320 45434 46171 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 protein_id gnl|my_center|LOCUS_05320 46489 47097 gene locus_tag LOCUS_05330 46489 47097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 47354 48361 gene locus_tag LOCUS_05340 47354 48361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05340 52568 48729 gene locus_tag LOCUS_05350 52568 48729 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_05350 54540 52561 gene locus_tag LOCUS_05360 54540 52561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 56019 54643 gene locus_tag LOCUS_05370 56019 54643 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444633.1 protein_id gnl|my_center|LOCUS_05370 58239 56236 gene locus_tag LOCUS_05380 58239 56236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 58727 59695 gene locus_tag LOCUS_05390 58727 59695 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_05390 60865 59897 gene locus_tag LOCUS_05400 60865 59897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 63154 61106 gene locus_tag LOCUS_05410 63154 61106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 67053 63175 gene locus_tag LOCUS_05420 67053 63175 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 protein_id gnl|my_center|LOCUS_05420 69169 67148 gene locus_tag LOCUS_05430 69169 67148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 70013 69435 gene locus_tag LOCUS_05440 70013 69435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05440 71124 70126 gene locus_tag LOCUS_05450 71124 70126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 72149 73480 gene locus_tag LOCUS_05460 72149 73480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 73599 74366 gene locus_tag LOCUS_05470 73599 74366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 74531 75007 gene locus_tag LOCUS_05480 74531 75007 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_05480 75070 75873 gene locus_tag LOCUS_05490 gene tpiA 75070 75873 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence009 88 3225 gene locus_tag LOCUS_05500 88 3225 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_05500 3225 3536 gene locus_tag LOCUS_05510 3225 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041065645.1 protein_id gnl|my_center|LOCUS_05510 3668 3426 gene locus_tag LOCUS_05520 3668 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3884 4825 gene locus_tag LOCUS_05530 3884 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 6245 5682 gene locus_tag LOCUS_05540 6245 5682 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_05540 7444 6272 gene locus_tag LOCUS_05550 7444 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 9154 8258 gene locus_tag LOCUS_05560 9154 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 12552 9151 gene locus_tag LOCUS_05570 12552 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 14714 12564 gene locus_tag LOCUS_05580 14714 12564 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_05580 15734 17896 gene locus_tag LOCUS_05590 15734 17896 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082809.1 protein_id gnl|my_center|LOCUS_05590 17915 18682 gene locus_tag LOCUS_05600 17915 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 18859 19194 gene locus_tag LOCUS_05610 18859 19194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 19133 19378 gene locus_tag LOCUS_05620 19133 19378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 19390 23403 gene locus_tag LOCUS_05630 19390 23403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 23415 24050 gene locus_tag LOCUS_05640 23415 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 24056 26005 gene locus_tag LOCUS_05650 24056 26005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 26002 26979 gene locus_tag LOCUS_05660 26002 26979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 26999 29917 gene locus_tag LOCUS_05670 26999 29917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 29917 30861 gene locus_tag LOCUS_05680 29917 30861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 30845 32494 gene locus_tag LOCUS_05690 30845 32494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 32418 32696 gene locus_tag LOCUS_05700 32418 32696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 32693 33874 gene locus_tag LOCUS_05710 32693 33874 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276374.1 protein_id gnl|my_center|LOCUS_05710 33867 34385 gene locus_tag LOCUS_05720 gene purE 33867 34385 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_05720 34493 34741 gene locus_tag LOCUS_05730 34493 34741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 34921 36810 gene locus_tag LOCUS_05740 gene oadA 34921 36810 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_05740 38760 37261 gene locus_tag LOCUS_05750 38760 37261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 41805 38764 gene locus_tag LOCUS_05760 41805 38764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 41954 42148 gene locus_tag LOCUS_05770 41954 42148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 43306 42392 gene locus_tag LOCUS_05780 43306 42392 CDS product DUF6528 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332817.1 protein_id gnl|my_center|LOCUS_05780 43443 45236 gene locus_tag LOCUS_05790 43443 45236 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260488.1 protein_id gnl|my_center|LOCUS_05790 45268 45510 gene locus_tag LOCUS_05800 45268 45510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 46742 47098 gene locus_tag LOCUS_05810 46742 47098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 49069 47993 gene locus_tag LOCUS_05820 gene serC 49069 47993 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_05820 49386 50729 gene locus_tag LOCUS_05830 49386 50729 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_05830 50766 51647 gene locus_tag LOCUS_05840 50766 51647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 55656 52054 gene locus_tag LOCUS_05850 gene nifJ 55656 52054 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_05850 56691 55747 gene locus_tag LOCUS_05860 gene fba 56691 55747 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_05860 57619 57694 gene locus_tag LOCUS_t00070 57619 57694 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 57737 58948 gene locus_tag LOCUS_05870 gene tuf 57737 58948 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903497.1 protein_id gnl|my_center|LOCUS_05870 59020 59172 gene locus_tag LOCUS_05880 gene rpmG 59020 59172 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881260.1 protein_id gnl|my_center|LOCUS_05880 59181 59256 gene locus_tag LOCUS_t00080 59181 59256 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 59343 59546 gene locus_tag LOCUS_05890 59343 59546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 59572 60135 gene locus_tag LOCUS_05900 gene nusG 59572 60135 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_05900 60250 60675 gene locus_tag LOCUS_05910 gene rplK 60250 60675 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870243.1 protein_id gnl|my_center|LOCUS_05910 60692 61375 gene locus_tag LOCUS_05920 gene rplA 60692 61375 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987630.1 protein_id gnl|my_center|LOCUS_05920 61387 61905 gene locus_tag LOCUS_05930 61387 61905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 62038 62415 gene locus_tag LOCUS_05940 gene rplL 62038 62415 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 protein_id gnl|my_center|LOCUS_05940 62735 66592 gene locus_tag LOCUS_05950 gene rpoB 62735 66592 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882731.1 protein_id gnl|my_center|LOCUS_05950 66619 70815 gene locus_tag LOCUS_05960 gene rpoC 66619 70815 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895278.1 protein_id gnl|my_center|LOCUS_05960 71264 72466 gene locus_tag LOCUS_05970 gene metK 71264 72466 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062140.1 protein_id gnl|my_center|LOCUS_05970 72534 72633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72890 74287 gene locus_tag LOCUS_05980 gene ahcY 72890 74287 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932403.1 protein_id gnl|my_center|LOCUS_05980 74432 75292 gene locus_tag LOCUS_05990 gene rfbD 74432 75292 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence010 69 1130 gene locus_tag LOCUS_06000 69 1130 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938996.1 protein_id gnl|my_center|LOCUS_06000 1114 1305 gene locus_tag LOCUS_06010 1114 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1302 3290 gene locus_tag LOCUS_06020 gene dndD 1302 3290 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_06020 3293 4819 gene locus_tag LOCUS_06030 3293 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 5498 6649 gene locus_tag LOCUS_06040 5498 6649 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_06040 10742 7749 gene locus_tag LOCUS_06050 10742 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 12861 11371 gene locus_tag LOCUS_06060 12861 11371 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_06060 14674 12950 gene locus_tag LOCUS_06070 14674 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 16246 15167 gene locus_tag LOCUS_06080 16246 15167 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_06080 17979 16258 gene locus_tag LOCUS_06090 gene pilB 17979 16258 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_06090 19123 18359 gene locus_tag LOCUS_06100 19123 18359 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122515.1 protein_id gnl|my_center|LOCUS_06100 19109 19348 gene locus_tag LOCUS_06110 19109 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 19245 19940 gene locus_tag LOCUS_06120 19245 19940 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921820.1 protein_id gnl|my_center|LOCUS_06120 20066 21400 gene locus_tag LOCUS_06130 20066 21400 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_06130 21792 22649 gene locus_tag LOCUS_06140 21792 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 23933 22893 gene locus_tag LOCUS_06150 23933 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 24065 24394 gene locus_tag LOCUS_06160 24065 24394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 24669 25970 gene locus_tag LOCUS_06170 24669 25970 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_06170 25991 26221 gene locus_tag LOCUS_06180 25991 26221 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_06180 26284 26739 gene locus_tag LOCUS_06190 26284 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 26746 27216 gene locus_tag LOCUS_06200 26746 27216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 27213 27902 gene locus_tag LOCUS_06210 27213 27902 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_06210 29203 27899 gene locus_tag LOCUS_06220 29203 27899 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_06220 29441 31018 gene locus_tag LOCUS_06230 gene rny 29441 31018 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_06230 31026 31814 gene locus_tag LOCUS_06240 gene ymdB 31026 31814 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_06240 32072 33448 gene locus_tag LOCUS_06250 gene xseA 32072 33448 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_06250 33441 33677 gene locus_tag LOCUS_06260 33441 33677 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919931.1 protein_id gnl|my_center|LOCUS_06260 33731 34570 gene locus_tag LOCUS_06270 33731 34570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 34900 34667 gene locus_tag LOCUS_06280 34900 34667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 35132 35461 gene locus_tag LOCUS_06290 35132 35461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 35583 35753 gene locus_tag LOCUS_06300 35583 35753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 35819 36997 gene locus_tag LOCUS_06310 35819 36997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 37173 38519 gene locus_tag LOCUS_06320 gene gntU 37173 38519 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_06320 45126 38998 gene locus_tag LOCUS_06330 45126 38998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 46440 45487 gene locus_tag LOCUS_06340 46440 45487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 48590 47064 gene locus_tag LOCUS_06350 48590 47064 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_06350 48855 49778 gene locus_tag LOCUS_06360 48855 49778 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_06360 50357 50190 gene locus_tag LOCUS_06370 50357 50190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 52670 50370 gene locus_tag LOCUS_06380 52670 50370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 54119 53319 gene locus_tag LOCUS_06390 54119 53319 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_06390 54826 54161 gene locus_tag LOCUS_06400 54826 54161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 55235 55669 gene locus_tag LOCUS_06410 55235 55669 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393584.1 protein_id gnl|my_center|LOCUS_06410 55666 56379 gene locus_tag LOCUS_06420 55666 56379 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_06420 56540 58171 gene locus_tag LOCUS_06430 gene hcp 56540 58171 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_06430 59851 58907 gene locus_tag LOCUS_06440 59851 58907 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_06440 60105 60530 gene locus_tag LOCUS_06450 60105 60530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 60635 61201 gene locus_tag LOCUS_06460 60635 61201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 61537 62190 gene locus_tag LOCUS_06470 61537 62190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 62556 62480 gene locus_tag LOCUS_t00090 62556 62480 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 63224 62661 gene locus_tag LOCUS_06480 gene efp 63224 62661 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_06480 64914 63295 gene locus_tag LOCUS_06490 64914 63295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 65359 66432 gene locus_tag LOCUS_06500 65359 66432 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_06500 66473 66733 gene locus_tag LOCUS_06510 66473 66733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 67038 66730 gene locus_tag LOCUS_06520 67038 66730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 67413 67087 gene locus_tag LOCUS_06530 67413 67087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 68935 67931 gene locus_tag LOCUS_06540 68935 67931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence011 1426 56 gene locus_tag LOCUS_06550 1426 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4155 1426 gene locus_tag LOCUS_06560 4155 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4601 4413 gene locus_tag LOCUS_06570 4601 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 5107 5265 gene locus_tag LOCUS_06580 5107 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5356 5282 gene locus_tag LOCUS_t00100 5356 5282 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7404 5467 gene locus_tag LOCUS_06590 7404 5467 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_06590 8052 7513 gene locus_tag LOCUS_06600 8052 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06600 7991 8293 gene locus_tag LOCUS_06610 7991 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 12170 9276 gene locus_tag LOCUS_06620 12170 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 12724 12275 gene locus_tag LOCUS_06630 12724 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 13452 12796 gene locus_tag LOCUS_06640 13452 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 14021 13497 gene locus_tag LOCUS_06650 14021 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 14850 14005 gene locus_tag LOCUS_06660 14850 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 15365 14874 gene locus_tag LOCUS_06670 15365 14874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 16278 15625 gene locus_tag LOCUS_06680 16278 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 16445 16600 gene locus_tag LOCUS_06690 16445 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 17667 16609 gene locus_tag LOCUS_06700 17667 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 19140 17836 gene locus_tag LOCUS_06710 19140 17836 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_06710 19604 20911 gene locus_tag LOCUS_06720 19604 20911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 20908 21963 gene locus_tag LOCUS_06730 20908 21963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 23666 22533 gene locus_tag LOCUS_06740 23666 22533 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_06740 24703 23864 gene locus_tag LOCUS_06750 24703 23864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 25159 26088 gene locus_tag LOCUS_06760 gene mntA 25159 26088 CDS product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 protein_id gnl|my_center|LOCUS_06760 26137 26541 gene locus_tag LOCUS_06770 26137 26541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 26769 27482 gene locus_tag LOCUS_06780 26769 27482 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_06780 27479 28333 gene locus_tag LOCUS_06790 27479 28333 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103866.1 protein_id gnl|my_center|LOCUS_06790 28438 31095 gene locus_tag LOCUS_06800 28438 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 33724 32603 gene locus_tag LOCUS_06810 33724 32603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 35394 33742 gene locus_tag LOCUS_06820 35394 33742 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_06820 36178 35591 gene locus_tag LOCUS_06830 36178 35591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 36294 39974 gene locus_tag LOCUS_06840 36294 39974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 41106 40144 gene locus_tag LOCUS_06850 41106 40144 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965680.1 protein_id gnl|my_center|LOCUS_06850 41360 41136 gene locus_tag LOCUS_06860 41360 41136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 41722 41420 gene locus_tag LOCUS_06870 41722 41420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 44274 41917 gene locus_tag LOCUS_06880 44274 41917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 45939 44554 gene locus_tag LOCUS_06890 45939 44554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 47055 45964 gene locus_tag LOCUS_06900 47055 45964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 49551 47062 gene locus_tag LOCUS_06910 49551 47062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 51558 49597 gene locus_tag LOCUS_06920 51558 49597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 51827 51648 gene locus_tag LOCUS_06930 51827 51648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 53610 51760 gene locus_tag LOCUS_06940 53610 51760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 55946 53649 gene locus_tag LOCUS_06950 55946 53649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 59186 55956 gene locus_tag LOCUS_06960 59186 55956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 61657 59375 gene locus_tag LOCUS_06970 61657 59375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 61941 62654 gene locus_tag LOCUS_06980 61941 62654 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_06980 62683 63306 gene locus_tag LOCUS_06990 62683 63306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 63294 64577 gene locus_tag LOCUS_07000 63294 64577 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919324.1 protein_id gnl|my_center|LOCUS_07000 64599 65366 gene locus_tag LOCUS_07010 64599 65366 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_07010 65363 66382 gene locus_tag LOCUS_07020 65363 66382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence012 2854 1739 gene locus_tag LOCUS_07030 2854 1739 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_07030 4403 3126 gene locus_tag LOCUS_07040 4403 3126 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_07040 7655 4629 gene locus_tag LOCUS_07050 7655 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 8824 7760 gene locus_tag LOCUS_07060 8824 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 9262 10140 gene locus_tag LOCUS_07070 gene rhaS 9262 10140 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703945.1 protein_id gnl|my_center|LOCUS_07070 10341 11210 gene locus_tag LOCUS_07080 10341 11210 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_07080 11323 11703 gene locus_tag LOCUS_07090 11323 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 11700 12509 gene locus_tag LOCUS_07100 11700 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 12517 13077 gene locus_tag LOCUS_07110 12517 13077 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_07110 13083 14414 gene locus_tag LOCUS_07120 13083 14414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 14559 19637 gene locus_tag LOCUS_07130 14559 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 20509 21843 gene locus_tag LOCUS_07140 20509 21843 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_07140 22111 22542 gene locus_tag LOCUS_07150 22111 22542 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_07150 22593 23924 gene locus_tag LOCUS_07160 22593 23924 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_07160 24197 23925 gene locus_tag LOCUS_07170 24197 23925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 24428 27148 gene locus_tag LOCUS_07180 24428 27148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 27514 28323 gene locus_tag LOCUS_07190 27514 28323 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616157.1 protein_id gnl|my_center|LOCUS_07190 29015 28623 gene locus_tag LOCUS_07200 29015 28623 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440082.1 protein_id gnl|my_center|LOCUS_07200 29573 30700 gene locus_tag LOCUS_07210 gene rnd 29573 30700 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895548.1 protein_id gnl|my_center|LOCUS_07210 31037 31888 gene locus_tag LOCUS_07220 31037 31888 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_07220 33108 34259 gene locus_tag LOCUS_07230 33108 34259 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938231.1 protein_id gnl|my_center|LOCUS_07230 37123 34271 gene locus_tag LOCUS_07240 gene uvrA 37123 34271 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_07240 38914 37319 gene locus_tag LOCUS_07250 38914 37319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 41253 40069 gene locus_tag LOCUS_07260 41253 40069 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_07260 43911 41806 gene locus_tag LOCUS_07270 43911 41806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 45460 44180 gene locus_tag LOCUS_07280 45460 44180 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_07280 46633 45467 gene locus_tag LOCUS_07290 46633 45467 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_07290 46995 47645 gene locus_tag LOCUS_07300 46995 47645 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933408.1 protein_id gnl|my_center|LOCUS_07300 47764 49143 gene locus_tag LOCUS_07310 47764 49143 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_07310 49640 51307 gene locus_tag LOCUS_07320 gene sulP 49640 51307 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942949.1 protein_id gnl|my_center|LOCUS_07320 52046 52132 gene locus_tag LOCUS_t00110 52046 52132 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54155 52797 gene locus_tag LOCUS_07330 54155 52797 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 protein_id gnl|my_center|LOCUS_07330 54416 54228 gene locus_tag LOCUS_07340 54416 54228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 54498 54752 gene locus_tag LOCUS_07350 54498 54752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 54737 54925 gene locus_tag LOCUS_07360 54737 54925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 57365 54948 gene locus_tag LOCUS_07370 57365 54948 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797477.1 protein_id gnl|my_center|LOCUS_07370 60380 57702 gene locus_tag LOCUS_07380 60380 57702 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_07380 61405 60377 gene locus_tag LOCUS_07390 61405 60377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 63024 61405 gene locus_tag LOCUS_07400 63024 61405 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_07400 65357 64212 gene locus_tag LOCUS_07410 65357 64212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence013 140 610 gene locus_tag LOCUS_07420 140 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 794 579 gene locus_tag LOCUS_07430 794 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 972 733 gene locus_tag LOCUS_07440 972 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1549 1052 gene locus_tag LOCUS_07450 1549 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2812 1976 gene locus_tag LOCUS_07460 2812 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 10213 3053 gene locus_tag LOCUS_07470 10213 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 14898 10249 gene locus_tag LOCUS_07480 14898 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 18125 14943 gene locus_tag LOCUS_07490 18125 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 19445 18192 gene locus_tag LOCUS_07500 19445 18192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 21576 19828 gene locus_tag LOCUS_07510 21576 19828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 21769 22218 gene locus_tag LOCUS_07520 21769 22218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 22518 23129 gene locus_tag LOCUS_07530 22518 23129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 23222 27076 gene locus_tag LOCUS_07540 23222 27076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 27690 27448 gene locus_tag LOCUS_07550 27690 27448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 29926 28742 gene locus_tag LOCUS_07560 29926 28742 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_07560 30377 29898 gene locus_tag LOCUS_07570 30377 29898 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255696.1 protein_id gnl|my_center|LOCUS_07570 31710 30874 gene locus_tag LOCUS_07580 31710 30874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 31897 32079 gene locus_tag LOCUS_07590 31897 32079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 32060 32230 gene locus_tag LOCUS_07600 32060 32230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 32286 32444 gene locus_tag LOCUS_07610 32286 32444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 32445 32699 gene locus_tag LOCUS_07620 32445 32699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 32718 32888 gene locus_tag LOCUS_07630 32718 32888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 32881 33153 gene locus_tag LOCUS_07640 32881 33153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 33164 33415 gene locus_tag LOCUS_07650 33164 33415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 33521 33706 gene locus_tag LOCUS_07660 33521 33706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 33708 34133 gene locus_tag LOCUS_07670 33708 34133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 34144 34344 gene locus_tag LOCUS_07680 34144 34344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 34341 34661 gene locus_tag LOCUS_07690 34341 34661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 35748 36095 gene locus_tag LOCUS_07700 35748 36095 CDS product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014592.1 protein_id gnl|my_center|LOCUS_07700 36130 36387 gene locus_tag LOCUS_07710 36130 36387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 36384 36614 gene locus_tag LOCUS_07720 36384 36614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 36624 37193 gene locus_tag LOCUS_07730 36624 37193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 37190 39844 gene locus_tag LOCUS_07740 37190 39844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 40210 42531 gene locus_tag LOCUS_07750 40210 42531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 42533 43657 gene locus_tag LOCUS_07760 42533 43657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 43668 43865 gene locus_tag LOCUS_07770 43668 43865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 43973 44209 gene locus_tag LOCUS_07780 43973 44209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 44209 45762 gene locus_tag LOCUS_07790 44209 45762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 45766 46803 gene locus_tag LOCUS_07800 45766 46803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 46857 47891 gene locus_tag LOCUS_07810 46857 47891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 47976 48323 gene locus_tag LOCUS_07820 47976 48323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 48326 48922 gene locus_tag LOCUS_07830 48326 48922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 48919 49437 gene locus_tag LOCUS_07840 48919 49437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 49452 50129 gene locus_tag LOCUS_07850 49452 50129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 50133 50861 gene locus_tag LOCUS_07860 50133 50861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 50848 52563 gene locus_tag LOCUS_07870 50848 52563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 52565 52888 gene locus_tag LOCUS_07880 52565 52888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 52906 53271 gene locus_tag LOCUS_07890 52906 53271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 53281 53760 gene locus_tag LOCUS_07900 53281 53760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 53772 54275 gene locus_tag LOCUS_07910 53772 54275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 54268 55251 gene locus_tag LOCUS_07920 54268 55251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 55248 56042 gene locus_tag LOCUS_07930 55248 56042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 56039 56350 gene locus_tag LOCUS_07940 56039 56350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 56347 57129 gene locus_tag LOCUS_07950 56347 57129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 57126 57623 gene locus_tag LOCUS_07960 57126 57623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 57737 58015 gene locus_tag LOCUS_07970 57737 58015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 58038 58391 gene locus_tag LOCUS_07980 58038 58391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 58388 58612 gene locus_tag LOCUS_07990 58388 58612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 58609 59028 gene locus_tag LOCUS_08000 58609 59028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 59294 59076 gene locus_tag LOCUS_08010 59294 59076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 60024 59527 gene locus_tag LOCUS_08020 60024 59527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 61333 60284 gene locus_tag LOCUS_08030 61333 60284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 61584 61508 gene locus_tag LOCUS_t00120 61584 61508 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 61916 61692 gene locus_tag LOCUS_08040 61916 61692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 61824 63932 gene locus_tag LOCUS_08050 61824 63932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 64169 64510 gene locus_tag LOCUS_08060 64169 64510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence014 287 33 gene locus_tag LOCUS_08070 287 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2474 699 gene locus_tag LOCUS_08080 2474 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2710 3348 gene locus_tag LOCUS_08090 gene grpE 2710 3348 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 protein_id gnl|my_center|LOCUS_08090 3393 4574 gene locus_tag LOCUS_08100 gene dnaJ 3393 4574 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338764.1 protein_id gnl|my_center|LOCUS_08100 4891 6741 gene locus_tag LOCUS_08110 4891 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08110 6777 8642 gene locus_tag LOCUS_08120 6777 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08120 10443 8776 gene locus_tag LOCUS_08130 10443 8776 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_08130 10880 10566 gene locus_tag LOCUS_08140 10880 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 11366 13075 gene locus_tag LOCUS_08150 11366 13075 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930368.1 protein_id gnl|my_center|LOCUS_08150 13277 14671 gene locus_tag LOCUS_08160 13277 14671 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_08160 15196 15864 gene locus_tag LOCUS_08170 15196 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 15869 16096 gene locus_tag LOCUS_08180 15869 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 16386 17195 gene locus_tag LOCUS_08190 16386 17195 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_08190 17709 17500 gene locus_tag LOCUS_08200 17709 17500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 17873 18415 gene locus_tag LOCUS_08210 17873 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 18423 19901 gene locus_tag LOCUS_08220 18423 19901 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480035.1 protein_id gnl|my_center|LOCUS_08220 19998 22034 gene locus_tag LOCUS_08230 gene metG 19998 22034 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 protein_id gnl|my_center|LOCUS_08230 22629 23516 gene locus_tag LOCUS_08240 22629 23516 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_08240 24175 25164 gene locus_tag LOCUS_08250 24175 25164 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973397.1 protein_id gnl|my_center|LOCUS_08250 25620 26444 gene locus_tag LOCUS_08260 gene lgt 25620 26444 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_08260 26477 26950 gene locus_tag LOCUS_08270 26477 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 26950 28038 gene locus_tag LOCUS_08280 26950 28038 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_08280 29199 28069 gene locus_tag LOCUS_08290 29199 28069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 29725 30756 gene locus_tag LOCUS_08300 gene gmd 29725 30756 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_08300 30761 31687 gene locus_tag LOCUS_08310 30761 31687 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118908.1 protein_id gnl|my_center|LOCUS_08310 32602 31829 gene locus_tag LOCUS_08320 gene pssA 32602 31829 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_08320 33395 32655 gene locus_tag LOCUS_08330 gene pyrF 33395 32655 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_08330 34408 33677 gene locus_tag LOCUS_08340 34408 33677 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921820.1 protein_id gnl|my_center|LOCUS_08340 35025 34585 gene locus_tag LOCUS_08350 35025 34585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 37106 35268 gene locus_tag LOCUS_08360 37106 35268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_08360 39767 37806 gene locus_tag LOCUS_08370 39767 37806 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145060936.1 protein_id gnl|my_center|LOCUS_08370 39960 39876 gene locus_tag LOCUS_t00130 39960 39876 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40279 40962 gene locus_tag LOCUS_08380 40279 40962 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_08380 41334 42758 gene locus_tag LOCUS_08390 41334 42758 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198931.1 protein_id gnl|my_center|LOCUS_08390 42878 42675 gene locus_tag LOCUS_08400 42878 42675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 45650 43206 gene locus_tag LOCUS_08410 45650 43206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 47258 46365 gene locus_tag LOCUS_08420 47258 46365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 47906 47376 gene locus_tag LOCUS_08430 47906 47376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 48472 49842 gene locus_tag LOCUS_08440 gene dnaA 48472 49842 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_08440 50152 51246 gene locus_tag LOCUS_08450 gene dnaN 50152 51246 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_08450 51322 51395 gene locus_tag LOCUS_t00140 51322 51395 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 51455 53719 gene locus_tag LOCUS_08460 51455 53719 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_08460 53738 55123 gene locus_tag LOCUS_08470 gene mnmE 53738 55123 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_08470 55366 56046 gene locus_tag LOCUS_08480 55366 56046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 56792 58669 gene locus_tag LOCUS_08490 gene mnmG 56792 58669 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115437557.1 protein_id gnl|my_center|LOCUS_08490 62463 59155 gene locus_tag LOCUS_08500 62463 59155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 63289 62612 gene locus_tag LOCUS_08510 63289 62612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 >Feature sequence015 2168 1383 gene locus_tag LOCUS_08520 gene nagB 2168 1383 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_08520 3982 2285 gene locus_tag LOCUS_08530 3982 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 8372 4779 gene locus_tag LOCUS_08540 8372 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 8698 8555 gene locus_tag LOCUS_08550 8698 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 8882 8682 gene locus_tag LOCUS_08560 8882 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9139 8822 gene locus_tag LOCUS_08570 9139 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 9562 9314 gene locus_tag LOCUS_08580 9562 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 10484 9630 gene locus_tag LOCUS_08590 10484 9630 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_08590 10648 11583 gene locus_tag LOCUS_08600 10648 11583 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_08600 11624 12703 gene locus_tag LOCUS_08610 11624 12703 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631126.1 protein_id gnl|my_center|LOCUS_08610 12782 15127 gene locus_tag LOCUS_08620 12782 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 15165 15380 gene locus_tag LOCUS_08630 15165 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 15391 18219 gene locus_tag LOCUS_08640 15391 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 19613 18747 gene locus_tag LOCUS_08650 19613 18747 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838999.1 protein_id gnl|my_center|LOCUS_08650 20353 19613 gene locus_tag LOCUS_08660 20353 19613 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_08660 21651 20353 gene locus_tag LOCUS_08670 gene hisD 21651 20353 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393531.1 protein_id gnl|my_center|LOCUS_08670 22719 22168 gene locus_tag LOCUS_08680 22719 22168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 23942 22716 gene locus_tag LOCUS_08690 23942 22716 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_08690 24181 23939 gene locus_tag LOCUS_08700 24181 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 25175 24228 gene locus_tag LOCUS_08710 25175 24228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 27893 25479 gene locus_tag LOCUS_08720 gene pheT 27893 25479 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_08720 28987 27965 gene locus_tag LOCUS_08730 gene pheS 28987 27965 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_08730 29823 30839 gene locus_tag LOCUS_08740 29823 30839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 30879 31874 gene locus_tag LOCUS_08750 30879 31874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 31896 32093 gene locus_tag LOCUS_08760 31896 32093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 32517 32362 gene locus_tag LOCUS_08770 32517 32362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 32973 32698 gene locus_tag LOCUS_08780 32973 32698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 33142 32954 gene locus_tag LOCUS_08790 33142 32954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 33324 33249 gene locus_tag LOCUS_t00150 33324 33249 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 33410 33335 gene locus_tag LOCUS_t00160 33410 33335 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34390 33482 gene locus_tag LOCUS_08800 34390 33482 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532293.1 protein_id gnl|my_center|LOCUS_08800 35363 34455 gene locus_tag LOCUS_08810 35363 34455 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_08810 36112 35360 gene locus_tag LOCUS_08820 36112 35360 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933673.1 protein_id gnl|my_center|LOCUS_08820 36236 36526 gene locus_tag LOCUS_08830 36236 36526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 37621 36545 gene locus_tag LOCUS_08840 37621 36545 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_08840 38890 37736 gene locus_tag LOCUS_08850 38890 37736 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_08850 39375 38899 gene locus_tag LOCUS_08860 gene fabZ 39375 38899 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_08860 40639 39392 gene locus_tag LOCUS_08870 gene fabF 40639 39392 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_08870 42305 40839 gene locus_tag LOCUS_08880 42305 40839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 43449 42307 gene locus_tag LOCUS_08890 43449 42307 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967202.1 protein_id gnl|my_center|LOCUS_08890 45112 43694 gene locus_tag LOCUS_08900 45112 43694 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_08900 45366 45590 gene locus_tag LOCUS_08910 45366 45590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 45587 47416 gene locus_tag LOCUS_08920 45587 47416 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_08920 47531 48832 gene locus_tag LOCUS_08930 47531 48832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 48874 50304 gene locus_tag LOCUS_08940 48874 50304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 50385 51386 gene locus_tag LOCUS_08950 50385 51386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 51401 52762 gene locus_tag LOCUS_08960 51401 52762 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_08960 52778 54289 gene locus_tag LOCUS_08970 52778 54289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 58120 55331 gene locus_tag LOCUS_08980 58120 55331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 60269 58161 gene locus_tag LOCUS_08990 60269 58161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 61710 60271 gene locus_tag LOCUS_09000 61710 60271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 62023 62202 gene locus_tag LOCUS_09010 62023 62202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence016 324 49 gene locus_tag LOCUS_09020 324 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1912 1700 gene locus_tag LOCUS_09030 1912 1700 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480037.1 protein_id gnl|my_center|LOCUS_09030 3258 2233 gene locus_tag LOCUS_09040 3258 2233 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_09040 4078 3272 gene locus_tag LOCUS_09050 4078 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5957 4098 gene locus_tag LOCUS_09060 5957 4098 CDS product electron-transfer flavoprotein:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143351.1 protein_id gnl|my_center|LOCUS_09060 8166 6079 gene locus_tag LOCUS_09070 8166 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 8426 8617 gene locus_tag LOCUS_09080 8426 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 8972 8889 gene locus_tag LOCUS_t00170 8972 8889 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10238 9339 gene locus_tag LOCUS_09090 10238 9339 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_09090 11341 11676 gene locus_tag LOCUS_09100 11341 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 11697 12083 gene locus_tag LOCUS_09110 11697 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12341 12868 gene locus_tag LOCUS_09120 12341 12868 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942947.1 protein_id gnl|my_center|LOCUS_09120 12887 13444 gene locus_tag LOCUS_09130 12887 13444 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942948.1 protein_id gnl|my_center|LOCUS_09130 13499 14605 gene locus_tag LOCUS_09140 13499 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 14654 15820 gene locus_tag LOCUS_09150 14654 15820 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957591.1 protein_id gnl|my_center|LOCUS_09150 16006 15752 gene locus_tag LOCUS_09160 16006 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 15966 17375 gene locus_tag LOCUS_09170 15966 17375 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943437.1 protein_id gnl|my_center|LOCUS_09170 18023 20089 gene locus_tag LOCUS_09180 18023 20089 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_09180 20438 