>Feature sequence01 1154 426 gene locus_tag LOCUS_00010 1154 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1629 1147 gene locus_tag LOCUS_00020 1629 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3215 1752 gene locus_tag LOCUS_00030 3215 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3858 3226 gene locus_tag LOCUS_00040 3858 3226 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_00040 5423 3873 gene locus_tag LOCUS_00050 gene murJ 5423 3873 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816533.1 protein_id gnl|my_center|LOCUS_00050 5587 5512 gene locus_tag LOCUS_t00010 5587 5512 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6553 5690 gene locus_tag LOCUS_00060 6553 5690 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479359.1 protein_id gnl|my_center|LOCUS_00060 6796 7563 gene locus_tag LOCUS_00070 6796 7563 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399793.1 protein_id gnl|my_center|LOCUS_00070 7621 10068 gene locus_tag LOCUS_00080 7621 10068 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219226.1 protein_id gnl|my_center|LOCUS_00080 10068 10259 gene locus_tag LOCUS_00090 gene ccoS 10068 10259 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212878.1 protein_id gnl|my_center|LOCUS_00090 10536 11963 gene locus_tag LOCUS_00100 gene ccoN 10536 11963 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477654.1 protein_id gnl|my_center|LOCUS_00100 11980 12618 gene locus_tag LOCUS_00110 gene ccoO 11980 12618 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_00110 12622 12798 gene locus_tag LOCUS_00120 12622 12798 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351115.1 protein_id gnl|my_center|LOCUS_00120 12814 13710 gene locus_tag LOCUS_00130 12814 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13836 15245 gene locus_tag LOCUS_00140 gene ccoG 13836 15245 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_00140 15266 15775 gene locus_tag LOCUS_00150 15266 15775 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706148.1 protein_id gnl|my_center|LOCUS_00150 15801 15935 gene locus_tag LOCUS_00160 15801 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16540 15989 gene locus_tag LOCUS_00170 16540 15989 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_00170 16727 17584 gene locus_tag LOCUS_00180 gene motA 16727 17584 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_00180 17612 18556 gene locus_tag LOCUS_00190 gene motB 17612 18556 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817154.1 protein_id gnl|my_center|LOCUS_00190 18606 18971 gene locus_tag LOCUS_00200 18606 18971 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_00200 19046 21394 gene locus_tag LOCUS_00210 19046 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21414 21911 gene locus_tag LOCUS_00220 21414 21911 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_00220 21936 24644 gene locus_tag LOCUS_00230 21936 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24668 27496 gene locus_tag LOCUS_00240 24668 27496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27535 30330 gene locus_tag LOCUS_00250 27535 30330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30402 31232 gene locus_tag LOCUS_00260 30402 31232 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832274.1 protein_id gnl|my_center|LOCUS_00260 31241 31846 gene locus_tag LOCUS_00270 gene cheD 31241 31846 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_00270 31893 32975 gene locus_tag LOCUS_00280 31893 32975 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198645.1 protein_id gnl|my_center|LOCUS_00280 33040 33345 gene locus_tag LOCUS_00290 gene hsbA 33040 33345 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_00290 33460 34428 gene locus_tag LOCUS_00300 33460 34428 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_00300 34453 35385 gene locus_tag LOCUS_00310 34453 35385 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 protein_id gnl|my_center|LOCUS_00310 35410 35805 gene locus_tag LOCUS_00320 gene cheY 35410 35805 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_00320 35816 36637 gene locus_tag LOCUS_00330 35816 36637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36647 38536 gene locus_tag LOCUS_00340 36647 38536 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_00340 38717 39850 gene locus_tag LOCUS_00350 gene flhB 38717 39850 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096066.1 protein_id gnl|my_center|LOCUS_00350 39850 41934 gene locus_tag LOCUS_00360 gene flhA 39850 41934 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_00360 41931 43385 gene locus_tag LOCUS_00370 41931 43385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43378 44265 gene locus_tag LOCUS_00380 43378 44265 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946724.1 protein_id gnl|my_center|LOCUS_00380 44265 45017 gene locus_tag LOCUS_00390 44265 45017 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_00390 45010 45750 gene locus_tag LOCUS_00400 45010 45750 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_00400 45750 46562 gene locus_tag LOCUS_00410 gene motD 45750 46562 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_00410 47034 46576 gene locus_tag LOCUS_00420 47034 46576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 47312 47034 gene locus_tag LOCUS_00430 47312 47034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48047 47376 gene locus_tag LOCUS_00440 gene flgA 48047 47376 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_00440 48139 48549 gene locus_tag LOCUS_00450 gene flgB 48139 48549 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811894.1 protein_id gnl|my_center|LOCUS_00450 48560 48973 gene locus_tag LOCUS_00460 gene flgC 48560 48973 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 protein_id gnl|my_center|LOCUS_00460 48988 49677 gene locus_tag LOCUS_00470 gene flgD 48988 49677 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_00470 49690 51072 gene locus_tag LOCUS_00480 gene flgE 49690 51072 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_00480 51094 51837 gene locus_tag LOCUS_00490 gene flgF 51094 51837 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073129.1 protein_id gnl|my_center|LOCUS_00490 51857 52639 gene locus_tag LOCUS_00500 gene flgG 51857 52639 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050114401.1 protein_id gnl|my_center|LOCUS_00500 52649 53302 gene locus_tag LOCUS_00510 gene flgH 52649 53302 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 protein_id gnl|my_center|LOCUS_00510 53390 54415 gene locus_tag LOCUS_00520 53390 54415 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_00520 54421 55389 gene locus_tag LOCUS_00530 gene flgJ 54421 55389 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 protein_id gnl|my_center|LOCUS_00530 55444 57495 gene locus_tag LOCUS_00540 gene flgK 55444 57495 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_00540 57510 58466 gene locus_tag LOCUS_00550 57510 58466 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405348.1 protein_id gnl|my_center|LOCUS_00550 58502 58939 gene locus_tag LOCUS_00560 58502 58939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 59721 58933 gene locus_tag LOCUS_00570 gene fliR 59721 58933 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_00570 59993 59724 gene locus_tag LOCUS_00580 gene fliQ 59993 59724 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187355.1 protein_id gnl|my_center|LOCUS_00580 60730 59990 gene locus_tag LOCUS_00590 gene fliP 60730 59990 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 protein_id gnl|my_center|LOCUS_00590 61172 60723 gene locus_tag LOCUS_00600 61172 60723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 61682 61248 gene locus_tag LOCUS_00610 gene fliN 61682 61248 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 protein_id gnl|my_center|LOCUS_00610 62691 61675 gene locus_tag LOCUS_00620 gene fliM 62691 61675 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_00620 63264 62698 gene locus_tag LOCUS_00630 63264 62698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 64524 63295 gene locus_tag LOCUS_00640 64524 63295 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695171.1 protein_id gnl|my_center|LOCUS_00640 65037 64582 gene locus_tag LOCUS_00650 gene fliJ 65037 64582 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211139.1 protein_id gnl|my_center|LOCUS_00650 66456 65044 gene locus_tag LOCUS_00660 gene fliI 66456 65044 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_00660 67124 66438 gene locus_tag LOCUS_00670 67124 66438 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037090.1 protein_id gnl|my_center|LOCUS_00670 68129 67131 gene locus_tag LOCUS_00680 gene fliG 68129 67131 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_00680 69879 68119 gene locus_tag LOCUS_00690 gene fliF 69879 68119 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_00690 69988 71184 gene locus_tag LOCUS_00700 gene fleS 69988 71184 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_00700 71177 72526 gene locus_tag LOCUS_00710 71177 72526 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706626.1 protein_id gnl|my_center|LOCUS_00710 72577 72900 gene locus_tag LOCUS_00720 gene fliE 72577 72900 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160376.1 protein_id gnl|my_center|LOCUS_00720 73751 72960 gene locus_tag LOCUS_00730 73751 72960 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197265.1 protein_id gnl|my_center|LOCUS_00730 74066 73773 gene locus_tag LOCUS_00740 74066 73773 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811829.1 protein_id gnl|my_center|LOCUS_00740 75273 74047 gene locus_tag LOCUS_00750 75273 74047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 75574 75299 gene locus_tag LOCUS_00760 75574 75299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 75947 75546 gene locus_tag LOCUS_00770 gene fliS 75947 75546 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 protein_id gnl|my_center|LOCUS_00770 77615 75960 gene locus_tag LOCUS_00780 gene fliD 77615 75960 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146764.1 protein_id gnl|my_center|LOCUS_00780 78025 77654 gene locus_tag LOCUS_00790 78025 77654 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_00790 78917 78084 gene locus_tag LOCUS_00800 78917 78084 CDS product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 protein_id gnl|my_center|LOCUS_00800 79570 79007 gene locus_tag LOCUS_00810 79570 79007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 79658 79757 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 80974 80147 gene locus_tag LOCUS_00820 80974 80147 CDS product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 protein_id gnl|my_center|LOCUS_00820 81251 83002 gene locus_tag LOCUS_00830 gene aprD 81251 83002 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_00830 82999 84360 gene locus_tag LOCUS_00840 82999 84360 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_00840 84363 86303 gene locus_tag LOCUS_00850 84363 86303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 89991 86338 gene locus_tag LOCUS_00860 89991 86338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 91064 90009 gene locus_tag LOCUS_00870 91064 90009 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037095.1 protein_id gnl|my_center|LOCUS_00870 92008 91061 gene locus_tag LOCUS_00880 92008 91061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 92684 91995 gene locus_tag LOCUS_00890 92684 91995 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_00890 93843 92707 gene locus_tag LOCUS_00900 93843 92707 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026433798.1 protein_id gnl|my_center|LOCUS_00900 95237 93855 gene locus_tag LOCUS_00910 95237 93855 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_00910 96730 95231 gene locus_tag LOCUS_00920 96730 95231 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_00920 98535 96727 gene locus_tag LOCUS_00930 98535 96727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 98575 98648 gene locus_tag LOCUS_t00020 98575 98648 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 99356 99021 gene locus_tag LOCUS_00940 99356 99021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 99355 101538 gene locus_tag LOCUS_00950 99355 101538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 102037 101540 gene locus_tag LOCUS_00960 102037 101540 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113020.1 protein_id gnl|my_center|LOCUS_00960 102774 102034 gene locus_tag LOCUS_00970 102774 102034 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_00970 103637 102771 gene locus_tag LOCUS_00980 103637 102771 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114074.1 protein_id gnl|my_center|LOCUS_00980 104014 103700 gene locus_tag LOCUS_00990 104014 103700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 104414 104229 gene locus_tag LOCUS_01000 104414 104229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 106093 104660 gene locus_tag LOCUS_01010 106093 104660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 106781 106080 gene locus_tag LOCUS_01020 gene bfmR 106781 106080 CDS product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_01020 106897 107388 gene locus_tag LOCUS_01030 106897 107388 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_01030 107621 107451 gene locus_tag LOCUS_01040 gene rpmG 107621 107451 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185395.1 protein_id gnl|my_center|LOCUS_01040 107872 107639 gene locus_tag LOCUS_01050 gene rpmB 107872 107639 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_01050 108634 107954 gene locus_tag LOCUS_01060 gene radC 108634 107954 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403975.1 protein_id gnl|my_center|LOCUS_01060 108682 109872 gene locus_tag LOCUS_01070 gene coaBC 108682 109872 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 protein_id gnl|my_center|LOCUS_01070 109872 110321 gene locus_tag LOCUS_01080 gene dut 109872 110321 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_01080 110386 111000 gene locus_tag LOCUS_01090 110386 111000 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_01090 114241 111032 gene locus_tag LOCUS_01100 114241 111032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 115628 114351 gene locus_tag LOCUS_01110 115628 114351 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_01110 115946 115641 gene locus_tag LOCUS_01120 115946 115641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 116136 116468 gene locus_tag LOCUS_01130 116136 116468 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_01130 116503 117852 gene locus_tag LOCUS_01140 gene soxC 116503 117852 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_01140 117836 118894 gene locus_tag LOCUS_01150 117836 118894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 118918 119385 gene locus_tag LOCUS_01160 gene soxY 118918 119385 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_01160 119422 119733 gene locus_tag LOCUS_01170 gene soxZ 119422 119733 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_01170 119850 120662 gene locus_tag LOCUS_01180 gene soxA 119850 120662 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_01180 120674 121279 gene locus_tag LOCUS_01190 gene soxX 120674 121279 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_01190 121344 123059 gene locus_tag LOCUS_01200 gene soxB 121344 123059 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_01200 123056 123670 gene locus_tag LOCUS_01210 123056 123670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 124912 123845 gene locus_tag LOCUS_01220 124912 123845 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086305.1 protein_id gnl|my_center|LOCUS_01220 126229 124964 gene locus_tag LOCUS_01230 126229 124964 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632948.1 protein_id gnl|my_center|LOCUS_01230 127635 126265 gene locus_tag LOCUS_01240 127635 126265 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_01240 127918 127637 gene locus_tag LOCUS_01250 127918 127637 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_01250 129045 127918 gene locus_tag LOCUS_01260 129045 127918 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958564.1 protein_id gnl|my_center|LOCUS_01260 131005 129224 gene locus_tag LOCUS_01270 gene aceK 131005 129224 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_01270 131205 133442 gene locus_tag LOCUS_01280 131205 133442 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400583.1 protein_id gnl|my_center|LOCUS_01280 133665 134906 gene locus_tag LOCUS_01290 gene icd 133665 134906 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_01290 134981 135778 gene locus_tag LOCUS_01300 gene murI 134981 135778 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_01300 135780 136979 gene locus_tag LOCUS_01310 135780 136979 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129868.1 protein_id gnl|my_center|LOCUS_01310 137210 136989 gene locus_tag LOCUS_01320 137210 136989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 137245 137556 gene locus_tag LOCUS_01330 137245 137556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 137565 138605 gene locus_tag LOCUS_01340 137565 138605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 139228 138599 gene locus_tag LOCUS_01350 gene fixJ 139228 138599 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_01350 141584 139221 gene locus_tag LOCUS_01360 gene fixL 141584 139221 CDS product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557112.1 protein_id gnl|my_center|LOCUS_01360 142355 141633 gene locus_tag LOCUS_01370 142355 141633 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_01370 142705 142352 gene locus_tag LOCUS_01380 142705 142352 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 protein_id gnl|my_center|LOCUS_01380 143909 143016 gene locus_tag LOCUS_01390 143909 143016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 144030 144815 gene locus_tag LOCUS_01400 144030 144815 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463393.1 protein_id gnl|my_center|LOCUS_01400 148346 144828 gene locus_tag LOCUS_01410 148346 144828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 150915 148327 gene locus_tag LOCUS_01420 150915 148327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 152693 150978 gene locus_tag LOCUS_01430 152693 150978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 163376 152712 gene locus_tag LOCUS_01440 163376 152712 CDS product VCBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086495.1 protein_id gnl|my_center|LOCUS_01440 164516 163707 gene locus_tag LOCUS_01450 164516 163707 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 protein_id gnl|my_center|LOCUS_01450 164625 165242 gene locus_tag LOCUS_01460 164625 165242 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_01460 165389 167092 gene locus_tag LOCUS_01470 165389 167092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 167104 167427 gene locus_tag LOCUS_01480 167104 167427 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_01480 167428 168027 gene locus_tag LOCUS_01490 gene recR 167428 168027 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193537.1 protein_id gnl|my_center|LOCUS_01490 168112 168708 gene locus_tag LOCUS_01500 gene petA 168112 168708 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815815.1 protein_id gnl|my_center|LOCUS_01500 168710 170011 gene locus_tag LOCUS_01510 168710 170011 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_01510 170023 170742 gene locus_tag LOCUS_01520 170023 170742 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199892.1 protein_id gnl|my_center|LOCUS_01520 170825 171421 gene locus_tag LOCUS_01530 170825 171421 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_01530 171418 171864 gene locus_tag LOCUS_01540 171418 171864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 171991 174711 gene locus_tag LOCUS_01550 171991 174711 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936224.1 protein_id gnl|my_center|LOCUS_01550 174731 175720 gene locus_tag LOCUS_01560 gene ybiB 174731 175720 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386538.1 protein_id gnl|my_center|LOCUS_01560 175948 178389 gene locus_tag LOCUS_01570 gene nirB 175948 178389 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_01570 178413 178727 gene locus_tag LOCUS_01580 178413 178727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 178742 179530 gene locus_tag LOCUS_01590 178742 179530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 179630 179998 gene locus_tag LOCUS_01600 179630 179998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 180020 180595 gene locus_tag LOCUS_01610 180020 180595 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 protein_id gnl|my_center|LOCUS_01610 180909 182174 gene locus_tag LOCUS_01620 180909 182174 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 protein_id gnl|my_center|LOCUS_01620 182227 183159 gene locus_tag LOCUS_01630 gene ntrB 182227 183159 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_01630 183174 183974 gene locus_tag LOCUS_01640 183174 183974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_01640 184322 184050 gene locus_tag LOCUS_01650 184322 184050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 185223 184456 gene locus_tag LOCUS_01660 185223 184456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533664.1 protein_id gnl|my_center|LOCUS_01660 185979 185245 gene locus_tag LOCUS_01670 185979 185245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 186108 186034 gene locus_tag LOCUS_t00030 186108 186034 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 411 1982 gene locus_tag LOCUS_01680 411 1982 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_01680 2024 3328 gene locus_tag LOCUS_01690 gene pilR 2024 3328 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_01690 3325 3906 gene locus_tag LOCUS_01700 gene ampD 3325 3906 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 protein_id gnl|my_center|LOCUS_01700 5097 3883 gene locus_tag LOCUS_01710 5097 3883 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406662.1 protein_id gnl|my_center|LOCUS_01710 7005 5161 gene locus_tag LOCUS_01720 7005 5161 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 protein_id gnl|my_center|LOCUS_01720 7250 9529 gene locus_tag LOCUS_01730 7250 9529 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_01730 9632 10645 gene locus_tag LOCUS_01740 9632 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 11487 10699 gene locus_tag LOCUS_01750 11487 10699 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_01750 11558 12289 gene locus_tag LOCUS_01760 11558 12289 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550196.1 protein_id gnl|my_center|LOCUS_01760 12289 13728 gene locus_tag LOCUS_01770 12289 13728 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191338.1 protein_id gnl|my_center|LOCUS_01770 13731 14429 gene locus_tag LOCUS_01780 13731 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 14431 15384 gene locus_tag LOCUS_01790 14431 15384 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 protein_id gnl|my_center|LOCUS_01790 15381 16031 gene locus_tag LOCUS_01800 15381 16031 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192015.1 protein_id gnl|my_center|LOCUS_01800 16028 16249 gene locus_tag LOCUS_01810 gene ybcJ 16028 16249 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190288.1 protein_id gnl|my_center|LOCUS_01810 16906 16253 gene locus_tag LOCUS_01820 16906 16253 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109354.1 protein_id gnl|my_center|LOCUS_01820 17946 16903 gene locus_tag LOCUS_01830 17946 16903 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_01830 18093 19145 gene locus_tag LOCUS_01840 gene tdt 18093 19145 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870080.1 protein_id gnl|my_center|LOCUS_01840 19145 20008 gene locus_tag LOCUS_01850 19145 20008 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389792.1 protein_id gnl|my_center|LOCUS_01850 21479 20067 gene locus_tag LOCUS_01860 gene ccoG 21479 20067 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_01860 21815 23146 gene locus_tag LOCUS_01870 21815 23146 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 protein_id gnl|my_center|LOCUS_01870 23217 23519 gene locus_tag LOCUS_01880 gene nirM 23217 23519 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_01880 23580 24857 gene locus_tag LOCUS_01890 23580 24857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957570.1 protein_id gnl|my_center|LOCUS_01890 24946 25947 gene locus_tag LOCUS_01900 24946 25947 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_01900 25949 29173 gene locus_tag LOCUS_01910 25949 29173 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_01910 29170 29394 gene locus_tag LOCUS_01920 29170 29394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 29935 29414 gene locus_tag LOCUS_01930 29935 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 30083 30182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31060 30506 gene locus_tag LOCUS_01940 31060 30506 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_01940 31171 32010 gene locus_tag LOCUS_01950 31171 32010 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063703.1 protein_id gnl|my_center|LOCUS_01950 32042 32914 gene locus_tag LOCUS_01960 32042 32914 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531399.1 protein_id gnl|my_center|LOCUS_01960 32911 33810 gene locus_tag LOCUS_01970 32911 33810 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_01970 34913 33813 gene locus_tag LOCUS_01980 34913 33813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 35606 34917 gene locus_tag LOCUS_01990 35606 34917 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393381.1 protein_id gnl|my_center|LOCUS_01990 35918 36550 gene locus_tag LOCUS_02000 35918 36550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 37190 36558 gene locus_tag LOCUS_02010 37190 36558 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_02010 39304 37187 gene locus_tag LOCUS_02020 gene ovoA 39304 37187 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704222.1 protein_id gnl|my_center|LOCUS_02020 42426 39421 gene locus_tag LOCUS_02030 42426 39421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 43247 42423 gene locus_tag LOCUS_02040 43247 42423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 44615 43521 gene locus_tag LOCUS_02050 gene mtnA 44615 43521 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_02050 45471 44698 gene locus_tag LOCUS_02060 45471 44698 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114755.1 protein_id gnl|my_center|LOCUS_02060 45578 46516 gene locus_tag LOCUS_02070 gene dmlR 45578 46516 CDS product DNA-binding transcriptional regulator DmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386838.1 protein_id gnl|my_center|LOCUS_02070 46525 47685 gene locus_tag LOCUS_02080 46525 47685 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_02080 47848 47678 gene locus_tag LOCUS_02090 47848 47678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 50199 48070 gene locus_tag LOCUS_02100 50199 48070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_02100 52925 50220 gene locus_tag LOCUS_02110 gene glnE 52925 50220 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196324.1 protein_id gnl|my_center|LOCUS_02110 53073 56825 gene locus_tag LOCUS_02120 53073 56825 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 protein_id gnl|my_center|LOCUS_02120 56822 57634 gene locus_tag LOCUS_02130 56822 57634 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813061.1 protein_id gnl|my_center|LOCUS_02130 57645 59090 gene locus_tag LOCUS_02140 gene tldD 57645 59090 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039540.1 protein_id gnl|my_center|LOCUS_02140 59122 59742 gene locus_tag LOCUS_02150 59122 59742 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_02150 59808 60887 gene locus_tag LOCUS_02160 gene aroG 59808 60887 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_02160 61141 60911 gene locus_tag LOCUS_02170 61141 60911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 61784 61200 gene locus_tag LOCUS_02180 61784 61200 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_02180 61847 62650 gene locus_tag LOCUS_02190 gene hyi 61847 62650 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085951.1 protein_id gnl|my_center|LOCUS_02190 62660 64141 gene locus_tag LOCUS_02200 62660 64141 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813050.1 protein_id gnl|my_center|LOCUS_02200 64141 65199 gene locus_tag LOCUS_02210 gene glcE 64141 65199 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_02210 65209 66447 gene locus_tag LOCUS_02220 gene glcF 65209 66447 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_02220 66444 67334 gene locus_tag LOCUS_02230 66444 67334 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_02230 67399 68151 gene locus_tag LOCUS_02240 67399 68151 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_02240 69688 68162 gene locus_tag LOCUS_02250 69688 68162 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_02250 71905 69698 gene locus_tag LOCUS_02260 71905 69698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 72291 71932 gene locus_tag LOCUS_02270 72291 71932 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941569.1 protein_id gnl|my_center|LOCUS_02270 74824 72284 gene locus_tag LOCUS_02280 74824 72284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 75291 74869 gene locus_tag LOCUS_02290 75291 74869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 75446 76675 gene locus_tag LOCUS_02300 gene ugpB 75446 76675 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703703.1 protein_id gnl|my_center|LOCUS_02300 76675 77394 gene locus_tag LOCUS_02310 gene ugpQ 76675 77394 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196745.1 protein_id gnl|my_center|LOCUS_02310 77461 80082 gene locus_tag LOCUS_02320 gene alaS 77461 80082 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_02320 80502 80161 gene locus_tag LOCUS_02330 80502 80161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 81858 80602 gene locus_tag LOCUS_02340 81858 80602 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_02340 83247 81868 gene locus_tag LOCUS_02350 83247 81868 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_02350 84222 83257 gene locus_tag LOCUS_02360 84222 83257 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_02360 84653 84222 gene locus_tag LOCUS_02370 84653 84222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 85660 84638 gene locus_tag LOCUS_02380 gene waaF 85660 84638 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706351.1 protein_id gnl|my_center|LOCUS_02380 85942 85754 gene locus_tag LOCUS_02390 85942 85754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 86880 85960 gene locus_tag LOCUS_02400 86880 85960 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_02400 86971 87417 gene locus_tag LOCUS_02410 86971 87417 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_02410 87417 87977 gene locus_tag LOCUS_02420 87417 87977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 87970 89067 gene locus_tag LOCUS_02430 gene mnmA 87970 89067 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_02430 89644 89057 gene locus_tag LOCUS_02440 89644 89057 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813001.1 protein_id gnl|my_center|LOCUS_02440 90396 89788 gene locus_tag LOCUS_02450 90396 89788 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931185.1 protein_id gnl|my_center|LOCUS_02450 90491 91861 gene locus_tag LOCUS_02460 gene purB 90491 91861 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951328.1 protein_id gnl|my_center|LOCUS_02460 91858 92097 gene locus_tag LOCUS_02470 91858 92097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 92110 92427 gene locus_tag LOCUS_02480 92110 92427 CDS product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 protein_id gnl|my_center|LOCUS_02480 92548 93006 gene locus_tag LOCUS_02490 92548 93006 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263284.1 protein_id gnl|my_center|LOCUS_02490 93088 93783 gene locus_tag LOCUS_02500 93088 93783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 96493 93791 gene locus_tag LOCUS_02510 96493 93791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 97341 96490 gene locus_tag LOCUS_02520 97341 96490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 98496 97549 gene locus_tag LOCUS_02530 gene secF 98496 97549 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_02530 100386 98509 gene locus_tag LOCUS_02540 gene secD 100386 98509 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_02540 100761 100435 gene locus_tag LOCUS_02550 gene yajC 100761 100435 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_02550 101916 100804 gene locus_tag LOCUS_02560 gene tgt 101916 100804 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064322.1 protein_id gnl|my_center|LOCUS_02560 102952 101906 gene locus_tag LOCUS_02570 gene queA 102952 101906 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538740.1 protein_id gnl|my_center|LOCUS_02570 103101 103017 gene locus_tag LOCUS_t00040 103101 103017 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 103537 103145 gene locus_tag LOCUS_02580 103537 103145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 104298 103534 gene locus_tag LOCUS_02590 104298 103534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 106890 104308 gene locus_tag LOCUS_02600 gene cphA 106890 104308 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_02600 109161 106906 gene locus_tag LOCUS_02610 gene cphA 109161 106906 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_02610 109756 109286 gene locus_tag LOCUS_02620 109756 109286 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_02620 112058 109764 gene locus_tag LOCUS_02630 112058 109764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_02630 112187 112762 gene locus_tag LOCUS_02640 112187 112762 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399826.1 protein_id gnl|my_center|LOCUS_02640 112755 113198 gene locus_tag LOCUS_02650 112755 113198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 113198 113734 gene locus_tag LOCUS_02660 113198 113734 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105520.1 protein_id gnl|my_center|LOCUS_02660 114142 113735 gene locus_tag LOCUS_02670 114142 113735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 116071 114263 gene locus_tag LOCUS_02680 116071 114263 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_02680 116335 116081 gene locus_tag LOCUS_02690 116335 116081 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_02690 117152 116565 gene locus_tag LOCUS_02700 gene sodB 117152 116565 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064087.1 protein_id gnl|my_center|LOCUS_02700 118551 117196 gene locus_tag LOCUS_02710 gene xseA 118551 117196 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064088.1 protein_id gnl|my_center|LOCUS_02710 118837 119442 gene locus_tag LOCUS_02720 118837 119442 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_02720 119446 119862 gene locus_tag LOCUS_02730 119446 119862 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_02730 119862 120869 gene locus_tag LOCUS_02740 gene lpxK 119862 120869 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 protein_id gnl|my_center|LOCUS_02740 120850 121026 gene locus_tag LOCUS_02750 120850 121026 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_02750 121023 121796 gene locus_tag LOCUS_02760 gene kdsB 121023 121796 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931124.1 protein_id gnl|my_center|LOCUS_02760 121884 122537 gene locus_tag LOCUS_02770 gene adk 121884 122537 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_02770 122542 123801 gene locus_tag LOCUS_02780 122542 123801 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_02780 124503 123811 gene locus_tag LOCUS_02790 124503 123811 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_02790 124612 126036 gene locus_tag LOCUS_02800 124612 126036 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009958659.1 protein_id gnl|my_center|LOCUS_02800 126564 126052 gene locus_tag LOCUS_02810 126564 126052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 127059 126664 gene locus_tag LOCUS_02820 127059 126664 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_02820 127960 127136 gene locus_tag LOCUS_02830 gene panC 127960 127136 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_02830 128834 128016 gene locus_tag LOCUS_02840 gene panB 128834 128016 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_02840 129194 128835 gene locus_tag LOCUS_02850 129194 128835 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_02850 129667 129191 gene locus_tag LOCUS_02860 129667 129191 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 protein_id gnl|my_center|LOCUS_02860 131010 129667 gene locus_tag LOCUS_02870 gene pcnB 131010 129667 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065010.1 protein_id gnl|my_center|LOCUS_02870 131728 131060 gene locus_tag LOCUS_02880 131728 131060 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_02880 132390 131731 gene locus_tag LOCUS_02890 gene hda 132390 131731 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_02890 133672 132398 gene locus_tag LOCUS_02900 gene tyrS 133672 132398 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225666.1 protein_id gnl|my_center|LOCUS_02900 134890 133829 gene locus_tag LOCUS_02910 134890 133829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 135097 135822 gene locus_tag LOCUS_02920 135097 135822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196610157.1 protein_id gnl|my_center|LOCUS_02920 135834 136424 gene locus_tag LOCUS_02930 135834 136424 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938122.1 protein_id gnl|my_center|LOCUS_02930 136575 137618 gene locus_tag LOCUS_02940 gene purM 136575 137618 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_02940 137769 138890 gene locus_tag LOCUS_02950 137769 138890 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_02950 138890 141925 gene locus_tag LOCUS_02960 138890 141925 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_02960 142014 143129 gene locus_tag LOCUS_02970 142014 143129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 144057 143119 gene locus_tag LOCUS_02980 gene miaA 144057 143119 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527674.1 protein_id gnl|my_center|LOCUS_02980 145886 144054 gene locus_tag LOCUS_02990 gene mutL 145886 144054 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065015.1 protein_id gnl|my_center|LOCUS_02990 145930 146574 gene locus_tag LOCUS_03000 145930 146574 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706279.1 protein_id gnl|my_center|LOCUS_03000 146574 147272 gene locus_tag LOCUS_03010 146574 147272 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814000.1 protein_id gnl|my_center|LOCUS_03010 147274 147921 gene locus_tag LOCUS_03020 gene purN 147274 147921 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522603.1 protein_id gnl|my_center|LOCUS_03020 147928 148923 gene locus_tag LOCUS_03030 147928 148923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 148920 150182 gene locus_tag LOCUS_03040 148920 150182 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_03040 150179 151444 gene locus_tag LOCUS_03050 150179 151444 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 protein_id gnl|my_center|LOCUS_03050 152391 151453 gene locus_tag LOCUS_03060 152391 151453 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_03060 154075 152477 gene locus_tag LOCUS_03070 gene aceB 154075 152477 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531448.1 protein_id gnl|my_center|LOCUS_03070 154202 154534 gene locus_tag LOCUS_03080 154202 154534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 154613 156013 gene locus_tag LOCUS_03090 154613 156013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 156184 157086 gene locus_tag LOCUS_03100 156184 157086 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_03100 158325 157297 gene locus_tag LOCUS_03110 158325 157297 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388793.1 protein_id gnl|my_center|LOCUS_03110 158518 158372 gene locus_tag LOCUS_03120 158518 158372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 159249 158749 gene locus_tag LOCUS_03130 159249 158749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence03 4791 2662 gene locus_tag LOCUS_03140 gene pilJ 4791 2662 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_03140 5343 4831 gene locus_tag LOCUS_03150 5343 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5720 5355 gene locus_tag LOCUS_03160 5720 5355 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_03160 6109 5735 gene locus_tag LOCUS_03170 gene pilG 6109 5735 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551738.1 protein_id gnl|my_center|LOCUS_03170 6336 7217 gene locus_tag LOCUS_03180 6336 7217 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 protein_id gnl|my_center|LOCUS_03180 7204 7839 gene locus_tag LOCUS_03190 gene thiE 7204 7839 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_03190 7836 9116 gene locus_tag LOCUS_03200 gene hemL 7836 9116 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_03200 9120 9458 gene locus_tag LOCUS_03210 gene sugE 9120 9458 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111167.1 protein_id gnl|my_center|LOCUS_03210 10985 9492 gene locus_tag LOCUS_03220 gene mgtE 10985 9492 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085996.1 protein_id gnl|my_center|LOCUS_03220 11710 11015 gene locus_tag LOCUS_03230 gene mtgA 11710 11015 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_03230 12531 11707 gene locus_tag LOCUS_03240 gene aroE 12531 11707 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103018.1 protein_id gnl|my_center|LOCUS_03240 13429 12542 gene locus_tag LOCUS_03250 13429 12542 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567783.1 protein_id gnl|my_center|LOCUS_03250 15330 13426 gene locus_tag LOCUS_03260 15330 13426 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527764.1 protein_id gnl|my_center|LOCUS_03260 15838 15338 gene locus_tag LOCUS_03270 15838 15338 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931244.1 protein_id gnl|my_center|LOCUS_03270 16728 15904 gene locus_tag LOCUS_03280 16728 15904 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_03280 17259 18179 gene locus_tag LOCUS_03290 17259 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 18344 18802 gene locus_tag LOCUS_03300 18344 18802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 19711 18815 gene locus_tag LOCUS_03310 19711 18815 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065020.1 protein_id gnl|my_center|LOCUS_03310 19783 20226 gene locus_tag LOCUS_03320 19783 20226 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_03320 20236 21099 gene locus_tag LOCUS_03330 20236 21099 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_03330 21179 21682 gene locus_tag LOCUS_03340 21179 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 22837 21686 gene locus_tag LOCUS_03350 22837 21686 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_03350 24068 22839 gene locus_tag LOCUS_03360 24068 22839 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_03360 24964 24065 gene locus_tag LOCUS_03370 24964 24065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_03370 26294 24975 gene locus_tag LOCUS_03380 26294 24975 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104318.1 protein_id gnl|my_center|LOCUS_03380 27438 26362 gene locus_tag LOCUS_03390 27438 26362 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_03390 28398 27484 gene locus_tag LOCUS_03400 28398 27484 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104319.1 protein_id gnl|my_center|LOCUS_03400 29192 28410 gene locus_tag LOCUS_03410 29192 28410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_03410 31162 29195 gene locus_tag LOCUS_03420 31162 29195 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_03420 31349 32023 gene locus_tag LOCUS_03430 31349 32023 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088702.1 protein_id gnl|my_center|LOCUS_03430 32484 32020 gene locus_tag LOCUS_03440 32484 32020 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390959.1 protein_id gnl|my_center|LOCUS_03440 33868 32540 gene locus_tag LOCUS_03450 33868 32540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 37073 33855 gene locus_tag LOCUS_03460 37073 33855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 39987 37219 gene locus_tag LOCUS_03470 39987 37219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 37594 37693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40129 41214 gene locus_tag LOCUS_03480 40129 41214 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113336.1 protein_id gnl|my_center|LOCUS_03480 41251 42093 gene locus_tag LOCUS_03490 41251 42093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 42226 42591 gene locus_tag LOCUS_03500 42226 42591 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390083.1 protein_id gnl|my_center|LOCUS_03500 42600 43877 gene locus_tag LOCUS_03510 42600 43877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 43888 44193 gene locus_tag LOCUS_03520 43888 44193 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704966.1 protein_id gnl|my_center|LOCUS_03520 44199 46409 gene locus_tag LOCUS_03530 44199 46409 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_03530 46467 48362 gene locus_tag LOCUS_03540 46467 48362 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704964.1 protein_id gnl|my_center|LOCUS_03540 48380 48931 gene locus_tag LOCUS_03550 48380 48931 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_03550 49020 49625 gene locus_tag LOCUS_03560 gene cheD 49020 49625 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102220.1 protein_id gnl|my_center|LOCUS_03560 49625 50434 gene locus_tag LOCUS_03570 49625 50434 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266627.1 protein_id gnl|my_center|LOCUS_03570 50431 51528 gene locus_tag LOCUS_03580 50431 51528 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_03580 52305 51541 gene locus_tag LOCUS_03590 52305 51541 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_03590 53497 52427 gene locus_tag LOCUS_03600 53497 52427 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_03600 55201 53561 gene locus_tag LOCUS_03610 gene gpmI 55201 53561 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_03610 55389 57956 gene locus_tag LOCUS_03620 55389 57956 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764073.1 protein_id gnl|my_center|LOCUS_03620 57949 60177 gene locus_tag LOCUS_03630 57949 60177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 60174 61490 gene locus_tag LOCUS_03640 60174 61490 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188702.1 protein_id gnl|my_center|LOCUS_03640 61487 62053 gene locus_tag LOCUS_03650 61487 62053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 62062 62706 gene locus_tag LOCUS_03660 62062 62706 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228461.1 protein_id gnl|my_center|LOCUS_03660 62703 63908 gene locus_tag LOCUS_03670 62703 63908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 63905 66145 gene locus_tag LOCUS_03680 63905 66145 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869802.1 protein_id gnl|my_center|LOCUS_03680 66150 67586 gene locus_tag LOCUS_03690 66150 67586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 67586 68587 gene locus_tag LOCUS_03700 gene clpX 67586 68587 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312723.1 protein_id gnl|my_center|LOCUS_03700 69660 68584 gene locus_tag LOCUS_03710 69660 68584 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_03710 71076 69730 gene locus_tag LOCUS_03720 71076 69730 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114319.1 protein_id gnl|my_center|LOCUS_03720 73124 71073 gene locus_tag LOCUS_03730 gene fusA 73124 71073 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_03730 73478 73155 gene locus_tag LOCUS_03740 73478 73155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 77557 73562 gene locus_tag LOCUS_03750 77557 73562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 78123 77581 gene locus_tag LOCUS_03760 78123 77581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 79298 78120 gene locus_tag LOCUS_03770 79298 78120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 79708 79298 gene locus_tag LOCUS_03780 79708 79298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 80403 79741 gene locus_tag LOCUS_03790 80403 79741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 80825 80397 gene locus_tag LOCUS_03800 80825 80397 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 protein_id gnl|my_center|LOCUS_03800 82382 81000 gene locus_tag LOCUS_03810 gene glmU 82382 81000 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190034.1 protein_id gnl|my_center|LOCUS_03810 83997 82531 gene locus_tag LOCUS_03820 83997 82531 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_03820 88634 83997 gene locus_tag LOCUS_03830 88634 83997 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_03830 89920 88823 gene locus_tag LOCUS_03840 gene aroB 89920 88823 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 protein_id gnl|my_center|LOCUS_03840 90399 89905 gene locus_tag LOCUS_03850 90399 89905 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_03850 92719 90521 gene locus_tag LOCUS_03860 gene pilQ 92719 90521 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_03860 93249 92716 gene locus_tag LOCUS_03870 93249 92716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 93917 93258 gene locus_tag LOCUS_03880 93917 93258 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_03880 94483 93920 gene locus_tag LOCUS_03890 94483 93920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 95568 94480 gene locus_tag LOCUS_03900 95568 94480 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_03900 95723 98035 gene locus_tag LOCUS_03910 95723 98035 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_03910 98354 98037 gene locus_tag LOCUS_03920 gene cyaY 98354 98037 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196764.1 protein_id gnl|my_center|LOCUS_03920 98557 99819 gene locus_tag LOCUS_03930 gene lysA 98557 99819 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_03930 99819 100190 gene locus_tag LOCUS_03940 99819 100190 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_03940 101120 100227 gene locus_tag LOCUS_03950 101120 100227 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 protein_id gnl|my_center|LOCUS_03950 102535 101198 gene locus_tag LOCUS_03960 gene hslU 102535 101198 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523084.1 protein_id gnl|my_center|LOCUS_03960 103068 102532 gene locus_tag LOCUS_03970 gene hslV 103068 102532 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_03970 104150 103083 gene locus_tag LOCUS_03980 104150 103083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 104143 104442 gene locus_tag LOCUS_03990 104143 104442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 105222 104458 gene locus_tag LOCUS_04000 105222 104458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 105793 105212 gene locus_tag LOCUS_04010 105793 105212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 106686 105790 gene locus_tag LOCUS_04020 106686 105790 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_04020 108091 106697 gene locus_tag LOCUS_04030 108091 106697 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_04030 108447 108166 gene locus_tag LOCUS_04040 108447 108166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 109650 108457 gene locus_tag LOCUS_04050 109650 108457 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199062.1 protein_id gnl|my_center|LOCUS_04050 109876 109724 gene locus_tag LOCUS_04060 109876 109724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 110891 109995 gene locus_tag LOCUS_04070 gene xerC 110891 109995 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038710.1 protein_id gnl|my_center|LOCUS_04070 111559 110888 gene locus_tag LOCUS_04080 111559 110888 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 protein_id gnl|my_center|LOCUS_04080 112386 111556 gene locus_tag LOCUS_04090 gene dapF 112386 111556 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807183.1 protein_id gnl|my_center|LOCUS_04090 112946 112446 gene locus_tag LOCUS_04100 112946 112446 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_04100 113818 112943 gene locus_tag LOCUS_04110 113818 112943 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807185.1 protein_id gnl|my_center|LOCUS_04110 114666 113815 gene locus_tag LOCUS_04120 114666 113815 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_04120 114825 115988 gene locus_tag LOCUS_04130 gene metK 114825 115988 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_04130 116050 117246 gene locus_tag LOCUS_04140 116050 117246 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_04140 117714 117286 gene locus_tag LOCUS_04150 117714 117286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 118662 117787 gene locus_tag LOCUS_04160 118662 117787 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446869.1 protein_id gnl|my_center|LOCUS_04160 120144 118681 gene locus_tag LOCUS_04170 gene rng 120144 118681 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_04170 120193 121467 gene locus_tag LOCUS_04180 gene yegQ 120193 121467 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_04180 121544 122686 gene locus_tag LOCUS_04190 121544 122686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 124645 122687 gene locus_tag LOCUS_04200 124645 122687 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968769.1 protein_id gnl|my_center|LOCUS_04200 124785 125564 gene locus_tag LOCUS_04210 124785 125564 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_04210 125620 126678 gene locus_tag LOCUS_04220 125620 126678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_04220 127237 126650 gene locus_tag LOCUS_04230 127237 126650 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_04230 127707 127237 gene locus_tag LOCUS_04240 gene rlmH 127707 127237 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_04240 128069 127704 gene locus_tag LOCUS_04250 128069 127704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 128734 128069 gene locus_tag LOCUS_04260 gene nadD 128734 128069 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_04260 129500 128727 gene locus_tag LOCUS_04270 129500 128727 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190835.1 protein_id gnl|my_center|LOCUS_04270 130246 129503 gene locus_tag LOCUS_04280 130246 129503 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706977.1 protein_id gnl|my_center|LOCUS_04280 131182 130256 gene locus_tag LOCUS_04290 131182 130256 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007184747.1 protein_id gnl|my_center|LOCUS_04290 131515 131186 gene locus_tag LOCUS_04300 131515 131186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 132275 131547 gene locus_tag LOCUS_04310 132275 131547 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence04 1047 1574 gene locus_tag LOCUS_04320 gene tsaE 1047 1574 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 protein_id gnl|my_center|LOCUS_04320 1496 2836 gene locus_tag LOCUS_04330 1496 2836 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_04330 3818 2844 gene locus_tag LOCUS_04340 3818 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 4025 4945 gene locus_tag LOCUS_04350 gene ribF 4025 4945 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704352.1 protein_id gnl|my_center|LOCUS_04350 4955 7753 gene locus_tag LOCUS_04360 gene ileS 4955 7753 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541624.1 protein_id gnl|my_center|LOCUS_04360 7746 8228 gene locus_tag LOCUS_04370 gene lspA 7746 8228 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812559.1 protein_id gnl|my_center|LOCUS_04370 8225 8656 gene locus_tag LOCUS_04380 8225 8656 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_04380 8656 9582 gene locus_tag LOCUS_04390 gene ispH 8656 9582 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_04390 10179 9592 gene locus_tag LOCUS_04400 10179 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 10362 10634 gene locus_tag LOCUS_04410 gene rpsT 10362 10634 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_04410 11030 10731 gene locus_tag LOCUS_04420 11030 10731 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 protein_id gnl|my_center|LOCUS_04420 11894 11118 gene locus_tag LOCUS_04430 11894 11118 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_04430 12032 13204 gene locus_tag LOCUS_04440 12032 13204 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064106.1 protein_id gnl|my_center|LOCUS_04440 13207 14127 gene locus_tag LOCUS_04450 gene argF 13207 14127 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_04450 14161 15390 gene locus_tag LOCUS_04460 14161 15390 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_04460 15394 15621 gene locus_tag LOCUS_04470 15394 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 15621 15938 gene locus_tag LOCUS_04480 15621 15938 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_04480 16004 16498 gene locus_tag LOCUS_04490 16004 16498 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_04490 17266 16553 gene locus_tag LOCUS_04500 17266 16553 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_04500 17294 17923 gene locus_tag LOCUS_04510 17294 17923 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_04510 17934 18191 gene locus_tag LOCUS_04520 17934 18191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 18188 18805 gene locus_tag LOCUS_04530 18188 18805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 18844 19767 gene locus_tag LOCUS_04540 18844 19767 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_04540 19791 20972 gene locus_tag LOCUS_04550 19791 20972 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 protein_id gnl|my_center|LOCUS_04550 21169 22581 gene locus_tag LOCUS_04560 21169 22581 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_04560 22597 23544 gene locus_tag LOCUS_04570 22597 23544 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_04570 23684 23556 gene locus_tag LOCUS_04580 23684 23556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 23870 25141 gene locus_tag LOCUS_04590 23870 25141 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_04590 26781 25162 gene locus_tag LOCUS_04600 26781 25162 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_04600 27252 26797 gene locus_tag LOCUS_04610 27252 26797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 27388 27813 gene locus_tag LOCUS_04620 27388 27813 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 protein_id gnl|my_center|LOCUS_04620 27961 31326 gene locus_tag LOCUS_04630 27961 31326 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 protein_id gnl|my_center|LOCUS_04630 31404 33926 gene locus_tag LOCUS_04640 31404 33926 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 protein_id gnl|my_center|LOCUS_04640 33929 34885 gene locus_tag LOCUS_04650 33929 34885 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_04650 34885 36099 gene locus_tag LOCUS_04660 34885 36099 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 protein_id gnl|my_center|LOCUS_04660 40124 36096 gene locus_tag LOCUS_04670 40124 36096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04670 43570 40124 gene locus_tag LOCUS_04680 43570 40124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 44676 43582 gene locus_tag LOCUS_04690 44676 43582 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_04690 45616 44753 gene locus_tag LOCUS_04700 gene rsgA 45616 44753 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_04700 45977 45666 gene locus_tag LOCUS_04710 45977 45666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 47224 45974 gene locus_tag LOCUS_04720 47224 45974 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189931.1 protein_id gnl|my_center|LOCUS_04720 47316 47825 gene locus_tag LOCUS_04730 gene orn 47316 47825 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535917.1 protein_id gnl|my_center|LOCUS_04730 49464 47842 gene locus_tag LOCUS_04740 49464 47842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012729952.1 protein_id gnl|my_center|LOCUS_04740 49757 49530 gene locus_tag LOCUS_04750 gene rpmE 49757 49530 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356285.1 protein_id gnl|my_center|LOCUS_04750 51109 49850 gene locus_tag LOCUS_04760 gene rho 51109 49850 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_04760 51599 51273 gene locus_tag LOCUS_04770 gene trxA 51599 51273 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_04770 52304 51702 gene locus_tag LOCUS_04780 52304 51702 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_04780 54265 52301 gene locus_tag LOCUS_04790 54265 52301 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 protein_id gnl|my_center|LOCUS_04790 54406 55410 gene locus_tag LOCUS_04800 54406 55410 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_04800 55480 56193 gene locus_tag LOCUS_04810 55480 56193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 56197 57480 gene locus_tag LOCUS_04820 56197 57480 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_04820 57592 58278 gene locus_tag LOCUS_04830 57592 58278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 58350 58778 gene locus_tag LOCUS_04840 gene ndk 58350 58778 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_04840 58842 59933 gene locus_tag LOCUS_04850 gene rlmN 58842 59933 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_04850 59930 60745 gene locus_tag LOCUS_04860 gene pilW 59930 60745 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 protein_id gnl|my_center|LOCUS_04860 60745 61686 gene locus_tag LOCUS_04870 60745 61686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 61690 62919 gene locus_tag LOCUS_04880 gene ispG 61690 62919 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036954.1 protein_id gnl|my_center|LOCUS_04880 62916 64205 gene locus_tag LOCUS_04890 gene hisS 62916 64205 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_04890 64211 64849 gene locus_tag LOCUS_04900 64211 64849 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810700.1 protein_id gnl|my_center|LOCUS_04900 64846 65997 gene locus_tag LOCUS_04910 gene bamB 64846 65997 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_04910 65994 67325 gene locus_tag LOCUS_04920 gene der 65994 67325 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_04920 67403 67639 gene locus_tag LOCUS_04930 gene hfq 67403 67639 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_04930 67742 68854 gene locus_tag LOCUS_04940 gene hflX 67742 68854 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198587.1 protein_id gnl|my_center|LOCUS_04940 68871 70205 gene locus_tag LOCUS_04950 gene hflK 68871 70205 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_04950 70205 71074 gene locus_tag LOCUS_04960 gene hflC 70205 71074 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_04960 71083 71268 gene locus_tag LOCUS_04970 71083 71268 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193501.1 protein_id gnl|my_center|LOCUS_04970 71265 72419 gene locus_tag LOCUS_04980 71265 72419 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_04980 72425 73732 gene locus_tag LOCUS_04990 72425 73732 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 protein_id gnl|my_center|LOCUS_04990 74161 73778 gene locus_tag LOCUS_05000 74161 73778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 74469 74385 gene locus_tag LOCUS_t00050 74469 74385 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 74510 76753 gene locus_tag LOCUS_05010 gene rnr 74510 76753 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225208.1 protein_id gnl|my_center|LOCUS_05010 76914 77441 gene locus_tag LOCUS_05020 76914 77441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 77490 78221 gene locus_tag LOCUS_05030 gene rlmB 77490 78221 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812973.1 protein_id gnl|my_center|LOCUS_05030 79701 78286 gene locus_tag LOCUS_05040 79701 78286 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_05040 82814 79698 gene locus_tag LOCUS_05050 82814 79698 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_05050 83948 82824 gene locus_tag LOCUS_05060 83948 82824 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_05060 84094 84711 gene locus_tag LOCUS_05070 gene nalD 84094 84711 CDS product efflux system transcriptional repressor NalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_05070 85605 84718 gene locus_tag LOCUS_05080 gene rarD 85605 84718 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103301.1 protein_id gnl|my_center|LOCUS_05080 86302 85610 gene locus_tag LOCUS_05090 86302 85610 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_05090 86407 88350 gene locus_tag LOCUS_05100 86407 88350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 88929 88357 gene locus_tag LOCUS_05110 88929 88357 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_05110 89045 89308 gene locus_tag LOCUS_05120 89045 89308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 89363 91345 gene locus_tag LOCUS_05130 89363 91345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 91354 91854 gene locus_tag LOCUS_05140 91354 91854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 91964 94570 gene locus_tag LOCUS_05150 91964 94570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 95884 94610 gene locus_tag LOCUS_05160 95884 94610 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_05160 96813 95884 gene locus_tag LOCUS_05170 gene cysD 96813 95884 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_05170 99116 96897 gene locus_tag LOCUS_05180 99116 96897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 100241 99156 gene locus_tag LOCUS_05190 gene trmA 100241 99156 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113457.1 protein_id gnl|my_center|LOCUS_05190 102021 100285 gene locus_tag LOCUS_05200 102021 100285 CDS product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705813.1 protein_id gnl|my_center|LOCUS_05200 102610 102113 gene locus_tag LOCUS_05210 102610 102113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 102822 106637 gene locus_tag LOCUS_05220 102822 106637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 106828 107340 gene locus_tag LOCUS_05230 106828 107340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 109702 107375 gene locus_tag LOCUS_05240 109702 107375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 110717 109812 gene locus_tag LOCUS_05250 110717 109812 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920837.1 protein_id gnl|my_center|LOCUS_05250 112378 110714 gene locus_tag LOCUS_05260 112378 110714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 113253 112534 gene locus_tag LOCUS_05270 113253 112534 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_05270 113770 113258 gene locus_tag LOCUS_05280 113770 113258 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_05280 115461 113770 gene locus_tag LOCUS_05290 115461 113770 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_05290 116266 115481 gene locus_tag LOCUS_05300 116266 115481 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_05300 116342 117283 gene locus_tag LOCUS_05310 116342 117283 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_05310 118100 117315 gene locus_tag LOCUS_05320 118100 117315 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821314.1 protein_id gnl|my_center|LOCUS_05320 118418 118152 gene locus_tag LOCUS_05330 118418 118152 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199503.1 protein_id gnl|my_center|LOCUS_05330 118720 118418 gene locus_tag LOCUS_05340 118720 118418 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 protein_id gnl|my_center|LOCUS_05340 119328 118720 gene locus_tag LOCUS_05350 119328 118720 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_05350 119380 120432 gene locus_tag LOCUS_05360 119380 120432 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085128.1 protein_id gnl|my_center|LOCUS_05360 120468 120815 gene locus_tag LOCUS_05370 120468 120815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 121469 120795 gene locus_tag LOCUS_05380 gene bioD 121469 120795 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_05380 122227 121466 gene locus_tag LOCUS_05390 gene bioC 122227 121466 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113247.1 protein_id gnl|my_center|LOCUS_05390 122933 122220 gene locus_tag LOCUS_05400 gene bioH 122933 122220 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_05400 124096 122930 gene locus_tag LOCUS_05410 gene bioF 124096 122930 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence05 314 2590 gene locus_tag LOCUS_05420 314 2590 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_05420 2665 3273 gene locus_tag LOCUS_05430 2665 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3289 3993 gene locus_tag LOCUS_05440 3289 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 5662 3959 gene locus_tag LOCUS_05450 5662 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 7896 5659 gene locus_tag LOCUS_05460 7896 5659 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093067210.1 protein_id gnl|my_center|LOCUS_05460 9653 7893 gene locus_tag LOCUS_05470 9653 7893 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611323.1 protein_id gnl|my_center|LOCUS_05470 10239 10054 gene locus_tag LOCUS_05480 10239 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 11259 10264 gene locus_tag LOCUS_05490 11259 10264 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308002.1 protein_id gnl|my_center|LOCUS_05490 11510 11385 gene locus_tag LOCUS_05500 11510 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 13308 11674 gene locus_tag LOCUS_05510 13308 11674 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198453.1 protein_id gnl|my_center|LOCUS_05510 14271 13720 gene locus_tag LOCUS_05520 14271 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 14869 14273 gene locus_tag LOCUS_05530 14869 14273 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_05530 16603 14942 gene locus_tag LOCUS_05540 16603 14942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 16794 18692 gene locus_tag LOCUS_05550 gene mnmG 16794 18692 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 protein_id gnl|my_center|LOCUS_05550 18689 19315 gene locus_tag LOCUS_05560 gene rsmG 18689 19315 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 protein_id gnl|my_center|LOCUS_05560 19322 20083 gene locus_tag LOCUS_05570 19322 20083 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_05570 20083 20931 gene locus_tag LOCUS_05580 20083 20931 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_05580 21049 21390 gene locus_tag