20995 gene locus_tag LOCUS_09190 20438 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 21100 22131 gene locus_tag LOCUS_09200 21100 22131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 22177 22896 gene locus_tag LOCUS_09210 22177 22896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_09210 22901 23284 gene locus_tag LOCUS_09220 22901 23284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 23306 24469 gene locus_tag LOCUS_09230 23306 24469 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705875.1 protein_id gnl|my_center|LOCUS_09230 24466 25740 gene locus_tag LOCUS_09240 24466 25740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 25737 26474 gene locus_tag LOCUS_09250 25737 26474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 26944 27480 gene locus_tag LOCUS_09260 26944 27480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 27950 28123 gene locus_tag LOCUS_09270 27950 28123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 29593 28682 gene locus_tag LOCUS_09280 29593 28682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 29884 29717 gene locus_tag LOCUS_09290 29884 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 31259 29814 gene locus_tag LOCUS_09300 31259 29814 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_09300 31908 31318 gene locus_tag LOCUS_09310 31908 31318 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_09310 33578 31893 gene locus_tag LOCUS_09320 33578 31893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 33769 34143 gene locus_tag LOCUS_09330 33769 34143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 35030 34326 gene locus_tag LOCUS_09340 gene rlmB 35030 34326 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_09340 35988 35263 gene locus_tag LOCUS_09350 35988 35263 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105341.1 protein_id gnl|my_center|LOCUS_09350 37297 36458 gene locus_tag LOCUS_09360 gene dapF 37297 36458 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_09360 39577 37346 gene locus_tag LOCUS_09370 39577 37346 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_09370 40326 39583 gene locus_tag LOCUS_09380 40326 39583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 41890 40337 gene locus_tag LOCUS_09390 41890 40337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 43404 41974 gene locus_tag LOCUS_09400 43404 41974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 43741 45669 gene locus_tag LOCUS_09410 43741 45669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 47137 45854 gene locus_tag LOCUS_09420 47137 45854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 48281 47241 gene locus_tag LOCUS_09430 48281 47241 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_09430 49976 48648 gene locus_tag LOCUS_09440 gene gltX 49976 48648 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098191.1 protein_id gnl|my_center|LOCUS_09440 51011 50142 gene locus_tag LOCUS_09450 51011 50142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 51184 51041 gene locus_tag LOCUS_09460 51184 51041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 52244 51744 gene locus_tag LOCUS_09470 gene ilvN 52244 51744 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_09470 54021 52264 gene locus_tag LOCUS_09480 54021 52264 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_09480 55384 54572 gene locus_tag LOCUS_09490 55384 54572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 55932 55525 gene locus_tag LOCUS_09500 55932 55525 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768982.1 protein_id gnl|my_center|LOCUS_09500 56678 55932 gene locus_tag LOCUS_09510 gene tolQ 56678 55932 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 protein_id gnl|my_center|LOCUS_09510 58169 56769 gene locus_tag LOCUS_09520 58169 56769 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_09520 58452 59258 gene locus_tag LOCUS_09530 58452 59258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 59255 59938 gene locus_tag LOCUS_09540 59255 59938 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_09540 62261 60597 gene locus_tag LOCUS_09550 62261 60597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence017 499 993 gene locus_tag LOCUS_09560 499 993 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_09560 990 2936 gene locus_tag LOCUS_09570 990 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2980 3369 gene locus_tag LOCUS_09580 2980 3369 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_09580 3667 6807 gene locus_tag LOCUS_09590 3667 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 7019 6825 gene locus_tag LOCUS_09600 7019 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7452 8627 gene locus_tag LOCUS_09610 7452 8627 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545883.1 protein_id gnl|my_center|LOCUS_09610 9619 8897 gene locus_tag LOCUS_09620 9619 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 10050 9634 gene locus_tag LOCUS_09630 gene rnk 10050 9634 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_09630 13135 10292 gene locus_tag LOCUS_09640 13135 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 16352 13332 gene locus_tag LOCUS_09650 16352 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 18710 17208 gene locus_tag LOCUS_09660 18710 17208 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922615.1 protein_id gnl|my_center|LOCUS_09660 20365 18770 gene locus_tag LOCUS_09670 20365 18770 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666312.1 protein_id gnl|my_center|LOCUS_09670 21398 20472 gene locus_tag LOCUS_09680 21398 20472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 21544 21753 gene locus_tag LOCUS_09690 21544 21753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 24941 22275 gene locus_tag LOCUS_09700 24941 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 25441 24938 gene locus_tag LOCUS_09710 25441 24938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 25629 25820 gene locus_tag LOCUS_09720 25629 25820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 25944 26726 gene locus_tag LOCUS_09730 25944 26726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 26889 27884 gene locus_tag LOCUS_09740 26889 27884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 27984 29639 gene locus_tag LOCUS_09750 27984 29639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 29723 30589 gene locus_tag LOCUS_09760 29723 30589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09760 30534 31022 gene locus_tag LOCUS_09770 30534 31022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 31372 34563 gene locus_tag LOCUS_09780 31372 34563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 35209 34661 gene locus_tag LOCUS_09790 35209 34661 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932621.1 protein_id gnl|my_center|LOCUS_09790 36189 35212 gene locus_tag LOCUS_09800 36189 35212 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_09800 37256 36186 gene locus_tag LOCUS_09810 37256 36186 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_09810 38329 37535 gene locus_tag LOCUS_09820 38329 37535 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 protein_id gnl|my_center|LOCUS_09820 38928 38380 gene locus_tag LOCUS_09830 38928 38380 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_09830 40238 38949 gene locus_tag LOCUS_09840 40238 38949 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_09840 40972 40274 gene locus_tag LOCUS_09850 40972 40274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 42005 41058 gene locus_tag LOCUS_09860 42005 41058 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081179.1 protein_id gnl|my_center|LOCUS_09860 43375 42002 gene locus_tag LOCUS_09870 43375 42002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 44049 43420 gene locus_tag LOCUS_09880 44049 43420 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_09880 44705 45721 gene locus_tag LOCUS_09890 44705 45721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 46250 49441 gene locus_tag LOCUS_09900 46250 49441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 49952 49494 gene locus_tag LOCUS_09910 49952 49494 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_09910 50624 50028 gene locus_tag LOCUS_09920 gene lpoB 50624 50028 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706416.1 protein_id gnl|my_center|LOCUS_09920 51097 50666 gene locus_tag LOCUS_09930 51097 50666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 53319 51775 gene locus_tag LOCUS_09940 53319 51775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817955.1 protein_id gnl|my_center|LOCUS_09940 54609 53362 gene locus_tag LOCUS_09950 54609 53362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 55154 54657 gene locus_tag LOCUS_09960 55154 54657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 57037 55502 gene locus_tag LOCUS_09970 gene xylB 57037 55502 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013398.1 protein_id gnl|my_center|LOCUS_09970 57266 57377 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaatcagtgcctgtccctaa 58257 57982 gene locus_tag LOCUS_09980 58257 57982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 60694 58403 gene locus_tag LOCUS_09990 60694 58403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence018 2768 2241 gene locus_tag LOCUS_10000 2768 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 3543 2752 gene locus_tag LOCUS_10010 3543 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3792 3556 gene locus_tag LOCUS_10020 3792 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 6228 3793 gene locus_tag LOCUS_10030 6228 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6558 6271 gene locus_tag LOCUS_10040 6558 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 6748 6620 gene locus_tag LOCUS_10050 6748 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 7413 7012 gene locus_tag LOCUS_10060 7413 7012 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869808.1 protein_id gnl|my_center|LOCUS_10060 9198 7540 gene locus_tag LOCUS_10070 9198 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 11286 9349 gene locus_tag LOCUS_10080 11286 9349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_10080 12211 11291 gene locus_tag LOCUS_10090 gene trxB 12211 11291 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020310.1 protein_id gnl|my_center|LOCUS_10090 13942 12224 gene locus_tag LOCUS_10100 13942 12224 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_10100 15032 13947 gene locus_tag LOCUS_10110 15032 13947 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_10110 16726 15032 gene locus_tag LOCUS_10120 16726 15032 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_10120 18195 16762 gene locus_tag LOCUS_10130 gene gatB 18195 16762 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_10130 19735 18263 gene locus_tag LOCUS_10140 gene gatA 19735 18263 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_10140 20050 19760 gene locus_tag LOCUS_10150 gene gatC 20050 19760 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_10150 21182 20517 gene locus_tag LOCUS_10160 21182 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 22252 21587 gene locus_tag LOCUS_10170 22252 21587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 23291 22377 gene locus_tag LOCUS_10180 23291 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 26338 23606 gene locus_tag LOCUS_10190 26338 23606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 27741 26386 gene locus_tag LOCUS_10200 27741 26386 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 protein_id gnl|my_center|LOCUS_10200 28475 33061 gene locus_tag LOCUS_10210 28475 33061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 33158 33589 gene locus_tag LOCUS_10220 33158 33589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 35830 33908 gene locus_tag LOCUS_10230 35830 33908 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263947.1 protein_id gnl|my_center|LOCUS_10230 40189 35840 gene locus_tag LOCUS_10240 40189 35840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 50629 40322 gene locus_tag LOCUS_10250 50629 40322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 51225 50710 gene locus_tag LOCUS_10260 51225 50710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 51459 53420 gene locus_tag LOCUS_10270 51459 53420 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_10270 53501 54505 gene locus_tag LOCUS_10280 53501 54505 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120892.1 protein_id gnl|my_center|LOCUS_10280 54882 55064 gene locus_tag LOCUS_10290 54882 55064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 56614 55184 gene locus_tag LOCUS_10300 56614 55184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 56846 56556 gene locus_tag LOCUS_10310 56846 56556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 57283 56906 gene locus_tag LOCUS_10320 57283 56906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 57681 57511 gene locus_tag LOCUS_10330 57681 57511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 57709 58452 gene locus_tag LOCUS_10340 57709 58452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 58936 60297 gene locus_tag LOCUS_10350 gene istA 58936 60297 CDS product IS21-like element ISBj11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 protein_id gnl|my_center|LOCUS_10350 60298 61035 gene locus_tag LOCUS_10360 gene istB 60298 61035 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence019 1840 272 gene locus_tag LOCUS_10370 1840 272 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122841.1 protein_id gnl|my_center|LOCUS_10370 2093 1860 gene locus_tag LOCUS_10380 2093 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3021 2353 gene locus_tag LOCUS_10390 3021 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 3853 3056 gene locus_tag LOCUS_10400 3853 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 5013 4024 gene locus_tag LOCUS_10410 5013 4024 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931747.1 protein_id gnl|my_center|LOCUS_10410 5624 5010 gene locus_tag LOCUS_10420 5624 5010 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_10420 6031 5843 gene locus_tag LOCUS_10430 6031 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7209 6028 gene locus_tag LOCUS_10440 7209 6028 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790476.1 protein_id gnl|my_center|LOCUS_10440 7470 8018 gene locus_tag LOCUS_10450 7470 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 9738 8848 gene locus_tag LOCUS_10460 gene lsrF 9738 8848 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098846.1 protein_id gnl|my_center|LOCUS_10460 10399 9788 gene locus_tag LOCUS_10470 gene dhaL 10399 9788 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389096.1 protein_id gnl|my_center|LOCUS_10470 11715 10714 gene locus_tag LOCUS_10480 gene dhaK 11715 10714 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494451.1 protein_id gnl|my_center|LOCUS_10480 12481 12167 gene locus_tag LOCUS_10490 12481 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 13352 12585 gene locus_tag LOCUS_10500 13352 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 13921 13505 gene locus_tag LOCUS_10510 13921 13505 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_10510 15899 13989 gene locus_tag LOCUS_10520 15899 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 16130 15912 gene locus_tag LOCUS_10530 16130 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 18387 16693 gene locus_tag LOCUS_10540 18387 16693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 20270 18384 gene locus_tag LOCUS_10550 20270 18384 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_10550 21856 20483 gene locus_tag LOCUS_10560 21856 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 23362 21866 gene locus_tag LOCUS_10570 23362 21866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 24227 23607 gene locus_tag LOCUS_10580 24227 23607 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_10580 25969 24305 gene locus_tag LOCUS_10590 25969 24305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 27441 25948 gene locus_tag LOCUS_10600 27441 25948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 28876 27458 gene locus_tag LOCUS_10610 28876 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 29598 29017 gene locus_tag LOCUS_10620 29598 29017 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_10620 32563 29765 gene locus_tag LOCUS_10630 32563 29765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 32820 32560 gene locus_tag LOCUS_10640 32820 32560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 33776 32820 gene locus_tag LOCUS_10650 33776 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 36577 33917 gene locus_tag LOCUS_10660 36577 33917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 37648 36971 gene locus_tag LOCUS_10670 37648 36971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 38701 37793 gene locus_tag LOCUS_10680 38701 37793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 39692 39018 gene locus_tag LOCUS_10690 39692 39018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 41536 39995 gene locus_tag LOCUS_10700 41536 39995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 41699 41520 gene locus_tag LOCUS_10710 41699 41520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 43796 41856 gene locus_tag LOCUS_10720 43796 41856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 45690 43939 gene locus_tag LOCUS_10730 45690 43939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 47312 46788 gene locus_tag LOCUS_10740 47312 46788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 48434 47730 gene locus_tag LOCUS_10750 48434 47730 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_10750 50590 49445 gene locus_tag LOCUS_10760 50590 49445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 50777 50631 gene locus_tag LOCUS_10770 50777 50631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 52231 51056 gene locus_tag LOCUS_10780 52231 51056 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_10780 53789 52596 gene locus_tag LOCUS_10790 53789 52596 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462479.1 protein_id gnl|my_center|LOCUS_10790 55072 54359 gene locus_tag LOCUS_10800 55072 54359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 55739 55335 gene locus_tag LOCUS_10810 55739 55335 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_10810 57525 56755 gene locus_tag LOCUS_10820 57525 56755 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 protein_id gnl|my_center|LOCUS_10820 59699 59055 gene locus_tag LOCUS_10830 59699 59055 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_10830 61118 60894 gene locus_tag LOCUS_10840 61118 60894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 61296 61096 gene locus_tag LOCUS_10850 61296 61096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence020 332 1741 gene locus_tag LOCUS_10860 332 1741 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767194.1 protein_id gnl|my_center|LOCUS_10860 2443 3099 gene locus_tag LOCUS_10870 2443 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3190 4812 gene locus_tag LOCUS_10880 3190 4812 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_10880 4874 5176 gene locus_tag LOCUS_10890 4874 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5527 8658 gene locus_tag LOCUS_10900 5527 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 8999 11767 gene locus_tag LOCUS_10910 8999 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 11686 12399 gene locus_tag LOCUS_10920 11686 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 12735 12565 gene locus_tag LOCUS_10930 12735 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 12812 15847 gene locus_tag LOCUS_10940 12812 15847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 15877 19380 gene locus_tag LOCUS_10950 15877 19380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 19391 19705 gene locus_tag LOCUS_10960 gene rhaM 19391 19705 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_10960 19923 20162 gene locus_tag LOCUS_10970 19923 20162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 20243 22396 gene locus_tag LOCUS_10980 20243 22396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 22453 25854 gene locus_tag LOCUS_10990 22453 25854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 25863 26063 gene locus_tag LOCUS_11000 25863 26063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 26255 26866 gene locus_tag LOCUS_11010 gene wrbA 26255 26866 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_11010 26895 28883 gene locus_tag LOCUS_11020 26895 28883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 28876 30687 gene locus_tag LOCUS_11030 28876 30687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 31099 34692 gene locus_tag LOCUS_11040 31099 34692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 35026 35721 gene locus_tag LOCUS_11050 gene rpe 35026 35721 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027876.1 protein_id gnl|my_center|LOCUS_11050 35731 37548 gene locus_tag LOCUS_11060 gene lepA 35731 37548 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_11060 38058 39212 gene locus_tag LOCUS_11070 38058 39212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 39320 40447 gene locus_tag LOCUS_11080 39320 40447 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764572.1 protein_id gnl|my_center|LOCUS_11080 40569 40997 gene locus_tag LOCUS_11090 gene rplM 40569 40997 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418312.1 protein_id gnl|my_center|LOCUS_11090 41032 41424 gene locus_tag LOCUS_11100 gene rpsI 41032 41424 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_11100 41537 43888 gene locus_tag LOCUS_11110 41537 43888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 44216 44665 gene locus_tag LOCUS_11120 44216 44665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 44688 46286 gene locus_tag LOCUS_11130 44688 46286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 46444 47784 gene locus_tag LOCUS_11140 46444 47784 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_11140 47923 50784 gene locus_tag LOCUS_11150 47923 50784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 51417 54200 gene locus_tag LOCUS_11160 51417 54200 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898759.1 protein_id gnl|my_center|LOCUS_11160 54197 56692 gene locus_tag LOCUS_11170 54197 56692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 57572 56955 gene locus_tag LOCUS_11180 57572 56955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 57777 59084 gene locus_tag LOCUS_11190 gene aroA 57777 59084 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141040.1 protein_id gnl|my_center|LOCUS_11190 59379 60458 gene locus_tag LOCUS_11200 gene queA 59379 60458 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence021 443 796 gene locus_tag LOCUS_11210 443 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3185 2112 gene locus_tag LOCUS_11220 gene purM 3185 2112 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404229.1 protein_id gnl|my_center|LOCUS_11220 3504 3689 gene locus_tag LOCUS_11230 3504 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6228 3730 gene locus_tag LOCUS_11240 6228 3730 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_11240 10854 6346 gene locus_tag LOCUS_11250 10854 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 11141 11557 gene locus_tag LOCUS_11260 11141 11557 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945928.1 protein_id gnl|my_center|LOCUS_11260 12811 12266 gene locus_tag LOCUS_11270 12811 12266 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_11270 12971 14704 gene locus_tag LOCUS_11280 12971 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 14741 16261 gene locus_tag LOCUS_11290 14741 16261 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_11290 19073 16278 gene locus_tag LOCUS_11300 19073 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 21333 19888 gene locus_tag LOCUS_11310 21333 19888 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_11310 23212 21404 gene locus_tag LOCUS_11320 23212 21404 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_11320 23491 23264 gene locus_tag LOCUS_11330 23491 23264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 23721 24857 gene locus_tag LOCUS_11340 23721 24857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 25799 29563 gene locus_tag LOCUS_11350 25799 29563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 30416 31648 gene locus_tag LOCUS_11360 30416 31648 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_11360 32983 31652 gene locus_tag LOCUS_11370 32983 31652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 35409 32980 gene locus_tag LOCUS_11380 35409 32980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 35971 36267 gene locus_tag LOCUS_11390 35971 36267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 36939 37184 gene locus_tag LOCUS_11400 36939 37184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 37171 37581 gene locus_tag LOCUS_11410 37171 37581 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_11410 40662 37729 gene locus_tag LOCUS_11420 40662 37729 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_11420 41918 47470 gene locus_tag LOCUS_11430 41918 47470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 47380 53970 gene locus_tag LOCUS_11440 47380 53970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 54227 57283 gene locus_tag LOCUS_11450 54227 57283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 57346 57681 gene locus_tag LOCUS_11460 57346 57681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 58361 57945 gene locus_tag LOCUS_11470 58361 57945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 58558 58358 gene locus_tag LOCUS_11480 58558 58358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 59147 59341 gene locus_tag LOCUS_11490 59147 59341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 59341 59628 gene locus_tag LOCUS_11500 59341 59628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 59687 59995 gene locus_tag LOCUS_11510 59687 59995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 60328 60002 gene locus_tag LOCUS_11520 60328 60002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence022 1957 3009 gene locus_tag LOCUS_11530 1957 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3029 3400 gene locus_tag LOCUS_11540 3029 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3502 4605 gene locus_tag LOCUS_11550 3502 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 5110 4565 gene locus_tag LOCUS_11560 5110 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6840 5125 gene locus_tag LOCUS_11570 6840 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_11570 8348 6879 gene locus_tag LOCUS_11580 8348 6879 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402023.1 protein_id gnl|my_center|LOCUS_11580 8546 8965 gene locus_tag LOCUS_11590 gene mscL 8546 8965 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399960.1 protein_id gnl|my_center|LOCUS_11590 10876 9071 gene locus_tag LOCUS_11600 10876 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 13186 10934 gene locus_tag LOCUS_11610 13186 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 14880 13648 gene locus_tag LOCUS_11620 14880 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 15744 15484 gene locus_tag LOCUS_11630 15744 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11630 16347 15778 gene locus_tag LOCUS_11640 16347 15778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 18412 16358 gene locus_tag LOCUS_11650 18412 16358 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118381.1 protein_id gnl|my_center|LOCUS_11650 18935 19873 gene locus_tag LOCUS_11660 18935 19873 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394598.1 protein_id gnl|my_center|LOCUS_11660 19860 21236 gene locus_tag LOCUS_11670 19860 21236 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_11670 22261 21218 gene locus_tag LOCUS_11680 22261 21218 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_11680 23867 22734 gene locus_tag LOCUS_11690 23867 22734 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_11690 24919 23891 gene locus_tag LOCUS_11700 24919 23891 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 protein_id gnl|my_center|LOCUS_11700 26151 24934 gene locus_tag LOCUS_11710 26151 24934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_11710 26428 28383 gene locus_tag LOCUS_11720 26428 28383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 29929 28730 gene locus_tag LOCUS_11730 29929 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 30129 31400 gene locus_tag LOCUS_11740 gene purD 30129 31400 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_11740 31468 31974 gene locus_tag LOCUS_11750 gene purE 31468 31974 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_11750 32009 33811 gene locus_tag LOCUS_11760 32009 33811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 33987 35372 gene locus_tag LOCUS_11770 33987 35372 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_11770 35490 37637 gene locus_tag LOCUS_11780 35490 37637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 39585 37618 gene locus_tag LOCUS_11790 39585 37618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 39953 39582 gene locus_tag LOCUS_11800 39953 39582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 40768 39956 gene locus_tag LOCUS_11810 40768 39956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 40935 42224 gene locus_tag LOCUS_11820 40935 42224 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815633.1 protein_id gnl|my_center|LOCUS_11820 42630 43223 gene locus_tag LOCUS_11830 gene ruvA 42630 43223 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_11830 45090 44173 gene locus_tag LOCUS_11840 45090 44173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 46678 45113 gene locus_tag LOCUS_11850 46678 45113 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_11850 49101 46717 gene locus_tag LOCUS_11860 49101 46717 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_11860 50988 49141 gene locus_tag LOCUS_11870 50988 49141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 52452 51022 gene locus_tag LOCUS_11880 52452 51022 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 protein_id gnl|my_center|LOCUS_11880 53576 52707 gene locus_tag LOCUS_11890 53576 52707 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_11890 55270 53573 gene locus_tag LOCUS_11900 55270 53573 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080205.1 protein_id gnl|my_center|LOCUS_11900 56004 55312 gene locus_tag LOCUS_11910 56004 55312 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_11910 56360 56073 gene locus_tag LOCUS_11920 56360 56073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 <57436 56308 gene locus_tag LOCUS_11930 <57436 56308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267266.1:4-phosphoerythronate dehydrogenase PdxB >Feature sequence023 3995 1236 gene locus_tag LOCUS_11940 3995 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 7334 4308 gene locus_tag LOCUS_11950 7334 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 7606 7331 gene locus_tag LOCUS_11960 7606 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 7816 10020 gene locus_tag LOCUS_11970 7816 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 10323 13052 gene locus_tag LOCUS_11980 gene polA 10323 13052 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_11980 13400 13972 gene locus_tag LOCUS_11990 13400 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 13969 15231 gene locus_tag LOCUS_12000 13969 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 15389 16789 gene locus_tag LOCUS_12010 15389 16789 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_12010 16791 18308 gene locus_tag LOCUS_12020 16791 18308 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437136.1 protein_id gnl|my_center|LOCUS_12020 20629 18626 gene locus_tag LOCUS_12030 gene tkt 20629 18626 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944033.1 protein_id gnl|my_center|LOCUS_12030 21626 20742 gene locus_tag LOCUS_12040 21626 20742 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_12040 21742 22380 gene locus_tag LOCUS_12050 21742 22380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 22530 23372 gene locus_tag LOCUS_12060 22530 23372 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942064.1 protein_id gnl|my_center|LOCUS_12060 24879 24067 gene locus_tag LOCUS_12070 gene trpA 24879 24067 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383540.1 protein_id gnl|my_center|LOCUS_12070 26108 24885 gene locus_tag LOCUS_12080 gene trpB 26108 24885 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 protein_id gnl|my_center|LOCUS_12080 27705 26638 gene locus_tag LOCUS_12090 27705 26638 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109525.1 protein_id gnl|my_center|LOCUS_12090 28364 27708 gene locus_tag LOCUS_12100 28364 27708 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 protein_id gnl|my_center|LOCUS_12100 29220 28438 gene locus_tag LOCUS_12110 gene trpC 29220 28438 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_12110 30288 29269 gene locus_tag LOCUS_12120 gene trpD 30288 29269 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_12120 30866 30288 gene locus_tag LOCUS_12130 30866 30288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12130 32354 30912 gene locus_tag LOCUS_12140 gene trpE 32354 30912 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_12140 32651 32782 gene locus_tag LOCUS_12150 32651 32782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 34170 33652 gene locus_tag LOCUS_12160 34170 33652 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938692.1 protein_id gnl|my_center|LOCUS_12160 34555 35016 gene locus_tag LOCUS_12170 34555 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 35652 40235 gene locus_tag LOCUS_12180 35652 40235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 41293 41613 gene locus_tag LOCUS_12190 41293 41613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 41901 42131 gene locus_tag LOCUS_12200 41901 42131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 42085 42345 gene locus_tag LOCUS_12210 42085 42345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 48405 42631 gene locus_tag LOCUS_12220 48405 42631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 48843 48520 gene locus_tag LOCUS_12230 48843 48520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 49045 50229 gene locus_tag LOCUS_12240 49045 50229 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_12240 50303 51082 gene locus_tag LOCUS_12250 50303 51082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 54007 51134 gene locus_tag LOCUS_12260 54007 51134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 55455 54682 gene locus_tag LOCUS_12270 55455 54682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence024 4112 933 gene locus_tag LOCUS_12280 4112 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4952 4119 gene locus_tag LOCUS_12290 4952 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 5229 7658 gene locus_tag LOCUS_12300 5229 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 8202 7804 gene locus_tag LOCUS_12310 8202 7804 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_12310 9269 8304 gene locus_tag LOCUS_12320 9269 8304 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_12320 11758 9971 gene locus_tag LOCUS_12330 11758 9971 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_12330 13329 12235 gene locus_tag LOCUS_12340 gene hydE 13329 12235 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_12340 14390 13326 gene locus_tag LOCUS_12350 gene mnmA 14390 13326 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_12350 14561 14797 gene locus_tag LOCUS_12360 14561 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 14815 16782 gene locus_tag LOCUS_12370 14815 16782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 16817 17791 gene locus_tag LOCUS_12380 16817 17791 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_12380 18289 19311 gene locus_tag LOCUS_12390 18289 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12390 19372 21630 gene locus_tag LOCUS_12400 19372 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12400 22182 23342 gene locus_tag LOCUS_12410 22182 23342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 23425 23982 gene locus_tag LOCUS_12420 23425 23982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 23991 24530 gene locus_tag LOCUS_12430 23991 24530 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_12430 24527 25642 gene locus_tag LOCUS_12440 24527 25642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 26061 26621 gene locus_tag LOCUS_12450 26061 26621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 27874 26618 gene locus_tag LOCUS_12460 27874 26618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 28168 27962 gene locus_tag LOCUS_12470 28168 27962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 28400 28987 gene locus_tag LOCUS_12480 28400 28987 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_12480 28984 29565 gene locus_tag LOCUS_12490 28984 29565 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114038.1 protein_id gnl|my_center|LOCUS_12490 29632 31092 gene locus_tag LOCUS_12500 29632 31092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 32296 31763 gene locus_tag LOCUS_12510 32296 31763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 33625 32861 gene locus_tag LOCUS_12520 33625 32861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 34707 33748 gene locus_tag LOCUS_12530 34707 33748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 35237 36610 gene locus_tag LOCUS_12540 35237 36610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 36965 36807 gene locus_tag LOCUS_12550 36965 36807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 37008 37298 gene locus_tag LOCUS_12560 37008 37298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 37322 38014 gene locus_tag LOCUS_12570 37322 38014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 38125 39294 gene locus_tag LOCUS_12580 38125 39294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 39291 39977 gene locus_tag LOCUS_12590 39291 39977 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_12590 42165 41206 gene locus_tag LOCUS_12600 42165 41206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_12600 43775 42168 gene locus_tag LOCUS_12610 43775 42168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 44849 43782 gene locus_tag LOCUS_12620 44849 43782 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 protein_id gnl|my_center|LOCUS_12620 44973 45046 gene locus_tag LOCUS_t00180 44973 45046 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 45241 47571 gene locus_tag LOCUS_12630 45241 47571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 47471 48355 gene locus_tag LOCUS_12640 47471 48355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 52023 48643 gene locus_tag LOCUS_12650 52023 48643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 52371 53741 gene locus_tag LOCUS_12660 52371 53741 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_12660 53838 54713 gene locus_tag LOCUS_12670 53838 54713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 55834 55130 gene locus_tag LOCUS_12680 55834 55130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence025 1952 657 gene locus_tag LOCUS_12690 1952 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3211 5373 gene locus_tag LOCUS_12700 3211 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 8299 5936 gene locus_tag LOCUS_12710 8299 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 11117 9510 gene locus_tag LOCUS_12720 11117 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 13148 11478 gene locus_tag LOCUS_12730 13148 11478 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_12730 14625 13354 gene locus_tag LOCUS_12740 14625 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 15466 14684 gene locus_tag LOCUS_12750 15466 14684 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_12750 18635 15699 gene locus_tag LOCUS_12760 18635 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 18925 18632 gene locus_tag LOCUS_12770 18925 18632 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817201.1 protein_id gnl|my_center|LOCUS_12770 20676 19738 gene locus_tag LOCUS_12780 20676 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 21752 20673 gene locus_tag LOCUS_12790 21752 20673 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_12790 23254 21860 gene locus_tag LOCUS_12800 23254 21860 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_12800 29052 23548 gene locus_tag LOCUS_12810 29052 23548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 29168 30322 gene locus_tag LOCUS_12820 29168 30322 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_12820 30479 32221 gene locus_tag LOCUS_12830 30479 32221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 32287 33354 gene locus_tag LOCUS_12840 32287 33354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 33479 34393 gene locus_tag LOCUS_12850 33479 34393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 34315 34719 gene locus_tag LOCUS_12860 34315 34719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 35032 35853 gene locus_tag LOCUS_12870 gene panB 35032 35853 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_12870 35869 37287 gene locus_tag LOCUS_12880 35869 37287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 37287 40598 gene locus_tag LOCUS_12890 37287 40598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 40824 42317 gene locus_tag LOCUS_12900 gene guaB 40824 42317 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_12900 42576 42743 gene locus_tag LOCUS_12910 42576 42743 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_12910 42831 44351 gene locus_tag LOCUS_12920 42831 44351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 44388 45251 gene locus_tag LOCUS_12930 44388 45251 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933356.1 protein_id gnl|my_center|LOCUS_12930 45671 46951 gene locus_tag LOCUS_12940 45671 46951 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_12940 48490 46985 gene locus_tag LOCUS_12950 48490 46985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 49941 48487 gene locus_tag LOCUS_12960 49941 48487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 50014 50301 gene locus_tag LOCUS_12970 50014 50301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 51198 50374 gene locus_tag LOCUS_12980 51198 50374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12980 51732 51199 gene locus_tag LOCUS_12990 51732 51199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12990 51891 52541 gene locus_tag LOCUS_13000 51891 52541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence026 3939 2563 gene locus_tag LOCUS_13010 3939 2563 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924853.1 protein_id gnl|my_center|LOCUS_13010 7107 3982 gene locus_tag LOCUS_13020 7107 3982 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393549.1 protein_id gnl|my_center|LOCUS_13020 8357 7104 gene locus_tag LOCUS_13030 8357 7104 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967877.1 protein_id gnl|my_center|LOCUS_13030 9064 8453 gene locus_tag LOCUS_13040 gene acrS 9064 8453 CDS product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129529.1 protein_id gnl|my_center|LOCUS_13040 10811 9822 gene locus_tag LOCUS_13050 10811 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 11587 10826 gene locus_tag LOCUS_13060 11587 10826 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_13060 13457 11838 gene locus_tag LOCUS_13070 13457 11838 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_13070 13726 14520 gene locus_tag LOCUS_13080 13726 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 14940 15128 gene locus_tag LOCUS_13090 14940 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 17913 15121 gene locus_tag LOCUS_13100 17913 15121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 18744 17983 gene locus_tag LOCUS_13110 18744 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13110 19414 19007 gene locus_tag LOCUS_13120 19414 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 20224 19538 gene locus_tag LOCUS_13130 20224 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 21493 21918 gene locus_tag LOCUS_13140 21493 21918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 21950 22966 gene locus_tag LOCUS_13150 21950 22966 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705322.1 protein_id gnl|my_center|LOCUS_13150 