LOCUS_05590 21049 21390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 21393 22259 gene locus_tag LOCUS_05600 gene atpB 21393 22259 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 protein_id gnl|my_center|LOCUS_05600 22315 22563 gene locus_tag LOCUS_05610 22315 22563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 22605 23075 gene locus_tag LOCUS_05620 22605 23075 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214796.1 protein_id gnl|my_center|LOCUS_05620 23081 23614 gene locus_tag LOCUS_05630 23081 23614 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524508.1 protein_id gnl|my_center|LOCUS_05630 23624 25162 gene locus_tag LOCUS_05640 gene atpA 23624 25162 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_05640 25178 26041 gene locus_tag LOCUS_05650 gene atpG 25178 26041 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817813.1 protein_id gnl|my_center|LOCUS_05650 26079 27482 gene locus_tag LOCUS_05660 gene atpD 26079 27482 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815343.1 protein_id gnl|my_center|LOCUS_05660 27511 27936 gene locus_tag LOCUS_05670 27511 27936 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_05670 28609 28040 gene locus_tag LOCUS_05680 28609 28040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 29352 28615 gene locus_tag LOCUS_05690 gene ubiE 29352 28615 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_05690 29773 29357 gene locus_tag LOCUS_05700 29773 29357 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_05700 31415 29826 gene locus_tag LOCUS_05710 31415 29826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 31852 31412 gene locus_tag LOCUS_05720 31852 31412 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550872.1 protein_id gnl|my_center|LOCUS_05720 35807 31932 gene locus_tag LOCUS_05730 35807 31932 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189879.1 protein_id gnl|my_center|LOCUS_05730 36368 35952 gene locus_tag LOCUS_05740 36368 35952 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462564.1 protein_id gnl|my_center|LOCUS_05740 36406 37938 gene locus_tag LOCUS_05750 gene ilvA 36406 37938 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_05750 38031 38963 gene locus_tag LOCUS_05760 gene cysK 38031 38963 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_05760 38987 40150 gene locus_tag LOCUS_05770 38987 40150 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_05770 40771 40187 gene locus_tag LOCUS_05780 40771 40187 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 protein_id gnl|my_center|LOCUS_05780 40780 42717 gene locus_tag LOCUS_05790 40780 42717 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525894.1 protein_id gnl|my_center|LOCUS_05790 42819 43244 gene locus_tag LOCUS_05800 42819 43244 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_05800 43245 43751 gene locus_tag LOCUS_05810 43245 43751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 43729 44214 gene locus_tag LOCUS_05820 43729 44214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 44211 44975 gene locus_tag LOCUS_05830 44211 44975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 45026 47128 gene locus_tag LOCUS_05840 45026 47128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 47202 48164 gene locus_tag LOCUS_05850 47202 48164 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197236.1 protein_id gnl|my_center|LOCUS_05850 48181 49419 gene locus_tag LOCUS_05860 48181 49419 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525896.1 protein_id gnl|my_center|LOCUS_05860 49581 49384 gene locus_tag LOCUS_05870 49581 49384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 49637 50443 gene locus_tag LOCUS_05880 49637 50443 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_05880 50624 50433 gene locus_tag LOCUS_05890 50624 50433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 50768 51646 gene locus_tag LOCUS_05900 50768 51646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 52813 51656 gene locus_tag LOCUS_05910 52813 51656 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038719.1 protein_id gnl|my_center|LOCUS_05910 52905 54047 gene locus_tag LOCUS_05920 52905 54047 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_05920 54058 57207 gene locus_tag LOCUS_05930 54058 57207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 57270 58145 gene locus_tag LOCUS_05940 gene ttcA 57270 58145 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 protein_id gnl|my_center|LOCUS_05940 58197 59111 gene locus_tag LOCUS_05950 58197 59111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 59532 59176 gene locus_tag LOCUS_05960 59532 59176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042871048.1 protein_id gnl|my_center|LOCUS_05960 60495 59554 gene locus_tag LOCUS_05970 gene hprK 60495 59554 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195225.1 protein_id gnl|my_center|LOCUS_05970 60945 60499 gene locus_tag LOCUS_05980 60945 60499 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929966.1 protein_id gnl|my_center|LOCUS_05980 61320 60997 gene locus_tag LOCUS_05990 gene raiA 61320 60997 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_05990 62790 61336 gene locus_tag LOCUS_06000 62790 61336 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_06000 63551 62817 gene locus_tag LOCUS_06010 gene lptB 63551 62817 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_06010 63982 63548 gene locus_tag LOCUS_06020 gene recX 63982 63548 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006855.1 protein_id gnl|my_center|LOCUS_06020 65012 63975 gene locus_tag LOCUS_06030 gene recA 65012 63975 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 protein_id gnl|my_center|LOCUS_06030 65275 65949 gene locus_tag LOCUS_06040 65275 65949 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114801.1 protein_id gnl|my_center|LOCUS_06040 66001 67500 gene locus_tag LOCUS_06050 66001 67500 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_06050 67557 68615 gene locus_tag LOCUS_06060 67557 68615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 68699 69007 gene locus_tag LOCUS_06070 68699 69007 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_06070 69014 69652 gene locus_tag LOCUS_06080 69014 69652 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_06080 69640 70557 gene locus_tag LOCUS_06090 69640 70557 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810478.1 protein_id gnl|my_center|LOCUS_06090 72670 71015 gene locus_tag LOCUS_06100 72670 71015 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 protein_id gnl|my_center|LOCUS_06100 72778 73563 gene locus_tag LOCUS_06110 72778 73563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818606.1 protein_id gnl|my_center|LOCUS_06110 73574 73891 gene locus_tag LOCUS_06120 73574 73891 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 protein_id gnl|my_center|LOCUS_06120 73888 75663 gene locus_tag LOCUS_06130 gene dsbD 73888 75663 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_06130 75729 75804 gene locus_tag LOCUS_t00060 75729 75804 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 75808 75892 gene locus_tag LOCUS_t00070 75808 75892 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 76733 75954 gene locus_tag LOCUS_06140 76733 75954 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_06140 78123 76777 gene locus_tag LOCUS_06150 gene mnmE 78123 76777 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 protein_id gnl|my_center|LOCUS_06150 79773 78127 gene locus_tag LOCUS_06160 gene yidC 79773 78127 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_06160 80280 80005 gene locus_tag LOCUS_06170 80280 80005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 80528 80394 gene locus_tag LOCUS_06180 80528 80394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 80759 82138 gene locus_tag LOCUS_06190 gene dnaA 80759 82138 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929554.1 protein_id gnl|my_center|LOCUS_06190 82348 83454 gene locus_tag LOCUS_06200 gene dnaN 82348 83454 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_06200 83526 86015 gene locus_tag LOCUS_06210 gene gyrB 83526 86015 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_06210 86490 86047 gene locus_tag LOCUS_06220 86490 86047 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence06 <1 1283 gene locus_tag LOCUS_06230 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963528.1:radical SAM protein 1297 2766 gene locus_tag LOCUS_06240 1297 2766 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_06240 2763 3401 gene locus_tag LOCUS_06250 2763 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3723 5165 gene locus_tag LOCUS_06260 3723 5165 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_06260 5162 5977 gene locus_tag LOCUS_06270 5162 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5981 9358 gene locus_tag LOCUS_06280 5981 9358 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_06280 9355 10533 gene locus_tag LOCUS_06290 9355 10533 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_06290 10565 10936 gene locus_tag LOCUS_06300 10565 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 10987 12816 gene locus_tag LOCUS_06310 10987 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 12813 13139 gene locus_tag LOCUS_06320 12813 13139 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_06320 13221 15593 gene locus_tag LOCUS_06330 gene parC 13221 15593 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186334.1 protein_id gnl|my_center|LOCUS_06330 16255 15704 gene locus_tag LOCUS_06340 16255 15704 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_06340 16795 16397 gene locus_tag LOCUS_06350 16795 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 17099 17023 gene locus_tag LOCUS_t00080 17099 17023 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17227 17151 gene locus_tag LOCUS_t00090 17227 17151 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17367 19031 gene locus_tag LOCUS_06360 gene ettA 17367 19031 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_06360 19290 20117 gene locus_tag LOCUS_06370 19290 20117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 20114 20650 gene locus_tag LOCUS_06380 20114 20650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 21074 20796 gene locus_tag LOCUS_06390 21074 20796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 21248 22024 gene locus_tag LOCUS_06400 21248 22024 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812386.1 protein_id gnl|my_center|LOCUS_06400 22062 23504 gene locus_tag LOCUS_06410 gene gtfA 22062 23504 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_06410 23525 25435 gene locus_tag LOCUS_06420 23525 25435 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096642.1 protein_id gnl|my_center|LOCUS_06420 26192 25482 gene locus_tag LOCUS_06430 26192 25482 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_06430 26349 27035 gene locus_tag LOCUS_06440 26349 27035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 27542 27045 gene locus_tag LOCUS_06450 27542 27045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 28137 27586 gene locus_tag LOCUS_06460 28137 27586 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_06460 28276 29292 gene locus_tag LOCUS_06470 28276 29292 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072427.1 protein_id gnl|my_center|LOCUS_06470 29502 29317 gene locus_tag LOCUS_06480 29502 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 31697 29505 gene locus_tag LOCUS_06490 31697 29505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 32216 31815 gene locus_tag LOCUS_06500 32216 31815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 32461 32246 gene locus_tag LOCUS_06510 32461 32246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 32872 32971 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34424 33204 gene locus_tag LOCUS_06520 34424 33204 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_06520 34824 34417 gene locus_tag LOCUS_06530 34824 34417 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_06530 34876 36129 gene locus_tag LOCUS_06540 34876 36129 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_06540 36174 36701 gene locus_tag LOCUS_06550 36174 36701 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_06550 37567 37124 gene locus_tag LOCUS_06560 37567 37124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 37686 40001 gene locus_tag LOCUS_06570 37686 40001 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_06570 40145 42403 gene locus_tag LOCUS_06580 40145 42403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 42425 42790 gene locus_tag LOCUS_06590 42425 42790 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967551.1 protein_id gnl|my_center|LOCUS_06590 42787 43668 gene locus_tag LOCUS_06600 gene hslO 42787 43668 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_06600 43665 45014 gene locus_tag LOCUS_06610 43665 45014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 45553 45035 gene locus_tag LOCUS_06620 45553 45035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 46069 45557 gene locus_tag LOCUS_06630 46069 45557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 47637 46216 gene locus_tag LOCUS_06640 47637 46216 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 protein_id gnl|my_center|LOCUS_06640 48922 47600 gene locus_tag LOCUS_06650 gene rimO 48922 47600 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705268.1 protein_id gnl|my_center|LOCUS_06650 49302 49030 gene locus_tag LOCUS_06660 49302 49030 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723777.1 protein_id gnl|my_center|LOCUS_06660 49992 49312 gene locus_tag LOCUS_06670 49992 49312 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561393.1 protein_id gnl|my_center|LOCUS_06670 50607 50002 gene locus_tag LOCUS_06680 50607 50002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 51706 50609 gene locus_tag LOCUS_06690 51706 50609 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_06690 53229 51703 gene locus_tag LOCUS_06700 gene rsxC 53229 51703 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_06700 53778 53251 gene locus_tag LOCUS_06710 53778 53251 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339116.1 protein_id gnl|my_center|LOCUS_06710 54369 53791 gene locus_tag LOCUS_06720 gene rsxA 54369 53791 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 protein_id gnl|my_center|LOCUS_06720 54651 56183 gene locus_tag LOCUS_06730 54651 56183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 56203 57822 gene locus_tag LOCUS_06740 gene nifA 56203 57822 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577822.1 protein_id gnl|my_center|LOCUS_06740 59277 57892 gene locus_tag LOCUS_06750 59277 57892 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039554.1 protein_id gnl|my_center|LOCUS_06750 59485 59814 gene locus_tag LOCUS_06760 59485 59814 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_06760 59801 60091 gene locus_tag LOCUS_06770 59801 60091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 60095 60628 gene locus_tag LOCUS_06780 gene fldA 60095 60628 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367697.1 protein_id gnl|my_center|LOCUS_06780 60752 61267 gene locus_tag LOCUS_06790 60752 61267 CDS product DUF2478 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390969.1 protein_id gnl|my_center|LOCUS_06790 61687 61256 gene locus_tag LOCUS_06800 61687 61256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 61873 62691 gene locus_tag LOCUS_06810 61873 62691 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190826.1 protein_id gnl|my_center|LOCUS_06810 62713 63459 gene locus_tag LOCUS_06820 gene modA 62713 63459 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_06820 63479 64156 gene locus_tag LOCUS_06830 gene modB 63479 64156 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_06830 64158 65228 gene locus_tag LOCUS_06840 gene modC 64158 65228 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_06840 65378 66454 gene locus_tag LOCUS_06850 65378 66454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 66479 69562 gene locus_tag LOCUS_06860 66479 69562 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_06860 69559 69861 gene locus_tag LOCUS_06870 69559 69861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 69858 71129 gene locus_tag LOCUS_06880 69858 71129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 73427 71175 gene locus_tag LOCUS_06890 73427 71175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 74096 73707 gene locus_tag LOCUS_06900 74096 73707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 74405 74115 gene locus_tag LOCUS_06910 74405 74115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 74867 75268 gene locus_tag LOCUS_06920 74867 75268 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_06920 75270 75731 gene locus_tag LOCUS_06930 75270 75731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 75737 76342 gene locus_tag LOCUS_06940 75737 76342 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337790.1 protein_id gnl|my_center|LOCUS_06940 76355 77011 gene locus_tag LOCUS_06950 gene pmrA 76355 77011 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_06950 77008 78360 gene locus_tag LOCUS_06960 77008 78360 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_06960 78433 79401 gene locus_tag LOCUS_06970 78433 79401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 79595 79398 gene locus_tag LOCUS_06980 79595 79398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 79616 81292 gene locus_tag LOCUS_06990 79616 81292 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_06990 81326 82180 gene locus_tag LOCUS_07000 gene rlmA 81326 82180 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010103.1 protein_id gnl|my_center|LOCUS_07000 82215 82928 gene locus_tag LOCUS_07010 82215 82928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206308.1 protein_id gnl|my_center|LOCUS_07010 85643 82920 gene locus_tag LOCUS_07020 85643 82920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence07 716 555 gene locus_tag LOCUS_07030 716 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1092 2276 gene locus_tag LOCUS_07040 gene sbcD 1092 2276 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 protein_id gnl|my_center|LOCUS_07040 2273 5779 gene locus_tag LOCUS_07050 2273 5779 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208688.1 protein_id gnl|my_center|LOCUS_07050 8431 5789 gene locus_tag LOCUS_07060 8431 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 8783 8589 gene locus_tag LOCUS_07070 8783 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9906 9025 gene locus_tag LOCUS_07080 gene carH 9906 9025 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_07080 11203 10460 gene locus_tag LOCUS_07090 11203 10460 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_07090 11988 11248 gene locus_tag LOCUS_07100 11988 11248 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525015.1 protein_id gnl|my_center|LOCUS_07100 13694 12009 gene locus_tag LOCUS_07110 gene phaC 13694 12009 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086513.1 protein_id gnl|my_center|LOCUS_07110 14796 14029 gene locus_tag LOCUS_07120 14796 14029 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_07120 15567 14827 gene locus_tag LOCUS_07130 gene pgeF 15567 14827 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_07130 16516 15560 gene locus_tag LOCUS_07140 gene rluD 16516 15560 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079108.1 protein_id gnl|my_center|LOCUS_07140 16515 17339 gene locus_tag LOCUS_07150 16515 17339 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813594.1 protein_id gnl|my_center|LOCUS_07150 19768 17405 gene locus_tag LOCUS_07160 19768 17405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 20196 19768 gene locus_tag LOCUS_07170 20196 19768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 21526 20180 gene locus_tag LOCUS_07180 gene rmuC 21526 20180 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_07180 24371 21531 gene locus_tag LOCUS_07190 24371 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 24370 24861 gene locus_tag LOCUS_07200 24370 24861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 24893 25282 gene locus_tag LOCUS_07210 24893 25282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 26038 25283 gene locus_tag LOCUS_07220 gene gloB 26038 25283 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087949.1 protein_id gnl|my_center|LOCUS_07220 26067 26783 gene locus_tag LOCUS_07230 26067 26783 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_07230 26773 27219 gene locus_tag LOCUS_07240 gene rnhA 26773 27219 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_07240 27231 27965 gene locus_tag LOCUS_07250 gene dnaQ 27231 27965 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064948.1 protein_id gnl|my_center|LOCUS_07250 27962 29275 gene locus_tag LOCUS_07260 27962 29275 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_07260 32543 29283 gene locus_tag LOCUS_07270 32543 29283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 32704 33963 gene locus_tag LOCUS_07280 32704 33963 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_07280 33960 34493 gene locus_tag LOCUS_07290 33960 34493 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_07290 34606 37518 gene locus_tag LOCUS_07300 34606 37518 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338646.1 protein_id gnl|my_center|LOCUS_07300 37520 37861 gene locus_tag LOCUS_07310 37520 37861 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721306.1 protein_id gnl|my_center|LOCUS_07310 37858 39387 gene locus_tag LOCUS_07320 37858 39387 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338647.1 protein_id gnl|my_center|LOCUS_07320 39387 39911 gene locus_tag LOCUS_07330 39387 39911 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721310.1 protein_id gnl|my_center|LOCUS_07330 39908 40177 gene locus_tag LOCUS_07340 39908 40177 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721312.1 protein_id gnl|my_center|LOCUS_07340 40188 40556 gene locus_tag LOCUS_07350 40188 40556 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721315.1 protein_id gnl|my_center|LOCUS_07350 40864 43383 gene locus_tag LOCUS_07360 40864 43383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 43386 44513 gene locus_tag LOCUS_07370 43386 44513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 44510 45166 gene locus_tag LOCUS_07380 44510 45166 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_07380 45318 46142 gene locus_tag LOCUS_07390 45318 46142 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_07390 46888 46145 gene locus_tag LOCUS_07400 gene ubiE 46888 46145 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385128.1 protein_id gnl|my_center|LOCUS_07400 47382 46891 gene locus_tag LOCUS_07410 47382 46891 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_07410 48206 47379 gene locus_tag LOCUS_07420 48206 47379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 48695 48207 gene locus_tag LOCUS_07430 48695 48207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 49564 48698 gene locus_tag LOCUS_07440 49564 48698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 50565 49600 gene locus_tag LOCUS_07450 gene napH 50565 49600 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925622.1 protein_id gnl|my_center|LOCUS_07450 51380 50562 gene locus_tag LOCUS_07460 gene napG 51380 50562 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091295.1 protein_id gnl|my_center|LOCUS_07460 52777 51413 gene locus_tag LOCUS_07470 52777 51413 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 protein_id gnl|my_center|LOCUS_07470 53759 52782 gene locus_tag LOCUS_07480 53759 52782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 54573 53848 gene locus_tag LOCUS_07490 54573 53848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 54986 54678 gene locus_tag LOCUS_07500 54986 54678 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939104.1 protein_id gnl|my_center|LOCUS_07500 57360 55069 gene locus_tag LOCUS_07510 gene nosZ 57360 55069 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_07510 57587 58042 gene locus_tag LOCUS_07520 57587 58042 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707377.1 protein_id gnl|my_center|LOCUS_07520 58114 58449 gene locus_tag LOCUS_07530 58114 58449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 58542 59219 gene locus_tag LOCUS_07540 58542 59219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 59219 59629 gene locus_tag LOCUS_07550 59219 59629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 59632 60237 gene locus_tag LOCUS_07560 59632 60237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 60282 60920 gene locus_tag LOCUS_07570 60282 60920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 61105 61734 gene locus_tag LOCUS_07580 61105 61734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 61734 62633 gene locus_tag LOCUS_07590 61734 62633 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_07590 63242 62778 gene locus_tag LOCUS_07600 63242 62778 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707377.1 protein_id gnl|my_center|LOCUS_07600 63857 63264 gene locus_tag LOCUS_07610 63857 63264 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_07610 64323 63850 gene locus_tag LOCUS_07620 64323 63850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 64537 65697 gene locus_tag LOCUS_07630 64537 65697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 65709 68474 gene locus_tag LOCUS_07640 65709 68474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07640 68550 69044 gene locus_tag LOCUS_07650 68550 69044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 71284 69062 gene locus_tag LOCUS_07660 71284 69062 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065079.1 protein_id gnl|my_center|LOCUS_07660 72181 71453 gene locus_tag LOCUS_07670 72181 71453 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 protein_id gnl|my_center|LOCUS_07670 72858 72178 gene locus_tag LOCUS_07680 gene gltK 72858 72178 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194080.1 protein_id gnl|my_center|LOCUS_07680 73595 72855 gene locus_tag LOCUS_07690 73595 72855 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194293.1 protein_id gnl|my_center|LOCUS_07690 74534 73650 gene locus_tag LOCUS_07700 74534 73650 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 protein_id gnl|my_center|LOCUS_07700 74752 75642 gene locus_tag LOCUS_07710 74752 75642 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_07710 75646 76407 gene locus_tag LOCUS_07720 75646 76407 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_07720 77644 76415 gene locus_tag LOCUS_07730 77644 76415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_07730 78497 77736 gene locus_tag LOCUS_07740 78497 77736 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930761.1 protein_id gnl|my_center|LOCUS_07740 79345 78494 gene locus_tag LOCUS_07750 79345 78494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 <80936 79374 gene locus_tag LOCUS_07760 <80936 79374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037274.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence08 1838 882 gene locus_tag LOCUS_07770 gene glyQ 1838 882 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_07770 2228 2938 gene locus_tag LOCUS_07780 2228 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3025 3579 gene locus_tag LOCUS_07790 gene msrA 3025 3579 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_07790 4425 3592 gene locus_tag LOCUS_07800 4425 3592 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132575.1 protein_id gnl|my_center|LOCUS_07800 4491 5435 gene locus_tag LOCUS_07810 4491 5435 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_07810 6909 5443 gene locus_tag LOCUS_07820 gene lnt 6909 5443 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064331.1 protein_id gnl|my_center|LOCUS_07820 7744 6896 gene locus_tag LOCUS_07830 7744 6896 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_07830 8196 7750 gene locus_tag LOCUS_07840 gene ybeY 8196 7750 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 protein_id gnl|my_center|LOCUS_07840 9163 8171 gene locus_tag LOCUS_07850 9163 8171 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 protein_id gnl|my_center|LOCUS_07850 10511 9144 gene locus_tag LOCUS_07860 gene miaB 10511 9144 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064327.1 protein_id gnl|my_center|LOCUS_07860 10593 10669 gene locus_tag LOCUS_t00100 10593 10669 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10870 10794 gene locus_tag LOCUS_t00110 10870 10794 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12872 10881 gene locus_tag LOCUS_07870 gene rpoD 12872 10881 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190933.1 protein_id gnl|my_center|LOCUS_07870 14649 12919 gene locus_tag LOCUS_07880 gene dnaG 14649 12919 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940969.1 protein_id gnl|my_center|LOCUS_07880 15145 14699 gene locus_tag LOCUS_07890 15145 14699 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_07890 15480 15268 gene locus_tag LOCUS_07900 gene rpsU 15480 15268 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 protein_id gnl|my_center|LOCUS_07900 15610 16656 gene locus_tag LOCUS_07910 gene tsaD 15610 16656 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_07910 17379 16783 gene locus_tag LOCUS_07920 gene plsY 17379 16783 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_07920 17374 17796 gene locus_tag LOCUS_07930 gene folB 17374 17796 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212199.1 protein_id gnl|my_center|LOCUS_07930 18282 17842 gene locus_tag LOCUS_07940 18282 17842 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_07940 18959 18468 gene locus_tag LOCUS_07950 gene ybaK 18959 18468 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_07950 20083 18986 gene locus_tag LOCUS_07960 20083 18986 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193389.1 protein_id gnl|my_center|LOCUS_07960 21318 20086 gene locus_tag LOCUS_07970 21318 20086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967751.1 protein_id gnl|my_center|LOCUS_07970 22290 21382 gene locus_tag LOCUS_07980 gene xerD 22290 21382 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535956.1 protein_id gnl|my_center|LOCUS_07980 22789 22268 gene locus_tag LOCUS_07990 22789 22268 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_07990 23999 22824 gene locus_tag LOCUS_08000 23999 22824 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_08000 24462 24004 gene locus_tag LOCUS_08010 24462 24004 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121698.1 protein_id gnl|my_center|LOCUS_08010 25752 24496 gene locus_tag LOCUS_08020 25752 24496 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557250.1 protein_id gnl|my_center|LOCUS_08020 25866 26114 gene locus_tag LOCUS_08030 25866 26114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 27123 26116 gene locus_tag LOCUS_08040 gene holA 27123 26116 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_08040 27647 27123 gene locus_tag LOCUS_08050 27647 27123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 30270 27658 gene locus_tag LOCUS_08060 gene leuS 30270 27658 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456399.1 protein_id gnl|my_center|LOCUS_08060 30336 31223 gene locus_tag LOCUS_08070 30336 31223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 31575 31225 gene locus_tag LOCUS_08080 31575 31225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 31817 33976 gene locus_tag LOCUS_08090 31817 33976 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 protein_id gnl|my_center|LOCUS_08090 34097 35071 gene locus_tag LOCUS_08100 34097 35071 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_08100 35082 36401 gene locus_tag LOCUS_08110 35082 36401 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116611749.1 protein_id gnl|my_center|LOCUS_08110 36398 37030 gene locus_tag LOCUS_08120 36398 37030 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_08120 38036 37134 gene locus_tag LOCUS_08130 38036 37134 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 protein_id gnl|my_center|LOCUS_08130 38141 38848 gene locus_tag LOCUS_08140 38141 38848 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_08140 38870 39433 gene locus_tag LOCUS_08150 38870 39433 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179442.1 protein_id gnl|my_center|LOCUS_08150 39506 40306 gene locus_tag LOCUS_08160 39506 40306 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_08160 40844 40284 gene locus_tag LOCUS_08170 40844 40284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 41980 40841 gene locus_tag LOCUS_08180 41980 40841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 42791 41994 gene locus_tag LOCUS_08190 42791 41994 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_08190 42880 46344 gene locus_tag LOCUS_08200 gene dnaE 42880 46344 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_08200 47913 46396 gene locus_tag LOCUS_08210 47913 46396 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246699.1 protein_id gnl|my_center|LOCUS_08210 48587 48006 gene locus_tag LOCUS_08220 48587 48006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 50446 48755 gene locus_tag LOCUS_08230 gene sulP 50446 48755 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_08230 50552 50749 gene locus_tag LOCUS_08240 50552 50749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 51097 50756 gene locus_tag LOCUS_08250 51097 50756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 53605 51500 gene locus_tag LOCUS_08260 gene metG 53605 51500 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203868.1 protein_id gnl|my_center|LOCUS_08260 53774 54865 gene locus_tag LOCUS_08270 gene apbC 53774 54865 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_08270 54936 55502 gene locus_tag LOCUS_08280 gene dcd 54936 55502 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687863.1 protein_id gnl|my_center|LOCUS_08280 55574 57802 gene locus_tag LOCUS_08290 55574 57802 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 protein_id gnl|my_center|LOCUS_08290 58279 57803 gene locus_tag LOCUS_08300 58279 57803 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218701.1 protein_id gnl|my_center|LOCUS_08300 59877 58282 gene locus_tag LOCUS_08310 gene pgi 59877 58282 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_08310 60714 59881 gene locus_tag LOCUS_08320 60714 59881 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976151.1 protein_id gnl|my_center|LOCUS_08320 60840 62381 gene locus_tag LOCUS_08330 60840 62381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 62756 64129 gene locus_tag LOCUS_08340 62756 64129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 64699 64109 gene locus_tag LOCUS_08350 gene mog 64699 64109 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522377.1 protein_id gnl|my_center|LOCUS_08350 65150 64686 gene locus_tag LOCUS_08360 gene yjgA 65150 64686 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225402.1 protein_id gnl|my_center|LOCUS_08360 65181 66623 gene locus_tag LOCUS_08370 gene pmbA 65181 66623 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_08370 66726 67865 gene locus_tag LOCUS_08380 66726 67865 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence09 <1 2711 gene locus_tag LOCUS_08390 <1 2711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463958.1:bifunctional diguanylate cyclase/phosphodiesterase 2821 3282 gene