23399 23055 gene locus_tag LOCUS_13160 gene rsfS 23399 23055 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257176.1 protein_id gnl|my_center|LOCUS_13160 24016 23414 gene locus_tag LOCUS_13170 24016 23414 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 protein_id gnl|my_center|LOCUS_13170 25096 24068 gene locus_tag LOCUS_13180 gene ugpC 25096 24068 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_13180 25366 25175 gene locus_tag LOCUS_13190 25366 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 26273 25347 gene locus_tag LOCUS_13200 gene hslO 26273 25347 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125179.1 protein_id gnl|my_center|LOCUS_13200 28410 26365 gene locus_tag LOCUS_13210 28410 26365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 29788 28499 gene locus_tag LOCUS_13220 29788 28499 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_13220 30848 29817 gene locus_tag LOCUS_13230 30848 29817 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_13230 31460 31122 gene locus_tag LOCUS_13240 31460 31122 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_13240 31658 31497 gene locus_tag LOCUS_13250 31658 31497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 32847 31648 gene locus_tag LOCUS_13260 32847 31648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 33391 33050 gene locus_tag LOCUS_13270 33391 33050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 33907 33464 gene locus_tag LOCUS_13280 33907 33464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 34906 37719 gene locus_tag LOCUS_13290 34906 37719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 37998 40763 gene locus_tag LOCUS_13300 37998 40763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 41349 41071 gene locus_tag LOCUS_13310 41349 41071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 42037 41540 gene locus_tag LOCUS_13320 42037 41540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 42711 43091 gene locus_tag LOCUS_13330 42711 43091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 43208 43864 gene locus_tag LOCUS_13340 43208 43864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 44821 43976 gene locus_tag LOCUS_13350 gene nfo 44821 43976 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_13350 45876 45001 gene locus_tag LOCUS_13360 gene prmC 45876 45001 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_13360 46828 46490 gene locus_tag LOCUS_13370 46828 46490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 47183 46929 gene locus_tag LOCUS_13380 47183 46929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 47688 47206 gene locus_tag LOCUS_13390 gene smpB 47688 47206 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_13390 47969 47724 gene locus_tag LOCUS_13400 47969 47724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 48116 48189 gene locus_tag LOCUS_t00190 48116 48189 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 48198 48283 gene locus_tag LOCUS_t00200 48198 48283 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48926 49096 gene locus_tag LOCUS_13410 48926 49096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 49386 49165 gene locus_tag LOCUS_13420 49386 49165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 49504 49731 gene locus_tag LOCUS_13430 49504 49731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 49694 51871 gene locus_tag LOCUS_13440 49694 51871 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence027 881 12 gene locus_tag LOCUS_13450 881 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2019 1144 gene locus_tag LOCUS_13460 2019 1144 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870266.1 protein_id gnl|my_center|LOCUS_13460 3028 2348 gene locus_tag LOCUS_13470 3028 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3222 7646 gene locus_tag LOCUS_13480 3222 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 8189 8623 gene locus_tag LOCUS_13490 8189 8623 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933365.1 protein_id gnl|my_center|LOCUS_13490 9128 11290 gene locus_tag LOCUS_13500 9128 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 11262 11450 gene locus_tag LOCUS_13510 11262 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 11389 12321 gene locus_tag LOCUS_13520 11389 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 12330 12851 gene locus_tag LOCUS_13530 gene lspA 12330 12851 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_13530 12835 13788 gene locus_tag LOCUS_13540 gene miaA 12835 13788 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531036.1 protein_id gnl|my_center|LOCUS_13540 13757 14539 gene locus_tag LOCUS_13550 gene radC 13757 14539 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_13550 14555 15610 gene locus_tag LOCUS_13560 gene srlD 14555 15610 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_13560 15771 16886 gene locus_tag LOCUS_13570 15771 16886 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_13570 17278 17138 gene locus_tag LOCUS_13580 17278 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 18113 17607 gene locus_tag LOCUS_13590 18113 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 19464 18655 gene locus_tag LOCUS_13600 gene dapB 19464 18655 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_13600 20681 19812 gene locus_tag LOCUS_13610 gene dapA 20681 19812 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_13610 21069 21932 gene locus_tag LOCUS_13620 21069 21932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 22056 23336 gene locus_tag LOCUS_13630 22056 23336 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_13630 25122 24007 gene locus_tag LOCUS_13640 25122 24007 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876410.1 protein_id gnl|my_center|LOCUS_13640 27084 25237 gene locus_tag LOCUS_13650 27084 25237 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922133.1 protein_id gnl|my_center|LOCUS_13650 28024 27140 gene locus_tag LOCUS_13660 28024 27140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 28318 28025 gene locus_tag LOCUS_13670 28318 28025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 28589 30553 gene locus_tag LOCUS_13680 28589 30553 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008705477.1 protein_id gnl|my_center|LOCUS_13680 31263 32054 gene locus_tag LOCUS_13690 31263 32054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 32066 34096 gene locus_tag LOCUS_13700 32066 34096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 34157 34873 gene locus_tag LOCUS_13710 34157 34873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 34880 35500 gene locus_tag LOCUS_13720 34880 35500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 35593 38028 gene locus_tag LOCUS_13730 35593 38028 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_13730 39256 40203 gene locus_tag LOCUS_13740 39256 40203 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_13740 40852 40364 gene locus_tag LOCUS_13750 40852 40364 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_13750 41688 40906 gene locus_tag LOCUS_13760 41688 40906 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_13760 43935 42589 gene locus_tag LOCUS_13770 43935 42589 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_13770 44150 45217 gene locus_tag LOCUS_13780 44150 45217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 45393 48245 gene locus_tag LOCUS_13790 45393 48245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 48483 50336 gene locus_tag LOCUS_13800 48483 50336 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922207.1 protein_id gnl|my_center|LOCUS_13800 50330 51685 gene locus_tag LOCUS_13810 50330 51685 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence028 1968 685 gene locus_tag LOCUS_13820 1968 685 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723081.1 protein_id gnl|my_center|LOCUS_13820 3081 2113 gene locus_tag LOCUS_13830 3081 2113 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108438.1 protein_id gnl|my_center|LOCUS_13830 4539 3937 gene locus_tag LOCUS_13840 4539 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6271 4844 gene locus_tag LOCUS_13850 6271 4844 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_13850 6749 6255 gene locus_tag LOCUS_13860 gene nrfH 6749 6255 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_13860 6906 9287 gene locus_tag LOCUS_13870 6906 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 11976 9823 gene locus_tag LOCUS_13880 11976 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 12835 13314 gene locus_tag LOCUS_13890 gene eco 12835 13314 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706134.1 protein_id gnl|my_center|LOCUS_13890 13954 14625 gene locus_tag LOCUS_13900 13954 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 14634 15965 gene locus_tag LOCUS_13910 14634 15965 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921850.1 protein_id gnl|my_center|LOCUS_13910 16921 16007 gene locus_tag LOCUS_13920 16921 16007 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073864.1 protein_id gnl|my_center|LOCUS_13920 18052 17198 gene locus_tag LOCUS_13930 18052 17198 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_13930 18266 18853 gene locus_tag LOCUS_13940 18266 18853 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933158.1 protein_id gnl|my_center|LOCUS_13940 19006 20853 gene locus_tag LOCUS_13950 19006 20853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 21840 20938 gene locus_tag LOCUS_13960 21840 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 22019 21837 gene locus_tag LOCUS_13970 22019 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 22270 24273 gene locus_tag LOCUS_13980 22270 24273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_13980 24858 26555 gene locus_tag LOCUS_13990 24858 26555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 27200 27505 gene locus_tag LOCUS_14000 27200 27505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 27592 31740 gene locus_tag LOCUS_14010 27592 31740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 32341 40347 gene locus_tag LOCUS_14020 32341 40347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 40907 41842 gene locus_tag LOCUS_14030 40907 41842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 44736 42031 gene locus_tag LOCUS_14040 44736 42031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 46569 44932 gene locus_tag LOCUS_14050 46569 44932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 46744 47751 gene locus_tag LOCUS_14060 gene mmsR 46744 47751 CDS product MmsAB operon transcriptional regulator MmsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122160.1 protein_id gnl|my_center|LOCUS_14060 47895 50402 gene locus_tag LOCUS_14070 47895 50402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence029 357 4151 gene locus_tag LOCUS_14080 357 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4148 6127 gene locus_tag LOCUS_14090 4148 6127 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_14090 9783 7480 gene locus_tag LOCUS_14100 9783 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 13731 10660 gene locus_tag LOCUS_14110 gene vexK 13731 10660 CDS product efflux RND transporter permease subunit VexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625968.1 protein_id gnl|my_center|LOCUS_14110 14852 13731 gene locus_tag LOCUS_14120 14852 13731 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261804.1 protein_id gnl|my_center|LOCUS_14120 16452 15094 gene locus_tag LOCUS_14130 16452 15094 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_14130 17526 19682 gene locus_tag LOCUS_14140 17526 19682 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922418.1 protein_id gnl|my_center|LOCUS_14140 19679 20779 gene locus_tag LOCUS_14150 19679 20779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 20919 21827 gene locus_tag LOCUS_14160 20919 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 21834 25121 gene locus_tag LOCUS_14170 21834 25121 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_14170 25587 25339 gene locus_tag LOCUS_14180 25587 25339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 26336 26157 gene locus_tag LOCUS_14190 26336 26157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 28439 26418 gene locus_tag LOCUS_14200 28439 26418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 28967 30409 gene locus_tag LOCUS_14210 28967 30409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 30424 36588 gene locus_tag LOCUS_14220 30424 36588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 36591 36794 gene locus_tag LOCUS_14230 36591 36794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 37866 38375 gene locus_tag LOCUS_14240 37866 38375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 38372 38761 gene locus_tag LOCUS_14250 38372 38761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 39821 38904 gene locus_tag LOCUS_14260 39821 38904 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_14260 40380 39826 gene locus_tag LOCUS_14270 40380 39826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 40944 40750 gene locus_tag LOCUS_14280 40944 40750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 41308 40997 gene locus_tag LOCUS_14290 41308 40997 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263487.1 protein_id gnl|my_center|LOCUS_14290 41553 41296 gene locus_tag LOCUS_14300 41553 41296 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263488.1 protein_id gnl|my_center|LOCUS_14300 42022 41699 gene locus_tag LOCUS_14310 42022 41699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 42998 42216 gene locus_tag LOCUS_14320 42998 42216 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867618.1 protein_id gnl|my_center|LOCUS_14320 44151 43147 gene locus_tag LOCUS_14330 44151 43147 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_14330 46415 44904 gene locus_tag LOCUS_14340 46415 44904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 47250 47414 gene locus_tag LOCUS_14350 47250 47414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence030 <1 2813 gene locus_tag LOCUS_14360 <1 2813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 5536 3380 gene locus_tag LOCUS_14370 5536 3380 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_14370 7359 5533 gene locus_tag LOCUS_14380 7359 5533 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_14380 8110 7469 gene locus_tag LOCUS_14390 8110 7469 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 protein_id gnl|my_center|LOCUS_14390 8403 10553 gene locus_tag LOCUS_14400 8403 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 10687 11064 gene locus_tag LOCUS_14410 10687 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 11147 11863 gene locus_tag LOCUS_14420 11147 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 11920 14139 gene locus_tag LOCUS_14430 11920 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 14151 14477 gene locus_tag LOCUS_14440 14151 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 14794 15423 gene locus_tag LOCUS_14450 14794 15423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 15490 16335 gene locus_tag LOCUS_14460 gene yhdJ 15490 16335 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 protein_id gnl|my_center|LOCUS_14460 16488 17087 gene locus_tag LOCUS_14470 16488 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 17326 17985 gene locus_tag LOCUS_14480 17326 17985 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_14480 18413 19405 gene locus_tag LOCUS_14490 gene amrS 18413 19405 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_14490 19662 19462 gene locus_tag LOCUS_14500 19662 19462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 19957 19598 gene locus_tag LOCUS_14510 19957 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 21245 20373 gene locus_tag LOCUS_14520 21245 20373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 22063 21422 gene locus_tag LOCUS_14530 22063 21422 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_14530 23811 22072 gene locus_tag LOCUS_14540 23811 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 24219 23845 gene locus_tag LOCUS_14550 24219 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 26024 24114 gene locus_tag LOCUS_14560 26024 24114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 26255 26497 gene locus_tag LOCUS_14570 26255 26497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 26566 26913 gene locus_tag LOCUS_14580 26566 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 28167 27115 gene locus_tag LOCUS_14590 28167 27115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 29246 28113 gene locus_tag LOCUS_14600 29246 28113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 31135 29615 gene locus_tag LOCUS_14610 31135 29615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 31851 31174 gene locus_tag LOCUS_14620 31851 31174 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084526.1 protein_id gnl|my_center|LOCUS_14620 33157 32207 gene locus_tag LOCUS_14630 33157 32207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 34559 33288 gene locus_tag LOCUS_14640 34559 33288 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_14640 36448 35552 gene locus_tag LOCUS_14650 gene uvsE 36448 35552 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227599.1 protein_id gnl|my_center|LOCUS_14650 36868 37962 gene locus_tag LOCUS_14660 36868 37962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 protein_id gnl|my_center|LOCUS_14660 37966 39645 gene locus_tag LOCUS_14670 37966 39645 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255514.1 protein_id gnl|my_center|LOCUS_14670 40653 41147 gene locus_tag LOCUS_14680 40653 41147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 41289 42080 gene locus_tag LOCUS_14690 41289 42080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 42145 42558 gene locus_tag LOCUS_14700 42145 42558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 42837 43115 gene locus_tag LOCUS_14710 42837 43115 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_14710 43108 43431 gene locus_tag LOCUS_14720 43108 43431 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence031 961 116 gene locus_tag LOCUS_14730 961 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1935 958 gene locus_tag LOCUS_14740 1935 958 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_14740 2245 3846 gene locus_tag LOCUS_14750 2245 3846 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583551.1 protein_id gnl|my_center|LOCUS_14750 4548 4647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5630 4821 gene locus_tag LOCUS_14760 5630 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 5845 5624 gene locus_tag LOCUS_14770 5845 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 6516 5869 gene locus_tag LOCUS_14780 6516 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6761 9136 gene locus_tag LOCUS_14790 6761 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 9292 11796 gene locus_tag LOCUS_14800 9292 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 11829 13244 gene locus_tag LOCUS_14810 gene thrC 11829 13244 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_14810 13300 13578 gene locus_tag LOCUS_14820 13300 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 20544 14830 gene locus_tag LOCUS_14830 20544 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 21532 21631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21933 22139 gene locus_tag LOCUS_14840 21933 22139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 23196 22126 gene locus_tag LOCUS_14850 23196 22126 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_14850 23348 24814 gene locus_tag LOCUS_14860 gene glpK 23348 24814 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_14860 25181 26188 gene locus_tag LOCUS_14870 25181 26188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 26829 26434 gene locus_tag LOCUS_14880 26829 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 27409 27047 gene locus_tag LOCUS_14890 27409 27047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 27664 28644 gene locus_tag LOCUS_14900 27664 28644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 28703 29578 gene locus_tag LOCUS_14910 gene rsmA 28703 29578 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618805.1 protein_id gnl|my_center|LOCUS_14910 29600 30778 gene locus_tag LOCUS_14920 29600 30778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 30831 32198 gene locus_tag LOCUS_14930 gene argH 30831 32198 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082327.1 protein_id gnl|my_center|LOCUS_14930 32247 33035 gene locus_tag LOCUS_14940 32247 33035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 33032 33466 gene locus_tag LOCUS_14950 33032 33466 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_14950 33467 35788 gene locus_tag LOCUS_14960 33467 35788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 35847 37784 gene locus_tag LOCUS_14970 35847 37784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 39123 37927 gene locus_tag LOCUS_14980 39123 37927 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_14980 41633 39822 gene locus_tag LOCUS_14990 41633 39822 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933885.1 protein_id gnl|my_center|LOCUS_14990 42881 41928 gene locus_tag LOCUS_15000 42881 41928 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence032 2568 271 gene locus_tag LOCUS_15010 2568 271 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_15010 3440 2634 gene locus_tag LOCUS_15020 3440 2634 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_15020 4773 4315 gene locus_tag LOCUS_15030 4773 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5147 5704 gene locus_tag LOCUS_15040 5147 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6366 11582 gene locus_tag LOCUS_15050 6366 11582 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235238.1 protein_id gnl|my_center|LOCUS_15050 12818 11859 gene locus_tag LOCUS_15060 12818 11859 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_15060 13158 13355 gene locus_tag LOCUS_15070 13158 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 14196 15194 gene locus_tag LOCUS_15080 14196 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 15308 16408 gene locus_tag LOCUS_15090 15308 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 16405 17196 gene locus_tag LOCUS_15100 16405 17196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 17286 20051 gene locus_tag LOCUS_15110 17286 20051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 20076 24854 gene locus_tag LOCUS_15120 20076 24854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 25005 30284 gene locus_tag LOCUS_15130 25005 30284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 30445 32559 gene locus_tag LOCUS_15140 30445 32559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 33182 40183 gene locus_tag LOCUS_15150 33182 40183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 40477 41310 gene locus_tag LOCUS_15160 40477 41310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 41377 41586 gene locus_tag LOCUS_15170 41377 41586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 42039 41641 gene locus_tag LOCUS_15180 42039 41641 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_15180 42284 42036 gene locus_tag LOCUS_15190 42284 42036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 42359 42613 gene locus_tag LOCUS_15200 42359 42613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 43141 43572 gene locus_tag LOCUS_15210 43141 43572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 43792 44184 gene locus_tag LOCUS_15220 43792 44184 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_15220 44240 45460 gene locus_tag LOCUS_15230 44240 45460 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence033 3037 872 gene locus_tag LOCUS_15240 3037 872 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121109.1 protein_id gnl|my_center|LOCUS_15240 3468 3268 gene locus_tag LOCUS_15250 3468 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3591 4973 gene locus_tag LOCUS_15260 3591 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 5008 5394 gene locus_tag LOCUS_15270 5008 5394 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_15270 6237 6025 gene locus_tag LOCUS_15280 6237 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 6551 6327 gene locus_tag LOCUS_15290 6551 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 9711 6607 gene locus_tag LOCUS_15300 9711 6607 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942010.1 protein_id gnl|my_center|LOCUS_15300 10761 10153 gene locus_tag LOCUS_15310 10761 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 11034 11255 gene locus_tag LOCUS_15320 11034 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 12220 11513 gene locus_tag LOCUS_15330 12220 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 12918 12232 gene locus_tag LOCUS_15340 12918 12232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 16862 12969 gene locus_tag LOCUS_15350 gene pglX 16862 12969 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_15350 20474 16866 gene locus_tag LOCUS_15360 gene brxC 20474 16866 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942753.1 protein_id gnl|my_center|LOCUS_15360 21056 20484 gene locus_tag LOCUS_15370 21056 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 21822 21031 gene locus_tag LOCUS_15380 21822 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 22403 21819 gene locus_tag LOCUS_15390 22403 21819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 23197 22637 gene locus_tag LOCUS_15400 23197 22637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 23470 23691 gene locus_tag LOCUS_15410 23470 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 24192 24575 gene locus_tag LOCUS_15420 24192 24575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 26113 25286 gene locus_tag LOCUS_15430 26113 25286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 26945 26163 gene locus_tag LOCUS_15440 26945 26163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 27676 26942 gene locus_tag LOCUS_15450 27676 26942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 29960 27687 gene locus_tag LOCUS_15460 29960 27687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 31609 30023 gene locus_tag LOCUS_15470 gene rng 31609 30023 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_15470 32852 31671 gene locus_tag LOCUS_15480 gene rodA 32852 31671 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460900.1 protein_id gnl|my_center|LOCUS_15480 34668 32845 gene locus_tag LOCUS_15490 gene mrdA 34668 32845 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_15490 35176 34640 gene locus_tag LOCUS_15500 35176 34640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 35966 35166 gene locus_tag LOCUS_15510 gene mreC 35966 35166 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945174.1 protein_id gnl|my_center|LOCUS_15510 37113 36082 gene locus_tag LOCUS_15520 37113 36082 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_15520 37617 37210 gene locus_tag LOCUS_15530 37617 37210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 38652 38179 gene locus_tag LOCUS_15540 38652 38179 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_15540 39133 38696 gene locus_tag LOCUS_15550 39133 38696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 40514 39312 gene locus_tag LOCUS_15560 40514 39312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 41866 40514 gene locus_tag LOCUS_15570 gene glmM 41866 40514 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938578.1 protein_id gnl|my_center|LOCUS_15570 42154 43380 gene locus_tag LOCUS_15580 42154 43380 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_15580 43406 44419 gene locus_tag LOCUS_15590 gene pta 43406 44419 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence034 246 1469 gene locus_tag LOCUS_15600 246 1469 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_15600 1526 4336 gene locus_tag LOCUS_15610 1526 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5860 5534 gene locus_tag LOCUS_15620 5860 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 6188 5832 gene locus_tag LOCUS_15630 6188 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6501 6295 gene locus_tag LOCUS_15640 6501 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 7240 6884 gene locus_tag LOCUS_15650 7240 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 7371 7607 gene locus_tag LOCUS_15660 7371 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 7594 8190 gene locus_tag LOCUS_15670 7594 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 9544 8192 gene locus_tag LOCUS_15680 9544 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 12159 9556 gene locus_tag LOCUS_15690 gene clpB 12159 9556 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_15690 13565 12636 gene locus_tag LOCUS_15700 13565 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 13924 13673 gene locus_tag LOCUS_15710 13924 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 22801 13997 gene locus_tag LOCUS_15720 22801 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 22857 23072 gene locus_tag LOCUS_15730 22857 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 25171 24728 gene locus_tag LOCUS_15740 25171 24728 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_15740 26420 25185 gene locus_tag LOCUS_15750 gene spoVE 26420 25185 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_15750 28043 27036 gene locus_tag LOCUS_15760 28043 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 29421 28084 gene locus_tag LOCUS_15770 gene murD 29421 28084 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_15770 30817 29411 gene locus_tag LOCUS_15780 30817 29411 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_15780 32267 30804 gene locus_tag LOCUS_15790 32267 30804 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_15790 34058 32274 gene locus_tag LOCUS_15800 34058 32274 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_15800 34514 34086 gene locus_tag LOCUS_15810 34514 34086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 35508 34555 gene locus_tag LOCUS_15820 gene rsmH 35508 34555 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_15820 36124 35627 gene locus_tag LOCUS_15830 36124 35627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 36753 36229 gene locus_tag LOCUS_15840 36753 36229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 38679 37420 gene locus_tag LOCUS_15850 38679 37420 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986414.1 protein_id gnl|my_center|LOCUS_15850 40246 40875 gene locus_tag LOCUS_15860 40246 40875 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_15860 40886 42325 gene locus_tag LOCUS_15870 40886 42325 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_15870 42329 42508 gene locus_tag LOCUS_15880 42329 42508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 42423 43592 gene locus_tag LOCUS_15890 42423 43592 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence035 671 1621 gene locus_tag LOCUS_15900 671 1621 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_15900 1710 3443 gene locus_tag LOCUS_15910 gene ilvD 1710 3443 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_15910 3455 4519 gene locus_tag LOCUS_15920 3455 4519 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227743.1 protein_id gnl|my_center|LOCUS_15920 4785 6899 gene locus_tag LOCUS_15930 gene ovoA 4785 6899 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_15930 10546 7445 gene locus_tag LOCUS_15940 10546 7445 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_15940 11863 10583 gene locus_tag LOCUS_15950 11863 10583 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_15950 13057 11885 gene locus_tag LOCUS_15960 13057 11885 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_15960 13692 13913 gene locus_tag LOCUS_15970 13692 13913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 14037 15254 gene locus_tag LOCUS_15980 14037 15254 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_15980 15607 16347 gene locus_tag LOCUS_15990 15607 16347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 16578 17138 gene locus_tag LOCUS_16000 16578 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 17228 18904 gene locus_tag LOCUS_16010 17228 18904 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_16010 18897 19319 gene locus_tag LOCUS_16020 18897 19319 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_16020 19316 20875 gene locus_tag LOCUS_16030 19316 20875 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_16030 20945 21250 gene locus_tag LOCUS_16040 20945 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 21881 22411 gene locus_tag LOCUS_16050 21881 22411 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_16050 22590 22408 gene locus_tag LOCUS_16060 22590 22408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 23149 22694 gene locus_tag LOCUS_16070 23149 22694 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_16070 23313 23170 gene locus_tag LOCUS_16080 23313 23170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 24636 23365 gene locus_tag LOCUS_16090 24636 23365 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_16090 25972 24620 gene locus_tag LOCUS_16100 gene sufD 25972 24620 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_16100 26733 25969 gene locus_tag LOCUS_16110 gene sufC 26733 25969 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165620.1 protein_id gnl|my_center|LOCUS_16110 28185 26740 gene locus_tag LOCUS_16120 gene sufB 28185 26740 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_16120 28338 28264 gene locus_tag LOCUS_t00210 28338 28264 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 28508 29782 gene locus_tag LOCUS_16130 28508 29782 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_16130 29855 31528 gene locus_tag LOCUS_16140 29855 31528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 31544 32170 gene locus_tag LOCUS_16150 gene thiE 31544 32170 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_16150 32185 33459 gene locus_tag LOCUS_16160 32185 33459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 34153 35532 gene locus_tag LOCUS_16170 34153 35532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 36826 35525 gene locus_tag LOCUS_16180 36826 35525 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242311.1 protein_id gnl|my_center|LOCUS_16180 38039 36846 gene locus_tag LOCUS_16190 38039 36846 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_16190 39202 38036 gene locus_tag LOCUS_16200 39202 38036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 39890 39252 gene locus_tag LOCUS_16210 39890 39252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 40172 41242 gene locus_tag LOCUS_16220 40172 41242 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_16220 41274 42614 gene locus_tag LOCUS_16230 41274 42614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence036 1086 499 gene locus_tag LOCUS_16240 1086 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1394 1203 gene locus_tag LOCUS_16250 1394 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 5134 1457 gene locus_tag LOCUS_16260 gene hrpA 5134 1457 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_16260 7433 5964 gene locus_tag LOCUS_16270 7433 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 10324 7472 gene locus_tag LOCUS_16280 10324 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 11616 10321 gene locus_tag LOCUS_16290 11616 10321 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_16290 12403 11822 gene locus_tag LOCUS_16300 12403 11822 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_16300 12636 13940 gene locus_tag LOCUS_16310 gene ablA 12636 13940 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_16310 13940 14782 gene locus_tag LOCUS_16320 gene ablB 13940 14782 CDS product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023872.1 protein_id gnl|my_center|LOCUS_16320 15709 14870 gene locus_tag LOCUS_16330 15709 14870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 15962 16480 gene locus_tag LOCUS_16340 15962 16480 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_16340 16580 18541 gene locus_tag LOCUS_16350 16580 18541 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767105.1 protein_id gnl|my_center|LOCUS_16350 19060 20439 gene locus_tag LOCUS_16360 19060 20439 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666062.1 protein_id gnl|my_center|LOCUS_16360 22142 20940 gene locus_tag LOCUS_16370 22142 20940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 22350 22189 gene locus_tag LOCUS_16380 22350 22189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 23055 22390 gene locus_tag LOCUS_16390 23055 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 23357 23644 gene locus_tag LOCUS_16400 23357 23644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 23656 23910 gene locus_tag LOCUS_16410 23656 23910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 23922 24962 gene locus_tag LOCUS_16420 23922 24962 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 protein_id gnl|my_center|LOCUS_16420 25567 25953 gene locus_tag LOCUS_16430 25567 25953 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042653643.1 protein_id gnl|my_center|LOCUS_16430 25922 28336 gene locus_tag LOCUS_16440 25922 28336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 29520 30965 gene locus_tag LOCUS_16450 29520 30965 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_16450 32141 31500 gene locus_tag LOCUS_16460 32141 31500 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_16460 32324 32235 gene locus_tag LOCUS_t00220 32324 32235 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35234 32601 gene locus_tag LOCUS_16470 35234 32601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 36712 35285 gene locus_tag LOCUS_16480 36712 35285 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_16480 37391 38806 gene locus_tag LOCUS_16490 gene sqr 37391 38806 CDS product type II sulfide:quinone oxidoreductase Sqr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033018.1 protein_id gnl|my_center|LOCUS_16490 39133 40077 gene locus_tag LOCUS_16500 gene cysK 39133 40077 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267110.1 protein_id gnl|my_center|LOCUS_16500 40499 41821 gene locus_tag LOCUS_16510 gene mtaB 40499 41821 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence037 1987 632 gene locus_tag LOCUS_16520 1987 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16520 3334 2027 gene locus_tag LOCUS_16530 3334 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4326 3331 gene locus_tag LOCUS_16540 4326 3331 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964118.1 protein_id gnl|my_center|LOCUS_16540 5884 4343 gene locus_tag LOCUS_16550 5884 4343 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_16550 6933 5881 gene locus_tag LOCUS_16560 6933 5881 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_16560 8297 6930 gene locus_tag LOCUS_16570 8297 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 9394 8294 gene locus_tag LOCUS_16580 9394 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 10766 9462 gene locus_tag LOCUS_16590 10766 9462 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263659.1 protein_id gnl|my_center|LOCUS_16590 12581 11217 gene locus_tag LOCUS_16600 12581 11217 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931886.1 protein_id gnl|my_center|LOCUS_16600 14758 12737 gene locus_tag LOCUS_16610 14758 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 16076 14811 gene locus_tag LOCUS_16620 16076 14811 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921850.1 protein_id gnl|my_center|LOCUS_16620 16224 16913 gene locus_tag LOCUS_16630 16224 16913 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_16630 17112 17240 gene locus_tag LOCUS_16640 17112 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 17642 18778 gene locus_tag LOCUS_16650 17642 18778 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237280.1 protein_id gnl|my_center|LOCUS_16650 18903 19640 gene locus_tag LOCUS_16660 18903 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 20803 20000 gene locus_tag LOCUS_16670 20803 20000 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_16670 21882 21016 gene locus_tag LOCUS_16680 21882 21016 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 protein_id gnl|my_center|LOCUS_16680 22781 21879 gene locus_tag LOCUS_16690 gene yfeC 22781 21879 CDS product iron/manganese ABC transporter permease subunit YfeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211844.1 protein_id gnl|my_center|LOCUS_16690 23692 22778 gene locus_tag LOCUS_16700 23692 22778 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630123.1 protein_id gnl|my_center|LOCUS_16700 24646 23747 gene locus_tag LOCUS_16710 gene yfeA 24646 23747 CDS product iron/manganese ABC transporter substrate-binding protein YfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 protein_id gnl|my_center|LOCUS_16710 26748 26089 gene locus_tag LOCUS_16720 gene larB 26748 26089 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_16720 28615 26840 gene locus_tag LOCUS_16730 28615 26840 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_16730 29559 29005 gene locus_tag LOCUS_16740 29559 29005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 30046 29747 gene locus_tag LOCUS_16750 30046 29747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 30225 31115 gene locus_tag LOCUS_16760 30225 31115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 31246 32373 gene locus_tag LOCUS_16770 gene thiH 31246 32373 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_16770 32934 32728 gene locus_tag LOCUS_16780 32934 32728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 34129 32870 gene locus_tag LOCUS_16790 34129 32870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 34525 34701 gene locus_tag LOCUS_16800 34525 34701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 36013 35678 gene locus_tag LOCUS_16810 36013 35678 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 protein_id gnl|my_center|LOCUS_16810 36240 35998 gene locus_tag LOCUS_16820 36240 35998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 36835 37086 gene locus_tag LOCUS_16830 36835 37086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 37094 37342 gene locus_tag LOCUS_16840 37094 37342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 37726 37881 gene locus_tag LOCUS_16850 37726 37881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 38828 38427 gene locus_tag LOCUS_16860 38828 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 39323 40525 gene locus_tag LOCUS_16870 39323 40525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 40685 41194 gene locus_tag LOCUS_16880 40685 41194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence038 1328 2491 gene locus_tag LOCUS_16890 1328 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3620 2670 gene locus_tag LOCUS_16900 3620 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 4412 3690 gene locus_tag LOCUS_16910 4412 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 5304 4528 gene locus_tag LOCUS_16920 5304 4528 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_16920 6343 5327 gene locus_tag LOCUS_16930 gene ypdE 6343 5327 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366040.1 protein_id gnl|my_center|LOCUS_16930 6796 6347 gene locus_tag LOCUS_16940 6796 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 7035 7337 gene locus_tag LOCUS_16950 7035 7337 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092213181.1 protein_id gnl|my_center|LOCUS_16950 7334 8275 gene locus_tag LOCUS_16960 7334 8275 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821233.1 protein_id gnl|my_center|LOCUS_16960 8275 8562 gene locus_tag LOCUS_16970 8275 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16970 8595 9992 gene locus_tag LOCUS_16980 8595 9992 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074344.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16980 10422 9982 gene locus_tag LOCUS_16990 10422 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 11738 10686 gene locus_tag LOCUS_17000 gene lptG 11738 10686 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_17000 12407 13738 gene locus_tag LOCUS_17010 12407 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 13772 14005 gene locus_tag LOCUS_17020 13772 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 13977 14135 gene locus_tag LOCUS_17030 13977 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 15329 14172 gene locus_tag LOCUS_17040 15329 14172 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427756.1 protein_id gnl|my_center|LOCUS_17040 15521 17794 gene locus_tag LOCUS_17050 15521 17794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 17800 19650 gene locus_tag LOCUS_17060 17800 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 19783 23193 gene locus_tag LOCUS_17070 19783 23193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 23352 23801 gene locus_tag LOCUS_17080 23352 23801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 23813 23995 gene locus_tag LOCUS_17090 23813 23995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 24304 24403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24415 26163 gene locus_tag LOCUS_17100 24415 26163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 26917 26657 gene locus_tag LOCUS_17110 26917 26657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 27701 27294 gene locus_tag LOCUS_17120 27701 27294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 27968 28195 gene locus_tag LOCUS_17130 27968 28195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 28185 28928 gene locus_tag LOCUS_17140 28185 28928 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816178.1 protein_id gnl|my_center|LOCUS_17140 29306 30214 gene locus_tag LOCUS_17150 gene cysD 29306 30214 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776455.1 protein_id gnl|my_center|LOCUS_17150 30230 32080 gene locus_tag LOCUS_17160 gene cysN 30230 32080 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_17160 32286 33938 gene locus_tag LOCUS_17170 32286 33938 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 protein_id gnl|my_center|LOCUS_17170 36227 33855 gene locus_tag LOCUS_17180 36227 33855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 36426 36641 gene locus_tag LOCUS_17190 36426 36641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 37401 36622 gene locus_tag LOCUS_17200 37401 36622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 39352 37484 gene locus_tag LOCUS_17210 39352 37484 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_17210 41588 39708 gene locus_tag LOCUS_17220 41588 39708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence039 1622 621 gene locus_tag LOCUS_17230 gene rnhC 1622 621 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_17230 3299 2547 gene locus_tag LOCUS_17240 3299 2547 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_17240 4187 3969 gene locus_tag LOCUS_17250 4187 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 4942 4535 gene locus_tag LOCUS_17260 4942 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6415 5150 gene locus_tag LOCUS_17270 gene icd 6415 5150 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_17270 8660 6984 gene locus_tag LOCUS_17280 8660 6984 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679009.1 protein_id gnl|my_center|LOCUS_17280 9309 8644 gene locus_tag LOCUS_17290 9309 8644 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682388.1 protein_id gnl|my_center|LOCUS_17290 9483 11132 gene locus_tag LOCUS_17300 9483 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 11903 14368 gene locus_tag LOCUS_17310 11903 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 14481 15461 gene locus_tag LOCUS_17320 14481 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 15470 16840 gene locus_tag LOCUS_17330 15470 16840 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250670.1 protein_id gnl|my_center|LOCUS_17330 16855 17964 gene locus_tag LOCUS_17340 16855 17964 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044915.1 protein_id gnl|my_center|LOCUS_17340 18004 18585 gene locus_tag LOCUS_17350 18004 18585 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084193.1 protein_id gnl|my_center|LOCUS_17350 19361 19906 gene locus_tag LOCUS_17360 19361 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 20899 19925 gene locus_tag LOCUS_17370 20899 19925 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257990.1 protein_id gnl|my_center|LOCUS_17370 22119 20977 gene locus_tag LOCUS_17380 22119 20977 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 protein_id gnl|my_center|LOCUS_17380 23474 22116 gene locus_tag LOCUS_17390 23474 22116 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_17390 24043 23477 gene locus_tag LOCUS_17400 24043 23477 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_17400 25207 24116 gene locus_tag LOCUS_17410 25207 24116 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_17410 25471 26115 gene locus_tag LOCUS_17420 25471 26115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 26266 27105 gene locus_tag LOCUS_17430 26266 27105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 27110 28957 gene locus_tag LOCUS_17440 gene asnB 27110 28957 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102035.1 protein_id gnl|my_center|LOCUS_17440 29034 29801 gene locus_tag LOCUS_17450 29034 29801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 29849 30865 gene locus_tag LOCUS_17460 29849 30865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 30871 32046 gene locus_tag LOCUS_17470 30871 32046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 32151 32972 gene locus_tag LOCUS_17480 32151 32972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 33002 33124 gene locus_tag LOCUS_17490 33002 33124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 35211 33880 gene locus_tag LOCUS_17500 35211 33880 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_17500 35541 35789 gene locus_tag LOCUS_17510 35541 35789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 36150 36896 gene locus_tag LOCUS_17520 36150 36896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 36889 37038 gene locus_tag LOCUS_17530 36889 37038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 37171 38307 gene locus_tag LOCUS_17540 37171 38307 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_17540 38308 39111 gene locus_tag LOCUS_17550 38308 39111 CDS product DUF4886 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119653.1 protein_id gnl|my_center|LOCUS_17550 41067 39607 gene locus_tag LOCUS_17560 41067 39607 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869758.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence040 1111 182 gene locus_tag LOCUS_17570 1111 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1342 2565 gene locus_tag LOCUS_17580 1342 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 2562 3038 gene locus_tag LOCUS_17590 2562 3038 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_17590 3551 5518 gene locus_tag LOCUS_17600 3551 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 5613 8033 gene locus_tag LOCUS_17610 5613 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 8361 10415 gene locus_tag LOCUS_17620 8361 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 11078 13201 gene locus_tag LOCUS_17630 11078 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 13214 13615 gene locus_tag LOCUS_17640 13214 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 13563 15350 gene locus_tag LOCUS_17650 13563 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 15642 16979 gene locus_tag LOCUS_17660 15642 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 17173 18591 gene locus_tag LOCUS_17670 17173 18591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 20292 18949 gene locus_tag LOCUS_17680 20292 18949 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_17680 20703 20416 gene locus_tag LOCUS_17690 20703 20416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 21467 20607 gene locus_tag LOCUS_17700 21467 20607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 24278 21579 gene locus_tag LOCUS_17710 24278 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 24501 24319 gene locus_tag LOCUS_17720 24501 24319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 28989 24544 gene locus_tag LOCUS_17730 28989 24544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 30445 29000 gene locus_tag LOCUS_17740 30445 29000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 31485 30442 gene locus_tag LOCUS_17750 31485 30442 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933236.1 protein_id gnl|my_center|LOCUS_17750 33600 31507 gene locus_tag LOCUS_17760 33600 31507 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_17760 35331 33601 gene locus_tag LOCUS_17770 35331 33601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 36278 35328 gene locus_tag LOCUS_17780 36278 35328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 39331 36275 gene locus_tag LOCUS_17790 39331 36275 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036268.1 protein_id gnl|my_center|LOCUS_17790 39595 39383 gene locus_tag LOCUS_17800 39595 39383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 40004 39744 gene locus_tag LOCUS_17810 40004 39744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 <41214 39994 gene locus_tag LOCUS_17820 <41214 39994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020677315.1:DEAD/DEAH box helicase family protein >Feature sequence041 1094 9571 gene locus_tag LOCUS_17830 1094 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 9620 12241 gene locus_tag LOCUS_17840 9620 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 12316 13254 gene locus_tag LOCUS_17850 12316 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 13247 23887 gene locus_tag LOCUS_17860 13247 23887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 23935 26229 gene locus_tag LOCUS_17870 23935 26229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 26452 27387 gene locus_tag LOCUS_17880 26452 27387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 28039 28638 gene locus_tag LOCUS_17890 28039 28638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 28724 29626 gene locus_tag LOCUS_17900 28724 29626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 29890 31170 gene locus_tag LOCUS_17910 29890 31170 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_17910 31247 33856 gene locus_tag LOCUS_17920 31247 33856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 33982 34854 gene locus_tag LOCUS_17930 33982 34854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 34856 35734 gene locus_tag LOCUS_17940 34856 35734 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967715.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence042 143 11107 gene locus_tag LOCUS_17950 143 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 11204 14845 gene locus_tag LOCUS_17960 11204 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 14891 17308 gene locus_tag LOCUS_17970 14891 17308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 19468 18359 gene locus_tag LOCUS_17980 19468 18359 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_17980 20293 19475 gene locus_tag LOCUS_17990 20293 19475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 21493 20753 gene locus_tag LOCUS_18000 21493 20753 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_18000 21619 22830 gene locus_tag LOCUS_18010 gene tolB 21619 22830 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_18010 22862 23467 gene locus_tag LOCUS_18020 22862 23467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 23514 24068 gene locus_tag LOCUS_18030 23514 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 24099 24641 gene locus_tag LOCUS_18040 24099 24641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 24638 25450 gene locus_tag LOCUS_18050 gene tatC 24638 25450 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314395.1 protein_id gnl|my_center|LOCUS_18050 25466 26053 gene locus_tag LOCUS_18060 gene hisB 25466 26053 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325657.1 protein_id gnl|my_center|LOCUS_18060 26389 27117 gene locus_tag LOCUS_18070 gene hisA 26389 27117 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_18070 27182 28462 gene locus_tag LOCUS_18080 27182 28462 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_18080 29063 30415 gene locus_tag LOCUS_18090 29063 30415 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694115.1 protein_id gnl|my_center|LOCUS_18090 30412 31602 gene locus_tag LOCUS_18100 30412 31602 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816935.1 protein_id gnl|my_center|LOCUS_18100 31595 32263 gene locus_tag LOCUS_18110 31595 32263 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653794.1 protein_id gnl|my_center|LOCUS_18110 32260 32880 gene locus_tag LOCUS_18120 32260 32880 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456515.1 protein_id gnl|my_center|LOCUS_18120 33402 34010 gene locus_tag LOCUS_18130 gene nqrE 33402 34010 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303538.1 protein_id gnl|my_center|LOCUS_18130 34013 35230 gene locus_tag LOCUS_18140 gene nqrF 34013 35230 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 protein_id gnl|my_center|LOCUS_18140 35233 35397 gene locus_tag LOCUS_18150 35233 35397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 36615 36112 gene locus_tag LOCUS_18160 36615 36112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 37014 36640 gene locus_tag LOCUS_18170 37014 36640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 37621 37295 gene locus_tag LOCUS_18180 37621 37295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 38010 39347 gene locus_tag LOCUS_18190 gene rimO 38010 39347 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence043 1887 1105 gene locus_tag LOCUS_18200 gene hpnK 1887 1105 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_18200 2972 2019 gene locus_tag LOCUS_18210 2972 2019 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694490.1 protein_id gnl|my_center|LOCUS_18210 4044 2986 gene locus_tag LOCUS_18220 4044 2986 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_18220 5102 4053 gene locus_tag LOCUS_18230 5102 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 6508 5099 gene locus_tag LOCUS_18240 6508 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 7135 6596 gene locus_tag LOCUS_18250 7135 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 8214 7372 gene locus_tag LOCUS_18260 8214 7372 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257988.1 protein_id gnl|my_center|LOCUS_18260 8962 8276 gene locus_tag LOCUS_18270 8962 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 10230 9592 gene locus_tag LOCUS_18280 10230 9592 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919404.1 protein_id gnl|my_center|LOCUS_18280 11406 10243 gene locus_tag LOCUS_18290 11406 10243 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039963.1 protein_id gnl|my_center|LOCUS_18290 12617 11403 gene locus_tag LOCUS_18300 12617 11403 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_18300 13476 12643 gene locus_tag LOCUS_18310 13476 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 15133 14600 gene locus_tag LOCUS_18320 15133 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 16217 15603 gene locus_tag LOCUS_18330 16217 15603 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_18330 18730 18829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20064 19660 gene locus_tag LOCUS_18340 20064 19660 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_18340 20378 20061 gene locus_tag LOCUS_18350 20378 20061 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_18350 21661 21125 gene locus_tag LOCUS_18360 21661 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 23090 22692 gene locus_tag LOCUS_18370 23090 22692 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_18370 24630 24289 gene locus_tag LOCUS_18380 24630 24289 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770554.1 protein_id gnl|my_center|LOCUS_18380 24949 24617 gene locus_tag LOCUS_18390 24949 24617 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_18390 25584 25279 gene locus_tag LOCUS_18400 25584 25279 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_18400 25978 25568 gene locus_tag LOCUS_18410 25978 25568 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962808.1 protein_id gnl|my_center|LOCUS_18410 26880 26308 gene locus_tag LOCUS_18420 26880 26308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 27064 26867 gene locus_tag LOCUS_18430 27064 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 27714 27304 gene locus_tag LOCUS_18440 27714 27304 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_18440 28105 27704 gene locus_tag LOCUS_18450 28105 27704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 30685 28748 gene locus_tag LOCUS_18460 gene cysN 30685 28748 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_18460 31769 30870 gene locus_tag LOCUS_18470 gene cysD 31769 30870 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209386.1 protein_id gnl|my_center|LOCUS_18470 33918 32131 gene locus_tag LOCUS_18480 33918 32131 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_18480 35237 34242 gene locus_tag LOCUS_18490 35237 34242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 36256 35447 gene locus_tag LOCUS_18500 gene galU 36256 35447 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817120.1 protein_id gnl|my_center|LOCUS_18500 36414 36513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38668 36734 gene locus_tag LOCUS_18510 38668 36734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 40056 38779 gene locus_tag LOCUS_18520 40056 38779 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence044 23 1096 gene locus_tag LOCUS_18530 23 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1108 1995 gene locus_tag LOCUS_18540 1108 1995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_18540 2291 3646 gene locus_tag LOCUS_18550 2291 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3763 6015 gene locus_tag LOCUS_18560 3763 6015 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921368.1 protein_id gnl|my_center|LOCUS_18560 6175 7356 gene locus_tag LOCUS_18570 6175 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 7917 7519 gene locus_tag LOCUS_18580 7917 7519 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920634.1 protein_id gnl|my_center|LOCUS_18580 8606 7914 gene locus_tag LOCUS_18590 8606 7914 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_18590 9583 8603 gene locus_tag LOCUS_18600 9583 8603 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_18600 9897 11579 gene locus_tag LOCUS_18610 gene fucI 9897 11579 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_18610 11605 12315 gene locus_tag LOCUS_18620 11605 12315 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130794.1 protein_id gnl|my_center|LOCUS_18620 17485 13448 gene locus_tag LOCUS_18630 17485 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 18206 17604 gene locus_tag LOCUS_18640 18206 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 18837 18322 gene locus_tag LOCUS_18650 18837 18322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 19155 20279 gene locus_tag LOCUS_18660 gene aroF 19155 20279 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_18660 20557 21405 gene locus_tag LOCUS_18670 20557 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 21978 22403 gene locus_tag LOCUS_18680 21978 22403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 22485 23054 gene locus_tag LOCUS_18690 22485 23054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 23168 23746 gene locus_tag LOCUS_18700 gene rsxA 23168 23746 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_18700 23758 24549 gene locus_tag LOCUS_18710 23758 24549 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_18710 24760 26112 gene locus_tag LOCUS_18720 gene rsxC 24760 26112 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_18720 26112 27125 gene locus_tag LOCUS_18730 26112 27125 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_18730 27122 27679 gene locus_tag LOCUS_18740 27122 27679 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_18740 27684 28001 gene locus_tag LOCUS_18750 27684 28001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 28127 28576 gene locus_tag LOCUS_18760 28127 28576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 30396 28969 gene locus_tag LOCUS_18770 30396 28969 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889170.1 protein_id gnl|my_center|LOCUS_18770 31279 30533 gene locus_tag LOCUS_18780 31279 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 33566 31707 gene locus_tag LOCUS_18790 33566 31707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 33815 34756 gene locus_tag LOCUS_18800 33815 34756 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_18800 34770 35747 gene locus_tag LOCUS_18810 34770 35747 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_18810 35869 36735 gene locus_tag LOCUS_18820 35869 36735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 36783 38216 gene locus_tag LOCUS_18830 gene tilS 36783 38216 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257904.1 protein_id gnl|my_center|LOCUS_18830 39213 38218 gene locus_tag LOCUS_18840 gene gluQRS 39213 38218 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence045 605 1351 gene locus_tag LOCUS_18850 605 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1704 2585 gene locus_tag LOCUS_18860 1704 2585 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_18860 2849 2643 gene locus_tag LOCUS_18870 2849 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 4988 2874 gene locus_tag LOCUS_18880 4988 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 5066 6097 gene locus_tag LOCUS_18890 gene tdh 5066 6097 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478141.1 protein_id gnl|my_center|LOCUS_18890 6433 7623 gene locus_tag LOCUS_18900 gene kbl 6433 7623 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213845.1 protein_id gnl|my_center|LOCUS_18900 7698 9107 gene locus_tag LOCUS_18910 7698 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 9348 10793 gene locus_tag LOCUS_18920 9348 10793 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_18920 10892 12094 gene locus_tag LOCUS_18930 10892 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 12135 13133 gene locus_tag LOCUS_18940 12135 13133 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813861.1 protein_id gnl|my_center|LOCUS_18940 13366 14022 gene locus_tag LOCUS_18950 13366 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 14019 14753 gene locus_tag LOCUS_18960 14019 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 14713 15870 gene locus_tag LOCUS_18970 14713 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 16752 17063 gene locus_tag LOCUS_18980 16752 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 17072 18382 gene locus_tag LOCUS_18990 17072 18382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 18399 18569 gene locus_tag LOCUS_19000 18399 18569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 18614 19300 gene locus_tag LOCUS_19010 18614 19300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 19514 20467 gene locus_tag LOCUS_19020 19514 20467 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_19020 20651 22675 gene locus_tag LOCUS_19030 20651 22675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 22677 24878 gene locus_tag LOCUS_19040 22677 24878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 24904 25551 gene locus_tag LOCUS_19050 24904 25551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 25565 29164 gene locus_tag LOCUS_19060 25565 29164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 29161 31473 gene locus_tag LOCUS_19070 29161 31473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 32745 33539 gene locus_tag LOCUS_19080 32745 33539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 33561 33734 gene locus_tag LOCUS_19090 33561 33734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 33700 35076 gene locus_tag LOCUS_19100 33700 35076 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_19100 35097 38402 gene locus_tag LOCUS_19110 35097 38402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 38793 38644 gene locus_tag LOCUS_19120 38793 38644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence046 1195 281 gene locus_tag LOCUS_19130 1195 281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071977.1 protein_id gnl|my_center|LOCUS_19130 2098 1196 gene locus_tag LOCUS_19140 2098 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2898 2167 gene locus_tag LOCUS_19150 2898 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3863 3105 gene locus_tag LOCUS_19160 3863 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5842 3860 gene locus_tag LOCUS_19170 5842 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 6855 5881 gene locus_tag LOCUS_19180 gene folD 6855 5881 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_19180 7549 6866 gene locus_tag LOCUS_19190 7549 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 8019 7630 gene locus_tag LOCUS_19200 gene dut 8019 7630 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454700.1 protein_id gnl|my_center|LOCUS_19200 8333 8257 gene locus_tag LOCUS_t00230 8333 8257 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8406 10607 gene locus_tag LOCUS_19210 8406 10607 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477586.1 protein_id gnl|my_center|LOCUS_19210 10808 10632 gene locus_tag LOCUS_19220 10808 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 11487 10954 gene locus_tag LOCUS_19230 11487 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 11785 12051 gene locus_tag LOCUS_19240 11785 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 12476 12048 gene locus_tag LOCUS_19250 12476 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 13045 12476 gene locus_tag LOCUS_19260 gene sbrI 13045 12476 CDS product ECF family RNA polymerase sigma factor SbrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_19260 14204 13221 gene locus_tag LOCUS_19270 14204 13221 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029244.1 protein_id gnl|my_center|LOCUS_19270 15290 14367 gene locus_tag LOCUS_19280 15290 14367 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_19280 15749 15309 gene locus_tag LOCUS_19290 gene aroQ 15749 15309 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735140.1 protein_id gnl|my_center|LOCUS_19290 16564 15761 gene locus_tag LOCUS_19300 16564 15761 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_19300 17560 16586 gene locus_tag LOCUS_19310 17560 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 18254 17550 gene locus_tag LOCUS_19320 gene tmk 18254 17550 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775041.1 protein_id gnl|my_center|LOCUS_19320 19768 18362 gene locus_tag LOCUS_19330 gene cysS 19768 18362 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883567.1 protein_id gnl|my_center|LOCUS_19330 20218 19835 gene locus_tag LOCUS_19340 gene ispF 20218 19835 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766012.1 protein_id gnl|my_center|LOCUS_19340 22431 20842 gene locus_tag LOCUS_19350 22431 20842 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_19350 26588 22428 gene locus_tag LOCUS_19360 26588 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 27634 28200 gene locus_tag LOCUS_19370 27634 28200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 30135 28201 gene locus_tag LOCUS_19380 30135 28201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 30865 30521 gene locus_tag LOCUS_19390 30865 30521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 31845 30868 gene locus_tag LOCUS_19400 31845 30868 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583276.1 protein_id gnl|my_center|LOCUS_19400 32180 31842 gene locus_tag LOCUS_19410 32180 31842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 33603 32587 gene locus_tag LOCUS_19420 33603 32587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 33763 33611 gene locus_tag LOCUS_19430 33763 33611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 35449 34175 gene locus_tag LOCUS_19440 gene tyrS 35449 34175 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962338.1 protein_id gnl|my_center|LOCUS_19440 37321 35576 gene locus_tag LOCUS_19450 gene rpsA 37321 35576 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_19450 37920 37678 gene locus_tag LOCUS_19460 37920 37678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence047 1779 520 gene locus_tag LOCUS_19470 1779 520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_19470 2488 1766 gene locus_tag LOCUS_19480 2488 1766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_19480 3977 2532 gene locus_tag LOCUS_19490 3977 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5265 4021 gene locus_tag LOCUS_19500 5265 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5794 5609 gene locus_tag LOCUS_19510 5794 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5933 6994 gene locus_tag LOCUS_19520 5933 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 7076 8974 gene locus_tag LOCUS_19530 7076 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 9507 9244 gene locus_tag LOCUS_19540 9507 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 9677 12502 gene locus_tag LOCUS_19550 9677 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 12624 14024 gene locus_tag LOCUS_19560 12624 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 13981 14715 gene locus_tag LOCUS_19570 13981 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 14699 16246 gene locus_tag LOCUS_19580 14699 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 16514 18130 gene locus_tag LOCUS_19590 16514 18130 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_19590 18628 20070 gene locus_tag LOCUS_19600 18628 20070 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_19600 20509 20204 gene locus_tag LOCUS_19610 20509 20204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 21106 21384 gene locus_tag LOCUS_19620 21106 21384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 22402 21500 gene locus_tag LOCUS_19630 22402 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 22745 22473 gene locus_tag LOCUS_19640 22745 22473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 23695 23417 gene locus_tag LOCUS_19650 23695 23417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 23880 23692 gene locus_tag LOCUS_19660 23880 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 24080 24382 gene locus_tag LOCUS_19670 24080 24382 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006027262.1 protein_id gnl|my_center|LOCUS_19670 24379 24675 gene locus_tag LOCUS_19680 24379 24675 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_19680 25192 24929 gene locus_tag LOCUS_19690 25192 24929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 25852 25340 gene locus_tag LOCUS_19700 25852 25340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 27525 25873 gene locus_tag LOCUS_19710 27525 25873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 28331 27522 gene locus_tag LOCUS_19720 28331 27522 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 protein_id gnl|my_center|LOCUS_19720 29482 28442 gene locus_tag LOCUS_19730 29482 28442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 30972 30424 gene locus_tag LOCUS_19740 30972 30424 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201532.1 protein_id gnl|my_center|LOCUS_19740 33589 31013 gene locus_tag LOCUS_19750 33589 31013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 35815 34529 gene locus_tag LOCUS_19760 gene eno 35815 34529 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence048 498 1946 gene locus_tag LOCUS_19770 498 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3235 1982 gene locus_tag LOCUS_19780 3235 1982 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_19780 3705 3235 gene locus_tag LOCUS_19790 3705 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4007 3777 gene locus_tag LOCUS_19800 4007 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 5624 5184 gene locus_tag LOCUS_19810 5624 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 5860 6816 gene locus_tag LOCUS_19820 5860 6816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939846.1 protein_id gnl|my_center|LOCUS_19820 7508 6861 gene locus_tag LOCUS_19830 7508 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 7661 7975 gene locus_tag LOCUS_19840 gene rhaM 7661 7975 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_19840 8103 11408 gene locus_tag LOCUS_19850 8103 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11726 17674 gene locus_tag LOCUS_19860 11726 17674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 18140 19219 gene locus_tag LOCUS_19870 18140 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 19990 20256 gene locus_tag LOCUS_19880 19990 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 20742 21104 gene locus_tag LOCUS_19890 20742 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 21101 21718 gene locus_tag LOCUS_19900 21101 21718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 21736 22566 gene locus_tag LOCUS_19910 gene larE 21736 22566 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_19910 22592 23491 gene locus_tag LOCUS_19920 gene nhoA 22592 23491 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366444.1 protein_id gnl|my_center|LOCUS_19920 24524 25189 gene locus_tag LOCUS_19930 24524 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 25219 28389 gene locus_tag LOCUS_19940 25219 28389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 28906 29229 gene locus_tag LOCUS_19950 28906 29229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 29691 30449 gene locus_tag LOCUS_19960 29691 30449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 30923 31153 gene locus_tag LOCUS_19970 30923 31153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 31279 31488 gene locus_tag LOCUS_19980 31279 31488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 31485 32285 gene locus_tag LOCUS_19990 31485 32285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 32326 32844 gene locus_tag LOCUS_20000 32326 32844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 32946 33323 gene locus_tag LOCUS_20010 32946 33323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 33863 35161 gene locus_tag LOCUS_20020 33863 35161 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120384.1 protein_id gnl|my_center|LOCUS_20020 35699 35911 gene locus_tag LOCUS_20030 35699 35911 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_20030 36244 36786 gene locus_tag LOCUS_20040 36244 36786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence049 3415 683 gene locus_tag LOCUS_20050 3415 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 6285 3430 gene locus_tag LOCUS_20060 6285 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 8252 7335 gene locus_tag LOCUS_20070 8252 7335 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_20070 9619 8582 gene locus_tag LOCUS_20080 9619 8582 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615566.1 protein_id gnl|my_center|LOCUS_20080 10725 9709 gene locus_tag LOCUS_20090 10725 9709 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_20090 10880 11074 gene locus_tag LOCUS_20100 10880 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 14963 11094 gene locus_tag LOCUS_20110 gene purL 14963 11094 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100278782.1 protein_id gnl|my_center|LOCUS_20110 18778 15341 gene locus_tag LOCUS_20120 18778 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 21624 19651 gene locus_tag LOCUS_20130 gene uvrB 21624 19651 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441064.1 protein_id gnl|my_center|LOCUS_20130 24916 21644 gene locus_tag LOCUS_20140 24916 21644 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225518.1 protein_id gnl|my_center|LOCUS_20140 31011 25627 gene locus_tag LOCUS_20150 31011 25627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 32801 31134 gene locus_tag LOCUS_20160 32801 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 35971 32912 gene locus_tag LOCUS_20170 35971 32912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 36531 36665 gene locus_tag LOCUS_20180 36531 36665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence050 1157 714 gene locus_tag LOCUS_20190 1157 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1450 2718 gene locus_tag LOCUS_20200 1450 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4707 2725 gene locus_tag LOCUS_20210 4707 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 6142 4772 gene locus_tag LOCUS_20220 6142 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 6602 6228 gene locus_tag LOCUS_20230 6602 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 6822 7886 gene locus_tag LOCUS_20240 6822 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 7987 9252 gene locus_tag LOCUS_20250 7987 9252 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 protein_id gnl|my_center|LOCUS_20250 9252 10847 gene locus_tag LOCUS_20260 9252 10847 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_20260 10926 13079 gene locus_tag LOCUS_20270 10926 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 14747 13737 gene locus_tag LOCUS_20280 14747 13737 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_20280 15861 15274 gene locus_tag LOCUS_20290 15861 15274 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_20290 18408 16303 gene locus_tag LOCUS_20300 18408 16303 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_20300 18569 22426 gene locus_tag LOCUS_20310 18569 22426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 22448 22615 gene locus_tag LOCUS_20320 22448 22615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 22649 22927 gene locus_tag LOCUS_20330 22649 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 29675 23802 gene locus_tag LOCUS_20340 29675 23802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 31893 30172 gene locus_tag LOCUS_20350 gene argS 31893 30172 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 protein_id gnl|my_center|LOCUS_20350 32110 32922 gene locus_tag LOCUS_20360 32110 32922 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937390.1 protein_id gnl|my_center|LOCUS_20360 33685 33314 gene locus_tag LOCUS_20370 33685 33314 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_20370 34073 34759 gene locus_tag LOCUS_20380 34073 34759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence051 761 1348 gene locus_tag LOCUS_20390 761 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 3135 1558 gene locus_tag LOCUS_20400 3135 1558 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_20400 3621 3415 gene locus_tag LOCUS_20410 3621 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 7040 3942 gene locus_tag LOCUS_20420 7040 3942 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_20420 8233 7040 gene locus_tag LOCUS_20430 8233 7040 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839428.1 protein_id gnl|my_center|LOCUS_20430 9501 8230 gene locus_tag LOCUS_20440 9501 8230 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_20440 11371 10091 gene locus_tag LOCUS_20450 11371 10091 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119461.1 protein_id gnl|my_center|LOCUS_20450 18380 12024 gene locus_tag LOCUS_20460 18380 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 20541 18535 gene locus_tag LOCUS_20470 20541 18535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 27501 20929 gene locus_tag LOCUS_20480 27501 20929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 28714 27848 gene locus_tag LOCUS_20490 28714 27848 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_20490 30773 29175 gene locus_tag LOCUS_20500 30773 29175 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213109130.1 protein_id gnl|my_center|LOCUS_20500 30853 31143 gene locus_tag LOCUS_20510 30853 31143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 31900 32163 gene locus_tag LOCUS_20520 31900 32163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 32305 32643 gene locus_tag LOCUS_20530 32305 32643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 33868 33287 gene locus_tag LOCUS_20540 33868 33287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence052 3 761 gene locus_tag LOCUS_20550 3 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 765 1406 gene locus_tag LOCUS_20560 765 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1814 4945 gene locus_tag LOCUS_20570 1814 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 5398 6660 gene locus_tag LOCUS_20580 5398 6660 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_20580 6773 8680 gene locus_tag LOCUS_20590 6773 8680 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937411.1 protein_id gnl|my_center|LOCUS_20590 8691 9200 gene locus_tag LOCUS_20600 8691 9200 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_20600 9197 9823 gene locus_tag LOCUS_20610 9197 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20610 9820 10569 gene locus_tag LOCUS_20620 9820 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 10668 11294 gene locus_tag LOCUS_20630 10668 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 11729 11962 gene locus_tag LOCUS_20640 11729 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 12023 14212 gene locus_tag LOCUS_20650 12023 14212 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172660227.1 protein_id gnl|my_center|LOCUS_20650 14521 14763 gene locus_tag LOCUS_20660 14521 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 15917 14760 gene locus_tag LOCUS_20670 15917 14760 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_20670 17224 16106 gene locus_tag LOCUS_20680 17224 16106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 19175 17217 gene locus_tag LOCUS_20690 19175 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 20296 20898 gene locus_tag LOCUS_20700 20296 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 20943 22316 gene locus_tag LOCUS_20710 20943 22316 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_20710 22550 24991 gene locus_tag LOCUS_20720 22550 24991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 25041 26237 gene locus_tag LOCUS_20730 25041 26237 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108907.1 protein_id gnl|my_center|LOCUS_20730 27564 26254 gene locus_tag LOCUS_20740 27564 26254 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_20740 28707 28306 gene locus_tag LOCUS_20750 28707 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 29155 28709 gene locus_tag LOCUS_20760 29155 28709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 30062 29160 gene locus_tag LOCUS_20770 gene nadA 30062 29160 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_20770 32555 30114 gene locus_tag LOCUS_20780 32555 30114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 32704 34095 gene locus_tag LOCUS_20790 32704 34095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 34202 35173 gene locus_tag LOCUS_20800 34202 35173 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence053 1752 151 gene locus_tag LOCUS_20810 gene nadB 1752 151 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_20810 3012 1945 gene locus_tag LOCUS_20820 gene ahbD 3012 1945 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_20820 4420 3242 gene locus_tag LOCUS_20830 gene ahbC 4420 3242 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_20830 4593 4429 gene locus_tag LOCUS_20840 4593 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4681 5724 gene locus_tag LOCUS_20850 4681 5724 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_20850 5735 6937 gene locus_tag LOCUS_20860 5735 6937 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_20860 8678 7797 gene locus_tag LOCUS_20870 8678 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 9469 9648 gene locus_tag LOCUS_20880 9469 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 10122 10757 gene locus_tag LOCUS_20890 gene plsY 10122 10757 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_20890 10768 11754 gene locus_tag LOCUS_20900 10768 11754 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_20900 11894 12352 gene locus_tag LOCUS_20910 11894 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 12385 12705 gene locus_tag LOCUS_20920 12385 12705 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_20920 12848 14023 gene locus_tag LOCUS_20930 12848 14023 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_20930 14207 15406 gene locus_tag LOCUS_20940 14207 15406 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_20940 17964 15979 gene locus_tag LOCUS_20950 17964 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 18303 17977 gene locus_tag LOCUS_20960 18303 17977 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938669.1 protein_id gnl|my_center|LOCUS_20960 19231 18314 gene locus_tag LOCUS_20970 19231 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 19511 20698 gene locus_tag LOCUS_20980 19511 20698 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_20980 20723 21538 gene locus_tag LOCUS_20990 20723 21538 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_20990 22086 22928 gene locus_tag LOCUS_21000 22086 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 22925 24805 gene locus_tag LOCUS_21010 22925 24805 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_21010 24825 25856 gene locus_tag LOCUS_21020 24825 25856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 25893 26672 gene locus_tag LOCUS_21030 25893 26672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 26669 27454 gene locus_tag LOCUS_21040 gene ccsA 26669 27454 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933223.1 protein_id gnl|my_center|LOCUS_21040 27576 29624 gene locus_tag LOCUS_21050 27576 29624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 30773 30432 gene locus_tag LOCUS_21060 30773 30432 CDS product DUF6172 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275192.1 protein_id gnl|my_center|LOCUS_21060 32793 30778 gene locus_tag LOCUS_21070 32793 30778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 33982 32852 gene locus_tag LOCUS_21080 33982 32852 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486313.