locus_tag LOCUS_08400 2821 3282 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_08400 3726 3944 gene locus_tag LOCUS_08410 3726 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 6452 4077 gene locus_tag LOCUS_08420 gene ppsA 6452 4077 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_08420 7258 6491 gene locus_tag LOCUS_08430 7258 6491 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_08430 7434 8222 gene locus_tag LOCUS_08440 7434 8222 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222289.1 protein_id gnl|my_center|LOCUS_08440 8219 8899 gene locus_tag LOCUS_08450 8219 8899 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939069.1 protein_id gnl|my_center|LOCUS_08450 8896 10326 gene locus_tag LOCUS_08460 8896 10326 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_08460 10426 13245 gene locus_tag LOCUS_08470 10426 13245 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389164.1 protein_id gnl|my_center|LOCUS_08470 13323 13769 gene locus_tag LOCUS_08480 13323 13769 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194548.1 protein_id gnl|my_center|LOCUS_08480 13769 16531 gene locus_tag LOCUS_08490 gene ppc 13769 16531 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_08490 16544 17362 gene locus_tag LOCUS_08500 16544 17362 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063753.1 protein_id gnl|my_center|LOCUS_08500 18167 17397 gene locus_tag LOCUS_08510 18167 17397 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063752.1 protein_id gnl|my_center|LOCUS_08510 18754 18164 gene locus_tag LOCUS_08520 gene rnhB 18754 18164 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095664.1 protein_id gnl|my_center|LOCUS_08520 19890 18742 gene locus_tag LOCUS_08530 gene lpxB 19890 18742 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192608.1 protein_id gnl|my_center|LOCUS_08530 20662 19892 gene locus_tag LOCUS_08540 gene lpxA 20662 19892 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 protein_id gnl|my_center|LOCUS_08540 21101 20664 gene locus_tag LOCUS_08550 gene fabZ 21101 20664 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_08550 22144 21125 gene locus_tag LOCUS_08560 gene lpxD 22144 21125 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521195.1 protein_id gnl|my_center|LOCUS_08560 22656 22150 gene locus_tag LOCUS_08570 22656 22150 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_08570 24954 22669 gene locus_tag LOCUS_08580 gene bamA 24954 22669 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_08580 26327 24960 gene locus_tag LOCUS_08590 gene rseP 26327 24960 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 protein_id gnl|my_center|LOCUS_08590 27514 26324 gene locus_tag LOCUS_08600 gene ispC 27514 26324 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_08600 28347 27511 gene locus_tag LOCUS_08610 28347 27511 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 protein_id gnl|my_center|LOCUS_08610 28999 28340 gene locus_tag LOCUS_08620 gene uppS 28999 28340 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_08620 29679 29122 gene locus_tag LOCUS_08630 gene frr 29679 29122 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_08630 30407 29691 gene locus_tag LOCUS_08640 gene pyrH 30407 29691 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 protein_id gnl|my_center|LOCUS_08640 31325 30426 gene locus_tag LOCUS_08650 gene tsf 31325 30426 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_08650 32131 31385 gene locus_tag LOCUS_08660 gene rpsB 32131 31385 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_08660 33232 32321 gene locus_tag LOCUS_08670 gene rfbD 33232 32321 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_08670 33347 34147 gene locus_tag LOCUS_08680 gene map 33347 34147 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_08680 34147 36705 gene locus_tag LOCUS_08690 34147 36705 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811808.1 protein_id gnl|my_center|LOCUS_08690 37039 36710 gene locus_tag LOCUS_08700 37039 36710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 37874 37083 gene locus_tag LOCUS_08710 37874 37083 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_08710 38577 37876 gene locus_tag LOCUS_08720 38577 37876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 39122 38574 gene locus_tag LOCUS_08730 39122 38574 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694420.1 protein_id gnl|my_center|LOCUS_08730 39991 39122 gene locus_tag LOCUS_08740 gene galU 39991 39122 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_08740 42045 39988 gene locus_tag LOCUS_08750 gene ligA 42045 39988 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_08750 43271 42045 gene locus_tag LOCUS_08760 43271 42045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 46963 43268 gene locus_tag LOCUS_08770 gene smc 46963 43268 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198894.1 protein_id gnl|my_center|LOCUS_08770 46865 47338 gene locus_tag LOCUS_08780 46865 47338 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_08780 47378 47806 gene locus_tag LOCUS_08790 47378 47806 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072206.1 protein_id gnl|my_center|LOCUS_08790 47889 49079 gene locus_tag LOCUS_08800 gene dapC 47889 49079 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_08800 49094 49909 gene locus_tag LOCUS_08810 gene dapD 49094 49909 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118664.1 protein_id gnl|my_center|LOCUS_08810 49998 51185 gene locus_tag LOCUS_08820 49998 51185 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439300.1 protein_id gnl|my_center|LOCUS_08820 51186 52352 gene locus_tag LOCUS_08830 gene dapE 51186 52352 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688278.1 protein_id gnl|my_center|LOCUS_08830 52374 53270 gene locus_tag LOCUS_08840 gene prmB 52374 53270 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_08840 53332 54198 gene locus_tag LOCUS_08850 53332 54198 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537097.1 protein_id gnl|my_center|LOCUS_08850 55454 54228 gene locus_tag LOCUS_08860 55454 54228 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_08860 55856 55638 gene locus_tag LOCUS_08870 55856 55638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 55785 56423 gene locus_tag LOCUS_08880 55785 56423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 57922 56453 gene locus_tag LOCUS_08890 57922 56453 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207211.1 protein_id gnl|my_center|LOCUS_08890 58287 58547 gene locus_tag LOCUS_08900 58287 58547 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_08900 58544 58981 gene locus_tag LOCUS_08910 58544 58981 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_08910 59366 59291 gene locus_tag LOCUS_t00120 59366 59291 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 59521 60828 gene locus_tag LOCUS_08920 gene tig 59521 60828 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521257.1 protein_id gnl|my_center|LOCUS_08920 60944 61573 gene locus_tag LOCUS_08930 gene clpP 60944 61573 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688955.1 protein_id gnl|my_center|LOCUS_08930 61588 62850 gene locus_tag LOCUS_08940 gene clpX 61588 62850 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_08940 62918 65332 gene locus_tag LOCUS_08950 gene lon 62918 65332 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_08950 65493 65765 gene locus_tag LOCUS_08960 gene hupB 65493 65765 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_08960 66579 65797 gene locus_tag LOCUS_08970 gene trmJ 66579 65797 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771034.1 protein_id gnl|my_center|LOCUS_08970 66646 67458 gene locus_tag LOCUS_08980 66646 67458 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence10 699 2213 gene locus_tag LOCUS_08990 699 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2267 2899 gene locus_tag LOCUS_09000 2267 2899 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 protein_id gnl|my_center|LOCUS_09000 2960 3613 gene locus_tag LOCUS_09010 2960 3613 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185654.1 protein_id gnl|my_center|LOCUS_09010 3613 3936 gene locus_tag LOCUS_09020 3613 3936 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_09020 3944 5269 gene locus_tag LOCUS_09030 3944 5269 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_09030 6494 5235 gene locus_tag LOCUS_09040 gene waaA 6494 5235 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532247.1 protein_id gnl|my_center|LOCUS_09040 7450 6494 gene locus_tag LOCUS_09050 gene waaC 7450 6494 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530067.1 protein_id gnl|my_center|LOCUS_09050 7491 8261 gene locus_tag LOCUS_09060 7491 8261 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_09060 8292 9299 gene locus_tag LOCUS_09070 8292 9299 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_09070 9310 11133 gene locus_tag LOCUS_09080 gene glmS 9310 11133 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_09080 11366 12766 gene locus_tag LOCUS_09090 gene ahcY 11366 12766 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807196.1 protein_id gnl|my_center|LOCUS_09090 12824 13480 gene locus_tag LOCUS_09100 12824 13480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09100 13477 14361 gene locus_tag LOCUS_09110 13477 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 14378 15199 gene locus_tag LOCUS_09120 14378 15199 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125767.1 protein_id gnl|my_center|LOCUS_09120 15196 16020 gene locus_tag LOCUS_09130 gene metF 15196 16020 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_09130 16060 16890 gene locus_tag LOCUS_09140 16060 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 16997 17476 gene locus_tag LOCUS_09150 gene aroQ 16997 17476 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 protein_id gnl|my_center|LOCUS_09150 17532 17990 gene locus_tag LOCUS_09160 gene accB 17532 17990 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_09160 17998 19356 gene locus_tag LOCUS_09170 gene accC 17998 19356 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194420.1 protein_id gnl|my_center|LOCUS_09170 19358 20248 gene locus_tag LOCUS_09180 gene prmA 19358 20248 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931932.1 protein_id gnl|my_center|LOCUS_09180 20436 20535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20776 20591 gene locus_tag LOCUS_09190 20776 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 20694 21425 gene locus_tag LOCUS_09200 20694 21425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 21432 22370 gene locus_tag LOCUS_09210 21432 22370 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_09210 22373 22819 gene locus_tag LOCUS_09220 22373 22819 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210054.1 protein_id gnl|my_center|LOCUS_09220 22897 23661 gene locus_tag LOCUS_09230 22897 23661 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_09230 23739 24452 gene locus_tag LOCUS_09240 23739 24452 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09240 25203 24373 gene locus_tag LOCUS_09250 25203 24373 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 protein_id gnl|my_center|LOCUS_09250 25399 27138 gene locus_tag LOCUS_09260 gene aprD 25399 27138 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_09260 27166 28557 gene locus_tag LOCUS_09270 27166 28557 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_09270 28559 29929 gene locus_tag LOCUS_09280 28559 29929 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_09280 30040 31896 gene locus_tag LOCUS_09290 30040 31896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 32288 32064 gene locus_tag LOCUS_09300 32288 32064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 32531 32313 gene locus_tag LOCUS_09310 32531 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 32631 33284 gene locus_tag LOCUS_09320 32631 33284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 33374 34966 gene locus_tag LOCUS_09330 33374 34966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 34991 38752 gene locus_tag LOCUS_09340 34991 38752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 38757 39470 gene locus_tag LOCUS_09350 38757 39470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 39536 44563 gene locus_tag LOCUS_09360 39536 44563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 44673 47621 gene locus_tag LOCUS_09370 44673 47621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 47820 48020 gene locus_tag LOCUS_09380 47820 48020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 48098 48787 gene locus_tag LOCUS_09390 gene ccmA 48098 48787 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895172.1 protein_id gnl|my_center|LOCUS_09390 48797 49465 gene locus_tag LOCUS_09400 gene ccmB 48797 49465 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 protein_id gnl|my_center|LOCUS_09400 49462 50208 gene locus_tag LOCUS_09410 gene ccmC 49462 50208 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_09410 50205 50393 gene locus_tag LOCUS_09420 gene ccmD 50205 50393 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545344.1 protein_id gnl|my_center|LOCUS_09420 50390 50875 gene locus_tag LOCUS_09430 50390 50875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 50878 52869 gene locus_tag LOCUS_09440 50878 52869 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_09440 52866 53450 gene locus_tag LOCUS_09450 52866 53450 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036835.1 protein_id gnl|my_center|LOCUS_09450 53447 53926 gene locus_tag LOCUS_09460 gene ccmH 53447 53926 CDS product cytochrome c maturation protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114292.1 protein_id gnl|my_center|LOCUS_09460 53923 54774 gene locus_tag LOCUS_09470 53923 54774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 55096 54827 gene locus_tag LOCUS_09480 55096 54827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 57195 55183 gene locus_tag LOCUS_09490 57195 55183 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_09490 58831 57296 gene locus_tag LOCUS_09500 58831 57296 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_09500 59877 58867 gene locus_tag LOCUS_09510 gene meaB 59877 58867 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_09510 62034 59884 gene locus_tag LOCUS_09520 gene scpA 62034 59884 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_09520 62198 62863 gene locus_tag LOCUS_09530 62198 62863 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930715.1 protein_id gnl|my_center|LOCUS_09530 63150 62950 gene locus_tag LOCUS_09540 63150 62950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 63399 63324 gene locus_tag LOCUS_t00130 63399 63324 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 64104 63619 gene locus_tag LOCUS_09550 64104 63619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 65159 64101 gene locus_tag LOCUS_09560 65159 64101 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_09560 66245 65334 gene locus_tag LOCUS_09570 66245 65334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence11 977 3 gene locus_tag LOCUS_09580 gene rpoA 977 3 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_09580 1629 1000 gene locus_tag LOCUS_09590 gene rpsD 1629 1000 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_09590 2031 1642 gene locus_tag LOCUS_09600 gene rpsK 2031 1642 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_09600 2406 2044 gene locus_tag LOCUS_09610 gene rpsM 2406 2044 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 protein_id gnl|my_center|LOCUS_09610 2865 2647 gene locus_tag LOCUS_09620 gene infA 2865 2647 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_09620 4194 2872 gene locus_tag LOCUS_09630 gene secY 4194 2872 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_09630 4647 4213 gene locus_tag LOCUS_09640 gene rplO 4647 4213 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_09640 4833 4651 gene locus_tag LOCUS_09650 gene rpmD 4833 4651 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_09650 5364 4837 gene locus_tag LOCUS_09660 gene rpsE 5364 4837 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_09660 5748 5392 gene locus_tag LOCUS_09670 gene rplR 5748 5392 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 protein_id gnl|my_center|LOCUS_09670 6288 5758 gene locus_tag LOCUS_09680 gene rplF 6288 5758 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_09680 6695 6300 gene locus_tag LOCUS_09690 gene rpsH 6695 6300 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_09690 7015 6710 gene locus_tag LOCUS_09700 gene rpsN 7015 6710 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197948.1 protein_id gnl|my_center|LOCUS_09700 7562 7023 gene locus_tag LOCUS_09710 gene rplE 7562 7023 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 protein_id gnl|my_center|LOCUS_09710 7889 7572 gene locus_tag LOCUS_09720 gene rplX 7889 7572 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 protein_id gnl|my_center|LOCUS_09720 8268 7900 gene locus_tag LOCUS_09730 gene rplN 8268 7900 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_09730 8685 8419 gene locus_tag LOCUS_09740 gene rpsQ 8685 8419 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_09740 8876 8682 gene locus_tag LOCUS_09750 gene rpmC 8876 8682 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199856.1 protein_id gnl|my_center|LOCUS_09750 9301 8879 gene locus_tag LOCUS_09760 gene rplP 9301 8879 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 protein_id gnl|my_center|LOCUS_09760 10085 9294 gene locus_tag LOCUS_09770 gene rpsC 10085 9294 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_09770 10424 10095 gene locus_tag LOCUS_09780 gene rplV 10424 10095 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215424.1 protein_id gnl|my_center|LOCUS_09780 10709 10434 gene locus_tag LOCUS_09790 gene rpsS 10709 10434 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690082.1 protein_id gnl|my_center|LOCUS_09790 11547 10720 gene locus_tag LOCUS_09800 gene rplB 11547 10720 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199274.1 protein_id gnl|my_center|LOCUS_09800 11849 11547 gene locus_tag LOCUS_09810 gene rplW 11849 11547 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_09810 12469 11846 gene locus_tag LOCUS_09820 gene rplD 12469 11846 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 protein_id gnl|my_center|LOCUS_09820 13117 12479 gene locus_tag LOCUS_09830 gene rplC 13117 12479 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 protein_id gnl|my_center|LOCUS_09830 13539 13228 gene locus_tag LOCUS_09840 gene rpsJ 13539 13228 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_09840 14795 13605 gene locus_tag LOCUS_09850 gene tuf 14795 13605 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_09850 16910 14817 gene locus_tag LOCUS_09860 gene fusA 16910 14817 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198357.1 protein_id gnl|my_center|LOCUS_09860 17399 16929 gene locus_tag LOCUS_09870 gene rpsG 17399 16929 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_09870 17887 17510 gene locus_tag LOCUS_09880 gene rpsL 17887 17510 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521903.1 protein_id gnl|my_center|LOCUS_09880 22253 18054 gene locus_tag LOCUS_09890 gene rpoC 22253 18054 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_09890 26559 22276 gene locus_tag LOCUS_09900 26559 22276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 27125 26760 gene locus_tag LOCUS_09910 gene rplL 27125 26760 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_09910 27661 27164 gene locus_tag LOCUS_09920 gene rplJ 27661 27164 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 protein_id gnl|my_center|LOCUS_09920 28587 27892 gene locus_tag LOCUS_09930 gene rplA 28587 27892 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_09930 29021 28590 gene locus_tag LOCUS_09940 gene rplK 29021 28590 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_09940 29658 29125 gene locus_tag LOCUS_09950 gene nusG 29658 29125 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525645.1 protein_id gnl|my_center|LOCUS_09950 30008 29655 gene locus_tag LOCUS_09960 gene secE 30008 29655 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_09960 30108 30033 gene locus_tag LOCUS_t00140 30108 30033 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 31361 30171 gene locus_tag LOCUS_09970 gene tuf 31361 30171 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_09970 31488 31414 gene locus_tag LOCUS_t00150 31488 31414 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31592 31519 gene locus_tag LOCUS_t00160 31592 31519 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31717 31633 gene locus_tag LOCUS_t00170 31717 31633 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 32121 31813 gene locus_tag LOCUS_09980 gene nirM 32121 31813 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_09980 32909 32286 gene locus_tag LOCUS_09990 gene rhtB 32909 32286 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171710.1 protein_id gnl|my_center|LOCUS_09990 34762 32906 gene locus_tag LOCUS_10000 gene ilvD 34762 32906 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_10000 34854 35645 gene locus_tag LOCUS_10010 gene lgt 34854 35645 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_10010 35683 36156 gene locus_tag LOCUS_10020 35683 36156 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_10020 36171 36932 gene locus_tag LOCUS_10030 36171 36932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 37882 37004 gene locus_tag LOCUS_10040 gene htpX 37882 37004 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_10040 37981 38895 gene locus_tag LOCUS_10050 gene nhaR 37981 38895 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_10050 38933 40069 gene locus_tag LOCUS_10060 38933 40069 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_10060 40071 40946 gene locus_tag LOCUS_10070 40071 40946 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_10070 40948 41217 gene locus_tag LOCUS_10080 40948 41217 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189266.1 protein_id gnl|my_center|LOCUS_10080 41219 41836 gene locus_tag LOCUS_10090 gene lipB 41219 41836 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_10090 41829 42797 gene locus_tag LOCUS_10100 gene lipA 41829 42797 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_10100 43321 42794 gene locus_tag LOCUS_10110 43321 42794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 43671 43333 gene locus_tag LOCUS_10120 43671 43333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 44081 43800 gene locus_tag LOCUS_10130 44081 43800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 45384 44089 gene locus_tag LOCUS_10140 45384 44089 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_10140 46626 45484 gene locus_tag LOCUS_10150 46626 45484 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224938.1 protein_id gnl|my_center|LOCUS_10150 47045 46629 gene locus_tag LOCUS_10160 47045 46629 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201632.1 protein_id gnl|my_center|LOCUS_10160 47473 47039 gene locus_tag LOCUS_10170 47473 47039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 47357 47638 gene locus_tag LOCUS_10180 47357 47638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 47669 47971 gene locus_tag LOCUS_10190 47669 47971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 47968 48981 gene locus_tag LOCUS_10200 47968 48981 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_10200 49822 48962 gene locus_tag LOCUS_10210 gene siaD 49822 48962 CDS product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 protein_id gnl|my_center|LOCUS_10210 50192 49815 gene locus_tag LOCUS_10220 gene siaC 50192 49815 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_10220 50744 50202 gene locus_tag LOCUS_10230 gene siaB 50744 50202 CDS product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_10230 52751 50757 gene locus_tag LOCUS_10240 gene siaA 52751 50757 CDS product biofilm regulation protein phosphatase SiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 protein_id gnl|my_center|LOCUS_10240 53519 52815 gene locus_tag LOCUS_10250 53519 52815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064071.1 protein_id gnl|my_center|LOCUS_10250 54270 53512 gene locus_tag LOCUS_10260 54270 53512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_10260 55334 54267 gene locus_tag LOCUS_10270 55334 54267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_10270 56254 55331 gene locus_tag LOCUS_10280 56254 55331 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812854.1 protein_id gnl|my_center|LOCUS_10280 56537 56325 gene locus_tag LOCUS_10290 56537 56325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 57925 56489 gene locus_tag LOCUS_10300 57925 56489 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_10300 56567 56666 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58071 58820 gene locus_tag LOCUS_10310 58071 58820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 58826 60919 gene locus_tag LOCUS_10320 58826 60919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 61578 60916 gene locus_tag LOCUS_10330 61578 60916 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084012.1 protein_id gnl|my_center|LOCUS_10330 63072 61666 gene locus_tag LOCUS_10340 63072 61666 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205196.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence12 1260 1359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2255 1539 gene locus_tag LOCUS_10350 gene rph 2255 1539 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_10350 3182 2265 gene locus_tag LOCUS_10360 3182 2265 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_10360 4126 3179 gene locus_tag LOCUS_10370 4126 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4202 5068 gene locus_tag LOCUS_10380 4202 5068 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_10380 5093 5701 gene locus_tag LOCUS_10390 gene gmk 5093 5701 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_10390 5719 5925 gene locus_tag LOCUS_10400 gene rpoZ 5719 5925 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_10400 5947 8103 gene locus_tag LOCUS_10410 5947 8103 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_10410 8100 9350 gene locus_tag LOCUS_10420 8100 9350 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_10420 9350 10156 gene locus_tag LOCUS_10430 9350 10156 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_10430 11058 10198 gene locus_tag LOCUS_10440 gene rpoH 11058 10198 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815756.1 protein_id gnl|my_center|LOCUS_10440 11353 12135 gene locus_tag LOCUS_10450 gene gluQRS 11353 12135 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941983.1 protein_id gnl|my_center|LOCUS_10450 13285 12122 gene locus_tag LOCUS_10460 gene clsB 13285 12122 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_10460 14094 13312 gene locus_tag LOCUS_10470 14094 13312 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204659.1 protein_id gnl|my_center|LOCUS_10470 14239 15636 gene locus_tag LOCUS_10480 14239 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 15764 15937 gene locus_tag LOCUS_10490 15764 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 16238 18313 gene locus_tag LOCUS_10500 16238 18313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 19718 18399 gene locus_tag LOCUS_10510 19718 18399 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_10510 19648 20814 gene locus_tag LOCUS_10520 19648 20814 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256778.1 protein_id gnl|my_center|LOCUS_10520 21011 22054 gene locus_tag LOCUS_10530 21011 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 22151 23905 gene locus_tag LOCUS_10540 22151 23905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 25101 23899 gene locus_tag LOCUS_10550 25101 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 27502 25136 gene locus_tag LOCUS_10560 27502 25136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 27653 28618 gene locus_tag LOCUS_10570 27653 28618 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_10570 28615 29172 gene locus_tag LOCUS_10580 28615 29172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 29281 31101 gene locus_tag LOCUS_10590 29281 31101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 31149 33050 gene locus_tag LOCUS_10600 gene asnB 31149 33050 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_10600 33060 34544 gene locus_tag LOCUS_10610 33060 34544 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_10610 34544 35506 gene locus_tag LOCUS_10620 34544 35506 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_10620 36624 35503 gene locus_tag LOCUS_10630 36624 35503 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533209.1 protein_id gnl|my_center|LOCUS_10630 37148 36621 gene locus_tag LOCUS_10640 37148 36621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 37714 37145 gene locus_tag LOCUS_10650 37714 37145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 39312 37717 gene locus_tag LOCUS_10660 39312 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 40081 39305 gene locus_tag LOCUS_10670 40081 39305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 41547 40078 gene locus_tag LOCUS_10680 41547 40078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 42644 41580 gene locus_tag LOCUS_10690 42644 41580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 43529 42753 gene locus_tag LOCUS_10700 gene vpsK 43529 42753 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_10700 44654 43557 gene locus_tag LOCUS_10710 gene nadA 44654 43557 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_10710 45155 44700 gene locus_tag LOCUS_10720 45155 44700 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_10720 45200 46369 gene locus_tag LOCUS_10730 45200 46369 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195769.1 protein_id gnl|my_center|LOCUS_10730 46560 47975 gene locus_tag LOCUS_10740 gene glnA 46560 47975 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 protein_id gnl|my_center|LOCUS_10740 48080 48553 gene locus_tag LOCUS_10750 48080 48553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225204.1 protein_id gnl|my_center|LOCUS_10750 51794 48639 gene locus_tag LOCUS_10760 51794 48639 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 protein_id gnl|my_center|LOCUS_10760 52890 51796 gene locus_tag LOCUS_10770 gene mexJ 52890 51796 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_10770 52993 54054 gene locus_tag LOCUS_10780 gene glnL 52993 54054 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_10780 54102 55532 gene locus_tag LOCUS_10790 gene ntrC 54102 55532 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_10790 55608 56399 gene locus_tag LOCUS_10800 gene birA 55608 56399 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115072.1 protein_id gnl|my_center|LOCUS_10800 56396 57109 gene locus_tag LOCUS_10810 56396 57109 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196311.1 protein_id gnl|my_center|LOCUS_10810 57188 58198 gene locus_tag LOCUS_10820 57188 58198 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_10820 59664 58219 gene locus_tag LOCUS_10830 59664 58219 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_10830 61152 59734 gene locus_tag LOCUS_10840 61152 59734 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771203.1 protein_id gnl|my_center|LOCUS_10840 63044 61830 gene locus_tag LOCUS_10850 63044 61830 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence13 18 461 gene locus_tag LOCUS_10860 gene trxC 18 461 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_10860 517 1533 gene locus_tag LOCUS_10870 517 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_10870 1577 3196 gene locus_tag LOCUS_10880 1577 3196 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483222.1 protein_id gnl|my_center|LOCUS_10880 4603 3236 gene locus_tag LOCUS_10890 4603 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4765 5358 gene locus_tag LOCUS_10900 gene grpE 4765 5358 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_10900 5460 7394 gene locus_tag LOCUS_10910 gene dnaK 5460 7394 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_10910 7481 8620 gene locus_tag LOCUS_10920 gene dnaJ 7481 8620 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_10920 8758 9900 gene locus_tag LOCUS_10930 8758 9900 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_10930 11342 9969 gene locus_tag LOCUS_10940 gene cysS 11342 9969 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 protein_id gnl|my_center|LOCUS_10940 11451 12590 gene locus_tag LOCUS_10950 11451 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 12590 13894 gene locus_tag LOCUS_10960 12590 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 13897 14460 gene locus_tag LOCUS_10970 13897 14460 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_10970 14473 14964 gene locus_tag LOCUS_10980 14473 14964 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_10980 14961 15701 gene locus_tag LOCUS_10990 gene lpxH 14961 15701 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704629.1 protein_id gnl|my_center|LOCUS_10990 15706 17520 gene locus_tag LOCUS_11000 gene recQ 15706 17520 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_11000 18011 17535 gene locus_tag LOCUS_11010 18011 17535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 19119 18031 gene locus_tag LOCUS_11020 19119 18031 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073812.1 protein_id gnl|my_center|LOCUS_11020 20068 19124 gene locus_tag LOCUS_11030 gene mshM 20068 19124 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_11030 21921 20065 gene locus_tag LOCUS_11040 gene mshL 21921 20065 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_11040 22271 21930 gene locus_tag LOCUS_11050 22271 21930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 22939 22268 gene locus_tag LOCUS_11060 gene gspM 22939 22268 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456325.1 protein_id gnl|my_center|LOCUS_11060 23586 22936 gene locus_tag LOCUS_11070 23586 22936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 24518 23583 gene locus_tag LOCUS_11080 24518 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 24689 25228 gene locus_tag LOCUS_11090 24689 25228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 25218 25796 gene locus_tag LOCUS_11100 25218 25796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 25780 26721 gene locus_tag LOCUS_11110 25780 26721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 26718 27227 gene locus_tag LOCUS_11120 26718 27227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 27247 29694 gene locus_tag LOCUS_11130 27247 29694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 30216 29770 gene locus_tag LOCUS_11140 30216 29770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 30743 30234 gene locus_tag LOCUS_11150 30743 30234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 31972 30743 gene locus_tag LOCUS_11160 gene mshG 31972 30743 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_11160 33685 31976 gene locus_tag LOCUS_11170 gene mshE 33685 31976 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_11170 35089 33809 gene locus_tag LOCUS_11180 gene rhlE 35089 33809 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_11180 35469 36581 gene locus_tag LOCUS_11190 35469 36581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 37848 36607 gene locus_tag LOCUS_11200 37848 36607 