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence054 <1 721 gene locus_tag LOCUS_21090 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA note possible pseudo, frameshifted 1481 4684 gene locus_tag LOCUS_21100 gene carB 1481 4684 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_21100 4699 6039 gene locus_tag LOCUS_21110 4699 6039 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_21110 7567 6203 gene locus_tag LOCUS_21120 7567 6203 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_21120 7697 7939 gene locus_tag LOCUS_21130 7697 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 7824 9206 gene locus_tag LOCUS_21140 7824 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 10193 9282 gene locus_tag LOCUS_21150 10193 9282 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925457.1 protein_id gnl|my_center|LOCUS_21150 12970 11465 gene locus_tag LOCUS_21160 gene cls 12970 11465 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_21160 13365 12976 gene locus_tag LOCUS_21170 13365 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 13927 13355 gene locus_tag LOCUS_21180 13927 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 14604 14011 gene locus_tag LOCUS_21190 gene gmk 14604 14011 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546551.1 protein_id gnl|my_center|LOCUS_21190 15732 18491 gene locus_tag LOCUS_21200 15732 18491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 19062 21392 gene locus_tag LOCUS_21210 19062 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 21408 22004 gene locus_tag LOCUS_21220 21408 22004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 22117 24597 gene locus_tag LOCUS_21230 gene gyrB 22117 24597 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882923.1 protein_id gnl|my_center|LOCUS_21230 27615 25939 gene locus_tag LOCUS_21240 gene recN 27615 25939 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_21240 29529 27637 gene locus_tag LOCUS_21250 29529 27637 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953509.1 protein_id gnl|my_center|LOCUS_21250 30733 29510 gene locus_tag LOCUS_21260 30733 29510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 31263 30730 gene locus_tag LOCUS_21270 31263 30730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 32549 31632 gene locus_tag LOCUS_21280 32549 31632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 33005 34327 gene locus_tag LOCUS_21290 33005 34327 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence055 282 1082 gene locus_tag LOCUS_21300 282 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1167 2024 gene locus_tag LOCUS_21310 gene modA 1167 2024 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876557.1 protein_id gnl|my_center|LOCUS_21310 2021 2848 gene locus_tag LOCUS_21320 gene modA 2021 2848 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948645.1 protein_id gnl|my_center|LOCUS_21320 2845 3651 gene locus_tag LOCUS_21330 2845 3651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249669.1 protein_id gnl|my_center|LOCUS_21330 3648 4319 gene locus_tag LOCUS_21340 3648 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 6679 4325 gene locus_tag LOCUS_21350 6679 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 7076 6774 gene locus_tag LOCUS_21360 7076 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 8853 7864 gene locus_tag LOCUS_21370 8853 7864 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175762.1 protein_id gnl|my_center|LOCUS_21370 8996 9166 gene locus_tag LOCUS_21380 8996 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 12317 9513 gene locus_tag LOCUS_21390 12317 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 12543 13607 gene locus_tag LOCUS_21400 gene hisC 12543 13607 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_21400 13663 15297 gene locus_tag LOCUS_21410 13663 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 15370 17238 gene locus_tag LOCUS_21420 15370 17238 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_21420 17243 18190 gene locus_tag LOCUS_21430 17243 18190 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_21430 18198 18620 gene locus_tag LOCUS_21440 gene tsaE 18198 18620 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020035.1 protein_id gnl|my_center|LOCUS_21440 18648 20552 gene locus_tag LOCUS_21450 18648 20552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 20693 21280 gene locus_tag LOCUS_21460 20693 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 21353 22246 gene locus_tag LOCUS_21470 21353 22246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 22282 23178 gene locus_tag LOCUS_21480 22282 23178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 23971 23318 gene locus_tag LOCUS_21490 23971 23318 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 protein_id gnl|my_center|LOCUS_21490 24829 23990 gene locus_tag LOCUS_21500 24829 23990 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_21500 25330 24908 gene locus_tag LOCUS_21510 25330 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 25797 28235 gene locus_tag LOCUS_21520 25797 28235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 28291 29178 gene locus_tag LOCUS_21530 28291 29178 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903317.1 protein_id gnl|my_center|LOCUS_21530 29171 29827 gene locus_tag LOCUS_21540 29171 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 29824 30852 gene locus_tag LOCUS_21550 29824 30852 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929920.1 protein_id gnl|my_center|LOCUS_21550 31079 32203 gene locus_tag LOCUS_21560 31079 32203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 32322 32717 gene locus_tag LOCUS_21570 32322 32717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 32915 33133 gene locus_tag LOCUS_21580 32915 33133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 33714 33478 gene locus_tag LOCUS_21590 33714 33478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence056 1170 1463 gene locus_tag LOCUS_21600 1170 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1773 1405 gene locus_tag LOCUS_21610 1773 1405 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871614.1 protein_id gnl|my_center|LOCUS_21610 3573 1786 gene locus_tag LOCUS_21620 3573 1786 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_21620 3704 4573 gene locus_tag LOCUS_21630 3704 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4698 11255 gene locus_tag LOCUS_21640 4698 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 11432 11262 gene locus_tag LOCUS_21650 11432 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 11512 14082 gene locus_tag LOCUS_21660 gene leuS 11512 14082 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132571.1 protein_id gnl|my_center|LOCUS_21660 15239 15808 gene locus_tag LOCUS_21670 15239 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21670 15980 17896 gene locus_tag LOCUS_21680 gene htpG 15980 17896 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_21680 19218 19892 gene locus_tag LOCUS_21690 19218 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 19912 20832 gene locus_tag LOCUS_21700 19912 20832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 20894 22105 gene locus_tag LOCUS_21710 20894 22105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 22205 23611 gene locus_tag LOCUS_21720 22205 23611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 23657 26173 gene locus_tag LOCUS_21730 23657 26173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 26198 27298 gene locus_tag LOCUS_21740 gene rfbB 26198 27298 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921456.1 protein_id gnl|my_center|LOCUS_21740 27329 28204 gene locus_tag LOCUS_21750 gene rfbA 27329 28204 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_21750 29860 28478 gene locus_tag LOCUS_21760 29860 28478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 30295 31551 gene locus_tag LOCUS_21770 30295 31551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence057 755 450 gene locus_tag LOCUS_21780 755 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 931 743 gene locus_tag LOCUS_21790 931 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 4758 1645 gene locus_tag LOCUS_21800 4758 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4781 4987 gene locus_tag LOCUS_21810 4781 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5693 5328 gene locus_tag LOCUS_21820 5693 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 6052 5588 gene locus_tag LOCUS_21830 6052 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 7098 6448 gene locus_tag LOCUS_21840 7098 6448 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 protein_id gnl|my_center|LOCUS_21840 7448 7161 gene locus_tag LOCUS_21850 7448 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 8309 9613 gene locus_tag LOCUS_21860 8309 9613 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_21860 9663 11027 gene locus_tag LOCUS_21870 9663 11027 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931234.1 protein_id gnl|my_center|LOCUS_21870 11309 12880 gene locus_tag LOCUS_21880 gene cimA 11309 12880 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_21880 13136 14416 gene locus_tag LOCUS_21890 13136 14416 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 protein_id gnl|my_center|LOCUS_21890 14443 14937 gene locus_tag LOCUS_21900 14443 14937 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963327.1 protein_id gnl|my_center|LOCUS_21900 15994 15425 gene locus_tag LOCUS_21910 15994 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 16281 17510 gene locus_tag LOCUS_21920 16281 17510 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_21920 17868 20243 gene locus_tag LOCUS_21930 17868 20243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 20982 23963 gene locus_tag LOCUS_21940 20982 23963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 24024 26192 gene locus_tag LOCUS_21950 24024 26192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 26186 26497 gene locus_tag LOCUS_21960 26186 26497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 26665 28749 gene locus_tag LOCUS_21970 26665 28749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 28777 28932 gene locus_tag LOCUS_21980 28777 28932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 29515 28886 gene locus_tag LOCUS_21990 29515 28886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 30261 31232 gene locus_tag LOCUS_22000 30261 31232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 31294 32208 gene locus_tag LOCUS_22010 31294 32208 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706669.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence058 380 871 gene locus_tag LOCUS_22020 380 871 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930802.1 protein_id gnl|my_center|LOCUS_22020 871 2010 gene locus_tag LOCUS_22030 871 2010 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881328.1 protein_id gnl|my_center|LOCUS_22030 2156 2080 gene locus_tag LOCUS_t00240 2156 2080 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2392 2174 gene locus_tag LOCUS_22040 2392 2174 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_22040 2517 3914 gene locus_tag LOCUS_22050 2517 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 5143 3977 gene locus_tag LOCUS_22060 5143 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 5424 5185 gene locus_tag LOCUS_22070 5424 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 8343 5692 gene locus_tag LOCUS_22080 gene gyrA 8343 5692 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_22080 9974 8586 gene locus_tag LOCUS_22090 9974 8586 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_22090 10795 10031 gene locus_tag LOCUS_22100 10795 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 11893 10859 gene locus_tag LOCUS_22110 11893 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 12245 15742 gene locus_tag LOCUS_22120 12245 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 18240 16912 gene locus_tag LOCUS_22130 18240 16912 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_22130 19602 18283 gene locus_tag LOCUS_22140 19602 18283 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_22140 20143 19607 gene locus_tag LOCUS_22150 20143 19607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 21156 20143 gene locus_tag LOCUS_22160 21156 20143 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_22160 21882 22151 gene locus_tag LOCUS_22170 21882 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 22256 22414 gene locus_tag LOCUS_22180 22256 22414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 22427 22765 gene locus_tag LOCUS_22190 22427 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 22781 23191 gene locus_tag LOCUS_22200 22781 23191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22200 23428 24222 gene locus_tag LOCUS_22210 23428 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22210 24222 24923 gene locus_tag LOCUS_22220 24222 24923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22220 24985 25236 gene locus_tag LOCUS_22230 24985 25236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 25432 31977 gene locus_tag LOCUS_22240 25432 31977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence059 4181 1029 gene locus_tag LOCUS_22250 4181 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 5476 4568 gene locus_tag LOCUS_22260 5476 4568 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_22260 6066 6269 gene locus_tag LOCUS_22270 gene thiS 6066 6269 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 protein_id gnl|my_center|LOCUS_22270 6339 7118 gene locus_tag LOCUS_22280 6339 7118 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217273.1 protein_id gnl|my_center|LOCUS_22280 8676 7357 gene locus_tag LOCUS_22290 8676 7357 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_22290 9313 10164 gene locus_tag LOCUS_22300 gene nifU 9313 10164 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_22300 10263 11444 gene locus_tag LOCUS_22310 gene nifS 10263 11444 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_22310 11651 12616 gene locus_tag LOCUS_22320 11651 12616 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_22320 12665 13429 gene locus_tag LOCUS_22330 12665 13429 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_22330 13572 13787 gene locus_tag LOCUS_22340 13572 13787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 13804 13880 gene locus_tag LOCUS_t00250 13804 13880 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15390 14419 gene locus_tag LOCUS_22350 15390 14419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 15555 16268 gene locus_tag LOCUS_22360 15555 16268 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_22360 16413 18179 gene locus_tag LOCUS_22370 16413 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 18294 18219 gene locus_tag LOCUS_t00260 18294 18219 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 19464 18448 gene locus_tag LOCUS_22380 gene ablA 19464 18448 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023873.1 protein_id gnl|my_center|LOCUS_22380 20335 19469 gene locus_tag LOCUS_22390 20335 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 22044 20809 gene locus_tag LOCUS_22400 22044 20809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 22593 22952 gene locus_tag LOCUS_22410 22593 22952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 23363 23163 gene locus_tag LOCUS_22420 23363 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 23536 23620 gene locus_tag LOCUS_t00270 23536 23620 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 25234 24773 gene locus_tag LOCUS_22430 25234 24773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 26671 25253 gene locus_tag LOCUS_22440 26671 25253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 27195 26983 gene locus_tag LOCUS_22450 27195 26983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 28489 28716 gene locus_tag LOCUS_22460 28489 28716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 28713 29102 gene locus_tag LOCUS_22470 28713 29102 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_22470 29419 29162 gene locus_tag LOCUS_22480 29419 29162 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_22480 29639 29406 gene locus_tag LOCUS_22490 29639 29406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 30305 30078 gene locus_tag LOCUS_22500 30305 30078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 31482 30766 gene locus_tag LOCUS_22510 31482 30766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 32074 31475 gene locus_tag LOCUS_22520 32074 31475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence060 1111 338 gene locus_tag LOCUS_22530 1111 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1555 1154 gene locus_tag LOCUS_22540 1555 1154 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_22540 1782 1552 gene locus_tag LOCUS_22550 1782 1552 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_22550 2275 1970 gene locus_tag LOCUS_22560 2275 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2852 3244 gene locus_tag LOCUS_22570 2852 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3611 3204 gene locus_tag LOCUS_22580 3611 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4210 3953 gene locus_tag LOCUS_22590 4210 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4418 4200 gene locus_tag LOCUS_22600 4418 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 5167 4838 gene locus_tag LOCUS_22610 5167 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5680 5222 gene locus_tag LOCUS_22620 5680 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 6040 5807 gene locus_tag LOCUS_22630 6040 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6606 6073 gene locus_tag LOCUS_22640 6606 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 6770 6603 gene locus_tag LOCUS_22650 6770 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 7278 6700 gene locus_tag LOCUS_22660 7278 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 8311 7313 gene locus_tag LOCUS_22670 8311 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 8979 8413 gene locus_tag LOCUS_22680 8979 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 9834 10097 gene locus_tag LOCUS_22690 9834 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22690 10215 10613 gene locus_tag LOCUS_22700 10215 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 11298 11095 gene locus_tag LOCUS_22710 11298 11095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 11978 11394 gene locus_tag LOCUS_22720 11978 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 12876 11992 gene locus_tag LOCUS_22730 12876 11992 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259391.1 protein_id gnl|my_center|LOCUS_22730 13433 13164 gene locus_tag LOCUS_22740 13433 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 13990 15282 gene locus_tag LOCUS_22750 13990 15282 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_22750 15596 15850 gene locus_tag LOCUS_22760 15596 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22760 16411 16923 gene locus_tag LOCUS_22770 16411 16923 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525023.1 protein_id gnl|my_center|LOCUS_22770 17161 17823 gene locus_tag LOCUS_22780 17161 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 17851 19317 gene locus_tag LOCUS_22790 gene htrA 17851 19317 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872209.1 protein_id gnl|my_center|LOCUS_22790 19436 20638 gene locus_tag LOCUS_22800 19436 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 21061 20834 gene locus_tag LOCUS_22810 21061 20834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 21344 21135 gene locus_tag LOCUS_22820 21344 21135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 21725 21462 gene locus_tag LOCUS_22830 21725 21462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22830 22506 22024 gene locus_tag LOCUS_22840 22506 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 23468 22779 gene locus_tag LOCUS_22850 23468 22779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22850 23935 23465 gene locus_tag LOCUS_22860 23935 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22860 24097 26061 gene locus_tag LOCUS_22870 24097 26061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 26061 28637 gene locus_tag LOCUS_22880 26061 28637 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_22880 28914 31403 gene locus_tag LOCUS_22890 28914 31403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 31545 31691 gene locus_tag LOCUS_22900 31545 31691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence061 73 288 gene locus_tag LOCUS_22910 73 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 654 460 gene locus_tag LOCUS_22920 654 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 610 3219 gene locus_tag LOCUS_22930 610 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3646 3948 gene locus_tag LOCUS_22940 3646 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3945 6023 gene locus_tag LOCUS_22950 3945 6023 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901007.1 protein_id gnl|my_center|LOCUS_22950 6041 6397 gene locus_tag LOCUS_22960 6041 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 6732 6950 gene locus_tag LOCUS_22970 6732 6950 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 protein_id gnl|my_center|LOCUS_22970 6982 7131 gene locus_tag LOCUS_22980 6982 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7217 8659 gene locus_tag LOCUS_22990 gene lysS 7217 8659 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359372.1 protein_id gnl|my_center|LOCUS_22990 9125 11938 gene locus_tag LOCUS_23000 9125 11938 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_23000 16744 12818 gene locus_tag LOCUS_23010 16744 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 18377 16842 gene locus_tag LOCUS_23020 18377 16842 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_23020 18818 18573 gene locus_tag LOCUS_23030 18818 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 18881 19462 gene locus_tag LOCUS_23040 18881 19462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 19993 19679 gene locus_tag LOCUS_23050 19993 19679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 21570 20029 gene locus_tag LOCUS_23060 gene guaA 21570 20029 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_23060 23328 21931 gene locus_tag LOCUS_23070 gene purB 23328 21931 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_23070 23498 24925 gene locus_tag LOCUS_23080 23498 24925 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_23080 25124 26020 gene locus_tag LOCUS_23090 25124 26020 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_23090 28261 26654 gene locus_tag LOCUS_23100 28261 26654 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_23100 29598 28303 gene locus_tag LOCUS_23110 29598 28303 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_23110 31333 29591 gene locus_tag LOCUS_23120 31333 29591 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence062 3085 716 gene locus_tag LOCUS_23130 3085 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 5220 3160 gene locus_tag LOCUS_23140 5220 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 8567 5640 gene locus_tag LOCUS_23150 8567 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 11420 8997 gene locus_tag LOCUS_23160 11420 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 12415 11501 gene locus_tag LOCUS_23170 12415 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23170 13449 12664 gene locus_tag LOCUS_23180 13449 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 16214 14118 gene locus_tag LOCUS_23190 16214 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 16315 17100 gene locus_tag LOCUS_23200 16315 17100 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379796.1 protein_id gnl|my_center|LOCUS_23200 17090 17458 gene locus_tag LOCUS_23210 gene folB 17090 17458 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_23210 17451 17975 gene locus_tag LOCUS_23220 gene folK 17451 17975 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214497.1 protein_id gnl|my_center|LOCUS_23220 17965 18531 gene locus_tag LOCUS_23230 gene folE 17965 18531 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_23230 19411 18938 gene locus_tag LOCUS_23240 19411 18938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 19989 19408 gene locus_tag LOCUS_23250 19989 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 20918 19992 gene locus_tag LOCUS_23260 20918 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 21115 21522 gene locus_tag LOCUS_23270 21115 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 21685 23505 gene locus_tag LOCUS_23280 21685 23505 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_23280 23505 25685 gene locus_tag LOCUS_23290 23505 25685 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_23290 26183 25719 gene locus_tag LOCUS_23300 26183 25719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 26834 26217 gene locus_tag LOCUS_23310 26834 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 28213 26846 gene locus_tag LOCUS_23320 28213 26846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 29945 28206 gene locus_tag LOCUS_23330 29945 28206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 30511 30152 gene locus_tag LOCUS_23340 30511 30152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence063 362 664 gene locus_tag LOCUS_23350 362 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2439 1081 gene locus_tag LOCUS_23360 2439 1081 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926993.1 protein_id gnl|my_center|LOCUS_23360 3801 2545 gene locus_tag LOCUS_23370 3801 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 3949 7185 gene locus_tag LOCUS_23380 gene mfd 3949 7185 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_23380 8152 8775 gene locus_tag LOCUS_23390 8152 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 10858 9620 gene locus_tag LOCUS_23400 10858 9620 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_23400 11037 10855 gene locus_tag LOCUS_23410 11037 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 12366 12166 gene locus_tag LOCUS_23420 12366 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 13173 12523 gene locus_tag LOCUS_23430 13173 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_23430 14025 13792 gene locus_tag LOCUS_23440 14025 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 15229 14816 gene locus_tag LOCUS_23450 15229 14816 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_23450 15501 15226 gene locus_tag LOCUS_23460 15501 15226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 15626 15862 gene locus_tag LOCUS_23470 15626 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 16431 16021 gene locus_tag LOCUS_23480 16431 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 17009 16815 gene locus_tag LOCUS_23490 17009 16815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 17169 17014 gene locus_tag LOCUS_23500 17169 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 18050 17844 gene locus_tag LOCUS_23510 18050 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 18270 18124 gene locus_tag LOCUS_23520 18270 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 20038 18809 gene locus_tag LOCUS_23530 20038 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 22476 20134 gene locus_tag LOCUS_23540 22476 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 25525 22469 gene locus_tag LOCUS_23550 25525 22469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 28694 25644 gene locus_tag LOCUS_23560 28694 25644 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239259.1 protein_id gnl|my_center|LOCUS_23560 29993 28890 gene locus_tag LOCUS_23570 29993 28890 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_23570 30202 30005 gene locus_tag LOCUS_23580 30202 30005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence064 1284 208 gene locus_tag LOCUS_23590 1284 208 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_23590 2054 1290 gene locus_tag LOCUS_23600 2054 1290 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_23600 2766 4886 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcgcccgcgtggggcgcgac 5353 5063 gene locus_tag LOCUS_23610 gene cas2 5353 5063 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_23610 6386 5364 gene locus_tag LOCUS_23620 gene cas1c 6386 5364 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_23620 6710 6393 gene locus_tag LOCUS_23630 6710 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 8074 7109 gene locus_tag LOCUS_23640 gene cas7c 8074 7109 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388586.1 protein_id gnl|my_center|LOCUS_23640 10006 8093 gene locus_tag LOCUS_23650 gene cas8c 10006 8093 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_23650 10902 10009 gene locus_tag LOCUS_23660 10902 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 13187 10899 gene locus_tag LOCUS_23670 13187 10899 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_23670 14452 15081 gene locus_tag LOCUS_23680 14452 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 15376 16365 gene locus_tag LOCUS_23690 15376 16365 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_23690 16529 17467 gene locus_tag LOCUS_23700 16529 17467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_23700 17460 18428 gene locus_tag LOCUS_23710 17460 18428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_23710 18425 19561 gene locus_tag LOCUS_23720 18425 19561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_23720 19558 20691 gene locus_tag LOCUS_23730 19558 20691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_23730 20835 22232 gene locus_tag LOCUS_23740 20835 22232 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_23740 22791 28532 gene locus_tag LOCUS_23750 22791 28532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence065 2132 3388 gene locus_tag LOCUS_23760 2132 3388 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 protein_id gnl|my_center|LOCUS_23760 3487 3711 gene locus_tag LOCUS_23770 3487 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 4739 4020 gene locus_tag LOCUS_23780 4739 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 6075 4807 gene locus_tag LOCUS_23790 6075 4807 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_23790 6479 6859 gene locus_tag LOCUS_23800 6479 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 6929 7615 gene locus_tag LOCUS_23810 6929 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 8669 7806 gene locus_tag LOCUS_23820 8669 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 9409 9080 gene locus_tag LOCUS_23830 9409 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 9989 11230 gene locus_tag LOCUS_23840 9989 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 11342 12724 gene locus_tag LOCUS_23850 gene atoC 11342 12724 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125283.1 protein_id gnl|my_center|LOCUS_23850 12954 13685 gene locus_tag LOCUS_23860 12954 13685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 13678 14424 gene locus_tag LOCUS_23870 13678 14424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_23870 14450 16339 gene locus_tag LOCUS_23880 14450 16339 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_23880 16357 17439 gene locus_tag LOCUS_23890 16357 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 17744 18727 gene locus_tag LOCUS_23900 17744 18727 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_23900 18926 19813 gene locus_tag LOCUS_23910 18926 19813 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_23910 19876 20838 gene locus_tag LOCUS_23920 19876 20838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 20848 21885 gene locus_tag LOCUS_23930 20848 21885 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_23930 22083 24647 gene locus_tag LOCUS_23940 22083 24647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 24823 26739 gene locus_tag LOCUS_23950 24823 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 26736 27494 gene locus_tag LOCUS_23960 26736 27494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 27491 28753 gene locus_tag LOCUS_23970 27491 28753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence066 41 394 gene locus_tag LOCUS_23980 41 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1761 2141 gene locus_tag LOCUS_23990 1761 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 3577 2378 gene locus_tag LOCUS_24000 3577 2378 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_24000 3643 4170 gene locus_tag LOCUS_24010 3643 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 4249 4905 gene locus_tag LOCUS_24020 4249 4905 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940801.1 protein_id gnl|my_center|LOCUS_24020 4970 6847 gene locus_tag LOCUS_24030 4970 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 8054 6960 gene locus_tag LOCUS_24040 gene prfA 8054 6960 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_24040 8480 8265 gene locus_tag LOCUS_24050 gene rpmE 8480 8265 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_24050 9286 8585 gene locus_tag LOCUS_24060 gene rsmI 9286 8585 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_24060 10341 9241 gene locus_tag LOCUS_24070 10341 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 10894 10382 gene locus_tag LOCUS_24080 10894 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 11849 10908 gene locus_tag LOCUS_24090 11849 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 12236 13810 gene locus_tag LOCUS_24100 gene serA 12236 13810 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_24100 14121 14333 gene locus_tag LOCUS_24110 14121 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 14515 15366 gene locus_tag LOCUS_24120 gene prmA 14515 15366 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_24120 16232 16456 gene locus_tag LOCUS_24130 16232 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 16902 16534 gene locus_tag LOCUS_24140 16902 16534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 17111 18274 gene locus_tag LOCUS_24150 17111 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 18293 19696 gene locus_tag LOCUS_24160 18293 19696 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680054.1 protein_id gnl|my_center|LOCUS_24160 20367 22052 gene locus_tag LOCUS_24170 gene sulP 20367 22052 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_24170 22749 24221 gene locus_tag LOCUS_24180 22749 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 25635 26150 gene locus_tag LOCUS_24190 25635 26150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 26344 26925 gene locus_tag LOCUS_24200 26344 26925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 28228 28022 gene locus_tag LOCUS_24210 28228 28022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence067 459 1232 gene locus_tag LOCUS_24220 459 1232 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_24220 1326 2618 gene locus_tag LOCUS_24230 gene murA 1326 2618 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_24230 2896 3900 gene locus_tag LOCUS_24240 2896 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 5005 3920 gene locus_tag LOCUS_24250 5005 3920 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461803.1 protein_id gnl|my_center|LOCUS_24250 7186 5885 gene locus_tag LOCUS_24260 7186 5885 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 protein_id gnl|my_center|LOCUS_24260 8031 9245 gene locus_tag LOCUS_24270 gene rsmB 8031 9245 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_24270 9831 10652 gene locus_tag LOCUS_24280 9831 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 11672 11121 gene locus_tag LOCUS_24290 11672 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 11893 12393 gene locus_tag LOCUS_24300 gene tpx 11893 12393 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_24300 14791 12443 gene locus_tag LOCUS_24310 14791 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 15923 14808 gene locus_tag LOCUS_24320 gene holA 15923 14808 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_24320 16173 20657 gene locus_tag LOCUS_24330 16173 20657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 22838 21396 gene locus_tag LOCUS_24340 22838 21396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 24312 22930 gene locus_tag LOCUS_24350 24312 22930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 25625 24309 gene locus_tag LOCUS_24360 25625 24309 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_24360 26153 25824 gene locus_tag LOCUS_24370 26153 25824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 26373 26137 gene locus_tag LOCUS_24380 26373 26137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24380 26546 26325 gene locus_tag LOCUS_24390 26546 26325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence068 137 1117 gene locus_tag LOCUS_24400 137 1117 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566815.1 protein_id gnl|my_center|LOCUS_24400 1811 2638 gene locus_tag LOCUS_24410 1811 2638 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_24410 2629 3348 gene locus_tag LOCUS_24420 gene pflA 2629 3348 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799649.1 protein_id gnl|my_center|LOCUS_24420 4609 3719 gene locus_tag LOCUS_24430 4609 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4876 8361 gene locus_tag LOCUS_24440 4876 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 8591 8878 gene locus_tag LOCUS_24450 8591 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 8965 8890 gene locus_tag LOCUS_t00280 8965 8890 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9068 9556 gene locus_tag LOCUS_24460 9068 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 9564 10361 gene locus_tag LOCUS_24470 gene proC 9564 10361 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_24470 10375 10635 gene locus_tag LOCUS_24480 10375 10635 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_24480 10632 10835 gene locus_tag LOCUS_24490 10632 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 10825 12270 gene locus_tag LOCUS_24500 10825 12270 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_24500 13088 14038 gene locus_tag LOCUS_24510 13088 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 14083 14301 gene locus_tag LOCUS_24520 14083 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 15604 14666 gene locus_tag LOCUS_24530 15604 14666 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_24530 16576 15719 gene locus_tag LOCUS_24540 16576 15719 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_24540 16724 18157 gene locus_tag LOCUS_24550 16724 18157 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_24550 18516 18331 gene locus_tag LOCUS_24560 18516 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 19189 18491 gene locus_tag LOCUS_24570 19189 18491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24570 19757 20665 gene locus_tag LOCUS_24580 gene ispE 19757 20665 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_24580 20651 20724 gene locus_tag LOCUS_t00290 20651 20724 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20753 21763 gene locus_tag LOCUS_24590 20753 21763 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_24590 21913 22536 gene locus_tag LOCUS_24600 21913 22536 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_24600 22607 23200 gene locus_tag LOCUS_24610 gene pth 22607 23200 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240196.1 protein_id gnl|my_center|LOCUS_24610 23218 23622 gene locus_tag LOCUS_24620 23218 23622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 23653 24117 gene locus_tag LOCUS_24630 23653 24117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 24147 24404 gene locus_tag LOCUS_24640 24147 24404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 24428 24880 gene locus_tag LOCUS_24650 gene rplI 24428 24880 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_24650 26510 25782 gene locus_tag LOCUS_24660 26510 25782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence069 1153 911 gene locus_tag LOCUS_24670 1153 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1509 1210 gene locus_tag LOCUS_24680 1509 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2215 1652 gene locus_tag LOCUS_24690 2215 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2638 2737 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3295 2786 gene locus_tag LOCUS_24700 3295 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4377 7613 gene locus_tag LOCUS_24710 gene recC 4377 7613 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816979.1 protein_id gnl|my_center|LOCUS_24710 7610 10948 gene locus_tag LOCUS_24720 gene recB 7610 10948 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098544.1 protein_id gnl|my_center|LOCUS_24720 11826 13601 gene locus_tag LOCUS_24730 gene recD 11826 13601 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_24730 13660 13896 gene locus_tag LOCUS_24740 13660 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 13909 15969 gene locus_tag LOCUS_24750 13909 15969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 17155 15977 gene locus_tag LOCUS_24760 17155 15977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 17506 20244 gene locus_tag LOCUS_24770 17506 20244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 20558 23422 gene locus_tag LOCUS_24780 20558 23422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 23435 25327 gene locus_tag LOCUS_24790 23435 25327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 26119 25619 gene locus_tag LOCUS_24800 26119 25619 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_24800 27437 26778 gene locus_tag LOCUS_24810 27437 26778 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294676.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence070 651 563 gene locus_tag LOCUS_t00300 651 563 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 780 2081 gene locus_tag LOCUS_24820 780 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2111 2716 gene locus_tag LOCUS_24830 2111 2716 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_24830 2838 3035 gene locus_tag LOCUS_24840 2838 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 3052 3405 gene locus_tag LOCUS_24850 gene rplT 3052 3405 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939805.1 protein_id gnl|my_center|LOCUS_24850 3769 4434 gene locus_tag LOCUS_24860 3769 4434 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257281.1 protein_id gnl|my_center|LOCUS_24860 4536 5756 gene locus_tag LOCUS_24870 4536 5756 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_24870 6305 7762 gene locus_tag LOCUS_24880 6305 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 7943 7713 gene locus_tag LOCUS_24890 7943 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 8197 12033 gene locus_tag LOCUS_24900 8197 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 12180 15320 gene locus_tag LOCUS_24910 12180 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 15460 16260 gene locus_tag LOCUS_24920 15460 16260 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_24920 17921 16479 gene locus_tag LOCUS_24930 17921 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 18208 18726 gene locus_tag LOCUS_24940 18208 18726 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931814.1 protein_id gnl|my_center|LOCUS_24940 18896 19753 gene locus_tag LOCUS_24950 18896 19753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24950 19925 20653 gene locus_tag LOCUS_24960 19925 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 21940 20840 gene locus_tag LOCUS_24970 21940 20840 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_24970 22543 23385 gene locus_tag LOCUS_24980 gene lpxI 22543 23385 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_24980 23511 24689 gene locus_tag LOCUS_24990 gene lpxB 23511 24689 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_24990 24733 25947 gene locus_tag LOCUS_25000 24733 25947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 27374 26076 gene locus_tag LOCUS_25010 27374 26076 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544916.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence071 11267 10203 gene locus_tag LOCUS_25020 11267 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 11973 11368 gene locus_tag LOCUS_25030 11973 11368 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_25030 12806 13714 gene locus_tag LOCUS_25040 12806 13714 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_25040 14699 14860 gene locus_tag LOCUS_25050 14699 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 15123 17336 gene locus_tag LOCUS_25060 gene pflB 15123 17336 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056834.1 protein_id gnl|my_center|LOCUS_25060 19250 17805 gene locus_tag LOCUS_25070 gene der 19250 17805 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_25070 21984 20251 gene locus_tag LOCUS_25080 21984 20251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 22218 23087 gene locus_tag LOCUS_25090 gene hisG 22218 23087 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_25090 23487 24974 gene locus_tag LOCUS_25100 23487 24974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 24978 27044 gene locus_tag LOCUS_25110 24978 27044 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence072 148 2262 gene locus_tag LOCUS_25120 148 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3113 4108 gene locus_tag LOCUS_25130 gene gap 3113 4108 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_25130 4206 5450 gene locus_tag LOCUS_25140 4206 5450 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_25140 5694 5793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6251 6823 gene locus_tag LOCUS_25150 6251 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 6968 8623 gene locus_tag LOCUS_25160 6968 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 8636 13633 gene locus_tag LOCUS_25170 8636 13633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 13653 14594 gene locus_tag LOCUS_25180 13653 14594 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172286.1 protein_id gnl|my_center|LOCUS_25180 14688 15584 gene locus_tag LOCUS_25190 14688 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 16526 15591 gene locus_tag LOCUS_25200 16526 15591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 16623 18002 gene locus_tag LOCUS_25210 16623 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 21045 18922 gene locus_tag LOCUS_25220 21045 18922 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_25220 22488 21367 gene locus_tag LOCUS_25230 gene tal 22488 21367 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_25230 22487 22690 gene locus_tag LOCUS_25240 22487 22690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 23048 22758 gene locus_tag LOCUS_25250 23048 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 23315 24214 gene locus_tag LOCUS_25260 gene thyX 23315 24214 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_25260 26068 24722 gene locus_tag LOCUS_25270 gene pyk 26068 24722 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_25270 26638 27006 gene locus_tag LOCUS_25280 26638 27006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence073 701 6490 gene locus_tag LOCUS_25290 701 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 7242 9155 gene locus_tag LOCUS_25300 gene dnaK 7242 9155 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_25300 9210 9503 gene locus_tag LOCUS_25310 gene groES 9210 9503 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258595.1 protein_id gnl|my_center|LOCUS_25310 9534 11171 gene locus_tag LOCUS_25320 gene groL 9534 11171 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_25320 11680 14487 gene locus_tag LOCUS_25330 11680 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 12557 12637 gene locus_tag LOCUS_t00310 12557 12637 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15367 16179 gene locus_tag LOCUS_25340 15367 16179 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814132.1 protein_id gnl|my_center|LOCUS_25340 16176 18215 gene locus_tag LOCUS_25350 16176 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 18342 20057 gene locus_tag LOCUS_25360 18342 20057 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_25360 21844 20066 gene locus_tag LOCUS_25370 21844 20066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 22991 21876 gene locus_tag LOCUS_25380 22991 21876 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921834.1 protein_id gnl|my_center|LOCUS_25380 23253 23783 gene locus_tag LOCUS_25390 23253 23783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 24067 23822 gene locus_tag LOCUS_25400 24067 23822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 24907 26910 gene locus_tag LOCUS_25410 24907 26910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence074 292 1314 gene locus_tag LOCUS_25420 gene alr 292 1314 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_25420 1336 4002 gene locus_tag LOCUS_25430 1336 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 4409 4936 gene locus_tag LOCUS_25440 4409 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 4936 5118 gene locus_tag LOCUS_25450 4936 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 6483 5266 gene locus_tag LOCUS_25460 gene rlmD 6483 5266 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_25460 8007 6643 gene locus_tag LOCUS_25470 gene miaB 8007 6643 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_25470 9926 8004 gene locus_tag LOCUS_25480 9926 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 10873 9911 gene locus_tag LOCUS_25490 10873 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 12574 11522 gene locus_tag LOCUS_25500 12574 11522 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_25500 13626 12571 gene locus_tag LOCUS_25510 gene argC 13626 12571 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_25510 16626 14242 gene locus_tag LOCUS_25520 16626 14242 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_25520 19042 17303 gene locus_tag LOCUS_25530 19042 17303 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_25530 19355 20590 gene locus_tag LOCUS_25540 gene argJ 19355 20590 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_25540 20642 21520 gene locus_tag LOCUS_25550 gene argB 20642 21520 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_25550 21513 22712 gene locus_tag LOCUS_25560 21513 22712 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_25560 22805 24037 gene locus_tag LOCUS_25570 22805 24037 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212817996.1 protein_id gnl|my_center|LOCUS_25570 24268 25257 gene locus_tag LOCUS_25580 24268 25257 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_25580 25596 26333 gene locus_tag LOCUS_25590 25596 26333 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119010.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence075 436 882 gene locus_tag LOCUS_25600 436 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 955 1503 gene locus_tag LOCUS_25610 955 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2888 1500 gene locus_tag LOCUS_25620 2888 1500 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_25620 4678 2924 gene locus_tag LOCUS_25630 4678 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 4942 5475 gene locus_tag LOCUS_25640 4942 5475 CDS product COG2426 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249640.1 protein_id gnl|my_center|LOCUS_25640 5468 6463 gene locus_tag LOCUS_25650 5468 6463 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_25650 6605 7618 gene locus_tag LOCUS_25660 6605 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 7740 8732 gene locus_tag LOCUS_25670 7740 8732 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_25670 9863 10885 gene locus_tag LOCUS_25680 9863 10885 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_25680 10939 11403 gene locus_tag LOCUS_25690 10939 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 11400 12704 gene locus_tag LOCUS_25700 11400 12704 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_25700 12952 13146 gene locus_tag LOCUS_25710 12952 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 14885 13518 gene locus_tag LOCUS_25720 gene yjjJ 14885 13518 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_25720 15957 17450 gene locus_tag LOCUS_25730 15957 17450 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_25730 17447 18625 gene locus_tag LOCUS_25740 17447 18625 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022386.1 protein_id gnl|my_center|LOCUS_25740 18622 22002 gene locus_tag LOCUS_25750 18622 22002 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_25750 22299 22430 gene locus_tag LOCUS_25760 22299 22430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 22910 23119 gene locus_tag LOCUS_25770 22910 23119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 23410 23258 gene locus_tag LOCUS_25780 23410 23258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence076 120 299 gene locus_tag LOCUS_25790 120 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 420 668 gene locus_tag LOCUS_25800 420 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 708 998 gene locus_tag LOCUS_25810 708 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1048 1548 gene locus_tag LOCUS_25820 1048 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1913 3742 gene locus_tag LOCUS_25830 1913 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 5659 6093 gene locus_tag LOCUS_25840 5659 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 6837 7688 gene locus_tag LOCUS_25850 6837 7688 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256554.1 protein_id gnl|my_center|LOCUS_25850 7675 8442 gene locus_tag LOCUS_25860 7675 8442 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_25860 8562 8843 gene locus_tag LOCUS_25870 8562 8843 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086649.1 protein_id gnl|my_center|LOCUS_25870 8840 9064 gene locus_tag LOCUS_25880 8840 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 9263 9646 gene locus_tag LOCUS_25890 9263 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 9982 10206 gene locus_tag LOCUS_25900 9982 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 10482 10673 gene locus_tag LOCUS_25910 10482 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 11323 11159 gene locus_tag LOCUS_25920 11323 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 11725 11399 gene locus_tag LOCUS_25930 11725 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 12483 11728 gene locus_tag LOCUS_25940 12483 11728 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015241729.1 protein_id gnl|my_center|LOCUS_25940 13389 13598 gene locus_tag LOCUS_25950 13389 13598 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_25950 14389 16125 gene locus_tag LOCUS_25960 14389 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 18031 16643 gene locus_tag LOCUS_25970 gene asnS 18031 16643 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882977.1 protein_id gnl|my_center|LOCUS_25970 21319 18041 gene locus_tag LOCUS_25980 21319 18041 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256275.1 protein_id gnl|my_center|LOCUS_25980 21489 24812 gene locus_tag LOCUS_25990 21489 24812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 >Feature sequence077 1097 2686 gene locus_tag LOCUS_26000 1097 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2754 4490 gene locus_tag LOCUS_26010 2754 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 4477 4692 gene locus_tag LOCUS_26020 4477 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 4888 4727 gene locus_tag LOCUS_26030 4888 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 6690 5185 gene locus_tag LOCUS_26040 6690 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 8031 6697 gene locus_tag LOCUS_26050 8031 6697 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_26050 8890 8237 gene locus_tag LOCUS_26060 8890 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 9705 10694 gene locus_tag LOCUS_26070 9705 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 12257 11262 gene locus_tag LOCUS_26080 12257 11262 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_26080 12932 12354 gene locus_tag LOCUS_26090 12932 12354 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_26090 13860 13141 gene locus_tag LOCUS_26100 13860 13141 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_26100 14075 17950 gene locus_tag LOCUS_26110 14075 17950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 18109 19920 gene locus_tag LOCUS_26120 18109 19920 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_26120 20259 23843 gene locus_tag LOCUS_26130 20259 23843 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_26130 23900 24736 gene locus_tag LOCUS_26140 23900 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence078 875 567 gene locus_tag LOCUS_26150 875 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 1104 868 gene locus_tag LOCUS_26160 1104 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1858 2082 gene locus_tag LOCUS_26170 1858 2082 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_26170 2069 2401 gene locus_tag LOCUS_26180 2069 2401 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_26180 2391 3344 gene locus_tag LOCUS_26190 2391 3344 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_26190 4098 4280 gene locus_tag LOCUS_26200 4098 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 4268 4570 gene locus_tag LOCUS_26210 4268 4570 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 protein_id gnl|my_center|LOCUS_26210 5060 5278 gene locus_tag LOCUS_26220 5060 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 6542 6225 gene locus_tag LOCUS_26230 6542 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 6991 6569 gene locus_tag LOCUS_26240 6991 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 7100 7603 gene locus_tag LOCUS_26250 7100 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 9371 7935 gene locus_tag LOCUS_26260 9371 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 10418 9534 gene locus_tag LOCUS_26270 10418 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 14312 11697 gene locus_tag LOCUS_26280 14312 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 15799 14471 gene locus_tag LOCUS_26290 15799 14471 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_26290 16004 17407 gene locus_tag LOCUS_26300 16004 17407 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809528.1 protein_id gnl|my_center|LOCUS_26300 18144 17728 gene locus_tag LOCUS_26310 18144 17728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 19074 18220 gene locus_tag LOCUS_26320 19074 18220 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963753.1 protein_id gnl|my_center|LOCUS_26320 20478 19249 gene locus_tag LOCUS_26330 20478 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 20841 21836 gene locus_tag LOCUS_26340 20841 21836 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_26340 22615 23472 gene locus_tag LOCUS_26350 22615 23472 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence079 902 1165 gene locus_tag LOCUS_26360 902 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 1814 3514 gene locus_tag LOCUS_26370 1814 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 4793 3669 gene locus_tag LOCUS_26380 gene rhaT 4793 3669 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_26380 4971 5144 gene locus_tag LOCUS_26390 4971 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 5187 5426 gene locus_tag LOCUS_26400 5187 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 5456 6151 gene locus_tag LOCUS_26410 5456 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 6148 7587 gene locus_tag LOCUS_26420 6148 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 7806 7905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8056 8658 gene locus_tag LOCUS_26430 8056 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 8655 9341 gene locus_tag LOCUS_26440 8655 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 9392 10210 gene locus_tag LOCUS_26450 9392 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 10222 11973 gene locus_tag LOCUS_26460 10222 11973 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_26460 11990 12877 gene locus_tag LOCUS_26470 11990 12877 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 protein_id gnl|my_center|LOCUS_26470 13309 13530 gene locus_tag LOCUS_26480 13309 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 13578 15905 gene locus_tag LOCUS_26490 13578 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 18818 16263 gene locus_tag LOCUS_26500 18818 16263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 21190 19061 gene locus_tag LOCUS_26510 21190 19061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 24242 21339 gene locus_tag LOCUS_26520 24242 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence080 2238 3356 gene locus_tag LOCUS_26530 2238 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3346 5547 gene locus_tag LOCUS_26540 3346 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073425.1 protein_id gnl|my_center|LOCUS_26540 6371 6850 gene locus_tag LOCUS_26550 6371 6850 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929081.1 protein_id gnl|my_center|LOCUS_26550 6893 7126 gene locus_tag LOCUS_26560 6893 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 7137 7919 gene locus_tag LOCUS_26570 7137 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 8503 8261 gene locus_tag LOCUS_26580 8503 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 8698 9522 gene locus_tag LOCUS_26590 gene nadC 8698 9522 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_26590 9524 10276 gene locus_tag LOCUS_26600 9524 10276 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869867.1 protein_id gnl|my_center|LOCUS_26600 10415 11665 gene locus_tag LOCUS_26610 10415 11665 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_26610 11666 13333 gene locus_tag LOCUS_26620 11666 13333 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_26620 13670 14083 gene locus_tag LOCUS_26630 gene hisI 13670 14083 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903699.1 protein_id gnl|my_center|LOCUS_26630 14097 16724 gene locus_tag LOCUS_26640 14097 16724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 17740 18288 gene locus_tag LOCUS_26650 17740 18288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 18289 18648 gene locus_tag LOCUS_26660 18289 18648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 19040 19561 gene locus_tag LOCUS_26670 19040 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 21318 19810 gene locus_tag LOCUS_26680 21318 19810 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727239.1 protein_id gnl|my_center|LOCUS_26680 22262 21324 gene locus_tag LOCUS_26690 22262 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 22685 22485 gene locus_tag LOCUS_26700 22685 22485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 24099 23653 gene locus_tag LOCUS_26710 24099 23653 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence081 870 268 gene locus_tag LOCUS_26720 870 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1877 954 gene locus_tag LOCUS_26730 1877 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2103 1870 gene locus_tag LOCUS_26740 2103 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3839 3063 gene locus_tag LOCUS_26750 3839 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26750 4259 3849 gene locus_tag LOCUS_26760 4259 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 7387 4670 gene locus_tag LOCUS_26770 7387 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 8465 8390 gene locus_tag LOCUS_t00320 8465 8390 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9579 8770 gene locus_tag LOCUS_26780 9579 8770 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_26780 10973 9597 gene locus_tag LOCUS_26790 10973 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 11642 11022 gene locus_tag LOCUS_26800 11642 11022 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686506.1 protein_id gnl|my_center|LOCUS_26800 12067 11654 gene locus_tag LOCUS_26810 gene queD 12067 11654 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 protein_id gnl|my_center|LOCUS_26810 12822 12157 gene locus_tag LOCUS_26820 gene queC 12822 12157 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225597.1 protein_id gnl|my_center|LOCUS_26820 13313 12819 gene locus_tag LOCUS_26830 gene queF 13313 12819 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 protein_id gnl|my_center|LOCUS_26830 15644 13500 gene locus_tag LOCUS_26840 15644 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 17251 15755 gene locus_tag LOCUS_26850 17251 15755 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_26850 19567 17255 gene locus_tag LOCUS_26860 gene nuoF 19567 17255 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_26860 19849 20196 gene locus_tag LOCUS_26870 19849 20196 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_26870 20229 21335 gene locus_tag LOCUS_26880 20229 21335 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_26880 23071 21680 gene locus_tag LOCUS_26890 23071 21680 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_26890 23019 23186 gene locus_tag LOCUS_26900 23019 23186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 23427 23633 gene locus_tag LOCUS_26910 23427 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 23928 24530 gene locus_tag LOCUS_26920 23928 24530 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence082 761 5080 gene locus_tag LOCUS_26930 761 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 5197 6537 gene locus_tag LOCUS_26940 5197 6537 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_26940 6638 7372 gene locus_tag LOCUS_26950 6638 7372 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_26950 7390 8367 gene locus_tag LOCUS_26960 7390 8367 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_26960 10761 9010 gene locus_tag LOCUS_26970 10761 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 11762 10764 gene locus_tag LOCUS_26980 11762 10764 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_26980 12982 12227 gene locus_tag LOCUS_26990 12982 12227 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_26990 13199 12996 gene locus_tag LOCUS_27000 13199 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 13970 13203 gene locus_tag LOCUS_27010 13970 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 14156 15163 gene locus_tag LOCUS_27020 14156 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 15169 15750 gene locus_tag LOCUS_27030 15169 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 15747 16244 gene locus_tag LOCUS_27040 15747 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 16862 17191 gene locus_tag LOCUS_27050 16862 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 17191 19074 gene locus_tag LOCUS_27060 17191 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 19067 20374 gene locus_tag LOCUS_27070 19067 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 20824 21777 gene locus_tag LOCUS_27080 20824 21777 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_27080 21914 23239 gene locus_tag LOCUS_27090 21914 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence083 3262 527 gene locus_tag LOCUS_27100 3262 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 6878 3300 gene locus_tag LOCUS_27110 6878 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 7449 8252 gene locus_tag LOCUS_27120 7449 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 8280 9536 gene locus_tag LOCUS_27130 8280 9536 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_27130 9584 10606 gene locus_tag LOCUS_27140 9584 10606 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_27140 11106 12272 gene locus_tag LOCUS_27150 gene aroC 11106 12272 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933099.1 protein_id gnl|my_center|LOCUS_27150 13420 15030 gene locus_tag LOCUS_27160 13420 15030 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_27160 15109 15034 gene locus_tag LOCUS_t00330 15109 15034 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15600 16961 gene locus_tag LOCUS_27170 15600 16961 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656298.1 protein_id gnl|my_center|LOCUS_27170 16965 17891 gene locus_tag LOCUS_27180 gene era 16965 17891 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392137.1 protein_id gnl|my_center|LOCUS_27180 17980 18459 gene locus_tag LOCUS_27190 17980 18459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 22911 19273 gene locus_tag LOCUS_27200 22911 19273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence084 1775 360 gene locus_tag LOCUS_27210 1775 360 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727239.1 protein_id gnl|my_center|LOCUS_27210 2717 1794 gene locus_tag LOCUS_27220 2717 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 2887 4944 gene locus_tag LOCUS_27230 2887 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 6240 7604 gene locus_tag LOCUS_27240 6240 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 7619 8914 gene locus_tag LOCUS_27250 7619 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 9025 9618 gene locus_tag LOCUS_27260 9025 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 9615 12347 gene locus_tag LOCUS_27270 gene mksF 9615 12347 CDS product Mks condensin complex protein MksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113519.1 protein_id gnl|my_center|LOCUS_27270 12340 13221 gene locus_tag LOCUS_27280 12340 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 13212 15635 gene locus_tag LOCUS_27290 13212 15635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 17150 15930 gene locus_tag LOCUS_27300 17150 15930 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_27300 18985 17246 gene locus_tag LOCUS_27310 18985 17246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_27310 19181 19504 gene locus_tag LOCUS_27320 19181 19504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 19639 21387 gene locus_tag LOCUS_27330 gene ptsI 19639 21387 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208490.1 protein_id gnl|my_center|LOCUS_27330 21384 21740 gene locus_tag LOCUS_27340 21384 21740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 21836 21994 gene locus_tag LOCUS_27350 21836 21994 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048094.1 protein_id gnl|my_center|LOCUS_27350 22011 22958 gene locus_tag LOCUS_27360 22011 22958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 23605 22955 gene locus_tag LOCUS_27370 23605 22955 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792977.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence085 395 796 gene locus_tag LOCUS_27380 395 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 2066 1308 gene locus_tag LOCUS_27390 2066 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2553 2134 gene locus_tag LOCUS_27400 2553 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3932 2874 gene locus_tag LOCUS_27410 3932 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 4825 3941 gene locus_tag LOCUS_27420 4825 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_27420 6433 4907 gene locus_tag LOCUS_27430 6433 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27430 7284 6430 gene locus_tag LOCUS_27440 7284 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27440 9645 7399 gene locus_tag LOCUS_27450 9645 7399 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_27450 10346 11008 gene locus_tag LOCUS_27460 10346 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 11021 11500 gene locus_tag LOCUS_27470 11021 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27470 11655 15053 gene locus_tag LOCUS_27480 11655 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 15636 15830 gene locus_tag LOCUS_27490 15636 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 18474 16033 gene locus_tag LOCUS_27500 18474 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 19106 23371 gene locus_tag LOCUS_27510 19106 23371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence086 175 2658 gene locus_tag LOCUS_27520 175 2658 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_27520 2815 4020 gene locus_tag LOCUS_27530 gene galK 2815 4020 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_27530 6283 4085 gene locus_tag LOCUS_27540 6283 4085 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_27540 6592 6389 gene locus_tag LOCUS_27550 6592 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 7335 7604 gene locus_tag LOCUS_27560 7335 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 8362 9519 gene locus_tag LOCUS_27570 8362 9519 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_27570 10264 10058 gene locus_tag LOCUS_27580 10264 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 13408 10307 gene locus_tag LOCUS_27590 13408 10307 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_27590 15369 13693 gene locus_tag LOCUS_27600 15369 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 16858 15509 gene locus_tag LOCUS_27610 16858 15509 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_27610 17615 17274 gene locus_tag LOCUS_27620 17615 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 18346 20748 gene locus_tag LOCUS_27630 18346 20748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 20760 21671 gene locus_tag LOCUS_27640 20760 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 21686 22810 gene locus_tag LOCUS_27650 21686 22810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 23708 23511 gene locus_tag LOCUS_27660 23708 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence087 3211 1037 gene locus_tag LOCUS_27670 3211 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3378 4250 gene locus_tag LOCUS_27680 3378 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 4317 6500 gene locus_tag LOCUS_27690 4317 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 6555 8297 gene locus_tag LOCUS_27700 6555 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 8294 9052 gene locus_tag LOCUS_27710 8294 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 9085 9885 gene locus_tag LOCUS_27720 9085 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 9991 11733 gene locus_tag LOCUS_27730 9991 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 11794 12324 gene locus_tag LOCUS_27740 11794 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 12420 13100 gene locus_tag LOCUS_27750 12420 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 13319 13960 gene locus_tag LOCUS_27760 13319 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 13960 14583 gene locus_tag LOCUS_27770 13960 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 14564 15127 gene locus_tag LOCUS_27780 14564 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 15127 16002 gene locus_tag LOCUS_27790 15127 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 15999 19733 gene locus_tag LOCUS_27800 15999 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 20834 21547 gene locus_tag LOCUS_27810 20834 21547 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_27810 21513 21950 gene locus_tag LOCUS_27820 21513 21950 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_27820 22368 22442 gene locus_tag LOCUS_t00340 22368 22442 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence088 1771 413 gene locus_tag LOCUS_27830 1771 413 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_27830 2607 1951 gene locus_tag LOCUS_27840 2607 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 3666 3313 gene locus_tag LOCUS_27850 3666 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3896 3708 gene locus_tag LOCUS_27860 3896 3708 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430011.1 protein_id gnl|my_center|LOCUS_27860 4002 3915 gene locus_tag LOCUS_t00350 4002 3915 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5214 4108 gene locus_tag LOCUS_27870 5214 4108 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_27870 5844 5302 gene locus_tag LOCUS_27880 gene def 5844 5302 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460527.1 protein_id gnl|my_center|LOCUS_27880 5936 5860 gene locus_tag LOCUS_t00360 5936 5860 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6095 6170 gene locus_tag LOCUS_t00370 6095 6170 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8516 6288 gene locus_tag LOCUS_27890 8516 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 9186 8440 gene locus_tag LOCUS_27900 9186 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27900 11406 9253 gene locus_tag LOCUS_27910 11406 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 13027 11645 gene locus_tag LOCUS_27920 13027 11645 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_27920 13524 13024 gene locus_tag LOCUS_27930 13524 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 14672 13521 gene locus_tag LOCUS_27940 14672 13521 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_27940 15338 17131 gene locus_tag LOCUS_27950 15338 17131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 18063 17221 gene locus_tag LOCUS_27960 18063 17221 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031017.1 protein_id gnl|my_center|LOCUS_27960 19469 19047 gene locus_tag LOCUS_27970 19469 19047 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_27970 20887 19466 gene locus_tag LOCUS_27980 20887 19466 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921646.1 protein_id gnl|my_center|LOCUS_27980 22435 20951 gene locus_tag LOCUS_27990 22435 20951 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107896.1 protein_id gnl|my_center|LOCUS_27990 23024 22506 gene locus_tag LOCUS_28000 23024 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence089 618 842 gene locus_tag LOCUS_28010 618 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 974 2251 gene locus_tag LOCUS_28020 974 2251 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200164.1 protein_id gnl|my_center|LOCUS_28020 2281 2739 gene locus_tag LOCUS_28030 2281 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28030 2681 3355 gene locus_tag LOCUS_28040 2681 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28040 7926 4156 gene locus_tag LOCUS_28050 7926 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 8634 8029 gene locus_tag LOCUS_28060 8634 8029 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939073.1 protein_id gnl|my_center|LOCUS_28060 8924 9577 gene locus_tag LOCUS_28070 8924 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 9567 13769 gene locus_tag LOCUS_28080 9567 13769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 13821 14711 gene locus_tag LOCUS_28090 13821 14711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 14712 15299 gene locus_tag LOCUS_28100 14712 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 15247 15864 gene locus_tag LOCUS_28110 15247 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 16261 17349 gene locus_tag LOCUS_28120 16261 17349 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 protein_id gnl|my_center|LOCUS_28120 17377 18600 gene locus_tag LOCUS_28130 gene gltS 17377 18600 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094878.1 protein_id gnl|my_center|LOCUS_28130 19631 19173 gene locus_tag LOCUS_28140 gene tadA 19631 19173 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_28140 20888 19983 gene locus_tag LOCUS_28150 20888 19983 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_28150 <22774 21037 gene locus_tag LOCUS_28160 <22774 21037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008664336.1:sulfatase >Feature sequence090 <1 4339 gene locus_tag LOCUS_28170 <1 4339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038821.1:autotransporter BatB 6692 4602 gene locus_tag LOCUS_28180 6692 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 7015 13683 gene locus_tag LOCUS_28190 7015 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 14324 15367 gene locus_tag LOCUS_28200 gene sppA 14324 15367 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_28200 15596 17878 gene locus_tag LOCUS_28210 15596 17878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 17875 18771 gene locus_tag LOCUS_28220 17875 18771 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039097.1 protein_id gnl|my_center|LOCUS_28220 18764 19675 gene locus_tag LOCUS_28230 18764 19675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 19707 20909 gene locus_tag LOCUS_28240 gene ftsA 19707 20909 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_28240 20913 22106 gene locus_tag LOCUS_28250 gene ftsZ 20913 22106 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497096.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence091 1374 2756 gene locus_tag LOCUS_28260 1374 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 2753 3523 gene locus_tag LOCUS_28270 2753 3523 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_28270 3540 5906 gene locus_tag LOCUS_28280 3540 5906 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_28280 6982 7395 gene locus_tag LOCUS_28290 6982 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 8027 8356 gene locus_tag LOCUS_28300 8027 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 17919 8422 gene locus_tag LOCUS_28310 17919 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 20495 17919 gene locus_tag LOCUS_28320 20495 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence092 1127 381 gene locus_tag LOCUS_28330 1127 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 3824 1506 gene locus_tag LOCUS_28340 3824 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3875 4666 gene locus_tag LOCUS_28350 3875 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 5945 4755 gene locus_tag LOCUS_28360 5945 4755 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_28360 6845 6045 gene locus_tag LOCUS_28370 6845 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 7476 8390 gene locus_tag LOCUS_28380 7476 8390 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_28380 8673 9398 gene locus_tag LOCUS_28390 8673 9398 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066731.1 protein_id gnl|my_center|LOCUS_28390 9420 11021 gene locus_tag LOCUS_28400 9420 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 11209 12240 gene locus_tag LOCUS_28410 11209 12240 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_28410 12243 14378 gene locus_tag LOCUS_28420 12243 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 14451 17489 gene locus_tag LOCUS_28430 14451 17489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 17810 18589 gene locus_tag LOCUS_28440 17810 18589 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_28440 19076 19309 gene locus_tag LOCUS_28450 19076 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 19313 20113 gene locus_tag LOCUS_28460 19313 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 20276 20488 gene locus_tag LOCUS_28470 20276 20488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 20479 21297 gene locus_tag LOCUS_28480 20479 21297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence093 267 722 gene locus_tag LOCUS_28490 267 722 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403547.1 protein_id gnl|my_center|LOCUS_28490 1193 3526 gene locus_tag LOCUS_28500 1193 3526 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_28500 3704 4591 gene locus_tag LOCUS_28510 3704 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 4718 7030 gene locus_tag LOCUS_28520 4718 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 7071 9005 gene locus_tag LOCUS_28530 7071 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 9102 11273 gene locus_tag LOCUS_28540 9102 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 13150 11726 gene locus_tag LOCUS_28550 13150 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 13817 13128 gene locus_tag LOCUS_28560 13817 13128 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_28560 14567 13860 gene locus_tag LOCUS_28570 14567 13860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 15894 14815 gene locus_tag LOCUS_28580 gene dusB 15894 14815 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_28580 18221 16542 gene locus_tag LOCUS_28590 gene ettA 18221 16542 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_28590 18395 19219 gene locus_tag LOCUS_28600 18395 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 19534 20835 gene locus_tag LOCUS_28610 19534 20835 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence094 557 324 gene locus_tag LOCUS_28620 557 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 982 4239 gene locus_tag LOCUS_28630 982 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 5128 4295 gene locus_tag LOCUS_28640 5128 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 6118 5429 gene locus_tag LOCUS_28650 6118 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 7665 9044 gene locus_tag LOCUS_28660 7665 9044 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_28660 10426 9047 gene locus_tag LOCUS_28670 10426 9047 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_28670 11474 10440 gene locus_tag LOCUS_28680 11474 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 11586 12494 gene locus_tag LOCUS_28690 11586 12494 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_28690 14862 13561 gene locus_tag LOCUS_28700 14862 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 16519 14879 gene locus_tag LOCUS_28710 16519 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 18224 16578 gene locus_tag LOCUS_28720 18224 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 20020 18287 gene locus_tag LOCUS_28730 20020 18287 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798670.1 protein_id gnl|my_center|LOCUS_28730 <21290 20090 gene locus_tag LOCUS_28740 <21290 20090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786655.1:exo-alpha-sialidase >Feature sequence095 2137 1064 gene locus_tag LOCUS_28750 2137 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 2309 3217 gene locus_tag LOCUS_28760 2309 3217 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_28760 5734 4190 gene locus_tag LOCUS_28770 5734 4190 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870278.1 protein_id gnl|my_center|LOCUS_28770 7398 5731 gene locus_tag LOCUS_28780 gene lnt 7398 5731 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_28780 10278 7768 gene locus_tag LOCUS_28790 gene rnr 10278 7768 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_28790 11631 11176 gene locus_tag LOCUS_28800 11631 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 11767 11576 gene locus_tag LOCUS_28810 11767 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 13701 12016 gene locus_tag LOCUS_28820 13701 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 14353 13688 gene locus_tag LOCUS_28830 14353 13688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 15397 15008 gene locus_tag LOCUS_28840 15397 15008 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_28840 15621 15394 gene locus_tag LOCUS_28850 15621 15394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 16886 16206 gene locus_tag LOCUS_28860 16886 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 17203 20163 gene locus_tag LOCUS_28870 17203 20163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence096 4272 4090 gene locus_tag LOCUS_28880 4272 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 4521 5267 gene locus_tag LOCUS_28890 4521 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 5510 5890 gene locus_tag LOCUS_28900 5510 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5899 6621 gene locus_tag LOCUS_28910 5899 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 10814 7842 gene locus_tag LOCUS_28920 10814 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 12577 11063 gene locus_tag LOCUS_28930 12577 11063 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066693.1 protein_id gnl|my_center|LOCUS_28930 13395 12700 gene locus_tag LOCUS_28940 gene deoC 13395 12700 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970031.1 protein_id gnl|my_center|LOCUS_28940 14289 13519 gene locus_tag LOCUS_28950 14289 13519 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 protein_id gnl|my_center|LOCUS_28950 15261 14470 gene locus_tag LOCUS_28960 15261 14470 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063894.1 protein_id gnl|my_center|LOCUS_28960 20364 15361 gene locus_tag LOCUS_28970 20364 15361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence097 918 2591 gene locus_tag LOCUS_28980 918 2591 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392505.1 protein_id gnl|my_center|LOCUS_28980 2584 3894 gene locus_tag LOCUS_28990 2584 3894 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392504.1 protein_id gnl|my_center|LOCUS_28990 4670 9679 gene locus_tag LOCUS_29000 4670 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 13008 10057 gene locus_tag LOCUS_29010 13008 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 13505 13119 gene locus_tag LOCUS_29020 13505 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 13669 14271 gene locus_tag LOCUS_29030 13669 14271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 14273 14734 gene locus_tag LOCUS_29040 14273 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 14731 15009 gene locus_tag LOCUS_29050 14731 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 15032 16111 gene locus_tag LOCUS_29060 gene rlmN 15032 16111 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_29060 16278 16553 gene locus_tag LOCUS_29070 16278 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 16625 16849 gene locus_tag LOCUS_29080 16625 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 17987 16884 gene locus_tag LOCUS_29090 17987 16884 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_29090 19130 18111 gene locus_tag LOCUS_29100 19130 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence098 3491 399 gene locus_tag LOCUS_29110 3491 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 6107 3756 gene locus_tag LOCUS_29120 6107 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 6276 6073 gene locus_tag LOCUS_29130 6276 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 7228 6299 gene locus_tag LOCUS_29140 7228 6299 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_29140 10641 7240 gene locus_tag LOCUS_29150 10641 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 11833 10649 gene locus_tag LOCUS_29160 11833 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 13803 11839 gene locus_tag LOCUS_29170 13803 11839 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_29170 14348 15448 gene locus_tag LOCUS_29180 gene ychF 14348 15448 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938722.1 protein_id gnl|my_center|LOCUS_29180 15565 16059 gene locus_tag LOCUS_29190 15565 16059 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_29190 16064 16606 gene locus_tag LOCUS_29200 16064 16606 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_29200 16617 17009 gene locus_tag LOCUS_29210 16617 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_29210 17027 18814 gene locus_tag LOCUS_29220 gene nuoF 17027 18814 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence099 1960 746 gene locus_tag LOCUS_29230 1960 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 3795 2245 gene locus_tag LOCUS_29240 gene gpmI 3795 2245 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065873.1 protein_id gnl|my_center|LOCUS_29240 5218 3824 gene locus_tag LOCUS_29250 5218 3824 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_29250 6460 5342 gene locus_tag LOCUS_29260 gene prfB 6460 5342 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959142.1 protein_id gnl|my_center|LOCUS_29260 6772 9054 gene locus_tag LOCUS_29270 6772 9054 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119344.1 protein_id gnl|my_center|LOCUS_29270 14540 10215 gene locus_tag LOCUS_29280 14540 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 14910 15173 gene locus_tag LOCUS_29290 gene rpsO 14910 15173 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_29290 15318 17435 gene locus_tag LOCUS_29300 gene pnp 15318 17435 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_29300 17628 18134 gene locus_tag LOCUS_29310 gene ruvC 17628 18134 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_29310 18170 19666 gene locus_tag LOCUS_29320 18170 19666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence100 4043 2442 gene locus_tag LOCUS_29330 4043 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 5467 4046 gene locus_tag LOCUS_29340 5467 4046 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943160.1 protein_id gnl|my_center|LOCUS_29340 6243 5464 gene locus_tag LOCUS_29350 6243 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 6962 6213 gene locus_tag LOCUS_29360 6962 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 11812 6968 gene locus_tag LOCUS_29370 11812 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 12971 11823 gene locus_tag LOCUS_29380 12971 11823 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240281.1 protein_id gnl|my_center|LOCUS_29380 13719 12997 gene locus_tag LOCUS_29390 13719 12997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_29390 14540 13716 gene locus_tag LOCUS_29400 14540 13716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_29400 14896 14540 gene locus_tag LOCUS_29410 14896 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 15969 15406 gene locus_tag LOCUS_29420 15969 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 16648 16277 gene locus_tag LOCUS_29430 16648 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 18498 16879 gene locus_tag LOCUS_29440 18498 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence101 881 1891 gene locus_tag LOCUS_29450 881 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1888 2538 gene locus_tag LOCUS_29460 1888 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2535 3167 gene locus_tag LOCUS_29470 2535 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3164 3625 gene locus_tag LOCUS_29480 3164 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3820 5541 gene locus_tag LOCUS_29490 3820 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 5915 7387 gene locus_tag LOCUS_29500 5915 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 8375 12502 gene locus_tag LOCUS_29510 8375 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 14142 12835 gene locus_tag LOCUS_29520 14142 12835 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_29520 15544 14618 gene locus_tag LOCUS_29530 15544 14618 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064836.1 protein_id gnl|my_center|LOCUS_29530 18593 15537 gene locus_tag LOCUS_29540 18593 15537 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020247.