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895459.1 protein_id gnl|my_center|LOCUS_11200 39041 37845 gene locus_tag LOCUS_11210 39041 37845 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_11210 40582 39041 gene locus_tag LOCUS_11220 gene purF 40582 39041 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_11220 41088 40594 gene locus_tag LOCUS_11230 41088 40594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 41831 41085 gene locus_tag LOCUS_11240 41831 41085 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811818.1 protein_id gnl|my_center|LOCUS_11240 43140 41821 gene locus_tag LOCUS_11250 gene folC 43140 41821 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 protein_id gnl|my_center|LOCUS_11250 44090 43221 gene locus_tag LOCUS_11260 gene accD 44090 43221 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_11260 44893 44087 gene locus_tag LOCUS_11270 gene trpA 44893 44087 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_11270 46094 44895 gene locus_tag LOCUS_11280 gene trpB 46094 44895 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_11280 46707 46081 gene locus_tag LOCUS_11290 46707 46081 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187259.1 protein_id gnl|my_center|LOCUS_11290 47562 46774 gene locus_tag LOCUS_11300 gene truA 47562 46774 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812640.1 protein_id gnl|my_center|LOCUS_11300 48152 47559 gene locus_tag LOCUS_11310 48152 47559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 51457 48218 gene locus_tag LOCUS_11320 51457 48218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 52747 51614 gene locus_tag LOCUS_11330 gene asd 52747 51614 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_11330 53903 52851 gene locus_tag LOCUS_11340 gene leuB 53903 52851 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_11340 54581 53943 gene locus_tag LOCUS_11350 gene leuD 54581 53943 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_11350 54718 54590 gene locus_tag LOCUS_11360 54718 54590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 56141 54735 gene locus_tag LOCUS_11370 gene leuC 56141 54735 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219221.1 protein_id gnl|my_center|LOCUS_11370 57359 56172 gene locus_tag LOCUS_11380 57359 56172 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_11380 57662 57399 gene locus_tag LOCUS_11390 57662 57399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 58817 57717 gene locus_tag LOCUS_11400 gene aroC 58817 57717 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534774.1 protein_id gnl|my_center|LOCUS_11400 59394 58948 gene locus_tag LOCUS_11410 59394 58948 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_11410 59601 59909 gene locus_tag LOCUS_11420 59601 59909 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951376.1 protein_id gnl|my_center|LOCUS_11420 60785 59949 gene locus_tag LOCUS_11430 60785 59949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence14 1787 201 gene locus_tag LOCUS_11440 1787 201 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_11440 4132 1799 gene locus_tag LOCUS_11450 4132 1799 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_11450 4936 4169 gene locus_tag LOCUS_11460 4936 4169 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_11460 7149 4939 gene locus_tag LOCUS_11470 7149 4939 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_11470 7811 7146 gene locus_tag LOCUS_11480 7811 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 8636 7827 gene locus_tag LOCUS_11490 8636 7827 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_11490 11152 8633 gene locus_tag LOCUS_11500 11152 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 12188 11226 gene locus_tag LOCUS_11510 gene ala 12188 11226 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_11510 13157 12264 gene locus_tag LOCUS_11520 gene sucD 13157 12264 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_11520 14329 13169 gene locus_tag LOCUS_11530 gene sucC 14329 13169 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_11530 15057 14464 gene locus_tag LOCUS_11540 15057 14464 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_11540 15345 16148 gene locus_tag LOCUS_11550 15345 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 16893 16132 gene locus_tag LOCUS_11560 16893 16132 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_11560 16892 18046 gene locus_tag LOCUS_11570 16892 18046 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_11570 18105 18911 gene locus_tag LOCUS_11580 18105 18911 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_11580 19742 18912 gene locus_tag LOCUS_11590 gene tatC 19742 18912 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_11590 20116 19739 gene locus_tag LOCUS_11600 gene tatB 20116 19739 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448907.1 protein_id gnl|my_center|LOCUS_11600 20423 20190 gene locus_tag LOCUS_11610 gene tatA 20423 20190 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_11610 20785 20435 gene locus_tag LOCUS_11620 20785 20435 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 protein_id gnl|my_center|LOCUS_11620 21108 20782 gene locus_tag LOCUS_11630 21108 20782 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927225.1 protein_id gnl|my_center|LOCUS_11630 21503 21105 gene locus_tag LOCUS_11640 gene hisI 21503 21105 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_11640 22261 21503 gene locus_tag LOCUS_11650 gene hisF 22261 21503 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_11650 23001 22261 gene locus_tag LOCUS_11660 gene hisA 23001 22261 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_11660 23670 23038 gene locus_tag LOCUS_11670 gene hisH 23670 23038 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 protein_id gnl|my_center|LOCUS_11670 24254 23667 gene locus_tag LOCUS_11680 24254 23667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 24333 25403 gene locus_tag LOCUS_11690 gene hisC 24333 25403 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_11690 25406 25621 gene locus_tag LOCUS_11700 25406 25621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689624.1 protein_id gnl|my_center|LOCUS_11700 25655 27352 gene locus_tag LOCUS_11710 25655 27352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 27882 27364 gene locus_tag LOCUS_11720 27882 27364 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809303.1 protein_id gnl|my_center|LOCUS_11720 28313 27879 gene locus_tag LOCUS_11730 28313 27879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 29763 28459 gene locus_tag LOCUS_11740 gene hisD 29763 28459 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527888.1 protein_id gnl|my_center|LOCUS_11740 30408 29764 gene locus_tag LOCUS_11750 gene hisG 30408 29764 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_11750 30728 30522 gene locus_tag LOCUS_11760 30728 30522 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_11760 32187 30934 gene locus_tag LOCUS_11770 gene murA 32187 30934 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_11770 32422 32180 gene locus_tag LOCUS_11780 32422 32180 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_11780 33181 32429 gene locus_tag LOCUS_11790 33181 32429 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_11790 33909 33178 gene locus_tag LOCUS_11800 33909 33178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 34199 33918 gene locus_tag LOCUS_11810 34199 33918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 34816 34196 gene locus_tag LOCUS_11820 34816 34196 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_11820 35557 34832 gene locus_tag LOCUS_11830 35557 34832 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_11830 36024 35554 gene locus_tag LOCUS_11840 gene mlaD 36024 35554 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_11840 36815 36021 gene locus_tag LOCUS_11850 gene mlaE 36815 36021 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_11850 37620 36808 gene locus_tag LOCUS_11860 37620 36808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_11860 37849 39387 gene locus_tag LOCUS_11870 37849 39387 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_11870 39394 39876 gene locus_tag LOCUS_11880 39394 39876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 39873 41555 gene locus_tag LOCUS_11890 39873 41555 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_11890 41559 42746 gene locus_tag LOCUS_11900 41559 42746 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_11900 42754 44085 gene locus_tag LOCUS_11910 42754 44085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 44082 44669 gene locus_tag LOCUS_11920 44082 44669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 44666 44995 gene locus_tag LOCUS_11930 44666 44995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 44992 46941 gene locus_tag LOCUS_11940 44992 46941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 46922 47611 gene locus_tag LOCUS_11950 46922 47611 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390516.1 protein_id gnl|my_center|LOCUS_11950 47640 48296 gene locus_tag LOCUS_11960 47640 48296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 50210 48303 gene locus_tag LOCUS_11970 50210 48303 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_11970 50308 51306 gene locus_tag LOCUS_11980 50308 51306 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_11980 51332 51913 gene locus_tag LOCUS_11990 gene lptC 51332 51913 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689544.1 protein_id gnl|my_center|LOCUS_11990 51910 52506 gene locus_tag LOCUS_12000 gene lptA 51910 52506 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_12000 52703 53257 gene locus_tag LOCUS_12010 52703 53257 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_12010 53330 53893 gene locus_tag LOCUS_12020 53330 53893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 54752 53988 gene locus_tag LOCUS_12030 54752 53988 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814179.1 protein_id gnl|my_center|LOCUS_12030 55483 54749 gene locus_tag LOCUS_12040 55483 54749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 <56124 55476 gene locus_tag LOCUS_12050 <56124 55476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202033.1:ATP-dependent RNA helicase HrpA >Feature sequence15 657 13 gene locus_tag LOCUS_12060 gene narL 657 13 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_12060 2519 654 gene locus_tag LOCUS_12070 gene narX 2519 654 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_12070 2750 3277 gene locus_tag LOCUS_12080 gene napF 2750 3277 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 protein_id gnl|my_center|LOCUS_12080 3274 3525 gene locus_tag LOCUS_12090 3274 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3528 6104 gene locus_tag LOCUS_12100 gene napA 3528 6104 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_12100 6077 6979 gene locus_tag LOCUS_12110 gene napG 6077 6979 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_12110 6976 7827 gene locus_tag LOCUS_12120 gene napH 6976 7827 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013506.1 protein_id gnl|my_center|LOCUS_12120 7824 8288 gene locus_tag LOCUS_12130 7824 8288 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744358.1 protein_id gnl|my_center|LOCUS_12130 8312 8950 gene locus_tag LOCUS_12140 gene napC 8312 8950 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 protein_id gnl|my_center|LOCUS_12140 10482 9028 gene locus_tag LOCUS_12150 10482 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 11837 10629 gene locus_tag LOCUS_12160 gene nifS 11837 10629 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_12160 12823 11927 gene locus_tag LOCUS_12170 gene nifU 12823 11927 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_12170 13158 12835 gene locus_tag LOCUS_12180 13158 12835 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565964.1 protein_id gnl|my_center|LOCUS_12180 13696 13280 gene locus_tag LOCUS_12190 13696 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 14044 13700 gene locus_tag LOCUS_12200 14044 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 14316 14047 gene locus_tag LOCUS_12210 gene fdxB 14316 14047 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_12210 14531 14313 gene locus_tag LOCUS_12220 14531 14313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 15009 14548 gene locus_tag LOCUS_12230 15009 14548 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_12230 15478 15014 gene locus_tag LOCUS_12240 15478 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 15957 15478 gene locus_tag LOCUS_12250 gene nifX 15957 15478 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545689.1 protein_id gnl|my_center|LOCUS_12250 17323 15920 gene locus_tag LOCUS_12260 gene nifN 17323 15920 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084555.1 protein_id gnl|my_center|LOCUS_12260 18365 17394 gene locus_tag LOCUS_12270 18365 17394 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_12270 19204 18362 gene locus_tag LOCUS_12280 gene menB 19204 18362 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_12280 19303 19641 gene locus_tag LOCUS_12290 19303 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 19643 20554 gene locus_tag LOCUS_12300 19643 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 20554 22893 gene locus_tag LOCUS_12310 20554 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 23005 24126 gene locus_tag LOCUS_12320 23005 24126 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477386.1 protein_id gnl|my_center|LOCUS_12320 24495 24184 gene locus_tag LOCUS_12330 gene ilvN 24495 24184 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181706.1 protein_id gnl|my_center|LOCUS_12330 26167 24497 gene locus_tag LOCUS_12340 gene ilvB 26167 24497 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211027.1 protein_id gnl|my_center|LOCUS_12340 26230 26415 gene locus_tag LOCUS_12350 26230 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 26560 27795 gene locus_tag LOCUS_12360 26560 27795 CDS product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_12360 27788 28492 gene locus_tag LOCUS_12370 27788 28492 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_12370 28967 28494 gene locus_tag LOCUS_12380 28967 28494 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389836.1 protein_id gnl|my_center|LOCUS_12380 29842 28976 gene locus_tag LOCUS_12390 29842 28976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 30011 30523 gene locus_tag LOCUS_12400 30011 30523 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_12400 30664 31107 gene locus_tag LOCUS_12410 30664 31107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 32772 31024 gene locus_tag LOCUS_12420 32772 31024 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_12420 33711 32914 gene locus_tag LOCUS_12430 gene fabI 33711 32914 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_12430 35398 33755 gene locus_tag LOCUS_12440 35398 33755 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_12440 35493 35897 gene locus_tag LOCUS_12450 35493 35897 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 protein_id gnl|my_center|LOCUS_12450 35921 37282 gene locus_tag LOCUS_12460 35921 37282 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_12460 37313 38533 gene locus_tag LOCUS_12470 37313 38533 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 protein_id gnl|my_center|LOCUS_12470 39715 38534 gene locus_tag LOCUS_12480 39715 38534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 40932 39754 gene locus_tag LOCUS_12490 40932 39754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 41296 41451 gene locus_tag LOCUS_12500 41296 41451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 41544 42146 gene locus_tag LOCUS_12510 gene lexA 41544 42146 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930566.1 protein_id gnl|my_center|LOCUS_12510 43563 42352 gene locus_tag LOCUS_12520 gene hpnE 43563 42352 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_12520 44400 43567 gene locus_tag LOCUS_12530 gene hpnD 44400 43567 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_12530 45214 44405 gene locus_tag LOCUS_12540 gene hpnC 45214 44405 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_12540 45268 45352 gene locus_tag LOCUS_t00180 45268 45352 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46423 45434 gene locus_tag LOCUS_12550 46423 45434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 46629 46423 gene locus_tag LOCUS_12560 46629 46423 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809188.1 protein_id gnl|my_center|LOCUS_12560 46765 46841 gene locus_tag LOCUS_t00190 46765 46841 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 46982 48898 gene locus_tag LOCUS_12570 gene thrS 46982 48898 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_12570 49038 49445 gene locus_tag LOCUS_12580 gene infC 49038 49445 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_12580 49588 49785 gene locus_tag LOCUS_12590 gene rpmI 49588 49785 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191477.1 protein_id gnl|my_center|LOCUS_12590 49799 50158 gene locus_tag LOCUS_12600 gene rplT 49799 50158 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_12600 50250 51296 gene locus_tag LOCUS_12610 gene pheS 50250 51296 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_12610 51318 53702 gene locus_tag LOCUS_12620 gene pheT 51318 53702 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_12620 53719 54021 gene locus_tag LOCUS_12630 53719 54021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence16 <1 594 gene locus_tag LOCUS_12640 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189892.1:OmpA family protein 674 1372 gene locus_tag LOCUS_12650 674 1372 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_12650 2604 1432 gene locus_tag LOCUS_12660 2604 1432 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 protein_id gnl|my_center|LOCUS_12660 4745 2601 gene locus_tag LOCUS_12670 4745 2601 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810151.1 protein_id gnl|my_center|LOCUS_12670 4832 5287 gene locus_tag LOCUS_12680 4832 5287 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_12680 5318 6742 gene locus_tag LOCUS_12690 5318 6742 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_12690 6771 8054 gene locus_tag LOCUS_12700 6771 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9482 8076 gene locus_tag LOCUS_12710 9482 8076 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_12710 9996 9550 gene locus_tag LOCUS_12720 gene rplI 9996 9550 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_12720 10290 10015 gene locus_tag LOCUS_12730 gene rpsR 10290 10015 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 protein_id gnl|my_center|LOCUS_12730 10549 10262 gene locus_tag LOCUS_12740 gene priB 10549 10262 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_12740 10990 10616 gene locus_tag LOCUS_12750 gene rpsF 10990 10616 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688967.1 protein_id gnl|my_center|LOCUS_12750 12883 11102 gene locus_tag LOCUS_12760 12883 11102 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_12760 14652 12880 gene locus_tag LOCUS_12770 14652 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 15389 14724 gene locus_tag LOCUS_12780 15389 14724 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225261.1 protein_id gnl|my_center|LOCUS_12780 16331 15399 gene locus_tag LOCUS_12790 16331 15399 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 protein_id gnl|my_center|LOCUS_12790 17081 16332 gene locus_tag LOCUS_12800 17081 16332 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447049.1 protein_id gnl|my_center|LOCUS_12800 17264 17821 gene locus_tag LOCUS_12810 17264 17821 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084162.1 protein_id gnl|my_center|LOCUS_12810 19332 17836 gene locus_tag LOCUS_12820 gene ppx 19332 17836 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_12820 21422 19530 gene locus_tag LOCUS_12830 21422 19530 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_12830 22590 21481 gene locus_tag LOCUS_12840 22590 21481 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_12840 23587 22592 gene locus_tag LOCUS_12850 23587 22592 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_12850 23722 24240 gene locus_tag LOCUS_12860 23722 24240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 24377 25393 gene locus_tag LOCUS_12870 24377 25393 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_12870 25457 26056 gene locus_tag LOCUS_12880 25457 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 27707 26070 gene locus_tag LOCUS_12890 27707 26070 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_12890 27738 28889 gene locus_tag LOCUS_12900 27738 28889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390643.1 protein_id gnl|my_center|LOCUS_12900 28900 29604 gene locus_tag LOCUS_12910 gene aat 28900 29604 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521636.1 protein_id gnl|my_center|LOCUS_12910 29609 30352 gene locus_tag LOCUS_12920 29609 30352 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820991.1 protein_id gnl|my_center|LOCUS_12920 32582 30360 gene locus_tag LOCUS_12930 32582 30360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 33925 32705 gene locus_tag LOCUS_12940 33925 32705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_12940 34691 33993 gene locus_tag LOCUS_12950 34691 33993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_12950 35866 34691 gene locus_tag LOCUS_12960 35866 34691 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_12960 37260 35881 gene locus_tag LOCUS_12970 37260 35881 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113001.1 protein_id gnl|my_center|LOCUS_12970 37328 38374 gene locus_tag LOCUS_12980 37328 38374 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207200.1 protein_id gnl|my_center|LOCUS_12980 38449 39033 gene locus_tag LOCUS_12990 gene rsxA 38449 39033 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380762.1 protein_id gnl|my_center|LOCUS_12990 39033 39611 gene locus_tag LOCUS_13000 gene rsxB 39033 39611 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_13000 39611 41371 gene locus_tag LOCUS_13010 39611 41371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 41368 42402 gene locus_tag LOCUS_13020 41368 42402 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 protein_id gnl|my_center|LOCUS_13020 42399 43067 gene locus_tag LOCUS_13030 gene rsxG 42399 43067 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_13030 43064 43750 gene locus_tag LOCUS_13040 43064 43750 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_13040 43774 44862 gene locus_tag LOCUS_13050 43774 44862 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088017.1 protein_id gnl|my_center|LOCUS_13050 46214 44796 gene locus_tag LOCUS_13060 46214 44796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 46307 46939 gene locus_tag LOCUS_13070 gene nth 46307 46939 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036717.1 protein_id gnl|my_center|LOCUS_13070 46960 47391 gene locus_tag LOCUS_13080 46960 47391 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_13080 47410 48066 gene locus_tag LOCUS_13090 47410 48066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 48876 48103 gene locus_tag LOCUS_13100 48876 48103 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 protein_id gnl|my_center|LOCUS_13100 50753 48960 gene locus_tag LOCUS_13110 50753 48960 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_13110 50990 50778 gene locus_tag LOCUS_13120 50990 50778 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810443.1 protein_id gnl|my_center|LOCUS_13120 52974 51058 gene locus_tag LOCUS_13130 gene htpG 52974 51058 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence17 2225 1890 gene locus_tag LOCUS_13140 2225 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2367 3092 gene locus_tag LOCUS_13150 2367 3092 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216723.1 protein_id gnl|my_center|LOCUS_13150 3089 3613 gene locus_tag LOCUS_13160 3089 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087459406.1 protein_id gnl|my_center|LOCUS_13160 3618 4472 gene locus_tag LOCUS_13170 3618 4472 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_13170 4469 5002 gene locus_tag LOCUS_13180 gene ruvC 4469 5002 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_13180 5052 5630 gene locus_tag LOCUS_13190 gene ruvA 5052 5630 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_13190 5630 6685 gene locus_tag LOCUS_13200 5630 6685 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169951.1 protein_id gnl|my_center|LOCUS_13200 6682 7740 gene locus_tag LOCUS_13210 gene ruvB 6682 7740 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_13210 8345 8444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8736 9587 gene locus_tag LOCUS_13220 8736 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 9584 10006 gene locus_tag LOCUS_13230 gene ybgC 9584 10006 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_13230 10003 10680 gene locus_tag LOCUS_13240 gene tolQ 10003 10680 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_13240 10684 11088 gene locus_tag LOCUS_13250 gene tolR 10684 11088 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_13250 11093 11905 gene locus_tag LOCUS_13260 11093 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 11921 13207 gene locus_tag LOCUS_13270 gene tolB 11921 13207 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_13270 13234 13773 gene locus_tag LOCUS_13280 gene pal 13234 13773 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_13280 13776 14507 gene locus_tag LOCUS_13290 gene ybgF 13776 14507 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_13290 14508 15146 gene locus_tag LOCUS_13300 gene queE 14508 15146 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_13300 15162 15530 gene locus_tag LOCUS_13310 15162 15530 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925839.1 protein_id gnl|my_center|LOCUS_13310 15803 17497 gene locus_tag LOCUS_13320 15803 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 17549 18226 gene locus_tag LOCUS_13330 gene queC 17549 18226 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 protein_id gnl|my_center|LOCUS_13330 18228 19331 gene locus_tag LOCUS_13340 18228 19331 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_13340 19400 20062 gene locus_tag LOCUS_13350 19400 20062 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_13350 20059 21372 gene locus_tag LOCUS_13360 20059 21372 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526222.1 protein_id gnl|my_center|LOCUS_13360 21486 21794 gene locus_tag LOCUS_13370 21486 21794 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_13370 21795 23555 gene locus_tag LOCUS_13380 21795 23555 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339077.1 protein_id gnl|my_center|LOCUS_13380 24124 23882 gene locus_tag LOCUS_13390 24124 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 24195 25205 gene locus_tag LOCUS_13400 24195 25205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 25314 26813 gene locus_tag LOCUS_13410 25314 26813 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538218.1 protein_id gnl|my_center|LOCUS_13410 27760 26885 gene locus_tag LOCUS_13420 27760 26885 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 protein_id gnl|my_center|LOCUS_13420 29148 27871 gene locus_tag LOCUS_13430 29148 27871 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 protein_id gnl|my_center|LOCUS_13430 30802 29189 gene locus_tag LOCUS_13440 30802 29189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 31430 30813 gene locus_tag LOCUS_13450 gene cobO 31430 30813 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_13450 32224 31454 gene locus_tag LOCUS_13460 32224 31454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_13460 33207 32224 gene locus_tag LOCUS_13470 33207 32224 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_13470 35042 33213 gene locus_tag LOCUS_13480 35042 33213 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931557.1 protein_id gnl|my_center|LOCUS_13480 35470 35673 gene locus_tag LOCUS_13490 35470 35673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 35670 36002 gene locus_tag LOCUS_13500 35670 36002 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380079.1 protein_id gnl|my_center|LOCUS_13500 36278 37084 gene locus_tag LOCUS_13510 36278 37084 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_13510 37922 37086 gene locus_tag LOCUS_13520 37922 37086 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930717.1 protein_id gnl|my_center|LOCUS_13520 37989 38312 gene locus_tag LOCUS_13530 37989 38312 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_13530 38312 39988 gene locus_tag LOCUS_13540 38312 39988 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121878.1 protein_id gnl|my_center|LOCUS_13540 40323 40664 gene locus_tag LOCUS_13550 gene hypA 40323 40664 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_13550 40790 40889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41617 43938 gene locus_tag LOCUS_13560 gene hypF 41617 43938 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388061.1 protein_id gnl|my_center|LOCUS_13560 43907 44149 gene locus_tag LOCUS_13570 43907 44149 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_13570 44149 45273 gene locus_tag LOCUS_13580 gene hypD 44149 45273 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_13580 45266 46318 gene locus_tag LOCUS_13590 gene hypE 45266 46318 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089665.1 protein_id gnl|my_center|LOCUS_13590 46387 47199 gene locus_tag LOCUS_13600 46387 47199 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071255.1 protein_id gnl|my_center|LOCUS_13600 47341 49617 gene locus_tag LOCUS_13610 47341 49617 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446507.1 protein_id gnl|my_center|LOCUS_13610 50249 49662 gene locus_tag LOCUS_13620 50249 49662 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 protein_id gnl|my_center|LOCUS_13620 51592 50246 gene locus_tag LOCUS_13630 gene mpl 51592 50246 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_13630 51673 52233 gene locus_tag LOCUS_13640 51673 52233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence18 234 1802 gene locus_tag LOCUS_13650 gene nifK 234 1802 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_13650 1925 2152 gene locus_tag LOCUS_13660 1925 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2260 2451 gene locus_tag LOCUS_13670 2260 2451 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723758.1 protein_id gnl|my_center|LOCUS_13670 2566 3297 gene locus_tag LOCUS_13680 2566 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 3294 3557 gene locus_tag LOCUS_13690 3294 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3547 4317 gene locus_tag LOCUS_13700 3547 4317 CDS product 4Fe4S-binding leucine-rich repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388751.1 protein_id gnl|my_center|LOCUS_13700 4320 5288 gene locus_tag LOCUS_13710 4320 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5394 6791 gene locus_tag LOCUS_13720 gene nifE 5394 6791 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_13720 6925 7419 gene locus_tag LOCUS_13730 6925 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9952 7421 gene locus_tag LOCUS_13740 9952 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 10142 11410 gene locus_tag LOCUS_13750 10142 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 11407 12756 gene locus_tag LOCUS_13760 11407 12756 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_13760 12781 14859 gene locus_tag LOCUS_13770 gene ppk1 12781 14859 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521820.1 protein_id gnl|my_center|LOCUS_13770 15224 14922 gene locus_tag LOCUS_13780 15224 14922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 15585 15229 gene locus_tag LOCUS_13790 15585 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 15735 15661 gene locus_tag LOCUS_t00200 15735 15661 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15873 17267 gene locus_tag LOCUS_13800 gene gltX 15873 17267 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 protein_id gnl|my_center|LOCUS_13800 17331 17406 gene locus_tag LOCUS_t00210 17331 17406 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17429 17504 gene locus_tag LOCUS_t00220 17429 17504 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17529 17605 gene locus_tag LOCUS_t00230 17529 17605 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17642 17717 gene locus_tag LOCUS_t00240 17642 17717 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17752 17827 gene locus_tag LOCUS_t00250 17752 17827 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17853 17929 gene locus_tag LOCUS_t00260 17853 17929 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 18079 19437 gene locus_tag LOCUS_13810 18079 19437 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814738.1 protein_id gnl|my_center|LOCUS_13810 21402 19432 gene locus_tag LOCUS_13820 21402 19432 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_13820 22787 21402 gene locus_tag LOCUS_13830 22787 21402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930676.1 protein_id gnl|my_center|LOCUS_13830 23761 22784 gene locus_tag LOCUS_13840 23761 22784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_13840 23891 24268 gene locus_tag LOCUS_13850 23891 24268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 24297 25091 gene locus_tag LOCUS_13860 24297 25091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 25373 25286 gene locus_tag LOCUS_t00270 25373 25286 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25401 26837 gene locus_tag LOCUS_13870 gene mltF 25401 26837 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073169.1 protein_id gnl|my_center|LOCUS_13870 28131 26848 gene locus_tag LOCUS_13880 gene serS 28131 26848 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_13880 28288 29178 gene locus_tag LOCUS_13890 28288 29178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 30529 29213 gene locus_tag LOCUS_13900 30529 29213 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_13900 30661 31482 gene locus_tag LOCUS_13910 30661 31482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 32118 31498 gene locus_tag LOCUS_13920 gene lolA 32118 31498 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222831.1 protein_id gnl|my_center|LOCUS_13920 34463 32172 gene locus_tag LOCUS_13930 34463 32172 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_13930 34638 35597 gene locus_tag LOCUS_13940 gene trxB 34638 35597 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_13940 35604 36365 gene locus_tag LOCUS_13950 35604 36365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 36794 36456 gene locus_tag LOCUS_13960 36794 36456 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_13960 38439 36823 gene locus_tag LOCUS_13970 38439 36823 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526341.1 protein_id gnl|my_center|LOCUS_13970 38979 38443 gene locus_tag LOCUS_13980 gene ppa 38979 38443 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055070.1 protein_id gnl|my_center|LOCUS_13980 39823 39038 gene locus_tag LOCUS_13990 39823 39038 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_13990 40719 39820 gene locus_tag LOCUS_14000 gene cysM 40719 39820 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_14000 41710 40712 gene locus_tag LOCUS_14010 gene rfaD 41710 40712 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190173.1 protein_id gnl|my_center|LOCUS_14010 42646 41720 gene locus_tag LOCUS_14020 gene rfaE1 42646 41720 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_14020 43902 42730 gene locus_tag LOCUS_14030 gene lapB 43902 42730 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_14030 44180 43899 gene locus_tag LOCUS_14040 44180 43899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 44543 44247 gene locus_tag LOCUS_14050 44543 44247 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_14050 46222 44543 gene locus_tag LOCUS_14060 gene rpsA 46222 44543 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_14060 48239 46308 gene locus_tag LOCUS_14070 48239 46308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 48731 48369 gene locus_tag LOCUS_14080 48731 48369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence19 2544 481 gene locus_tag LOCUS_14090 gene uvrB 2544 481 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_14090 2629 3837 gene locus_tag LOCUS_14100 2629 3837 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198124.1 protein_id gnl|my_center|LOCUS_14100 3930 4005 gene locus_tag LOCUS_t00280 3930 4005 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4074 4325 gene locus_tag LOCUS_14110 4074 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4384 5409 gene locus_tag LOCUS_14120 gene moaA 4384 5409 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317890.1 protein_id gnl|my_center|LOCUS_14120 5630 7309 gene locus_tag LOCUS_14130 5630 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 9309 7468 gene locus_tag LOCUS_14140 gene typA 9309 7468 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818637.1 protein_id gnl|my_center|LOCUS_14140 9575 10528 gene locus_tag LOCUS_14150 9575 10528 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_14150 10538 13234 gene locus_tag LOCUS_14160 10538 13234 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_14160 13325 13732 gene locus_tag LOCUS_14170 13325 13732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 14194 13805 gene locus_tag LOCUS_14180 14194 13805 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_14180 16363 14210 gene locus_tag LOCUS_14190 16363 14210 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_14190 16525 16872 gene locus_tag LOCUS_14200 16525 16872 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820087.1 protein_id gnl|my_center|LOCUS_14200 16937 19072 gene locus_tag LOCUS_14210 16937 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 19696 19112 gene locus_tag LOCUS_14220 19696 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 20147 19689 gene locus_tag LOCUS_14230 20147 19689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 22700 20226 gene locus_tag LOCUS_14240 22700 20226 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_14240 24084 22720 gene locus_tag LOCUS_14250 gene radA 24084 22720 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930258.1 protein_id gnl|my_center|LOCUS_14250 25181 24090 gene locus_tag LOCUS_14260 gene alr 25181 24090 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532720.1 protein_id gnl|my_center|LOCUS_14260 26083 25178 gene locus_tag LOCUS_14270 26083 25178 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_14270 26224 27489 gene locus_tag LOCUS_14280 gene lplT 26224 27489 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_14280 28316 27525 gene locus_tag LOCUS_14290 28316 27525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 28777 28313 gene locus_tag LOCUS_14300 gene rimI 28777 28313 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_14300 29463 28774 gene locus_tag LOCUS_14310 gene tsaB 29463 28774 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 protein_id gnl|my_center|LOCUS_14310 29826 29515 gene locus_tag LOCUS_14320 29826 29515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 29987 30715 gene locus_tag LOCUS_14330 gene ompR 29987 30715 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 protein_id gnl|my_center|LOCUS_14330 30712 32016 gene locus_tag LOCUS_14340 30712 32016 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813884.1 protein_id gnl|my_center|LOCUS_14340 32502 32023 gene locus_tag LOCUS_14350 gene ispF 32502 32023 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_14350 33185 32499 gene locus_tag LOCUS_14360 gene ispD 33185 32499 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 protein_id gnl|my_center|LOCUS_14360 33227 34483 gene locus_tag LOCUS_14370 33227 34483 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704570.1 protein_id gnl|my_center|LOCUS_14370 34494 35084 gene locus_tag LOCUS_14380 34494 35084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 37063 35114 gene locus_tag LOCUS_14390 37063 35114 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706510.1 protein_id gnl|my_center|LOCUS_14390 38131 37127 gene locus_tag LOCUS_14400 gene galE 38131 37127 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527590.1 protein_id gnl|my_center|LOCUS_14400 39399 38233 gene locus_tag LOCUS_14410 39399 38233 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706681.1 protein_id gnl|my_center|LOCUS_14410 40665 39475 gene locus_tag LOCUS_14420 40665 39475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 44495 40668 gene locus_tag LOCUS_14430 44495 40668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 44619 47414 gene locus_tag LOCUS_14440 44619 47414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence20 2 1978 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgccccccgtttccgggaggcgatgc 2451 2161 gene locus_tag LOCUS_14450 gene cas2 2451 2161 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_14450 3482 2454 gene locus_tag LOCUS_14460 gene cas1c 3482 2454 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_14460 4122 3484 gene locus_tag LOCUS_14470 gene cas4 4122 3484 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_14470 4196 4438 gene locus_tag LOCUS_14480 4196 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5667 4486 gene locus_tag LOCUS_14490 5667 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 5803 6126 gene locus_tag LOCUS_14500 5803 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6334 6573 gene locus_tag LOCUS_14510 6334 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 7732 6824 gene locus_tag LOCUS_14520 gene cas7c 7732 6824 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_14520 9141 7759 gene locus_tag LOCUS_14530 9141 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 10117 9953 gene locus_tag LOCUS_14540 10117 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 11650 10673 gene locus_tag LOCUS_14550 11650 10673 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_14550 11908 14580 gene locus_tag LOCUS_14560 11908 14580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 14688 15962 gene locus_tag LOCUS_14570 14688 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 17676 16006 gene locus_tag LOCUS_14580 17676 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 17827 19980 gene locus_tag LOCUS_14590 17827 19980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 20217 21737 gene locus_tag LOCUS_14600 20217 21737 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_14600 21818 22189 gene locus_tag LOCUS_14610 21818 22189 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_14610 22204 22536 gene locus_tag LOCUS_14620 gene nirM 22204 22536 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_14620 23269 22583 gene locus_tag LOCUS_14630 23269 22583 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971533.1 protein_id gnl|my_center|LOCUS_14630 23966 23436 gene locus_tag LOCUS_14640 23966 23436 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947309.1 protein_id gnl|my_center|LOCUS_14640 24871 23963 gene locus_tag LOCUS_14650 24871 23963 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038572.1 protein_id gnl|my_center|LOCUS_14650 25780 24926 gene locus_tag LOCUS_14660 25780 24926 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399356.1 protein_id gnl|my_center|LOCUS_14660 26198 25770 gene locus_tag LOCUS_14670 gene pedF 26198 25770 CDS product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 protein_id gnl|my_center|LOCUS_14670 26448 28451 gene locus_tag LOCUS_14680 gene eatR 26448 28451 CDS product sigma-54-dependent transcriptional regulator EatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114083.1 protein_id gnl|my_center|LOCUS_14680 28832 28452 gene locus_tag LOCUS_14690 28832 28452 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468486.1 protein_id gnl|my_center|LOCUS_14690 30130 28829 gene locus_tag LOCUS_14700 30130 28829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_14700 30367 30140 gene locus_tag LOCUS_14710 30367 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 30810 30364 gene locus_tag LOCUS_14720 30810 30364 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_14720 31628 30888 gene locus_tag LOCUS_14730 31628 30888 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 protein_id gnl|my_center|LOCUS_14730 32260 31643 gene locus_tag LOCUS_14740 32260 31643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 34011 32263 gene locus_tag LOCUS_14750 gene phaC 34011 32263 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389569.1 protein_id gnl|my_center|LOCUS_14750 34188 34631 gene locus_tag LOCUS_14760 34188 34631 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_14760 35110 34622 gene locus_tag LOCUS_14770 35110 34622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 36570 35107 gene locus_tag LOCUS_14780 36570 35107 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_14780 37131 36583 gene locus_tag LOCUS_14790 37131 36583 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_14790 37844 37128 gene locus_tag LOCUS_14800 gene hoxU 37844 37128 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_14800 39745 37841 gene locus_tag LOCUS_14810 39745 37841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 39969 40757 gene locus_tag LOCUS_14820 gene fabI 39969 40757 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086243.1 protein_id gnl|my_center|LOCUS_14820 40834 41412 gene locus_tag LOCUS_14830 40834 41412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 41444 41926 gene locus_tag LOCUS_14840 41444 41926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 41943 43361 gene locus_tag LOCUS_14850 41943 43361 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 protein_id gnl|my_center|LOCUS_14850 43364 44545 gene locus_tag LOCUS_14860 43364 44545 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 protein_id gnl|my_center|LOCUS_14860 44752 47646 gene locus_tag LOCUS_14870 44752 47646 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529996.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence21 <1 3114 gene locus_tag LOCUS_14880 <1 3114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994005.1:Hpt domain-containing protein 4563 3145 gene locus_tag LOCUS_14890 4563 3145 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_14890 4602 5162 gene locus_tag LOCUS_14900 4602 5162 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_14900 5143 5589 gene locus_tag LOCUS_14910 gene ruvX 5143 5589 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213272.1 protein_id gnl|my_center|LOCUS_14910 5576 6082 gene locus_tag LOCUS_14920 gene pyrR 5576 6082 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_14920 6075 7034 gene locus_tag LOCUS_14930 6075 7034 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_14930 7038 8282 gene locus_tag LOCUS_14940 7038 8282 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_14940 8436 8723 gene locus_tag LOCUS_14950 8436 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 9023 8730 gene locus_tag LOCUS_14960 9023 8730 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530048.1 protein_id gnl|my_center|LOCUS_14960 9566 9033 gene locus_tag LOCUS_14970 9566 9033 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_14970 10378 9566 gene locus_tag LOCUS_14980 gene proC 10378 9566 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_14980 11063 10380 gene locus_tag LOCUS_14990 11063 10380 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_14990 11121 12164 gene locus_tag LOCUS_15000 11121 12164 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_15000 12190 13326 gene locus_tag LOCUS_15010 12190 13326 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_15010 13343 14029 gene locus_tag LOCUS_15020 13343 14029 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144308590.1 protein_id gnl|my_center|LOCUS_15020 14078 14392 gene locus_tag LOCUS_15030 14078 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 14486 16474 gene locus_tag LOCUS_15040 14486 16474 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_15040 17014 16571 gene locus_tag LOCUS_15050 17014 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 17258 17791 gene locus_tag LOCUS_15060 gene pncC 17258 17791 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 protein_id gnl|my_center|LOCUS_15060 18284 17844 gene locus_tag LOCUS_15070 18284 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 21617 18348 gene locus_tag LOCUS_15080 21617 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 23144 21624 gene locus_tag LOCUS_15090 gene ubiB 23144 21624 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_15090 23272 24786 gene locus_tag LOCUS_15100 23272 24786 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 protein_id gnl|my_center|LOCUS_15100 24779 25294 gene locus_tag LOCUS_15110 24779 25294 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_15110 25338 27101 gene locus_tag LOCUS_15120 gene argS 25338 27101 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_15120 27111 27764 gene locus_tag LOCUS_15130 27111 27764 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927242.1 protein_id gnl|my_center|LOCUS_15130 27777 28412 gene locus_tag LOCUS_15140 27777 28412 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_15140 28421 29185 gene locus_tag LOCUS_15150 28421 29185 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 protein_id gnl|my_center|LOCUS_15150 29404 30606 gene locus_tag LOCUS_15160 29404 30606 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_15160 30603 31742 gene locus_tag LOCUS_15170 30603 31742 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929017.1 protein_id gnl|my_center|LOCUS_15170 31739 34849 gene locus_tag LOCUS_15180 31739 34849 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_15180 34846 35172 gene locus_tag LOCUS_15190 gene glnB 34846 35172 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 protein_id gnl|my_center|LOCUS_15190 35449 35252 gene locus_tag LOCUS_15200 35449 35252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 35534 35923 gene locus_tag LOCUS_15210 35534 35923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 35970 36173 gene locus_tag LOCUS_15220 gene thiS 35970 36173 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_15220 36274 37056 gene locus_tag LOCUS_15230 36274 37056 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_15230 37053 37847 gene locus_tag LOCUS_15240 gene trmB 37053 37847 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185899.1 protein_id gnl|my_center|LOCUS_15240 37872 38861 gene locus_tag LOCUS_15250 37872 38861 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_15250 38858 39244 gene locus_tag LOCUS_15260 38858 39244 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 protein_id gnl|my_center|LOCUS_15260 39268 40416 gene locus_tag LOCUS_15270 39268 40416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 41648 40434 gene locus_tag LOCUS_15280 gene hemW 41648 40434 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_15280 42854 41658 gene locus_tag LOCUS_15290 42854 41658 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_15290 <44490 42847 gene locus_tag LOCUS_15300 <44490 42847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_115857529.1:DEAD/DEAH box helicase >Feature sequence22 2248 1862 gene locus_tag LOCUS_15310 gene gcvH 2248 1862 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266273.1 protein_id gnl|my_center|LOCUS_15310 3376 2285 gene locus_tag LOCUS_15320 gene gcvT 3376 2285 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202927.1 protein_id gnl|my_center|LOCUS_15320 3711 4586 gene locus_tag LOCUS_15330 3711 4586 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193008.1 protein_id gnl|my_center|LOCUS_15330 4589 5215 gene locus_tag LOCUS_15340 4589 5215 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_15340 5218 5877 gene locus_tag LOCUS_15350 5218 5877 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_15350 5886 7088 gene locus_tag LOCUS_15360 5886 7088 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_15360 7088 7378 gene locus_tag LOCUS_15370 7088 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 7380 8219 gene locus_tag LOCUS_15380 7380 8219 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_15380 8182 8733 gene locus_tag LOCUS_15390 8182 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15390 8720 9700 gene locus_tag LOCUS_15400 8720 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 9824 10264 gene locus_tag LOCUS_15410 gene rimP 9824 10264 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_15410 10286 11758 gene locus_tag LOCUS_15420 gene nusA 10286 11758 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_15420 11774 14569 gene locus_tag LOCUS_15430 gene infB 11774 14569 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526850.1 protein_id gnl|my_center|LOCUS_15430 14569 14949 gene locus_tag LOCUS_15440 gene rbfA 14569 14949 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951100.1 protein_id gnl|my_center|LOCUS_15440 14959 15861 gene locus_tag LOCUS_15450 gene truB 14959 15861 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_15450 15962 16231 gene locus_tag LOCUS_15460 gene rpsO 15962 16231 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456110.1 protein_id gnl|my_center|LOCUS_15460 16361 18496 gene locus_tag LOCUS_15470 gene pnp 16361 18496 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_15470 19088 18600 gene locus_tag LOCUS_15480 gene dksA 19088 18600 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140367.1 protein_id gnl|my_center|LOCUS_15480 19903 19217 gene locus_tag LOCUS_15490 19903 19217 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 protein_id gnl|my_center|LOCUS_15490 20018 20773 gene locus_tag LOCUS_15500 gene cysE 20018 20773 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_15500 20831 21334 gene locus_tag LOCUS_15510 gene iscR 20831 21334 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_15510 21343 22500 gene locus_tag LOCUS_15520 gene nifS 21343 22500 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_15520 22532 23743 gene locus_tag LOCUS_15530 22532 23743 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_15530 23831 24214 gene locus_tag LOCUS_15540 gene iscU 23831 24214 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_15540 24217 24540 gene locus_tag LOCUS_15550 gene iscA 24217 24540 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 protein_id gnl|my_center|LOCUS_15550 24540 25067 gene locus_tag LOCUS_15560 gene hscB 24540 25067 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_15560 25072 26952 gene locus_tag LOCUS_15570 gene hscA 25072 26952 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193590.1 protein_id gnl|my_center|LOCUS_15570 26949 27293 gene locus_tag LOCUS_15580 gene fdx 26949 27293 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_15580 27290 27484 gene locus_tag LOCUS_15590 gene iscX 27290 27484 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 protein_id gnl|my_center|LOCUS_15590 27501 27719 gene locus_tag LOCUS_15600 27501 27719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 28567 27728 gene locus_tag LOCUS_15610 gene serB 28567 27728 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_15610 29178 28564 gene locus_tag LOCUS_15620 29178 28564 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_15620 30372 29296 gene locus_tag LOCUS_15630 30372 29296 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109525.1 protein_id gnl|my_center|LOCUS_15630 33842 30369 gene locus_tag LOCUS_15640 gene mfd 33842 30369 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_15640 33988 35004 gene locus_tag LOCUS_15650 33988 35004 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206954.1 protein_id gnl|my_center|LOCUS_15650 35386 35015 gene locus_tag LOCUS_15660 35386 35015 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_15660 35485 36714 gene locus_tag LOCUS_15670 35485 36714 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_15670 36803 38113 gene locus_tag LOCUS_15680 36803 38113 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_15680 38895 38167 gene locus_tag LOCUS_15690 38895 38167 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 protein_id gnl|my_center|LOCUS_15690 40913 38892 gene locus_tag LOCUS_15700 40913 38892 CDS product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337374.1 protein_id gnl|my_center|LOCUS_15700 41078 42715 gene locus_tag LOCUS_15710 41078 42715 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257757.1 protein_id gnl|my_center|LOCUS_15710 42782 43531 gene locus_tag LOCUS_15720 42782 43531 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447049.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence23 1929 1342 gene locus_tag LOCUS_15730 1929 1342 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_15730 2032 2688 gene locus_tag LOCUS_15740 2032 2688 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_15740 2728 3978 gene locus_tag LOCUS_15750 2728 3978 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_15750 4050 4517 gene locus_tag LOCUS_15760 gene nrdR 4050 4517 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_15760 4514 5602 gene locus_tag LOCUS_15770 gene ribD 4514 5602 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186140.1 protein_id gnl|my_center|LOCUS_15770 6470 5658 gene locus_tag LOCUS_15780 gene moeB 6470 5658 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_15780 6871 6467 gene locus_tag LOCUS_15790 6871 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 8296 6887 gene locus_tag LOCUS_15800 gene cptA 8296 6887 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_15800 9666 8293 gene locus_tag LOCUS_15810 9666 8293 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_15810 9748 10065 gene locus_tag LOCUS_15820 9748 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10069 10494 gene locus_tag LOCUS_15830 10069 10494 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_15830 10491 10760 gene locus_tag LOCUS_15840 10491 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 10786 11241 gene locus_tag LOCUS_15850 gene secB 10786 11241 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_15850 11252 11698 gene locus_tag LOCUS_15860 11252 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 11695 12684 gene locus_tag LOCUS_15870 11695 12684 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_15870 13145 12681 gene locus_tag LOCUS_15880 13145 12681 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105425.1 protein_id gnl|my_center|LOCUS_15880 13718 13173 gene locus_tag LOCUS_15890 13718 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 13989 14972 gene locus_tag LOCUS_15900 gene bioB 13989 14972 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 protein_id gnl|my_center|LOCUS_15900 14969 15883 gene locus_tag LOCUS_15910 14969 15883 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_15910 16546 15872 gene locus_tag LOCUS_15920 gene msrQ 16546 15872 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065084.1 protein_id gnl|my_center|LOCUS_15920 17480 16548 gene locus_tag LOCUS_15930 gene msrP 17480 16548 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196774.1 protein_id gnl|my_center|LOCUS_15930 18379 17540 gene locus_tag LOCUS_15940 18379 17540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 18819 18388 gene locus_tag LOCUS_15950 18819 18388 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_15950 19553 18933 gene locus_tag LOCUS_15960 19553 18933 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_15960 19663 20334 gene locus_tag LOCUS_15970 gene yihA 19663 20334 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 protein_id gnl|my_center|LOCUS_15970 20454 21455 gene locus_tag LOCUS_15980 gene hemB 20454 21455 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_15980 22113 21508 gene locus_tag LOCUS_15990 gene slmA 22113 21508 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927138.1 protein_id gnl|my_center|LOCUS_15990 22848 22144 gene locus_tag LOCUS_16000 22848 22144 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_16000 23747 22860 gene locus_tag LOCUS_16010 gene argB 23747 22860 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_16010 24354 23908 gene locus_tag LOCUS_16020 gene nudB 24354 23908 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_16020 24722 24354 gene locus_tag LOCUS_16030 24722 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 25081 24719 gene locus_tag LOCUS_16040 25081 24719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 26887 25088 gene locus_tag LOCUS_16050 gene aspS 26887 25088 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_16050 27540 26911 gene locus_tag LOCUS_16060 27540 26911 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_16060 27776 27525 gene locus_tag LOCUS_16070 27776 27525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 28698 27847 gene locus_tag LOCUS_16080 gene pilD 28698 27847 CDS product type IV prepilin peptidase/methyltransferase PilD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112839.1 protein_id gnl|my_center|LOCUS_16080 29924 28698 gene locus_tag LOCUS_16090 29924 28698 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 protein_id gnl|my_center|LOCUS_16090 31659 29944 gene locus_tag LOCUS_16100 gene pilB 31659 29944 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_16100 33012 31741 gene locus_tag LOCUS_16110 33012 31741 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194395.1 protein_id gnl|my_center|LOCUS_16110 33852 33013 gene locus_tag LOCUS_16120 gene ccsA 33852 33013 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929606.1 protein_id gnl|my_center|LOCUS_16120 33882 35252 gene locus_tag LOCUS_16130 gene ffh 33882 35252 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_16130 35837 35253 gene locus_tag LOCUS_16140 35837 35253 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_16140 37594 35861 gene locus_tag LOCUS_16150 37594 35861 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_16150 37708 38259 gene locus_tag LOCUS_16160 37708 38259 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_16160 38256 38771 gene locus_tag LOCUS_16170 38256 38771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 38771 39391 gene locus_tag LOCUS_16180 gene coq7 38771 39391 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194286.1 protein_id gnl|my_center|LOCUS_16180 39787 39398 gene locus_tag LOCUS_16190 39787 39398 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_16190 40310 40738 gene locus_tag LOCUS_16200 gene rplM 40310 40738 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_16200 40748 41140 gene locus_tag LOCUS_16210 gene rpsI 40748 41140 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence24 1039 350 gene locus_tag LOCUS_16220 1039 350 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704843.1 protein_id gnl|my_center|LOCUS_16220 1423 1085 gene locus_tag LOCUS_16230 1423 1085 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185161.1 protein_id gnl|my_center|LOCUS_16230 1954 1502 gene locus_tag LOCUS_16240 1954 1502 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704516.1 protein_id gnl|my_center|LOCUS_16240 2274 1957 gene locus_tag LOCUS_16250 2274 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2651 2271 gene locus_tag LOCUS_16260 2651 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3359 2697 gene locus_tag LOCUS_16270 3359 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16270 4207 3356 gene locus_tag LOCUS_16280 gene asd 4207 3356 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 protein_id gnl|my_center|LOCUS_16280 5259 4237 gene locus_tag LOCUS_16290 gene rlmF 5259 4237 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092887.1 protein_id gnl|my_center|LOCUS_16290 5649 7544 gene locus_tag LOCUS_16300 5649 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7541 11125 gene locus_tag LOCUS_16310 7541 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 12334 11177 gene locus_tag LOCUS_16320 12334 11177 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205163.1 protein_id gnl|my_center|LOCUS_16320 12504 13757 gene locus_tag LOCUS_16330 12504 13757 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_16330 13847 15061 gene locus_tag LOCUS_16340 13847 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 15066 15497 gene locus_tag LOCUS_16350 15066 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 15611 16051 gene locus_tag LOCUS_16360 15611 16051 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_16360 16837 16037 gene locus_tag LOCUS_16370 16837 16037 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_16370 17813 16830 gene locus_tag LOCUS_16380 17813 16830 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_16380 18899 17913 gene locus_tag LOCUS_16390 18899 17913 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_16390 19152 19850 gene locus_tag LOCUS_16400 19152 19850 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188685.1 protein_id gnl|my_center|LOCUS_16400 19987 20373 gene locus_tag LOCUS_16410 gene sdhC 19987 20373 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813654.1 protein_id gnl|my_center|LOCUS_16410 20370 20717 gene locus_tag LOCUS_16420 gene sdhD 20370 20717 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_16420 20720 22504 gene locus_tag LOCUS_16430 gene sdhA 20720 22504 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980875.1 protein_id gnl|my_center|LOCUS_16430 22519 23229 gene locus_tag LOCUS_16440 22519 23229 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_16440 23229 23489 gene locus_tag LOCUS_16450 23229 23489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 23554 24852 gene locus_tag LOCUS_16460 23554 24852 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 protein_id gnl|my_center|LOCUS_16460 24993 27800 gene locus_tag LOCUS_16470 24993 27800 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_16470 27824 29047 gene locus_tag LOCUS_16480 gene odhB 27824 29047 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192735.1 protein_id gnl|my_center|LOCUS_16480 29177 30601 gene locus_tag LOCUS_16490 gene lpdA 29177 30601 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065168.1 protein_id gnl|my_center|LOCUS_16490 30705 31823 gene locus_tag LOCUS_16500 gene zapE 30705 31823 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_16500 31834 32631 gene locus_tag LOCUS_16510 31834 32631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 32861 35605 gene locus_tag LOCUS_16520 32861 35605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16520 36972 35689 gene locus_tag LOCUS_16530 36972 35689 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 protein_id gnl|my_center|LOCUS_16530 37148 37753 gene locus_tag LOCUS_16540 gene slmA 37148 37753 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927138.1 protein_id gnl|my_center|LOCUS_16540 37750 38940 gene locus_tag LOCUS_16550 37750 38940 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_16550 38988 40130 gene locus_tag LOCUS_16560 38988 40130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_16560 40132 40836 gene locus_tag LOCUS_16570 40132 40836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence25 1161 34 gene locus_tag LOCUS_16580 1161 34 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809304.1 protein_id gnl|my_center|LOCUS_16580 2397 1732 gene locus_tag LOCUS_16590 2397 1732 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036586.1 protein_id gnl|my_center|LOCUS_16590 2594 2947 gene locus_tag LOCUS_16600 2594 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2949 3413 gene locus_tag LOCUS_16610 2949 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3911 3438 gene locus_tag LOCUS_16620 3911 3438 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_16620 4032 5729 gene locus_tag LOCUS_16630 gene leuA 4032 5729 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_16630 5995 6894 gene locus_tag LOCUS_16640 5995 6894 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_16640 6909 7169 gene locus_tag LOCUS_16650 gene infA 6909 7169 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388420.1 protein_id gnl|my_center|LOCUS_16650 7939 7166 gene locus_tag LOCUS_16660 7939 7166 CDS product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_16660 8376 7936 gene locus_tag LOCUS_16670 8376 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 9419 8388 gene locus_tag LOCUS_16680 gene pyrC 9419 8388 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_16680 13050 9442 gene locus_tag LOCUS_16690 13050 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 13995 13135 gene locus_tag LOCUS_16700 gene rsmI 13995 13135 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812294.1 protein_id gnl|my_center|LOCUS_16700 14005 14367 gene locus_tag LOCUS_16710 14005 14367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 14422 15045 gene locus_tag LOCUS_16720 14422 15045 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692028.1 protein_id gnl|my_center|LOCUS_16720 15042 15689 gene locus_tag LOCUS_16730 15042 15689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 15722 16105 gene locus_tag LOCUS_16740 15722 16105 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_16740 16119 17831 gene locus_tag LOCUS_16750 16119 17831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 19666 17828 gene locus_tag LOCUS_16760 19666 17828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 20669 19671 gene locus_tag LOCUS_16770 20669 19671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 21586 20684 gene locus_tag LOCUS_16780 21586 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 24626 21630 gene locus_tag LOCUS_16790 24626 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 25164 24742 gene locus_tag LOCUS_16800 25164 24742 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383062.1 protein_id gnl|my_center|LOCUS_16800 25927 25166 gene locus_tag LOCUS_16810 25927 25166 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_16810 26461 25937 gene locus_tag LOCUS_16820 26461 25937 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104051.1 protein_id gnl|my_center|LOCUS_16820 27681 26458 gene locus_tag LOCUS_16830 27681 26458 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338708.1 protein_id gnl|my_center|LOCUS_16830 28236 27691 gene locus_tag LOCUS_16840 28236 27691 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104050.1 protein_id gnl|my_center|LOCUS_16840 29425 28241 gene locus_tag LOCUS_16850 29425 28241 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 protein_id gnl|my_center|LOCUS_16850 30192 29422 gene locus_tag LOCUS_16860 30192 29422 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_16860 31538 30198 gene locus_tag LOCUS_16870 31538 30198 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_16870 32348 31548 gene locus_tag LOCUS_16880 gene folE2 32348 31548 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_16880 32947 32384 gene locus_tag LOCUS_16890 32947 32384 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_16890 33054 33977 gene locus_tag LOCUS_16900 gene carH 33054 33977 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_16900 34141 34629 gene locus_tag LOCUS_16910 gene rfaE2 34141 34629 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_16910 36523 34631 gene locus_tag LOCUS_16920 36523 34631 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766050.1 protein_id gnl|my_center|LOCUS_16920 37460 36603 gene locus_tag LOCUS_16930 37460 36603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 37963 37505 gene locus_tag LOCUS_16940 gene ssb1 37963 37505 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168322.1 protein_id gnl|my_center|LOCUS_16940 39159 37981 gene locus_tag LOCUS_16950 39159 37981 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195190.