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence102 626 396 gene locus_tag LOCUS_29550 626 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_29550 876 616 gene locus_tag LOCUS_29560 876 616 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_29560 1609 1013 gene locus_tag LOCUS_29570 1609 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1795 1616 gene locus_tag LOCUS_29580 1795 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 2844 1792 gene locus_tag LOCUS_29590 2844 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 4148 3675 gene locus_tag LOCUS_29600 4148 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 4401 4222 gene locus_tag LOCUS_29610 4401 4222 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_29610 4589 4398 gene locus_tag LOCUS_29620 4589 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 5971 4706 gene locus_tag LOCUS_29630 5971 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 7248 6292 gene locus_tag LOCUS_29640 7248 6292 CDS product NgoFVII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280501.1 protein_id gnl|my_center|LOCUS_29640 8424 7330 gene locus_tag LOCUS_29650 8424 7330 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869708.1 protein_id gnl|my_center|LOCUS_29650 8634 9650 gene locus_tag LOCUS_29660 8634 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 13121 9726 gene locus_tag LOCUS_29670 13121 9726 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_29670 14275 13118 gene locus_tag LOCUS_29680 14275 13118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 15756 14272 gene locus_tag LOCUS_29690 15756 14272 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_29690 16906 16487 gene locus_tag LOCUS_29700 16906 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 17504 17286 gene locus_tag LOCUS_29710 17504 17286 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence103 618 848 gene locus_tag LOCUS_29720 618 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 1460 1855 gene locus_tag LOCUS_29730 1460 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 1833 2165 gene locus_tag LOCUS_29740 1833 2165 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_29740 2551 2712 gene locus_tag LOCUS_29750 2551 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3073 2915 gene locus_tag LOCUS_29760 3073 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 5315 3645 gene locus_tag LOCUS_29770 gene ilvD 5315 3645 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880508.1 protein_id gnl|my_center|LOCUS_29770 5709 5458 gene locus_tag LOCUS_29780 5709 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 6420 5722 gene locus_tag LOCUS_29790 6420 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 7340 6543 gene locus_tag LOCUS_29800 7340 6543 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_29800 9134 7353 gene locus_tag LOCUS_29810 9134 7353 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_29810 10379 9156 gene locus_tag LOCUS_29820 10379 9156 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_29820 11325 10408 gene locus_tag LOCUS_29830 11325 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 12533 12021 gene locus_tag LOCUS_29840 12533 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 14227 12530 gene locus_tag LOCUS_29850 14227 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 17220 15811 gene locus_tag LOCUS_29860 17220 15811 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119999.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence104 2140 944 gene locus_tag LOCUS_29870 2140 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 3027 2170 gene locus_tag LOCUS_29880 3027 2170 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_29880 5936 3096 gene locus_tag LOCUS_29890 gene ppdK 5936 3096 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_29890 6333 7307 gene locus_tag LOCUS_29900 6333 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 7342 8991 gene locus_tag LOCUS_29910 7342 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 9339 9764 gene locus_tag LOCUS_29920 9339 9764 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 protein_id gnl|my_center|LOCUS_29920 9863 10075 gene locus_tag LOCUS_29930 9863 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 10264 11322 gene locus_tag LOCUS_29940 10264 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 12414 11392 gene locus_tag LOCUS_29950 gene lpxC 12414 11392 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530964.1 protein_id gnl|my_center|LOCUS_29950 13847 12435 gene locus_tag LOCUS_29960 gene murC 13847 12435 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080384.1 protein_id gnl|my_center|LOCUS_29960 13925 14653 gene locus_tag LOCUS_29970 13925 14653 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_29970 15594 16445 gene locus_tag LOCUS_29980 15594 16445 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_29980 16992 16465 gene locus_tag LOCUS_29990 16992 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence105 2028 115 gene locus_tag LOCUS_30000 2028 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 4062 2113 gene locus_tag LOCUS_30010 4062 2113 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_30010 4313 4239 gene locus_tag LOCUS_t00380 4313 4239 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4416 4333 gene locus_tag LOCUS_t00390 4416 4333 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5638 4940 gene locus_tag LOCUS_30020 5638 4940 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_30020 7280 5871 gene locus_tag LOCUS_30030 7280 5871 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_30030 8601 10076 gene locus_tag LOCUS_30040 gene zwf 8601 10076 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080226.1 protein_id gnl|my_center|LOCUS_30040 10107 11480 gene locus_tag LOCUS_30050 10107 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 11655 15212 gene locus_tag LOCUS_30060 11655 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 15379 16482 gene locus_tag LOCUS_30070 15379 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence106 608 99 gene locus_tag LOCUS_30080 608 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 1769 1999 gene locus_tag LOCUS_30090 1769 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2744 2352 gene locus_tag LOCUS_30100 2744 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3210 5243 gene locus_tag LOCUS_30110 3210 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 6122 7297 gene locus_tag LOCUS_30120 gene gnfL 6122 7297 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_30120 7298 8698 gene locus_tag LOCUS_30130 7298 8698 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_30130 8695 9834 gene locus_tag LOCUS_30140 8695 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 9831 10766 gene locus_tag LOCUS_30150 9831 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 10781 11131 gene locus_tag LOCUS_30160 10781 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 11280 12488 gene locus_tag LOCUS_30170 11280 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 12502 14802 gene locus_tag LOCUS_30180 12502 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 15346 16587 gene locus_tag LOCUS_30190 15346 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence107 855 625 gene locus_tag LOCUS_30200 855 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 1356 979 gene locus_tag LOCUS_30210 1356 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 1638 1423 gene locus_tag LOCUS_30220 1638 1423 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393298.1 protein_id gnl|my_center|LOCUS_30220 1820 1635 gene locus_tag LOCUS_30230 1820 1635 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_30230 3715 1940 gene locus_tag LOCUS_30240 3715 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 5298 5029 gene locus_tag LOCUS_30250 5298 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 5622 5377 gene locus_tag LOCUS_30260 5622 5377 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_30260 5800 5603 gene locus_tag LOCUS_30270 5800 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 7301 6552 gene locus_tag LOCUS_30280 7301 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 7618 7370 gene locus_tag LOCUS_30290 7618 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 8251 7916 gene locus_tag LOCUS_30300 8251 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 8897 9280 gene locus_tag LOCUS_30310 8897 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 10295 10480 gene locus_tag LOCUS_30320 10295 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 10507 10767 gene locus_tag LOCUS_30330 10507 10767 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_30330 11736 11323 gene locus_tag LOCUS_30340 11736 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 12641 12441 gene locus_tag LOCUS_30350 12641 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 12882 12631 gene locus_tag LOCUS_30360 12882 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 13439 13011 gene locus_tag LOCUS_30370 13439 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 13796 13521 gene locus_tag LOCUS_30380 13796 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 14760 14569 gene locus_tag LOCUS_30390 14760 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 15141 14893 gene locus_tag LOCUS_30400 15141 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence108 1760 465 gene locus_tag LOCUS_30410 1760 465 CDS product DUF3472 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121875.1 protein_id gnl|my_center|LOCUS_30410 3132 1831 gene locus_tag LOCUS_30420 3132 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 10186 3524 gene locus_tag LOCUS_30430 10186 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 12257 11166 gene locus_tag LOCUS_30440 gene murG 12257 11166 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_30440 13890 12244 gene locus_tag LOCUS_30450 gene murJ 13890 12244 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 protein_id gnl|my_center|LOCUS_30450 15140 13902 gene locus_tag LOCUS_30460 gene lpxK 15140 13902 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_30460 15559 15885 gene locus_tag LOCUS_30470 15559 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence109 418 272 gene locus_tag LOCUS_30480 418 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3501 1657 gene locus_tag LOCUS_30490 3501 1657 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_30490 7243 3605 gene locus_tag LOCUS_30500 gene metH 7243 3605 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_30500 8389 7406 gene locus_tag LOCUS_30510 gene hemB 8389 7406 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_30510 9283 8681 gene locus_tag LOCUS_30520 9283 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 9669 9331 gene locus_tag LOCUS_30530 9669 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 10771 9689 gene locus_tag LOCUS_30540 10771 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 10883 12691 gene locus_tag LOCUS_30550 10883 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 12836 14737 gene locus_tag LOCUS_30560 12836 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 15518 15333 gene locus_tag LOCUS_30570 15518 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence110 1633 419 gene locus_tag LOCUS_30580 1633 419 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_30580 1976 2176 gene locus_tag LOCUS_30590 1976 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 2195 2335 gene locus_tag LOCUS_30600 2195 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30600 2485 2703 gene locus_tag LOCUS_30610 2485 2703 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_30610 3003 3842 gene locus_tag LOCUS_30620 3003 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3839 5101 gene locus_tag LOCUS_30630 3839 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 5104 6279 gene locus_tag LOCUS_30640 5104 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 6276 8384 gene locus_tag LOCUS_30650 6276 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 9132 12227 gene locus_tag LOCUS_30660 9132 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 14498 13704 gene locus_tag LOCUS_30670 14498 13704 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_30670 14728 14501 gene locus_tag LOCUS_30680 14728 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence111 <1 1316 gene locus_tag LOCUS_30690 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393716.1:group II intron reverse transcriptase/maturase 2247 2402 gene locus_tag LOCUS_30700 2247 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 2802 3431 gene locus_tag LOCUS_30710 2802 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3438 5633 gene locus_tag LOCUS_30720 3438 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 5714 5908 gene locus_tag LOCUS_30730 5714 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 6085 6426 gene locus_tag LOCUS_30740 6085 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 7287 6760 gene locus_tag LOCUS_30750 7287 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 7454 7284 gene locus_tag LOCUS_30760 7454 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 8308 7487 gene locus_tag LOCUS_30770 8308 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 9434 8355 gene locus_tag LOCUS_30780 9434 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 10945 10100 gene locus_tag LOCUS_30790 10945 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 11918 11076 gene locus_tag LOCUS_30800 11918 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30800 13538 11931 gene locus_tag LOCUS_30810 13538 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 13976 13797 gene locus_tag LOCUS_30820 13976 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 14971 13940 gene locus_tag LOCUS_30830 14971 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence112 595 1275 gene locus_tag LOCUS_30840 gene ispD 595 1275 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_30840 1332 2066 gene locus_tag LOCUS_30850 1332 2066 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_30850 2111 3727 gene locus_tag LOCUS_30860 2111 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 3727 5610 gene locus_tag LOCUS_30870 gene dxs 3727 5610 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_30870 5614 6306 gene locus_tag LOCUS_30880 5614 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 6330 8015 gene locus_tag LOCUS_30890 6330 8015 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_30890 8232 8666 gene locus_tag LOCUS_30900 8232 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036170.1 protein_id gnl|my_center|LOCUS_30900 9420 8917 gene locus_tag LOCUS_30910 9420 8917 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024219.1 protein_id gnl|my_center|LOCUS_30910 10589 9495 gene locus_tag LOCUS_30920 10589 9495 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_30920 11152 10691 gene locus_tag LOCUS_30930 11152 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 11804 11661 gene locus_tag LOCUS_30940 11804 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 12010 11804 gene locus_tag LOCUS_30950 12010 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 12138 11953 gene locus_tag LOCUS_30960 12138 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 12773 12465 gene locus_tag LOCUS_30970 12773 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 14154 13726 gene locus_tag LOCUS_30980 14154 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence113 1972 977 gene locus_tag LOCUS_30990 1972 977 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763529.1 protein_id gnl|my_center|LOCUS_30990 2766 2038 gene locus_tag LOCUS_31000 gene rph 2766 2038 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 protein_id gnl|my_center|LOCUS_31000 4767 2983 gene locus_tag LOCUS_31010 gene aspS 4767 2983 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599762.1 protein_id gnl|my_center|LOCUS_31010 4982 5716 gene locus_tag LOCUS_31020 4982 5716 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_31020 5774 6550 gene locus_tag LOCUS_31030 5774 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 6550 7008 gene locus_tag LOCUS_31040 gene nrdR 6550 7008 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_31040 7164 7502 gene locus_tag LOCUS_31050 7164 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014842546.1 protein_id gnl|my_center|LOCUS_31050 7459 8040 gene locus_tag LOCUS_31060 7459 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 9031 8225 gene locus_tag LOCUS_31070 9031 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 11381 9207 gene locus_tag LOCUS_31080 11381 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 12727 11438 gene locus_tag LOCUS_31090 12727 11438 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_31090 13049 12729 gene locus_tag LOCUS_31100 13049 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 13957 13052 gene locus_tag LOCUS_31110 13957 13052 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978441.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence114 1377 325 gene locus_tag LOCUS_31120 1377 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3560 1374 gene locus_tag LOCUS_31130 3560 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 5559 3565 gene locus_tag LOCUS_31140 5559 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 6538 5660 gene locus_tag LOCUS_31150 6538 5660 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_31150 8285 7308 gene locus_tag LOCUS_31160 8285 7308 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_31160 9092 9889 gene locus_tag LOCUS_31170 gene ric 9092 9889 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963399.1 protein_id gnl|my_center|LOCUS_31170 9907 10953 gene locus_tag LOCUS_31180 9907 10953 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943774.1 protein_id gnl|my_center|LOCUS_31180 11206 11084 gene locus_tag LOCUS_31190 11206 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 14330 11250 gene locus_tag LOCUS_31200 14330 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence115 1328 3229 gene locus_tag LOCUS_31210 1328 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3462 4604 gene locus_tag LOCUS_31220 3462 4604 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_31220 4966 4802 gene locus_tag LOCUS_31230 4966 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 5065 5730 gene locus_tag LOCUS_31240 5065 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 6350 7738 gene locus_tag LOCUS_31250 6350 7738 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_31250 7735 8508 gene locus_tag LOCUS_31260 7735 8508 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 protein_id gnl|my_center|LOCUS_31260 8508 10463 gene locus_tag LOCUS_31270 8508 10463 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083312.1 protein_id gnl|my_center|LOCUS_31270 10465 11766 gene locus_tag LOCUS_31280 gene codB 10465 11766 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076226.1 protein_id gnl|my_center|LOCUS_31280 11790 12026 gene locus_tag LOCUS_31290 11790 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 12067 12936 gene locus_tag LOCUS_31300 12067 12936 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_31300 12983 14371 gene locus_tag LOCUS_31310 12983 14371 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_31310 >Feature sequence116 1010 372 gene locus_tag LOCUS_31320 gene ribE 1010 372 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 protein_id gnl|my_center|LOCUS_31320 2260 1172 gene locus_tag LOCUS_31330 2260 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 4800 2287 gene locus_tag LOCUS_31340 4800 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 6616 5600 gene locus_tag LOCUS_31350 6616 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 7478 6603 gene locus_tag LOCUS_31360 gene cdaA 7478 6603 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_31360 8350 7478 gene locus_tag LOCUS_31370 gene folP 8350 7478 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_31370 10865 8604 gene locus_tag LOCUS_31380 gene ftsH 10865 8604 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_31380 12611 10941 gene locus_tag LOCUS_31390 12611 10941 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_31390 12666 13271 gene locus_tag LOCUS_31400 12666 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence117 1587 151 gene locus_tag LOCUS_31410 1587 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 1885 1676 gene locus_tag LOCUS_31420 1885 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 3551 2346 gene locus_tag LOCUS_31430 3551 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 5487 3544 gene locus_tag LOCUS_31440 5487 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 6332 5916 gene locus_tag LOCUS_31450 6332 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 6568 6870 gene locus_tag LOCUS_31460 6568 6870 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006027262.1 protein_id gnl|my_center|LOCUS_31460 6867 7163 gene locus_tag LOCUS_31470 6867 7163 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_31470 8502 7396 gene locus_tag LOCUS_31480 8502 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 12618 8518 gene locus_tag LOCUS_31490 12618 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 13111 13311 gene locus_tag LOCUS_31500 13111 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 13608 13276 gene locus_tag LOCUS_31510 13608 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence118 145 1260 gene locus_tag LOCUS_31520 145 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870187.1 protein_id gnl|my_center|LOCUS_31520 1809 1609 gene locus_tag LOCUS_31530 1809 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 2111 8002 gene locus_tag LOCUS_31540 2111 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 8194 8661 gene locus_tag LOCUS_31550 8194 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 8750 9175 gene locus_tag LOCUS_31560 8750 9175 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 protein_id gnl|my_center|LOCUS_31560 9507 9583 gene locus_tag LOCUS_t00400 9507 9583 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9717 9872 gene locus_tag LOCUS_31570 9717 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 10343 11224 gene locus_tag LOCUS_31580 10343 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 13452 11911 gene locus_tag LOCUS_31590 gene hydG 13452 11911 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546878.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence119 308 550 gene locus_tag LOCUS_31600 308 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 1741 617 gene locus_tag LOCUS_31610 1741 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 1823 9745 gene locus_tag LOCUS_31620 1823 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 9767 12142 gene locus_tag LOCUS_31630 9767 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 12132 13583 gene locus_tag LOCUS_31640 12132 13583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence120 790 89 gene locus_tag LOCUS_31650 790 89 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877395.1 protein_id gnl|my_center|LOCUS_31650 1050 1787 gene locus_tag LOCUS_31660 1050 1787 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_31660 2362 3246 gene locus_tag LOCUS_31670 2362 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 3259 4161 gene locus_tag LOCUS_31680 3259 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 4166 5650 gene locus_tag LOCUS_31690 4166 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 5655 7934 gene locus_tag LOCUS_31700 5655 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 7951 9042 gene locus_tag LOCUS_31710 7951 9042 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_31710 9065 12364 gene locus_tag LOCUS_31720 9065 12364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 12709 13803 gene locus_tag LOCUS_31730 12709 13803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence121 1175 339 gene locus_tag LOCUS_31740 gene panC 1175 339 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_31740 2471 1200 gene locus_tag LOCUS_31750 gene hemL 2471 1200 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687258.1 protein_id gnl|my_center|LOCUS_31750 3798 2908 gene locus_tag LOCUS_31760 3798 2908 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_31760 5602 3863 gene locus_tag LOCUS_31770 5602 3863 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_31770 6103 5618 gene locus_tag LOCUS_31780 6103 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 6274 7281 gene locus_tag LOCUS_31790 6274 7281 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921432.1 protein_id gnl|my_center|LOCUS_31790 7420 8532 gene locus_tag LOCUS_31800 gene gcvT 7420 8532 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938973.1 protein_id gnl|my_center|LOCUS_31800 8893 9270 gene locus_tag LOCUS_31810 gene gcvH 8893 9270 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 protein_id gnl|my_center|LOCUS_31810 9273 10607 gene locus_tag LOCUS_31820 gene gcvPA 9273 10607 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941045.1 protein_id gnl|my_center|LOCUS_31820 10604 12070 gene locus_tag LOCUS_31830 gene gcvPB 10604 12070 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941046.1 protein_id gnl|my_center|LOCUS_31830 12072 12431 gene locus_tag LOCUS_31840 12072 12431 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552611.1 protein_id gnl|my_center|LOCUS_31840 13694 12651 gene locus_tag LOCUS_31850 gene xerC 13694 12651 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_31850 >Feature sequence122 4831 206 gene locus_tag LOCUS_31860 4831 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 5600 4965 gene locus_tag LOCUS_31870 5600 4965 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_31870 10888 6203 gene locus_tag LOCUS_31880 10888 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 12263 13132 gene locus_tag LOCUS_31890 12263 13132 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence123 378 554 gene locus_tag LOCUS_31900 378 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 1928 1080 gene locus_tag LOCUS_31910 1928 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3340 2039 gene locus_tag LOCUS_31920 3340 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 4415 3465 gene locus_tag LOCUS_31930 4415 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 5015 4452 gene locus_tag LOCUS_31940 gene frr 5015 4452 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_31940 5783 5040 gene locus_tag LOCUS_31950 gene pyrH 5783 5040 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_31950 5934 6506 gene locus_tag LOCUS_31960 5934 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 7252 7941 gene locus_tag LOCUS_31970 7252 7941 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570271.1 protein_id gnl|my_center|LOCUS_31970 8847 7945 gene locus_tag LOCUS_31980 8847 7945 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044966.1 protein_id gnl|my_center|LOCUS_31980 9422 8844 gene locus_tag LOCUS_31990 9422 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118772.1 protein_id gnl|my_center|LOCUS_31990 9848 9588 gene locus_tag LOCUS_32000 9848 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 10196 9966 gene locus_tag LOCUS_32010 10196 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 10926 10141 gene locus_tag LOCUS_32020 gene deoC 10926 10141 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773709.1 protein_id gnl|my_center|LOCUS_32020 12392 10947 gene locus_tag LOCUS_32030 gene rpoN 12392 10947 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_32030 13340 12690 gene locus_tag LOCUS_32040 13340 12690 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_32040 >Feature sequence124 560 369 gene locus_tag LOCUS_32050 560 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 1535 624 gene locus_tag LOCUS_32060 1535 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 2453 1908 gene locus_tag LOCUS_32070 2453 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 4431 2854 gene locus_tag LOCUS_32080 4431 2854 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_32080 4887 4531 gene locus_tag LOCUS_32090 gene tnpB 4887 4531 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748682.1 protein_id gnl|my_center|LOCUS_32090 5243 4881 gene locus_tag LOCUS_32100 5243 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 5381 5629 gene locus_tag LOCUS_32110 5381 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 5835 5647 gene locus_tag LOCUS_32120 5835 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 6854 5913 gene locus_tag LOCUS_32130 6854 5913 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290171.1 protein_id gnl|my_center|LOCUS_32130 7200 6958 gene locus_tag LOCUS_32140 7200 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 8060 7395 gene locus_tag LOCUS_32150 8060 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 8605 8276 gene locus_tag LOCUS_32160 8605 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 10841 8634 gene locus_tag LOCUS_32170 10841 8634 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 protein_id gnl|my_center|LOCUS_32170 12987 10858 gene locus_tag LOCUS_32180 12987 10858 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583939.1 protein_id gnl|my_center|LOCUS_32180 13370 13023 gene locus_tag LOCUS_32190 13370 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence125 1868 579 gene locus_tag LOCUS_32200 1868 579 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_32200 2237 3841 gene locus_tag LOCUS_32210 2237 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3945 4685 gene locus_tag LOCUS_32220 3945 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 4846 5424 gene locus_tag LOCUS_32230 4846 5424 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_32230 6647 5901 gene locus_tag LOCUS_32240 gene fabG 6647 5901 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_32240 7183 6713 gene locus_tag LOCUS_32250 7183 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 9437 7416 gene locus_tag LOCUS_32260 gene fusA 9437 7416 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_32260 9476 9634 gene locus_tag LOCUS_32270 9476 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 12362 10323 gene locus_tag LOCUS_32280 12362 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 12890 12426 gene locus_tag LOCUS_32290 12890 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 13379 13053 gene locus_tag LOCUS_32300 13379 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence126 135 293 gene locus_tag LOCUS_32310 135 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 947 6091 gene locus_tag LOCUS_32320 947 6091 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_32320 6095 8932 gene locus_tag LOCUS_32330 6095 8932 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_32330 8929 12759 gene locus_tag LOCUS_32340 8929 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence127 125 634 gene locus_tag LOCUS_32350 125 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 935 672 gene locus_tag LOCUS_32360 935 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 2754 1234 gene locus_tag LOCUS_32370 gene ilvA 2754 1234 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_32370 3370 4452 gene locus_tag LOCUS_32380 3370 4452 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_32380 4452 5261 gene locus_tag LOCUS_32390 gene truA 4452 5261 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725204.1 protein_id gnl|my_center|LOCUS_32390 5248 6441 gene locus_tag LOCUS_32400 5248 6441 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294596.1 protein_id gnl|my_center|LOCUS_32400 7290 6856 gene locus_tag LOCUS_32410 7290 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 7485 7294 gene locus_tag LOCUS_32420 7485 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 7575 8792 gene locus_tag LOCUS_32430 7575 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 8902 9915 gene locus_tag LOCUS_32440 8902 9915 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118153.