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence26 809 357 gene locus_tag LOCUS_16960 809 357 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_16960 1727 813 gene locus_tag LOCUS_16970 1727 813 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_16970 2741 1737 gene locus_tag LOCUS_16980 2741 1737 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_16980 2796 3758 gene locus_tag LOCUS_16990 2796 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4709 3762 gene locus_tag LOCUS_17000 4709 3762 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 protein_id gnl|my_center|LOCUS_17000 5809 4706 gene locus_tag LOCUS_17010 gene rodA 5809 4706 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_17010 7706 5796 gene locus_tag LOCUS_17020 gene mrdA 7706 5796 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_17020 8235 7714 gene locus_tag LOCUS_17030 gene mreD 8235 7714 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038565.1 protein_id gnl|my_center|LOCUS_17030 9137 8235 gene locus_tag LOCUS_17040 gene mreC 9137 8235 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17040 10211 9168 gene locus_tag LOCUS_17050 10211 9168 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_17050 10318 10605 gene locus_tag LOCUS_17060 gene gatC 10318 10605 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_17060 10602 12059 gene locus_tag LOCUS_17070 gene gatA 10602 12059 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_17070 12063 12596 gene locus_tag LOCUS_17080 12063 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 12609 14063 gene locus_tag LOCUS_17090 gene gatB 12609 14063 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_17090 14699 14064 gene locus_tag LOCUS_17100 14699 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 15330 14689 gene locus_tag LOCUS_17110 gene pyrE 15330 14689 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_17110 15375 16163 gene locus_tag LOCUS_17120 15375 16163 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225717.1 protein_id gnl|my_center|LOCUS_17120 16237 16551 gene locus_tag LOCUS_17130 16237 16551 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533578.1 protein_id gnl|my_center|LOCUS_17130 16557 16961 gene locus_tag LOCUS_17140 16557 16961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 16958 17251 gene locus_tag LOCUS_17150 16958 17251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 17248 17565 gene locus_tag LOCUS_17160 17248 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 18820 17549 gene locus_tag LOCUS_17170 18820 17549 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 protein_id gnl|my_center|LOCUS_17170 19431 18820 gene locus_tag LOCUS_17180 gene metW 19431 18820 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198304.1 protein_id gnl|my_center|LOCUS_17180 20558 19428 gene locus_tag LOCUS_17190 20558 19428 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_17190 22827 20737 gene locus_tag LOCUS_17200 22827 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 23723 22824 gene locus_tag LOCUS_17210 23723 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 24757 23867 gene locus_tag LOCUS_17220 24757 23867 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_17220 25746 24754 gene locus_tag LOCUS_17230 gene cobD 25746 24754 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_17230 26674 25739 gene locus_tag LOCUS_17240 gene cbiB 26674 25739 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112351.1 protein_id gnl|my_center|LOCUS_17240 27405 26671 gene locus_tag LOCUS_17250 gene bluB 27405 26671 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_17250 27496 28992 gene locus_tag LOCUS_17260 27496 28992 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038176.1 protein_id gnl|my_center|LOCUS_17260 30317 28965 gene locus_tag LOCUS_17270 30317 28965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 30925 30314 gene locus_tag LOCUS_17280 30925 30314 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_17280 31519 30959 gene locus_tag LOCUS_17290 gene cobU 31519 30959 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_17290 31808 32938 gene locus_tag LOCUS_17300 gene cobT 31808 32938 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_17300 32945 33730 gene locus_tag LOCUS_17310 32945 33730 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_17310 34308 34407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34460 35572 gene locus_tag LOCUS_17320 gene rfaQ 34460 35572 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703803.1 protein_id gnl|my_center|LOCUS_17320 35569 36705 gene locus_tag LOCUS_17330 35569 36705 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 protein_id gnl|my_center|LOCUS_17330 36739 37152 gene locus_tag LOCUS_17340 36739 37152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 37254 37424 gene locus_tag LOCUS_17350 37254 37424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence27 600 58 gene locus_tag LOCUS_17360 600 58 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040134.1 protein_id gnl|my_center|LOCUS_17360 2142 664 gene locus_tag LOCUS_17370 gene nuoN 2142 664 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_17370 3639 2155 gene locus_tag LOCUS_17380 3639 2155 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_17380 5708 3672 gene locus_tag LOCUS_17390 gene nuoL 5708 3672 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_17390 6022 5711 gene locus_tag LOCUS_17400 gene nuoK 6022 5711 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_17400 6633 6037 gene locus_tag LOCUS_17410 6633 6037 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_17410 7134 6646 gene locus_tag LOCUS_17420 gene nuoI 7134 6646 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_17420 8194 7145 gene locus_tag LOCUS_17430 gene nuoH 8194 7145 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196426.1 protein_id gnl|my_center|LOCUS_17430 10525 8195 gene locus_tag LOCUS_17440 gene nuoG 10525 8195 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543813.1 protein_id gnl|my_center|LOCUS_17440 11899 10571 gene locus_tag LOCUS_17450 gene nuoF 11899 10571 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_17450 12372 11899 gene locus_tag LOCUS_17460 gene nuoE 12372 11899 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 protein_id gnl|my_center|LOCUS_17460 13625 12372 gene locus_tag LOCUS_17470 13625 12372 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_17470 14223 13618 gene locus_tag LOCUS_17480 14223 13618 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_17480 14719 14243 gene locus_tag LOCUS_17490 14719 14243 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_17490 15139 14726 gene locus_tag LOCUS_17500 15139 14726 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_17500 15247 15163 gene locus_tag LOCUS_t00290 15247 15163 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15669 15298 gene locus_tag LOCUS_17510 gene secG 15669 15298 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_17510 16396 15683 gene locus_tag LOCUS_17520 gene tpiA 16396 15683 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100513.1 protein_id gnl|my_center|LOCUS_17520 17866 16514 gene locus_tag LOCUS_17530 gene glmM 17866 16514 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_17530 18698 17859 gene locus_tag LOCUS_17540 gene folP 18698 17859 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_17540 20619 18739 gene locus_tag LOCUS_17550 gene ftsH 20619 18739 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_17550 21262 20675 gene locus_tag LOCUS_17560 21262 20675 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 protein_id gnl|my_center|LOCUS_17560 21324 21686 gene locus_tag LOCUS_17570 21324 21686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 22148 21687 gene locus_tag LOCUS_17580 22148 21687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 22631 22155 gene locus_tag LOCUS_17590 gene greA 22631 22155 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_17590 25311 22699 gene locus_tag LOCUS_17600 25311 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 24826 24925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26502 25333 gene locus_tag LOCUS_17610 gene carA 26502 25333 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_17610 29159 26619 gene locus_tag LOCUS_17620 29159 26619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 29971 29165 gene locus_tag LOCUS_17630 gene dapB 29971 29165 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930964.1 protein_id gnl|my_center|LOCUS_17630 30457 29975 gene locus_tag LOCUS_17640 30457 29975 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105026.1 protein_id gnl|my_center|LOCUS_17640 30537 31004 gene locus_tag LOCUS_17650 gene fur 30537 31004 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_17650 31004 31603 gene locus_tag LOCUS_17660 31004 31603 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_17660 32112 31594 gene locus_tag LOCUS_17670 32112 31594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 33831 32164 gene locus_tag LOCUS_17680 gene recN 33831 32164 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 protein_id gnl|my_center|LOCUS_17680 34760 33831 gene locus_tag LOCUS_17690 34760 33831 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_17690 34808 35836 gene locus_tag LOCUS_17700 gene hrcA 34808 35836 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence28 550 293 gene locus_tag LOCUS_17710 550 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3859 758 gene locus_tag LOCUS_17720 3859 758 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_17720 4290 3868 gene locus_tag LOCUS_17730 4290 3868 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_17730 4675 4280 gene locus_tag LOCUS_17740 4675 4280 CDS product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_17740 5604 4672 gene locus_tag LOCUS_17750 5604 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 7112 6042 gene locus_tag LOCUS_17760 7112 6042 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_17760 9304 7109 gene locus_tag LOCUS_17770 9304 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 10996 9632 gene locus_tag LOCUS_17780 gene bioA 10996 9632 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189232.1 protein_id gnl|my_center|LOCUS_17780 12168 10996 gene locus_tag LOCUS_17790 12168 10996 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039403.1 protein_id gnl|my_center|LOCUS_17790 12255 13028 gene locus_tag LOCUS_17800 gene yaaA 12255 13028 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186203.1 protein_id gnl|my_center|LOCUS_17800 13143 15938 gene locus_tag LOCUS_17810 13143 15938 CDS product bifunctional glycoside hydrolase 114/ polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113950.1 protein_id gnl|my_center|LOCUS_17810 15904 19716 gene locus_tag LOCUS_17820 15904 19716 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113951.1 protein_id gnl|my_center|LOCUS_17820 19756 20301 gene locus_tag LOCUS_17830 19756 20301 CDS product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 protein_id gnl|my_center|LOCUS_17830 20321 21721 gene locus_tag LOCUS_17840 20321 21721 CDS product PelD GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113952.1 protein_id gnl|my_center|LOCUS_17840 21711 22733 gene locus_tag LOCUS_17850 21711 22733 CDS product pellicle/biofilm biosynthesis protein PelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113953.1 protein_id gnl|my_center|LOCUS_17850 22730 24259 gene locus_tag LOCUS_17860 gene pelF 22730 24259 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_17860 24264 25643 gene locus_tag LOCUS_17870 gene pelG 24264 25643 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_17870 26069 25653 gene locus_tag LOCUS_17880 26069 25653 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531895.1 protein_id gnl|my_center|LOCUS_17880 26128 27477 gene locus_tag LOCUS_17890 26128 27477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 27501 28442 gene locus_tag LOCUS_17900 27501 28442 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 protein_id gnl|my_center|LOCUS_17900 28445 29134 gene locus_tag LOCUS_17910 28445 29134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 29187 29507 gene locus_tag LOCUS_17920 29187 29507 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096284.1 protein_id gnl|my_center|LOCUS_17920 29597 31177 gene locus_tag LOCUS_17930 gene zorA 29597 31177 CDS product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036639.1 protein_id gnl|my_center|LOCUS_17930 31174 31896 gene locus_tag LOCUS_17940 31174 31896 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036640.1 protein_id gnl|my_center|LOCUS_17940 31893 32456 gene locus_tag LOCUS_17950 31893 32456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 33576 32539 gene locus_tag LOCUS_17960 gene tal 33576 32539 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689551.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence29 933 1472 gene locus_tag LOCUS_17970 933 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2122 1595 gene locus_tag LOCUS_17980 2122 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 4325 2295 gene locus_tag LOCUS_17990 4325 2295 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966949.1 protein_id gnl|my_center|LOCUS_17990 5036 4335 gene locus_tag LOCUS_18000 gene lolD 5036 4335 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161961949.1 protein_id gnl|my_center|LOCUS_18000 6276 5029 gene locus_tag LOCUS_18010 6276 5029 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_18010 6638 8413 gene locus_tag LOCUS_18020 6638 8413 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389742.1 protein_id gnl|my_center|LOCUS_18020 8424 10157 gene locus_tag LOCUS_18030 gene ngg 8424 10157 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111433.1 protein_id gnl|my_center|LOCUS_18030 10158 11393 gene locus_tag LOCUS_18040 10158 11393 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111432.1 protein_id gnl|my_center|LOCUS_18040 11800 11399 gene locus_tag LOCUS_18050 11800 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 11945 12970 gene locus_tag LOCUS_18060 11945 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193226.1 protein_id gnl|my_center|LOCUS_18060 12967 14655 gene locus_tag LOCUS_18070 gene recJ 12967 14655 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_18070 16772 14706 gene locus_tag LOCUS_18080 16772 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 17892 16993 gene locus_tag LOCUS_18090 17892 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 18752 17901 gene locus_tag LOCUS_18100 18752 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 19273 20250 gene locus_tag LOCUS_18110 gene prfB 19273 20250 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 protein_id gnl|my_center|LOCUS_18110 20272 21504 gene locus_tag LOCUS_18120 20272 21504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 23791 21506 gene locus_tag LOCUS_18130 23791 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 23936 25444 gene locus_tag LOCUS_18140 gene lysS 23936 25444 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205152.1 protein_id gnl|my_center|LOCUS_18140 25441 27237 gene locus_tag LOCUS_18150 gene mnmC 25441 27237 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554661.1 protein_id gnl|my_center|LOCUS_18150 27362 27787 gene locus_tag LOCUS_18160 gene norC 27362 27787 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_18160 27833 29209 gene locus_tag LOCUS_18170 gene norB 27833 29209 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_18170 29333 29932 gene locus_tag LOCUS_18180 29333 29932 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_18180 29919 30200 gene locus_tag LOCUS_18190 29919 30200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 30197 30997 gene locus_tag LOCUS_18200 gene nirQ 30197 30997 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_18200 31001 31405 gene locus_tag LOCUS_18210 31001 31405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 31402 32370 gene locus_tag LOCUS_18220 31402 32370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 32637 34241 gene locus_tag LOCUS_18230 32637 34241 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence30 2141 309 gene locus_tag LOCUS_18240 2141 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3211 2141 gene locus_tag LOCUS_18250 3211 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4385 3213 gene locus_tag LOCUS_18260 4385 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4862 4389 gene locus_tag LOCUS_18270 4862 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5218 4865 gene locus_tag LOCUS_18280 5218 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 8158 5399 gene locus_tag LOCUS_18290 8158 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 8408 8214 gene locus_tag LOCUS_18300 8408 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 8846 8568 gene locus_tag LOCUS_18310 8846 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 9463 8996 gene locus_tag LOCUS_18320 9463 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 10446 9463 gene locus_tag LOCUS_18330 10446 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 10911 10462 gene locus_tag LOCUS_18340 10911 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 11528 10911 gene locus_tag LOCUS_18350 11528 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 11827 11525 gene locus_tag LOCUS_18360 11827 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 12047 11820 gene locus_tag LOCUS_18370 12047 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 13387 12047 gene locus_tag LOCUS_18380 13387 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 13875 13387 gene locus_tag LOCUS_18390 13875 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 14032 13856 gene locus_tag LOCUS_18400 14032 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 14236 14036 gene locus_tag LOCUS_18410 14236 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 14746 14240 gene locus_tag LOCUS_18420 14746 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 15194 14751 gene locus_tag LOCUS_18430 15194 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 15565 15191 gene locus_tag LOCUS_18440 15565 15191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 15897 15565 gene locus_tag LOCUS_18450 15897 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 16969 15944 gene locus_tag LOCUS_18460 16969 15944 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104533.1 protein_id gnl|my_center|LOCUS_18460 17846 16986 gene locus_tag LOCUS_18470 17846 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 19049 17862 gene locus_tag LOCUS_18480 19049 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 20577 19027 gene locus_tag LOCUS_18490 20577 19027 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975801.1 protein_id gnl|my_center|LOCUS_18490 20786 20574 gene locus_tag LOCUS_18500 20786 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 21545 21084 gene locus_tag LOCUS_18510 21545 21084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 22123 21542 gene locus_tag LOCUS_18520 22123 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 22596 22348 gene locus_tag LOCUS_18530 22596 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344389.1 protein_id gnl|my_center|LOCUS_18530 23126 22593 gene locus_tag LOCUS_18540 23126 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 23592 23119 gene locus_tag LOCUS_18550 23592 23119 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164761.1 protein_id gnl|my_center|LOCUS_18550 24875 23640 gene locus_tag LOCUS_18560 24875 23640 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113632.1 protein_id gnl|my_center|LOCUS_18560 25339 24872 gene locus_tag LOCUS_18570 25339 24872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 25584 25417 gene locus_tag LOCUS_18580 25584 25417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 26146 25595 gene locus_tag LOCUS_18590 26146 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 27679 26249 gene locus_tag LOCUS_18600 27679 26249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 28450 27695 gene locus_tag LOCUS_18610 28450 27695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 28886 28560 gene locus_tag LOCUS_18620 28886 28560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 30187 29006 gene locus_tag LOCUS_18630 30187 29006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 30397 30224 gene locus_tag LOCUS_18640 30397 30224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 30788 30453 gene locus_tag LOCUS_18650 30788 30453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 31091 30849 gene locus_tag LOCUS_18660 31091 30849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 33112 31076 gene locus_tag LOCUS_18670 33112 31076 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027298.1 protein_id gnl|my_center|LOCUS_18670 33620 33093 gene locus_tag LOCUS_18680 33620 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence31 2921 225 gene locus_tag LOCUS_18690 2921 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3325 4329 gene locus_tag LOCUS_18700 3325 4329 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_18700 4326 4976 gene locus_tag LOCUS_18710 4326 4976 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_18710 4955 5329 gene locus_tag LOCUS_18720 4955 5329 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193415.1 protein_id gnl|my_center|LOCUS_18720 5307 6269 gene locus_tag LOCUS_18730 5307 6269 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_18730 6983 6273 gene locus_tag LOCUS_18740 6983 6273 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_18740 7561 6980 gene locus_tag LOCUS_18750 7561 6980 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_18750 7698 8162 gene locus_tag LOCUS_18760 7698 8162 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065088.1 protein_id gnl|my_center|LOCUS_18760 8184 8363 gene locus_tag LOCUS_18770 gene rpmF 8184 8363 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 protein_id gnl|my_center|LOCUS_18770 8382 9446 gene locus_tag LOCUS_18780 gene plsX 8382 9446 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_18780 9447 10406 gene locus_tag LOCUS_18790 9447 10406 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 protein_id gnl|my_center|LOCUS_18790 10425 11351 gene locus_tag LOCUS_18800 gene fabD 10425 11351 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020093.1 protein_id gnl|my_center|LOCUS_18800 11355 12095 gene locus_tag LOCUS_18810 gene fabG 11355 12095 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_18810 12169 12405 gene locus_tag LOCUS_18820 gene acpP 12169 12405 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_18820 12478 13713 gene locus_tag LOCUS_18830 gene fabF 12478 13713 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_18830 13741 14178 gene locus_tag LOCUS_18840 13741 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 15730 14132 gene locus_tag LOCUS_18850 gene nadB 15730 14132 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_18850 15894 16493 gene locus_tag LOCUS_18860 gene rpoE 15894 16493 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_18860 16499 16930 gene locus_tag LOCUS_18870 16499 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 16950 18386 gene locus_tag LOCUS_18880 16950 18386 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_18880 18376 18621 gene locus_tag LOCUS_18890 18376 18621 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687723.1 protein_id gnl|my_center|LOCUS_18890 18682 20472 gene locus_tag LOCUS_18900 gene lepA 18682 20472 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_18900 20481 21269 gene locus_tag LOCUS_18910 gene lepB 20481 21269 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_18910 21278 21628 gene locus_tag LOCUS_18920 21278 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 21631 22299 gene locus_tag LOCUS_18930 gene rnc 21631 22299 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 protein_id gnl|my_center|LOCUS_18930 22296 23180 gene locus_tag LOCUS_18940 gene era 22296 23180 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244050.1 protein_id gnl|my_center|LOCUS_18940 23196 23924 gene locus_tag LOCUS_18950 gene recO 23196 23924 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_18950 23921 24676 gene locus_tag LOCUS_18960 23921 24676 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_18960 24673 25047 gene locus_tag LOCUS_18970 gene acpS 24673 25047 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_18970 25041 26084 gene locus_tag LOCUS_18980 gene nagZ 25041 26084 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_18980 27281 26331 gene locus_tag LOCUS_18990 gene argC 27281 26331 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_18990 27994 27437 gene locus_tag LOCUS_19000 gene efp 27994 27437 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_19000 29128 28034 gene locus_tag LOCUS_19010 gene earP 29128 28034 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 protein_id gnl|my_center|LOCUS_19010 29127 29777 gene locus_tag LOCUS_19020 29127 29777 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_19020 29793 31610 gene locus_tag LOCUS_19030 gene uvrC 29793 31610 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449735.1 protein_id gnl|my_center|LOCUS_19030 31617 32195 gene locus_tag LOCUS_19040 gene pgsA 31617 32195 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_19040 32251 32326 gene locus_tag LOCUS_t00300 32251 32326 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32380 32453 gene locus_tag LOCUS_t00310 32380 32453 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 32461 32536 gene locus_tag LOCUS_t00320 32461 32536 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32603 32688 gene locus_tag LOCUS_t00330 32603 32688 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32957 33172 gene locus_tag LOCUS_19050 32957 33172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence32 428 57 gene locus_tag LOCUS_19060 gene rplS 428 57 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_19060 1215 454 gene locus_tag LOCUS_19070 gene trmD 1215 454 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_19070 1746 1237 gene locus_tag LOCUS_19080 gene rimM 1746 1237 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957579.1 protein_id gnl|my_center|LOCUS_19080 2015 1761 gene locus_tag LOCUS_19090 gene rpsP 2015 1761 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 protein_id gnl|my_center|LOCUS_19090 2187 3704 gene locus_tag LOCUS_19100 2187 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3745 4347 gene locus_tag LOCUS_19110 gene wrbA 3745 4347 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036095.1 protein_id gnl|my_center|LOCUS_19110 4338 4703 gene locus_tag LOCUS_19120 4338 4703 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812700.1 protein_id gnl|my_center|LOCUS_19120 6284 4743 gene locus_tag LOCUS_19130 6284 4743 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_19130 7053 6301 gene locus_tag LOCUS_19140 gene pssA 7053 6301 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_19140 8221 7205 gene locus_tag LOCUS_19150 gene ilvC 8221 7205 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_19150 8737 8246 gene locus_tag LOCUS_19160 gene ilvN 8737 8246 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_19160 10370 8757 gene locus_tag LOCUS_19170 10370 8757 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_19170 10293 10463 gene locus_tag LOCUS_19180 10293 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 10477 11139 gene locus_tag LOCUS_19190 10477 11139 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_19190 11136 11534 gene locus_tag LOCUS_19200 11136 11534 CDS product DUF3619 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204965.1 protein_id gnl|my_center|LOCUS_19200 11684 12034 gene locus_tag LOCUS_19210 11684 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 12056 12514 gene locus_tag LOCUS_19220 12056 12514 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 protein_id gnl|my_center|LOCUS_19220 13540 12464 gene locus_tag LOCUS_19230 gene lptG 13540 12464 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_19230 14640 13537 gene locus_tag LOCUS_19240 gene lptF 14640 13537 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_19240 14712 16208 gene locus_tag LOCUS_19250 gene pepA 14712 16208 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_19250 16205 16627 gene locus_tag LOCUS_19260 16205 16627 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193228.1 protein_id gnl|my_center|LOCUS_19260 16636 17229 gene locus_tag LOCUS_19270 16636 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 17284 20187 gene locus_tag LOCUS_19280 17284 20187 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_19280 20189 20677 gene locus_tag LOCUS_19290 20189 20677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 22366 20729 gene locus_tag LOCUS_19300 gene pabB 22366 20729 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927074.1 protein_id gnl|my_center|LOCUS_19300 22469 22568 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22801 22574 gene locus_tag LOCUS_19310 22801 22574 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_19310 24312 22840 gene locus_tag LOCUS_19320 24312 22840 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_19320 24359 24871 gene locus_tag LOCUS_19330 gene moaC 24359 24871 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_19330 25210 25007 gene locus_tag LOCUS_19340 25210 25007 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_19340 25480 25788 gene locus_tag LOCUS_19350 gene clpS 25480 25788 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_19350 25788 28046 gene locus_tag LOCUS_19360 gene clpA 25788 28046 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_19360 28123 28614 gene locus_tag LOCUS_19370 gene rraA 28123 28614 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267431.1 protein_id gnl|my_center|LOCUS_19370 30484 28676 gene locus_tag LOCUS_19380 30484 28676 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267534.1 protein_id gnl|my_center|LOCUS_19380 30793 32103 gene locus_tag LOCUS_19390 gene aceA 30793 32103 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence33 1594 200 gene locus_tag LOCUS_19400 gene amgS 1594 200 CDS product two-component system sensor histidine kinase AmgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096258.1 protein_id gnl|my_center|LOCUS_19400 2313 1591 gene locus_tag LOCUS_19410 2313 1591 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089391.1 protein_id gnl|my_center|LOCUS_19410 2808 3077 gene locus_tag LOCUS_19420 2808 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3089 3607 gene locus_tag LOCUS_19430 3089 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3756 4895 gene locus_tag LOCUS_19440 3756 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 5560 5132 gene locus_tag LOCUS_19450 5560 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 5724 6974 gene locus_tag LOCUS_19460 gene hemA 5724 6974 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_19460 7008 8090 gene locus_tag LOCUS_19470 gene prfA 7008 8090 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 protein_id gnl|my_center|LOCUS_19470 8087 8908 gene locus_tag LOCUS_19480 gene prmC 8087 8908 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929958.1 protein_id gnl|my_center|LOCUS_19480 8922 9245 gene locus_tag LOCUS_19490 gene grxD 8922 9245 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_19490 9691 9314 gene locus_tag LOCUS_19500 9691 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 9980 10279 gene locus_tag LOCUS_19510 9980 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 11714 10329 gene locus_tag LOCUS_19520 gene argH 11714 10329 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_19520 11784 12785 gene locus_tag LOCUS_19530 11784 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 12782 13579 gene locus_tag LOCUS_19540 12782 13579 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_19540 13674 13773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14664 13783 gene locus_tag LOCUS_19550 14664 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 14927 17164 gene locus_tag LOCUS_19560 gene ggpS 14927 17164 CDS product glucosylglycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038150.1 protein_id gnl|my_center|LOCUS_19560 17697 17161 gene locus_tag LOCUS_19570 17697 17161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 17906 18490 gene locus_tag LOCUS_19580 17906 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 18680 20269 gene locus_tag LOCUS_19590 18680 20269 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_19590 20484 21452 gene locus_tag LOCUS_19600 20484 21452 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_19600 21449 24520 gene locus_tag LOCUS_19610 21449 24520 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 protein_id gnl|my_center|LOCUS_19610 24517 25794 gene locus_tag LOCUS_19620 24517 25794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 29491 25838 gene locus_tag LOCUS_19630 29491 25838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 31188 29494 gene locus_tag LOCUS_19640 31188 29494 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence34 446 1921 gene locus_tag LOCUS_19650 gene trpE 446 1921 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 protein_id gnl|my_center|LOCUS_19650 2679 1918 gene locus_tag LOCUS_19660 2679 1918 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_19660 4033 2660 gene locus_tag LOCUS_19670 4033 2660 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992328.