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32440 10492 10226 gene locus_tag LOCUS_32450 10492 10226 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_32450 10796 10479 gene locus_tag LOCUS_32460 10796 10479 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_32460 11203 10907 gene locus_tag LOCUS_32470 11203 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 12358 11561 gene locus_tag LOCUS_32480 12358 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence128 1715 1128 gene locus_tag LOCUS_32490 1715 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 3216 1945 gene locus_tag LOCUS_32500 3216 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 3589 3410 gene locus_tag LOCUS_32510 3589 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 5008 3935 gene locus_tag LOCUS_32520 5008 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 12667 5012 gene locus_tag LOCUS_32530 12667 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence129 281 3772 gene locus_tag LOCUS_32540 281 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 4124 4402 gene locus_tag LOCUS_32550 4124 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 6495 4582 gene locus_tag LOCUS_32560 6495 4582 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_32560 6767 8344 gene locus_tag LOCUS_32570 6767 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 8385 11099 gene locus_tag LOCUS_32580 8385 11099 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139236412.1 protein_id gnl|my_center|LOCUS_32580 11799 11710 gene locus_tag LOCUS_t00410 11799 11710 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence130 663 370 gene locus_tag LOCUS_32590 663 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 1456 794 gene locus_tag LOCUS_32600 1456 794 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880134.1 protein_id gnl|my_center|LOCUS_32600 2838 1453 gene locus_tag LOCUS_32610 gene lpdA 2838 1453 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_32610 4285 2930 gene locus_tag LOCUS_32620 4285 2930 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874322.1 protein_id gnl|my_center|LOCUS_32620 6060 5218 gene locus_tag LOCUS_32630 6060 5218 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_32630 6948 6076 gene locus_tag LOCUS_32640 6948 6076 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_32640 7799 6945 gene locus_tag LOCUS_32650 7799 6945 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_32650 8786 7899 gene locus_tag LOCUS_32660 8786 7899 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_32660 9228 8869 gene locus_tag LOCUS_32670 9228 8869 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_32670 9628 9305 gene locus_tag LOCUS_32680 9628 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence131 5135 357 gene locus_tag LOCUS_32690 5135 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 5992 5522 gene locus_tag LOCUS_32700 5992 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 6320 8800 gene locus_tag LOCUS_32710 6320 8800 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_32710 8873 10099 gene locus_tag LOCUS_32720 8873 10099 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_32720 >Feature sequence132 469 107 gene locus_tag LOCUS_32730 469 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 1930 557 gene locus_tag LOCUS_32740 1930 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 2621 2346 gene locus_tag LOCUS_32750 2621 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 3932 3681 gene locus_tag LOCUS_32760 3932 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 4307 4098 gene locus_tag LOCUS_32770 4307 4098 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_32770 4507 4304 gene locus_tag LOCUS_32780 4507 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 5138 4569 gene locus_tag LOCUS_32790 5138 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 5665 5453 gene locus_tag LOCUS_32800 5665 5453 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_32800 7756 6206 gene locus_tag LOCUS_32810 7756 6206 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_32810 8966 7761 gene locus_tag LOCUS_32820 gene add 8966 7761 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_32820 10156 8963 gene locus_tag LOCUS_32830 10156 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 10539 10174 gene locus_tag LOCUS_32840 10539 10174 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_32840 11526 10606 gene locus_tag LOCUS_32850 11526 10606 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_32850 >Feature sequence133 2223 1066 gene locus_tag LOCUS_32860 gene mtlD 2223 1066 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645417.1 protein_id gnl|my_center|LOCUS_32860 4523 2241 gene locus_tag LOCUS_32870 4523 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 6042 5113 gene locus_tag LOCUS_32880 6042 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 6416 8272 gene locus_tag LOCUS_32890 6416 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 8301 9164 gene locus_tag LOCUS_32900 8301 9164 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_32900 9599 9150 gene locus_tag LOCUS_32910 gene dtd 9599 9150 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_32910 11501 9648 gene locus_tag LOCUS_32920 11501 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 >Feature sequence134 69 2150 gene locus_tag LOCUS_32930 69 2150 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_32930 2366 3073 gene locus_tag LOCUS_32940 gene rnc 2366 3073 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869841.1 protein_id gnl|my_center|LOCUS_32940 4127 3675 gene locus_tag LOCUS_32950 4127 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 6617 5307 gene locus_tag LOCUS_32960 6617 5307 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202787.1 protein_id gnl|my_center|LOCUS_32960 8554 6626 gene locus_tag LOCUS_32970 8554 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 11253 8623 gene locus_tag LOCUS_32980 11253 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence135 397 882 gene locus_tag LOCUS_32990 397 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 1416 952 gene locus_tag LOCUS_33000 1416 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 1658 1380 gene locus_tag LOCUS_33010 1658 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1853 2218 gene locus_tag LOCUS_33020 1853 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 2377 2622 gene locus_tag LOCUS_33030 2377 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 2830 3036 gene locus_tag LOCUS_33040 2830 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3341 3096 gene locus_tag LOCUS_33050 3341 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3993 3496 gene locus_tag LOCUS_33060 3993 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 4231 3962 gene locus_tag LOCUS_33070 4231 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 4258 5517 gene locus_tag LOCUS_33080 4258 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 9482 6543 gene locus_tag LOCUS_33090 9482 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 10037 10972 gene locus_tag LOCUS_33100 10037 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence136 1727 2977 gene locus_tag LOCUS_33110 1727 2977 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_33110 3042 3749 gene locus_tag LOCUS_33120 3042 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 3879 5615 gene locus_tag LOCUS_33130 3879 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 5702 6124 gene locus_tag LOCUS_33140 5702 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 6228 7931 gene locus_tag LOCUS_33150 6228 7931 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_33150 8069 9718 gene locus_tag LOCUS_33160 8069 9718 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence137 1916 441 gene locus_tag LOCUS_33170 1916 441 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_33170 2525 1938 gene locus_tag LOCUS_33180 2525 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 2799 3296 gene locus_tag LOCUS_33190 2799 3296 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_33190 3275 3952 gene locus_tag LOCUS_33200 3275 3952 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 protein_id gnl|my_center|LOCUS_33200 4114 5037 gene locus_tag LOCUS_33210 4114 5037 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_33210 5204 8362 gene locus_tag LOCUS_33220 5204 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 8386 9660 gene locus_tag LOCUS_33230 8386 9660 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_33230 10562 9708 gene locus_tag LOCUS_33240 10562 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 11062 10658 gene locus_tag LOCUS_33250 11062 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence138 502 86 gene locus_tag LOCUS_33260 502 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 848 504 gene locus_tag LOCUS_33270 848 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 1002 1202 gene locus_tag LOCUS_33280 1002 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 1403 1675 gene locus_tag LOCUS_33290 1403 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 1672 1971 gene locus_tag LOCUS_33300 1672 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 2047 2484 gene locus_tag LOCUS_33310 2047 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 2477 2713 gene locus_tag LOCUS_33320 2477 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 2710 3204 gene locus_tag LOCUS_33330 2710 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 3204 3335 gene locus_tag LOCUS_33340 3204 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 3461 3799 gene locus_tag LOCUS_33350 3461 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3835 4683 gene locus_tag LOCUS_33360 3835 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 4736 5431 gene locus_tag LOCUS_33370 4736 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 5507 7561 gene locus_tag LOCUS_33380 5507 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 7551 8513 gene locus_tag LOCUS_33390 7551 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 8513 9070 gene locus_tag LOCUS_33400 8513 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 9205 9996 gene locus_tag LOCUS_33410 9205 9996 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104521.1 protein_id gnl|my_center|LOCUS_33410 10189 10485 gene locus_tag LOCUS_33420 10189 10485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 10509 10970 gene locus_tag LOCUS_33430 10509 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence139 225 1685 gene locus_tag LOCUS_33440 225 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3887 1731 gene locus_tag LOCUS_33450 3887 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 8655 4033 gene locus_tag LOCUS_33460 8655 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 10670 8721 gene locus_tag LOCUS_33470 10670 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 10835 10674 gene locus_tag LOCUS_33480 10835 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence140 3381 2284 gene locus_tag LOCUS_33490 3381 2284 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050842.1 protein_id gnl|my_center|LOCUS_33490 5430 3589 gene locus_tag LOCUS_33500 5430 3589 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_33500 6227 5700 gene locus_tag LOCUS_33510 6227 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 6339 6548 gene locus_tag LOCUS_33520 6339 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 7731 9224 gene locus_tag LOCUS_33530 7731 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 <10949 9865 gene locus_tag LOCUS_33540 <10949 9865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence141 317 138 gene locus_tag LOCUS_33550 317 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 600 507 gene locus_tag LOCUS_t00420 600 507 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 838 1269 gene locus_tag LOCUS_33560 gene fucU 838 1269 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 protein_id gnl|my_center|LOCUS_33560 1770 3524 gene locus_tag LOCUS_33570 1770 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 4683 5963 gene locus_tag LOCUS_33580 4683 5963 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_33580 5977 6609 gene locus_tag LOCUS_33590 5977 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 7112 7360 gene locus_tag LOCUS_33600 7112 7360 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 protein_id gnl|my_center|LOCUS_33600 7357 7650 gene locus_tag LOCUS_33610 7357 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 7685 9253 gene locus_tag LOCUS_33620 7685 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 9277 10374 gene locus_tag LOCUS_33630 9277 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 >Feature sequence142 2113 3132 gene locus_tag LOCUS_33640 gene recA 2113 3132 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820771.1 protein_id gnl|my_center|LOCUS_33640 3251 5047 gene locus_tag LOCUS_33650 3251 5047 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_33650 5238 5411 gene locus_tag LOCUS_33660 5238 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 5590 6237 gene locus_tag LOCUS_33670 gene purN 5590 6237 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_33670 6270 7013 gene locus_tag LOCUS_33680 6270 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 8224 6959 gene locus_tag LOCUS_33690 8224 6959 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_33690 9625 8657 gene locus_tag LOCUS_33700 9625 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence143 346 1476 gene locus_tag LOCUS_33710 346 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_33710 1559 2824 gene locus_tag LOCUS_33720 1559 2824 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_33720 6523 2912 gene locus_tag LOCUS_33730 6523 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 7849 6920 gene locus_tag LOCUS_33740 7849 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 10035 7846 gene locus_tag LOCUS_33750 10035 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence144 399 1172 gene locus_tag LOCUS_33760 399 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 2510 1461 gene locus_tag LOCUS_33770 2510 1461 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658381.1 protein_id gnl|my_center|LOCUS_33770 5494 3176 gene locus_tag LOCUS_33780 gene ligA 5494 3176 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_33780 6587 5640 gene locus_tag LOCUS_33790 gene rssA 6587 5640 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096264.1 protein_id gnl|my_center|LOCUS_33790 6932 6588 gene locus_tag LOCUS_33800 6932 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 7066 7311 gene locus_tag LOCUS_33810 7066 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 7381 8436 gene locus_tag LOCUS_33820 7381 8436 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_33820 8445 9857 gene locus_tag LOCUS_33830 8445 9857 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_33830 >Feature sequence145 1303 425 gene locus_tag LOCUS_33840 1303 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 6572 1746 gene locus_tag LOCUS_33850 6572 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 7128 8519 gene locus_tag LOCUS_33860 7128 8519 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262523.1 protein_id gnl|my_center|LOCUS_33860 8576 9529 gene locus_tag LOCUS_33870 8576 9529 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_33870 >Feature sequence146 2573 2199 gene locus_tag LOCUS_33880 2573 2199 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_33880 3472 2795 gene locus_tag LOCUS_33890 3472 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 3828 3469 gene locus_tag LOCUS_33900 3828 3469 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_33900 7170 3898 gene locus_tag LOCUS_33910 7170 3898 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_33910 7329 7553 gene locus_tag LOCUS_33920 7329 7553 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140251.1 protein_id gnl|my_center|LOCUS_33920 7532 7966 gene locus_tag LOCUS_33930 7532 7966 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140252.1 protein_id gnl|my_center|LOCUS_33930 8017 10311 gene locus_tag LOCUS_33940 8017 10311 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255963.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence147 183 446 gene locus_tag LOCUS_33950 183 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 932 856 gene locus_tag LOCUS_t00430 932 856 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1154 1858 gene locus_tag LOCUS_33960 1154 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 2026 4836 gene locus_tag LOCUS_33970 2026 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 5160 4957 gene locus_tag LOCUS_33980 5160 4957 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 protein_id gnl|my_center|LOCUS_33980 5600 6811 gene locus_tag LOCUS_33990 5600 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 6915 9011 gene locus_tag LOCUS_34000 6915 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 10168 9650 gene locus_tag LOCUS_34010 10168 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 >Feature sequence148 4653 3169 gene locus_tag LOCUS_34020 4653 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 5416 4658 gene locus_tag LOCUS_34030 5416 4658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_34030 6700 5420 gene locus_tag LOCUS_34040 6700 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 7773 6697 gene locus_tag LOCUS_34050 7773 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 8299 8171 gene locus_tag LOCUS_34060 8299 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 8420 8271 gene locus_tag LOCUS_34070 8420 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 8431 8613 gene locus_tag LOCUS_34080 8431 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 9450 8599 gene locus_tag LOCUS_34090 9450 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence149 4774 3980 gene locus_tag LOCUS_34100 4774 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 5784 4708 gene locus_tag LOCUS_34110 5784 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 8865 6541 gene locus_tag LOCUS_34120 8865 6541 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence150 2541 1078 gene locus_tag LOCUS_34130 gene araA 2541 1078 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816285.1 protein_id gnl|my_center|LOCUS_34130 4311 2575 gene locus_tag LOCUS_34140 4311 2575 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_34140 5122 4373 gene locus_tag LOCUS_34150 5122 4373 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129982.1 protein_id gnl|my_center|LOCUS_34150 7141 5471 gene locus_tag LOCUS_34160 7141 5471 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_34160 7360 8385 gene locus_tag LOCUS_34170 7360 8385 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263354.1 protein_id gnl|my_center|LOCUS_34170 8433 9212 gene locus_tag LOCUS_34180 8433 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence151 474 1622 gene locus_tag LOCUS_34190 474 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 2752 5748 gene locus_tag LOCUS_34200 2752 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 6497 9013 gene locus_tag LOCUS_34210 6497 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 >Feature sequence152 1236 430 gene locus_tag LOCUS_34220 1236 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34220 2277 1348 gene locus_tag LOCUS_34230 2277 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34230 3605 2481 gene locus_tag LOCUS_34240 3605 2481 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_34240 4971 3595 gene locus_tag LOCUS_34250 4971 3595 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_34250 5706 4981 gene locus_tag LOCUS_34260 5706 4981 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937553.1 protein_id gnl|my_center|LOCUS_34260 6090 6287 gene locus_tag LOCUS_34270 6090 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 6284 6895 gene locus_tag LOCUS_34280 6284 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 6945 7421 gene locus_tag LOCUS_34290 6945 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 7643 8314 gene locus_tag LOCUS_34300 7643 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 8363 8668 gene locus_tag LOCUS_34310 8363 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence153 449 285 gene locus_tag LOCUS_34320 449 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 876 622 gene locus_tag LOCUS_34330 876 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 1330 1743 gene locus_tag LOCUS_34340 1330 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 1744 3099 gene locus_tag LOCUS_34350 1744 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 3096 4895 gene locus_tag LOCUS_34360 3096 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 4892 6577 gene locus_tag LOCUS_34370 4892 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 8481 7072 gene locus_tag LOCUS_34380 8481 7072 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_34380 >Feature sequence154 <1 2192 gene locus_tag LOCUS_34390 <1 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461428.1:InlB B-repeat-containing protein 2189 3199 gene locus_tag LOCUS_34400 2189 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 3676 4062 gene locus_tag LOCUS_34410 3676 4062 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963572.1 protein_id gnl|my_center|LOCUS_34410 4077 4448 gene locus_tag LOCUS_34420 4077 4448 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931877.1 protein_id gnl|my_center|LOCUS_34420 4462 5256 gene locus_tag LOCUS_34430 4462 5256 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027810.1 protein_id gnl|my_center|LOCUS_34430 5253 5870 gene locus_tag LOCUS_34440 5253 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 5867 6142 gene locus_tag LOCUS_34450 5867 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 6139 6438 gene locus_tag LOCUS_34460 6139 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 6535 6774 gene locus_tag LOCUS_34470 6535 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 7057 7156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7259 8110 gene locus_tag LOCUS_34480 gene nhoA 7259 8110 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187876.1 protein_id gnl|my_center|LOCUS_34480 >Feature sequence155 <1 624 gene locus_tag LOCUS_34490 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975461.1:ATP-dependent Clp protease ATP-binding subunit 702 971 gene locus_tag LOCUS_34500 gene rpsP 702 971 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965062.1 protein_id gnl|my_center|LOCUS_34500 987 1673 gene locus_tag LOCUS_34510 gene trmD 987 1673 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_34510 1718 2104 gene locus_tag LOCUS_34520 gene rplS 1718 2104 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_34520 2857 2357 gene locus_tag LOCUS_34530 2857 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 3456 3214 gene locus_tag LOCUS_34540 3456 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 3956 5671 gene locus_tag LOCUS_34550 3956 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 6357 7757 gene locus_tag LOCUS_34560 6357 7757 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544916.1 protein_id gnl|my_center|LOCUS_34560 7988 8064 gene locus_tag LOCUS_t00440 7988 8064 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence156 154 315 gene locus_tag LOCUS_34570 154 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 417 860 gene locus_tag LOCUS_34580 417 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 1481 1101 gene locus_tag LOCUS_34590 1481 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3066 1657 gene locus_tag LOCUS_34600 3066 1657 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_34600 3978 3199 gene locus_tag LOCUS_34610 gene lpxA 3978 3199 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_34610 5125 4016 gene locus_tag LOCUS_34620 gene lptF 5125 4016 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_34620 6109 5354 gene locus_tag LOCUS_34630 6109 5354 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071805.1 protein_id gnl|my_center|LOCUS_34630 8087 6141 gene locus_tag LOCUS_34640 8087 6141 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036446.1 protein_id gnl|my_center|LOCUS_34640 >Feature sequence157 448 2511 gene locus_tag LOCUS_34650 448 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 3209 2970 gene locus_tag LOCUS_34660 gene acpP 3209 2970 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_34660 4008 3265 gene locus_tag LOCUS_34670 gene fabG 4008 3265 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_34670 4973 4047 gene locus_tag LOCUS_34680 gene fabD 4973 4047 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_34680 6167 5100 gene locus_tag LOCUS_34690 6167 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 6503 6324 gene locus_tag LOCUS_34700 gene rpmF 6503 6324 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_34700 7042 6563 gene locus_tag LOCUS_34710 7042 6563 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869851.1 protein_id gnl|my_center|LOCUS_34710 7565 7014 gene locus_tag LOCUS_34720 gene coaD 7565 7014 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_34720 8193 7642 gene locus_tag LOCUS_34730 gene rsmD 8193 7642 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence158 2089 1775 gene locus_tag LOCUS_34740 2089 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 2476 2249 gene locus_tag LOCUS_34750 2476 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 4603 2939 gene locus_tag LOCUS_34760 4603 2939 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 protein_id gnl|my_center|LOCUS_34760 4942 4667 gene locus_tag LOCUS_34770 4942 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 5378 5139 gene locus_tag LOCUS_34780 5378 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 5640 5353 gene locus_tag LOCUS_34790 5640 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 6295 6134 gene locus_tag LOCUS_34800 6295 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 6831 7766 gene locus_tag LOCUS_34810 6831 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence159 2045 738 gene locus_tag LOCUS_34820 2045 738 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 protein_id gnl|my_center|LOCUS_34820 2686 3567 gene locus_tag LOCUS_34830 2686 3567 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_34830 4997 3711 gene locus_tag LOCUS_34840 4997 3711 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_34840 6872 5430 gene locus_tag LOCUS_34850 6872 5430 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_34850 7828 6926 gene locus_tag LOCUS_34860 7828 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence160 <1 2162 gene locus_tag LOCUS_34870 <1 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268805.1:RHS repeat-associated core domain-containing protein 2152 2763 gene locus_tag LOCUS_34880 2152 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3302 3901 gene locus_tag LOCUS_34890 3302 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142945.1 protein_id gnl|my_center|LOCUS_34890 3876 4913 gene locus_tag LOCUS_34900 3876 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 5232 5585 gene locus_tag LOCUS_34910 5232 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 5821 6063 gene locus_tag LOCUS_34920 5821 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 6060 6446 gene locus_tag LOCUS_34930 6060 6446 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_34930 6591 6803 gene locus_tag LOCUS_34940 6591 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 6849 7139 gene locus_tag LOCUS_34950 6849 7139 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_34950 7149 7448 gene locus_tag LOCUS_34960 7149 7448 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_34960 7499 7672 gene locus_tag LOCUS_34970 7499 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 7727 8227 gene locus_tag LOCUS_34980 7727 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence161 2702 3823 gene locus_tag LOCUS_34990 2702 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3789 6962 gene locus_tag LOCUS_35000 3789 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 8032 7058 gene locus_tag LOCUS_35010 8032 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence162 3012 1138 gene locus_tag LOCUS_35020 3012 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 4037 3306 gene locus_tag LOCUS_35030 4037 3306 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_35030 4700 4104 gene locus_tag LOCUS_35040 gene recR 4700 4104 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_35040 5025 4708 gene locus_tag LOCUS_35050 5025 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 6382 5132 gene locus_tag LOCUS_35060 gene lysA 6382 5132 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_35060 7148 6687 gene locus_tag LOCUS_35070 7148 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 7759 7166 gene locus_tag LOCUS_35080 7759 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence163 707 1912 gene locus_tag LOCUS_35090 707 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 1927 3504 gene locus_tag LOCUS_35100 1927 3504 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_35100 3514 4353 gene locus_tag LOCUS_35110 3514 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 4388 5269 gene locus_tag LOCUS_35120 4388 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 5247 5813 gene locus_tag LOCUS_35130 5247 5813 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 protein_id gnl|my_center|LOCUS_35130 6173 5865 gene locus_tag LOCUS_35140 6173 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 6341 6766 gene locus_tag LOCUS_35150 6341 6766 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957963.1 protein_id gnl|my_center|LOCUS_35150 6763 7221 gene locus_tag LOCUS_35160 6763 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 7221 7712 gene locus_tag LOCUS_35170 7221 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 >Feature sequence164 328 1107 gene locus_tag LOCUS_35180 328 1107 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_35180 7097 1953 gene locus_tag LOCUS_35190 7097 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence165 327 1466 gene locus_tag LOCUS_35200 327 1466 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_35200 3150 1777 gene locus_tag LOCUS_35210 3150 1777 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_35210 4754 3438 gene locus_tag LOCUS_35220 4754 3438 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_35220 6219 4789 gene locus_tag LOCUS_35230 gene uxaC 6219 4789 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_35230 7510 6227 gene locus_tag LOCUS_35240 gene serS 7510 6227 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_35240 >Feature sequence166 <1 574 gene locus_tag LOCUS_35250 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108495.1:sodium:solute symporter 635 2602 gene locus_tag LOCUS_35260 635 2602 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_35260 4276 3161 gene locus_tag LOCUS_35270 gene eboE 4276 3161 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_35270 5377 4382 gene locus_tag LOCUS_35280 5377 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 6190 5384 gene locus_tag LOCUS_35290 6190 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 6232 6453 gene locus_tag LOCUS_35300 6232 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence167 366 3659 gene locus_tag LOCUS_35310 366 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 3656 4195 gene locus_tag LOCUS_35320 3656 4195 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723131.1 protein_id gnl|my_center|LOCUS_35320 4967 4563 gene locus_tag LOCUS_35330 4967 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 5334 4957 gene locus_tag LOCUS_35340 5334 4957 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259444.1 protein_id gnl|my_center|LOCUS_35340 5446 7068 gene locus_tag LOCUS_35350 5446 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence168 336 518 gene locus_tag LOCUS_35360 336 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 588 758 gene locus_tag LOCUS_35370 588 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 2241 970 gene locus_tag LOCUS_35380 2241 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 3755 2238 gene locus_tag LOCUS_35390 3755 2238 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_35390 4009 5406 gene locus_tag LOCUS_35400 4009 5406 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_35400 5857 6183 gene locus_tag LOCUS_35410 5857 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 6328 6663 gene locus_tag LOCUS_35420 6328 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence169 <1 993 gene locus_tag LOCUS_35430 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097665.1:RHS repeat-associated core domain-containing protein 1106 1474 gene locus_tag LOCUS_35440 1106 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4272 2854 gene locus_tag LOCUS_35450 4272 2854 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence170 22 585 gene locus_tag LOCUS_35460 22 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 585 884 gene locus_tag LOCUS_35470 585 884 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557145.1 protein_id gnl|my_center|LOCUS_35470 905 2680 gene locus_tag LOCUS_35480 gene ptsP 905 2680 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_35480 2805 5888 gene locus_tag LOCUS_35490 gene secA 2805 5888 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence171 <1 803 gene locus_tag LOCUS_35500 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108961.1:rhamnulokinase 1067 3151 gene locus_tag LOCUS_35510 1067 3151 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206290416.1 protein_id gnl|my_center|LOCUS_35510 3485 3410 gene locus_tag LOCUS_t00450 3485 3410 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3588 3950 gene locus_tag LOCUS_35520 3588 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 4416 5237 gene locus_tag LOCUS_35530 4416 5237 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_35530 6387 6229 gene locus_tag LOCUS_35540 6387 6229 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_35540 >Feature sequence172 287 1921 gene locus_tag LOCUS_35550 287 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 2264 2554 gene locus_tag LOCUS_35560 2264 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 2594 4690 gene locus_tag LOCUS_35570 2594 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 6371 5010 gene locus_tag LOCUS_35580 6371 5010 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119999.1 protein_id gnl|my_center|LOCUS_35580 >Feature sequence173 722 1138 gene locus_tag LOCUS_35590 722 1138 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943436.1 protein_id gnl|my_center|LOCUS_35590 1167 6311 gene locus_tag LOCUS_35600 1167 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence174 1444 386 gene locus_tag LOCUS_35610 1444 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 1529 1738 gene locus_tag LOCUS_35620 1529 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 2319 1699 gene locus_tag LOCUS_35630 2319 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 3965 3363 gene locus_tag LOCUS_35640 3965 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 4125 5087 gene locus_tag LOCUS_35650 4125 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 5264 5638 gene locus_tag LOCUS_35660 5264 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence175 1300 449 gene locus_tag LOCUS_35670 1300 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 1477 2496 gene locus_tag LOCUS_35680 1477 2496 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_35680 >Feature sequence176 786 238 gene locus_tag LOCUS_35690 786 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 1251 802 gene locus_tag LOCUS_35700 1251 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 1907 1503 gene locus_tag LOCUS_35710 1907 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 3709 1907 gene locus_tag LOCUS_35720 3709 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3939 3706 gene locus_tag LOCUS_35730 3939 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 <6292 4266 gene locus_tag LOCUS_35740 <6292 4266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006037763.1:RHS repeat-associated core domain-containing protein >Feature sequence177 4506 1030 gene locus_tag LOCUS_35750 4506 1030 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922355.1 protein_id gnl|my_center|LOCUS_35750 5758 4508 gene locus_tag LOCUS_35760 5758 4508 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_35760 >Feature sequence178 241 909 gene locus_tag LOCUS_35770 241 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 1026 1763 gene locus_tag LOCUS_35780 1026 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1784 2533 gene locus_tag LOCUS_35790 gene kdsB 1784 2533 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_35790 2526 3350 gene locus_tag LOCUS_35800 gene kdsA 2526 3350 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_35800 3337 3879 gene locus_tag LOCUS_35810 3337 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 3876 4430 gene locus_tag LOCUS_35820 3876 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 4526 5281 gene locus_tag LOCUS_35830 gene lptB 4526 5281 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_35830 5322 5636 gene locus_tag LOCUS_35840 5322 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 >Feature sequence179 407 180 gene locus_tag LOCUS_35850 407 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 2852 489 gene locus_tag LOCUS_35860 2852 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 5446 2960 gene locus_tag LOCUS_35870 5446 2960 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027862.1 protein_id gnl|my_center|LOCUS_35870 5534 5680 gene locus_tag LOCUS_35880 5534 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 >Feature sequence180 2023 458 gene locus_tag LOCUS_35890 gene gnd 2023 458 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_35890 3210 2353 gene locus_tag LOCUS_35900 3210 2353 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964640.1 protein_id gnl|my_center|LOCUS_35900 4512 3229 gene locus_tag LOCUS_35910 4512 3229 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence181 2071 1142 gene locus_tag LOCUS_35920 2071 1142 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272390.1 protein_id gnl|my_center|LOCUS_35920 2537 2103 gene locus_tag LOCUS_35930 2537 2103 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313449.1 protein_id gnl|my_center|LOCUS_35930 3382 2624 gene locus_tag LOCUS_35940 3382 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922454.1 protein_id gnl|my_center|LOCUS_35940 4280 3537 gene locus_tag LOCUS_35950 gene ubiE 4280 3537 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_35950 4556 4819 gene locus_tag LOCUS_35960 4556 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 5094 4792 gene locus_tag LOCUS_35970 5094 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence182 <5718 5142 gene locus_tag LOCUS_35980 <5718 5142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003917061.1:DDE-type integrase/transposase/recombinase >Feature sequence183 <1 2990 gene locus_tag LOCUS_35990 <1 2990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962421.1:TaqI-like C-terminal specificity domain-containing protein 3856 3419 gene locus_tag LOCUS_36000 3856 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 4245 3928 gene locus_tag LOCUS_36010 4245 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 4826 4242 gene locus_tag LOCUS_36020 4826 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 4949 5551 gene locus_tag LOCUS_36030 4949 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence184 1502 702 gene locus_tag LOCUS_36040 1502 702 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_36040 4819 1541 gene locus_tag LOCUS_36050 4819 1541 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_36050 4715 4921 gene locus_tag LOCUS_36060 4715 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence185 2014 2199 gene locus_tag LOCUS_36070 2014 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 2469 2290 gene locus_tag LOCUS_36080 2469 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 2757 2536 gene locus_tag LOCUS_36090 2757 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 4088 2754 gene locus_tag LOCUS_36100 4088 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 5001 4660 gene locus_tag LOCUS_36110 5001 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence186 123 207 gene locus_tag LOCUS_t00460 123 207 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 501 1811 gene locus_tag LOCUS_36120 gene tig 501 1811 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_36120 1825 2424 gene locus_tag LOCUS_36130 gene clpP 1825 2424 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_36130 2421 3677 gene locus_tag LOCUS_36140 gene clpX 2421 3677 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_36140 3871 4164 gene locus_tag LOCUS_36150 3871 4164 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_36150 4182 4258 gene locus_tag LOCUS_t00470 4182 4258 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4268 4343 gene locus_tag LOCUS_t00480 4268 4343 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5008 4388 gene locus_tag LOCUS_36160 5008 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 >Feature sequence187 2358 724 gene locus_tag LOCUS_36170 2358 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 5031 2407 gene locus_tag LOCUS_36180 5031 2407 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence188 2093 1152 gene locus_tag LOCUS_36190 2093 1152 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_36190 2163 2387 gene locus_tag LOCUS_36200 2163 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 2357 3661 gene locus_tag LOCUS_36210 2357 3661 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_36210 4957 4046 gene locus_tag LOCUS_36220 4957 4046 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence189 3531 2515 gene locus_tag LOCUS_36230 3531 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 4979 3537 gene locus_tag LOCUS_36240 4979 3537 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence190 1231 713 gene locus_tag LOCUS_36250 1231 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 2043 1252 gene locus_tag LOCUS_36260 2043 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 2819 2055 gene locus_tag LOCUS_36270 2819 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 4010 2832 gene locus_tag LOCUS_36280 4010 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence191 464 1609 gene locus_tag LOCUS_36290 464 1609 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811750.1 protein_id gnl|my_center|LOCUS_36290 1703 2164 gene locus_tag LOCUS_36300 gene ribE 1703 2164 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_36300 2187 2684 gene locus_tag LOCUS_36310 2187 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 2932 4014 gene locus_tag LOCUS_36320 gene ribD 2932 4014 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_36320 4174 4569 gene locus_tag LOCUS_36330 4174 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence192 247 1296 gene locus_tag LOCUS_36340 247 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 1289 2248 gene locus_tag LOCUS_36350 1289 2248 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_36350 2828 2904 gene locus_tag LOCUS_t00490 2828 2904 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3777 3400 gene locus_tag LOCUS_36360 3777 3400 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143794.1 protein_id gnl|my_center|LOCUS_36360 4140 3934 gene locus_tag LOCUS_36370 4140 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 4451 4263 gene locus_tag LOCUS_36380 4451 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 4824 4501 gene locus_tag LOCUS_36390 4824 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence193 193 660 gene locus_tag LOCUS_36400 193 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36400 2432 1029 gene locus_tag LOCUS_36410 2432 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3706 2477 gene locus_tag LOCUS_36420 3706 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 4405 3716 gene locus_tag LOCUS_36430 4405 3716 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855408.1 protein_id gnl|my_center|LOCUS_36430 4876 4454 gene locus_tag LOCUS_36440 4876 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 >Feature sequence194 2910 2311 gene locus_tag LOCUS_36450 2910 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 <4887 3134 gene locus_tag LOCUS_36460 <4887 3134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein >Feature sequence195 1933 2832 gene locus_tag LOCUS_36470 1933 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 3119 3241 gene locus_tag LOCUS_36480 3119 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 3352 4350 gene locus_tag LOCUS_36490 3352 4350 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921653.1 protein_id gnl|my_center|LOCUS_36490 >Feature sequence196 <1 1382 gene locus_tag LOCUS_36500 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922366.1:glutamine amidotransferase 2791 1742 gene locus_tag LOCUS_36510 2791 1742 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_36510 4695 2788 gene locus_tag LOCUS_36520 4695 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 >Feature sequence197 <1 3008 gene locus_tag LOCUS_36530 <1 3008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962421.1:TaqI-like C-terminal specificity domain-containing protein >Feature sequence198 2177 759 gene locus_tag LOCUS_36540 2177 759 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_36540 3044 4339 gene locus_tag LOCUS_36550 3044 4339 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_36550 >Feature sequence199 1841 4111 gene locus_tag LOCUS_36560 1841 4111 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_36560 >Feature sequence200 1717 1418 gene locus_tag LOCUS_36570 1717 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 3333 2098 gene locus_tag LOCUS_36580 3333 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence201 1356 109 gene locus_tag LOCUS_36590 1356 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 1841 1431 gene locus_tag LOCUS_36600 1841 1431 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684748.1 protein_id gnl|my_center|LOCUS_36600 2517 3515 gene locus_tag LOCUS_36610 2517 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 >Feature sequence202 2151 1060 gene locus_tag LOCUS_36620 2151 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 2335 2664 gene locus_tag LOCUS_36630 2335 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 2695 2814 gene locus_tag LOCUS_36640 2695 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2866 3048 gene locus_tag LOCUS_36650 2866 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 3917 3051 gene locus_tag LOCUS_36660 3917 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence203 175 2496 gene locus_tag LOCUS_36670 175 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 3524 2547 gene locus_tag LOCUS_36680 3524 2547 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence204 2578 71 gene locus_tag LOCUS_36690 2578 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 >Feature sequence205 2484 1234 gene locus_tag LOCUS_36700 2484 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 3497 2631 gene locus_tag LOCUS_36710 3497 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 >Feature sequence206 892 86 gene locus_tag LOCUS_36720 892 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 3190 902 gene locus_tag LOCUS_36730 3190 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence207 2960 3346 gene locus_tag LOCUS_36740 2960 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 >Feature sequence208 120 782 gene locus_tag LOCUS_36750 120 782 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 protein_id gnl|my_center|LOCUS_36750 1968 817 gene locus_tag LOCUS_36760 gene hemW 1968 817 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_36760 2849 2202 gene locus_tag LOCUS_36770 2849 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence209 901 1326 gene locus_tag LOCUS_36780 901 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 1326 2324 gene locus_tag LOCUS_36790 1326 2324 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_36790 >Feature sequence210 1611 2285 gene locus_tag LOCUS_36800 1611 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 >Feature sequence211 447 2807 gene locus_tag LOCUS_36810 447 2807 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_36810 >Feature sequence212 557 27 gene locus_tag LOCUS_36820 557 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 1218 667 gene locus_tag LOCUS_36830 1218 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 1820 1230 gene locus_tag LOCUS_36840 1820 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 1974 1831 gene locus_tag LOCUS_36850 1974 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 2022 2222 gene locus_tag LOCUS_36860 2022 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 2219 2371 gene locus_tag LOCUS_36870 2219 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 2368 2757 gene locus_tag LOCUS_36880 2368 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 2905 2645 gene locus_tag LOCUS_36890 2905 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence213 774 385 gene locus_tag LOCUS_36900 774 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 1076 804 gene locus_tag LOCUS_36910 1076 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 1785 1297 gene locus_tag LOCUS_36920 1785 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36920 2338 1973 gene locus_tag LOCUS_36930 2338 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence214 1837 1316 gene locus_tag LOCUS_36940 1837 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 2235 1834 gene locus_tag LOCUS_36950 2235 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence215 1614 400 gene locus_tag LOCUS_36960 1614 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 <2780 1687 gene locus_tag LOCUS_36970 <2780 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967015.1:autotransporter outer membrane beta-barrel domain-containing protein >Feature sequence216 1130 1429 gene locus_tag LOCUS_36980 1130 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 1440 2333 gene locus_tag LOCUS_36990 gene xerD 1440 2333 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_36990 >Feature sequence217 1820 1089 gene locus_tag LOCUS_37000 1820 1089 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_37000 >Feature sequence218 1465 2382 gene locus_tag LOCUS_37010 1465 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010