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19670 4233 4448 gene locus_tag LOCUS_19680 4233 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4689 5261 gene locus_tag LOCUS_19690 4689 5261 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 protein_id gnl|my_center|LOCUS_19690 5258 6283 gene locus_tag LOCUS_19700 gene trpD 5258 6283 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_19700 6314 6892 gene locus_tag LOCUS_19710 6314 6892 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_19710 6889 7677 gene locus_tag LOCUS_19720 gene trpC 6889 7677 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_19720 8425 7823 gene locus_tag LOCUS_19730 8425 7823 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_19730 8657 9688 gene locus_tag LOCUS_19740 gene omp38 8657 9688 CDS product porin Omp38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528149.1 protein_id gnl|my_center|LOCUS_19740 10264 10363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11519 10401 gene locus_tag LOCUS_19750 gene proB 11519 10401 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_19750 12606 11521 gene locus_tag LOCUS_19760 gene obgE 12606 11521 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_19760 12941 12678 gene locus_tag LOCUS_19770 gene rpmA 12941 12678 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948350.1 protein_id gnl|my_center|LOCUS_19770 13274 12963 gene locus_tag LOCUS_19780 gene rplU 13274 12963 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_19780 13400 13744 gene locus_tag LOCUS_19790 13400 13744 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_19790 13741 14817 gene locus_tag LOCUS_19800 13741 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 15340 14918 gene locus_tag LOCUS_19810 15340 14918 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_19810 16618 15419 gene locus_tag LOCUS_19820 16618 15419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_19820 17828 16620 gene locus_tag LOCUS_19830 17828 16620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_19830 18520 17819 gene locus_tag LOCUS_19840 18520 17819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_19840 19660 18521 gene locus_tag LOCUS_19850 19660 18521 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095131.1 protein_id gnl|my_center|LOCUS_19850 20257 19670 gene locus_tag LOCUS_19860 20257 19670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 20918 20601 gene locus_tag LOCUS_19870 20918 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 21744 20920 gene locus_tag LOCUS_19880 21744 20920 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_19880 22295 21741 gene locus_tag LOCUS_19890 22295 21741 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703426.1 protein_id gnl|my_center|LOCUS_19890 23181 22300 gene locus_tag LOCUS_19900 23181 22300 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_19900 24017 23205 gene locus_tag LOCUS_19910 gene pyrF 24017 23205 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_19910 25183 24014 gene locus_tag LOCUS_19920 25183 24014 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611273.1 protein_id gnl|my_center|LOCUS_19920 27109 25274 gene locus_tag LOCUS_19930 27109 25274 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193654.1 protein_id gnl|my_center|LOCUS_19930 28767 27196 gene locus_tag LOCUS_19940 28767 27196 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_19940 28925 29314 gene locus_tag LOCUS_19950 gene crcB 28925 29314 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_19950 31117 29480 gene locus_tag LOCUS_19960 31117 29480 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880567.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence35 40 696 gene locus_tag LOCUS_19970 40 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 914 1858 gene locus_tag LOCUS_19980 914 1858 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_19980 1865 3934 gene locus_tag LOCUS_19990 1865 3934 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070809.1 protein_id gnl|my_center|LOCUS_19990 3931 4353 gene locus_tag LOCUS_20000 3931 4353 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099655.1 protein_id gnl|my_center|LOCUS_20000 4350 6170 gene locus_tag LOCUS_20010 4350 6170 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939039.1 protein_id gnl|my_center|LOCUS_20010 6163 7512 gene locus_tag LOCUS_20020 6163 7512 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529601.1 protein_id gnl|my_center|LOCUS_20020 7560 8567 gene locus_tag LOCUS_20030 gene murB 7560 8567 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 protein_id gnl|my_center|LOCUS_20030 9249 8542 gene locus_tag LOCUS_20040 9249 8542 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965197.1 protein_id gnl|my_center|LOCUS_20040 9353 9922 gene locus_tag LOCUS_20050 9353 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 9935 13111 gene locus_tag LOCUS_20060 9935 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 13450 13121 gene locus_tag LOCUS_20070 13450 13121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 13525 14175 gene locus_tag LOCUS_20080 13525 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 14175 15056 gene locus_tag LOCUS_20090 14175 15056 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_20090 15123 16358 gene locus_tag LOCUS_20100 15123 16358 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178900.1 protein_id gnl|my_center|LOCUS_20100 17282 16290 gene locus_tag LOCUS_20110 17282 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_20110 19421 17439 gene locus_tag LOCUS_20120 19421 17439 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815335.1 protein_id gnl|my_center|LOCUS_20120 20743 19685 gene locus_tag LOCUS_20130 gene hemE 20743 19685 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 protein_id gnl|my_center|LOCUS_20130 22255 20801 gene locus_tag LOCUS_20140 22255 20801 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_20140 23698 22265 gene locus_tag LOCUS_20150 gene trkA 23698 22265 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_20150 24987 23722 gene locus_tag LOCUS_20160 24987 23722 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 protein_id gnl|my_center|LOCUS_20160 27118 24965 gene locus_tag LOCUS_20170 27118 24965 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_20170 27723 27115 gene locus_tag LOCUS_20180 27723 27115 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_20180 28975 27716 gene locus_tag LOCUS_20190 gene rsmB 28975 27716 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951361.1 protein_id gnl|my_center|LOCUS_20190 29010 29882 gene locus_tag LOCUS_20200 29010 29882 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110374.1 protein_id gnl|my_center|LOCUS_20200 30830 29916 gene locus_tag LOCUS_20210 gene fmt 30830 29916 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_20210 31330 30827 gene locus_tag LOCUS_20220 gene def 31330 30827 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence36 2051 1488 gene locus_tag LOCUS_20230 gene ahpC 2051 1488 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_20230 2321 2620 gene locus_tag LOCUS_20240 2321 2620 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_20240 2678 3133 gene locus_tag LOCUS_20250 2678 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 3167 4330 gene locus_tag LOCUS_20260 3167 4330 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_20260 4342 5079 gene locus_tag LOCUS_20270 4342 5079 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_20270 5405 5851 gene locus_tag LOCUS_20280 gene mraZ 5405 5851 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931263.1 protein_id gnl|my_center|LOCUS_20280 5848 6774 gene locus_tag LOCUS_20290 gene rsmH 5848 6774 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 protein_id gnl|my_center|LOCUS_20290 6774 7043 gene locus_tag LOCUS_20300 6774 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 7043 8791 gene locus_tag LOCUS_20310 7043 8791 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195138.1 protein_id gnl|my_center|LOCUS_20310 8791 10269 gene locus_tag LOCUS_20320 8791 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 10266 11627 gene locus_tag LOCUS_20330 gene murF 10266 11627 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_20330 11627 12730 gene locus_tag LOCUS_20340 gene mraY 11627 12730 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_20340 12731 14083 gene locus_tag LOCUS_20350 gene murD 12731 14083 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705695.1 protein_id gnl|my_center|LOCUS_20350 14077 15240 gene locus_tag LOCUS_20360 gene ftsW 14077 15240 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039094.1 protein_id gnl|my_center|LOCUS_20360 15237 16295 gene locus_tag LOCUS_20370 gene murG 15237 16295 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_20370 16292 17680 gene locus_tag LOCUS_20380 gene murC 16292 17680 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_20380 17680 18585 gene locus_tag LOCUS_20390 17680 18585 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763895.1 protein_id gnl|my_center|LOCUS_20390 18594 19334 gene locus_tag LOCUS_20400 18594 19334 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_20400 19339 20568 gene locus_tag LOCUS_20410 gene ftsA 19339 20568 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_20410 20604 21785 gene locus_tag LOCUS_20420 gene ftsZ 20604 21785 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_20420 21868 22779 gene locus_tag LOCUS_20430 gene lpxC 21868 22779 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194158.1 protein_id gnl|my_center|LOCUS_20430 22786 22974 gene locus_tag LOCUS_20440 22786 22974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 23395 22961 gene locus_tag LOCUS_20450 23395 22961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 23408 24328 gene locus_tag LOCUS_20460 23408 24328 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 protein_id gnl|my_center|LOCUS_20460 24419 27112 gene locus_tag LOCUS_20470 gene secA 24419 27112 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194125.1 protein_id gnl|my_center|LOCUS_20470 27194 28420 gene locus_tag LOCUS_20480 gene argJ 27194 28420 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931662.1 protein_id gnl|my_center|LOCUS_20480 29010 28417 gene locus_tag LOCUS_20490 29010 28417 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089374.1 protein_id gnl|my_center|LOCUS_20490 29400 29017 gene locus_tag LOCUS_20500 gene apaG 29400 29017 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence37 608 108 gene locus_tag LOCUS_20510 608 108 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814305.1 protein_id gnl|my_center|LOCUS_20510 663 1700 gene locus_tag LOCUS_20520 gene mutY 663 1700 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_20520 2880 1672 gene locus_tag LOCUS_20530 2880 1672 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_20530 3310 2918 gene locus_tag LOCUS_20540 3310 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3387 5294 gene locus_tag LOCUS_20550 3387 5294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634756.1 protein_id gnl|my_center|LOCUS_20550 5393 6223 gene locus_tag LOCUS_20560 5393 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 6224 8242 gene locus_tag LOCUS_20570 6224 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 8285 8899 gene locus_tag LOCUS_20580 gene thrH 8285 8899 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_20580 8912 9340 gene locus_tag LOCUS_20590 8912 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 9344 10207 gene locus_tag LOCUS_20600 gene purU 9344 10207 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_20600 10211 10753 gene locus_tag LOCUS_20610 10211 10753 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_20610 12329 10896 gene locus_tag LOCUS_20620 12329 10896 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275136.1 protein_id gnl|my_center|LOCUS_20620 12679 12341 gene locus_tag LOCUS_20630 12679 12341 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_20630 13519 12761 gene locus_tag LOCUS_20640 13519 12761 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930529.1 protein_id gnl|my_center|LOCUS_20640 13761 14003 gene locus_tag LOCUS_20650 13761 14003 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030003521.1 protein_id gnl|my_center|LOCUS_20650 14010 15503 gene locus_tag LOCUS_20660 14010 15503 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697442.1 protein_id gnl|my_center|LOCUS_20660 15496 16704 gene locus_tag LOCUS_20670 15496 16704 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_20670 17076 16684 gene locus_tag LOCUS_20680 17076 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 17162 17656 gene locus_tag LOCUS_20690 17162 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 18205 17675 gene locus_tag LOCUS_20700 gene mobA 18205 17675 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192903.1 protein_id gnl|my_center|LOCUS_20700 19658 18351 gene locus_tag LOCUS_20710 gene phnE 19658 18351 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 protein_id gnl|my_center|LOCUS_20710 20738 19911 gene locus_tag LOCUS_20720 20738 19911 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_20720 21612 20743 gene locus_tag LOCUS_20730 21612 20743 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119656.1 protein_id gnl|my_center|LOCUS_20730 22002 25685 gene locus_tag LOCUS_20740 gene metH 22002 25685 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_20740 28976 26007 gene locus_tag LOCUS_20750 28976 26007 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975001.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence38 <1 573 gene locus_tag LOCUS_20760 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527208.1:phosphoribosylformylglycinamidine synthase 1032 694 gene locus_tag LOCUS_20770 1032 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1316 1116 gene locus_tag LOCUS_20780 1316 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 1315 1719 gene locus_tag LOCUS_20790 1315 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 4590 1894 gene locus_tag LOCUS_20800 4590 1894 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_20800 5124 4681 gene locus_tag LOCUS_20810 5124 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5150 5638 gene locus_tag LOCUS_20820 5150 5638 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 protein_id gnl|my_center|LOCUS_20820 6164 5616 gene locus_tag LOCUS_20830 6164 5616 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534522.1 protein_id gnl|my_center|LOCUS_20830 6232 6900 gene locus_tag LOCUS_20840 6232 6900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_20840 6998 7074 gene locus_tag LOCUS_t00340 6998 7074 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7098 7174 gene locus_tag LOCUS_t00350 7098 7174 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8221 7535 gene locus_tag LOCUS_20850 8221 7535 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832895.1 protein_id gnl|my_center|LOCUS_20850 8402 9763 gene locus_tag LOCUS_20860 8402 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 9784 10887 gene locus_tag LOCUS_20870 9784 10887 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_20870 10902 12995 gene locus_tag LOCUS_20880 10902 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 13111 14991 gene locus_tag LOCUS_20890 13111 14991 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527215.1 protein_id gnl|my_center|LOCUS_20890 15551 16117 gene locus_tag LOCUS_20900 gene phaR 15551 16117 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 protein_id gnl|my_center|LOCUS_20900 16948 16127 gene locus_tag LOCUS_20910 16948 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 17412 16924 gene locus_tag LOCUS_20920 17412 16924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 17750 17409 gene locus_tag LOCUS_20930 17750 17409 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_20930 18305 17760 gene locus_tag LOCUS_20940 18305 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 19083 18307 gene locus_tag LOCUS_20950 gene cysE 19083 18307 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_20950 20215 19076 gene locus_tag LOCUS_20960 gene nifV 20215 19076 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_20960 20886 20374 gene locus_tag LOCUS_20970 20886 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 22123 20987 gene locus_tag LOCUS_20980 22123 20987 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_20980 22962 22204 gene locus_tag LOCUS_20990 22962 22204 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070759.1 protein_id gnl|my_center|LOCUS_20990 24938 22959 gene locus_tag LOCUS_21000 24938 22959 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070758.1 protein_id gnl|my_center|LOCUS_21000 25763 24954 gene locus_tag LOCUS_21010 25763 24954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence39 867 154 gene locus_tag LOCUS_21020 gene fnr 867 154 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_21020 983 2386 gene locus_tag LOCUS_21030 gene hemN 983 2386 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689506.1 protein_id gnl|my_center|LOCUS_21030 2451 3113 gene locus_tag LOCUS_21040 2451 3113 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687733.1 protein_id gnl|my_center|LOCUS_21040 3125 5338 gene locus_tag LOCUS_21050 gene copA1 3125 5338 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_21050 5335 7020 gene locus_tag LOCUS_21060 5335 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 7020 7226 gene locus_tag LOCUS_21070 7020 7226 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656255.1 protein_id gnl|my_center|LOCUS_21070 7257 8303 gene locus_tag LOCUS_21080 gene selD 7257 8303 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_21080 8548 10617 gene locus_tag LOCUS_21090 8548 10617 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082728.1 protein_id gnl|my_center|LOCUS_21090 10635 11780 gene locus_tag LOCUS_21100 10635 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 12031 11828 gene locus_tag LOCUS_21110 12031 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 12745 12263 gene locus_tag LOCUS_21120 gene bfr 12745 12263 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675497.1 protein_id gnl|my_center|LOCUS_21120 13241 12756 gene locus_tag LOCUS_21130 gene bfr 13241 12756 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_21130 14034 13390 gene locus_tag LOCUS_21140 14034 13390 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391460.1 protein_id gnl|my_center|LOCUS_21140 15537 14119 gene locus_tag LOCUS_21150 15537 14119 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198129.1 protein_id gnl|my_center|LOCUS_21150 16405 15530 gene locus_tag LOCUS_21160 16405 15530 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813578.1 protein_id gnl|my_center|LOCUS_21160 16741 16406 gene locus_tag LOCUS_21170 16741 16406 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198127.1 protein_id gnl|my_center|LOCUS_21170 18229 16754 gene locus_tag LOCUS_21180 18229 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 18777 18232 gene locus_tag LOCUS_21190 18777 18232 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930217.1 protein_id gnl|my_center|LOCUS_21190 19321 18887 gene locus_tag LOCUS_21200 19321 18887 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_21200 20078 19323 gene locus_tag LOCUS_21210 20078 19323 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194134.1 protein_id gnl|my_center|LOCUS_21210 20658 20080 gene locus_tag LOCUS_21220 20658 20080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 20952 20776 gene locus_tag LOCUS_21230 20952 20776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 22931 21099 gene locus_tag LOCUS_21240 22931 21099 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_21240 23925 23131 gene locus_tag LOCUS_21250 23925 23131 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191514.1 protein_id gnl|my_center|LOCUS_21250 24968 23922 gene locus_tag LOCUS_21260 24968 23922 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_21260 25558 25337 gene locus_tag LOCUS_21270 25558 25337 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_21270 25625 25933 gene locus_tag LOCUS_21280 25625 25933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 25933 26490 gene locus_tag LOCUS_21290 gene greB 25933 26490 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_21290 26717 26792 gene locus_tag LOCUS_t00360 26717 26792 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence40 528 139 gene locus_tag LOCUS_21300 528 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_21300 1034 555 gene locus_tag LOCUS_21310 1034 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1392 1012 gene locus_tag LOCUS_21320 1392 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389789.1 protein_id gnl|my_center|LOCUS_21320 1707 1402 gene locus_tag LOCUS_21330 1707 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1822 1691 gene locus_tag LOCUS_21340 1822 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2473 1835 gene locus_tag LOCUS_21350 gene petA 2473 1835 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 protein_id gnl|my_center|LOCUS_21350 3599 2460 gene locus_tag LOCUS_21360 gene cydB 3599 2460 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195344.1 protein_id gnl|my_center|LOCUS_21360 4655 3615 gene locus_tag LOCUS_21370 4655 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4095 4194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4845 4645 gene locus_tag LOCUS_21380 4845 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 5031 6317 gene locus_tag LOCUS_21390 5031 6317 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266169.1 protein_id gnl|my_center|LOCUS_21390 6985 6368 gene locus_tag LOCUS_21400 6985 6368 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_21400 8634 6982 gene locus_tag LOCUS_21410 8634 6982 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_21410 9500 8736 gene locus_tag LOCUS_21420 9500 8736 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_21420 9668 10501 gene locus_tag LOCUS_21430 9668 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 10502 12412 gene locus_tag LOCUS_21440 10502 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 12511 13572 gene locus_tag LOCUS_21450 12511 13572 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_21450 13611 14483 gene locus_tag LOCUS_21460 13611 14483 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_21460 14495 16540 gene locus_tag LOCUS_21470 gene tkt 14495 16540 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 protein_id gnl|my_center|LOCUS_21470 16660 17667 gene locus_tag LOCUS_21480 gene gap 16660 17667 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_21480 17679 18716 gene locus_tag LOCUS_21490 gene fba 17679 18716 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 protein_id gnl|my_center|LOCUS_21490 18791 19489 gene locus_tag LOCUS_21500 gene rpe 18791 19489 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 protein_id gnl|my_center|LOCUS_21500 19658 20329 gene locus_tag LOCUS_21510 19658 20329 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_21510 22357 20309 gene locus_tag LOCUS_21520 gene feoB 22357 20309 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545132.1 protein_id gnl|my_center|LOCUS_21520 23482 22418 gene locus_tag LOCUS_21530 gene fba 23482 22418 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190157.1 protein_id gnl|my_center|LOCUS_21530 25000 23570 gene locus_tag LOCUS_21540 gene pyk 25000 23570 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_21540 26216 25002 gene locus_tag LOCUS_21550 26216 25002 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189839.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence41 1040 3508 gene locus_tag LOCUS_21560 1040 3508 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_21560 3505 4821 gene locus_tag LOCUS_21570 3505 4821 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814426.1 protein_id gnl|my_center|LOCUS_21570 4818 5810 gene locus_tag LOCUS_21580 gene pdxA 4818 5810 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951346.1 protein_id gnl|my_center|LOCUS_21580 5807 6577 gene locus_tag LOCUS_21590 gene rsmA 5807 6577 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189099.1 protein_id gnl|my_center|LOCUS_21590 7016 6822 gene locus_tag LOCUS_21600 7016 6822 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_21600 7760 7089 gene locus_tag LOCUS_21610 7760 7089 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_21610 8528 7764 gene locus_tag LOCUS_21620 gene xth 8528 7764 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193531.1 protein_id gnl|my_center|LOCUS_21620 8989 8525 gene locus_tag LOCUS_21630 8989 8525 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941229.1 protein_id gnl|my_center|LOCUS_21630 11069 9012 gene locus_tag LOCUS_21640 11069 9012 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550186.1 protein_id gnl|my_center|LOCUS_21640 11900 11133 gene locus_tag LOCUS_21650 11900 11133 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 protein_id gnl|my_center|LOCUS_21650 12974 12021 gene locus_tag LOCUS_21660 12974 12021 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_21660 14421 13087 gene locus_tag LOCUS_21670 14421 13087 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_21670 15443 14418 gene locus_tag LOCUS_21680 15443 14418 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_21680 17802 15505 gene locus_tag LOCUS_21690 17802 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 18608 17808 gene locus_tag LOCUS_21700 gene nirQ 18608 17808 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_21700 20050 18671 gene locus_tag LOCUS_21710 20050 18671 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_21710 20231 21196 gene locus_tag LOCUS_21720 20231 21196 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942059.1 protein_id gnl|my_center|LOCUS_21720 21367 21912 gene locus_tag LOCUS_21730 21367 21912 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094859.1 protein_id gnl|my_center|LOCUS_21730 22129 25233 gene locus_tag LOCUS_21740 22129 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 <26471 25275 gene locus_tag LOCUS_21750 <26471 25275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000229101.1:DEAD/DEAH box helicase family protein >Feature sequence42 <1 1848 gene locus_tag LOCUS_21760 <1 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889379.1:class I SAM-dependent DNA methyltransferase 1905 2162 gene locus_tag LOCUS_21770 1905 2162 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 protein_id gnl|my_center|LOCUS_21770 2159 2413 gene locus_tag LOCUS_21780 2159 2413 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769718.1 protein_id gnl|my_center|LOCUS_21780 3780 2752 gene locus_tag LOCUS_21790 gene gap 3780 2752 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236620.1 protein_id gnl|my_center|LOCUS_21790 5808 3805 gene locus_tag LOCUS_21800 gene tkt 5808 3805 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098688.1 protein_id gnl|my_center|LOCUS_21800 6957 5944 gene locus_tag LOCUS_21810 6957 5944 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095990.1 protein_id gnl|my_center|LOCUS_21810 9468 6991 gene locus_tag LOCUS_21820 9468 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 10078 9515 gene locus_tag LOCUS_21830 10078 9515 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_21830 10120 10854 gene locus_tag LOCUS_21840 10120 10854 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_21840 10865 11866 gene locus_tag LOCUS_21850 10865 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 11727 11826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11863 12588 gene locus_tag LOCUS_21860 11863 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 12590 13909 gene locus_tag LOCUS_21870 gene argA 12590 13909 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_21870 14220 16394 gene locus_tag LOCUS_21880 gene katG 14220 16394 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_21880 16527 16802 gene locus_tag LOCUS_21890 16527 16802 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_21890 17018 16863 gene locus_tag LOCUS_21900 17018 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 18873 17035 gene locus_tag LOCUS_21910 18873 17035 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_21910 19119 20921 gene locus_tag LOCUS_21920 19119 20921 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_21920 22446 20929 gene locus_tag LOCUS_21930 22446 20929 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_21930 23468 22443 gene locus_tag LOCUS_21940 23468 22443 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 protein_id gnl|my_center|LOCUS_21940 24304 23465 gene locus_tag LOCUS_21950 24304 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 25217 24552 gene locus_tag LOCUS_21960 gene rpiA 25217 24552 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269261.1 protein_id gnl|my_center|LOCUS_21960 25325 25858 gene locus_tag LOCUS_21970 25325 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence43 112 36 gene locus_tag LOCUS_t00370 112 36 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 783 214 gene locus_tag LOCUS_21980 783 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1735 893 gene locus_tag LOCUS_21990 gene ispE 1735 893 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808500.1 protein_id gnl|my_center|LOCUS_21990 2301 1732 gene locus_tag LOCUS_22000 gene lolB 2301 1732 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818921.1 protein_id gnl|my_center|LOCUS_22000 4004 2298 gene locus_tag LOCUS_22010 4004 2298 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_22010 4093 4926 gene locus_tag LOCUS_22020 gene mutM 4093 4926 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925978.1 protein_id gnl|my_center|LOCUS_22020 4994 6952 gene locus_tag LOCUS_22030 4994 6952 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_22030 7308 7051 gene locus_tag LOCUS_22040 7308 7051 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_22040 7819 7325 gene locus_tag LOCUS_22050 gene coaD 7819 7325 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_22050 8358 7816 gene locus_tag LOCUS_22060 gene rsmD 8358 7816 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808577.1 protein_id gnl|my_center|LOCUS_22060 9656 8355 gene locus_tag LOCUS_22070 9656 8355 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_22070 11014 9656 gene locus_tag LOCUS_22080 11014 9656 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_22080 11137 12129 gene locus_tag LOCUS_22090 11137 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 12160 12810 gene locus_tag LOCUS_22100 gene ftsE 12160 12810 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225752.1 protein_id gnl|my_center|LOCUS_22100 12807 13706 gene locus_tag LOCUS_22110 12807 13706 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040576.1 protein_id gnl|my_center|LOCUS_22110 14000 13746 gene locus_tag LOCUS_22120 gene minE 14000 13746 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 protein_id gnl|my_center|LOCUS_22120 14817 14002 gene locus_tag LOCUS_22130 gene minD 14817 14002 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814250.1 protein_id gnl|my_center|LOCUS_22130 15653 14856 gene locus_tag LOCUS_22140 gene minC 15653 14856 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072533.1 protein_id gnl|my_center|LOCUS_22140 16979 15759 gene locus_tag LOCUS_22150 16979 15759 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_22150 17536 16976 gene locus_tag LOCUS_22160 17536 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 17660 19024 gene locus_tag LOCUS_22170 17660 19024 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_22170 19045 19707 gene locus_tag LOCUS_22180 19045 19707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 19704 20315 gene locus_tag LOCUS_22190 gene coaE 19704 20315 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_22190 20390 21148 gene locus_tag LOCUS_22200 gene zapD 20390 21148 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_22200 22313 21369 gene locus_tag LOCUS_22210 22313 21369 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064924.1 protein_id gnl|my_center|LOCUS_22210 23191 22310 gene locus_tag LOCUS_22220 23191 22310 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_22220 23581 24456 gene locus_tag LOCUS_22230 23581 24456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 24615 25817 gene locus_tag LOCUS_22240 24615 25817 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence44 <1 695 gene locus_tag LOCUS_22250 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:PAS domain S-box protein 698 1924 gene locus_tag LOCUS_22260 698 1924 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207582.1 protein_id gnl|my_center|LOCUS_22260 1918 2106 gene locus_tag LOCUS_22270 1918 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2242 2613 gene locus_tag LOCUS_22280 2242 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 5301 2692 gene locus_tag LOCUS_22290 gene pepN 5301 2692 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189239.1 protein_id gnl|my_center|LOCUS_22290 5953 5342 gene locus_tag LOCUS_22300 5953 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 6429 5950 gene locus_tag LOCUS_22310 6429 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 6428 7363 gene locus_tag LOCUS_22320 gene hemC 6428 7363 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 protein_id gnl|my_center|LOCUS_22320 7371 8153 gene locus_tag LOCUS_22330 7371 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 8252 9274 gene locus_tag LOCUS_22340 8252 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 9271 10461 gene locus_tag LOCUS_22350 9271 10461 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_22350 10475 10714 gene locus_tag LOCUS_22360 10475 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 11683 10751 gene locus_tag LOCUS_22370 gene hemF 11683 10751 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930863.1 protein_id gnl|my_center|LOCUS_22370 13319 11676 gene locus_tag LOCUS_22380 13319 11676 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943967.1 protein_id gnl|my_center|LOCUS_22380 14608 13331 gene locus_tag LOCUS_22390 gene purD 14608 13331 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_22390 16517 14925 gene locus_tag LOCUS_22400 gene purH 16517 14925 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_22400 16842 16609 gene locus_tag LOCUS_22410 16842 16609 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_22410 17852 16839 gene locus_tag LOCUS_22420 gene dusB 17852 16839 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_22420 18867 17995 gene locus_tag LOCUS_22430 18867 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 20062 18917 gene locus_tag LOCUS_22440 20062 18917 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 protein_id gnl|my_center|LOCUS_22440 21362 20055 gene locus_tag LOCUS_22450 21362 20055 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931462.1 protein_id gnl|my_center|LOCUS_22450 21976 21359 gene locus_tag LOCUS_22460 21976 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_22460 22671 21973 gene locus_tag LOCUS_22470 22671 21973 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931409.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence45 933 1 gene locus_tag LOCUS_22480 933 1 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_22480 1150 2187 gene locus_tag LOCUS_22490 gene pstS 1150 2187 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 protein_id gnl|my_center|LOCUS_22490 2289 3236 gene locus_tag LOCUS_22500 gene pstC 2289 3236 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_22500 3247 4089 gene locus_tag LOCUS_22510 gene pstA 3247 4089 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521821.1 protein_id gnl|my_center|LOCUS_22510 4120 4905 gene locus_tag LOCUS_22520 gene pstB 4120 4905 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193614.1 protein_id gnl|my_center|LOCUS_22520 4914 5618 gene locus_tag LOCUS_22530 gene phoU 4914 5618 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853444.1 protein_id gnl|my_center|LOCUS_22530 5615 6301 gene locus_tag LOCUS_22540 gene phoB 5615 6301 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_22540 6308 7600 gene locus_tag LOCUS_22550 gene phoR 6308 7600 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_22550 9289 7646 gene locus_tag LOCUS_22560 9289 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 9574 10365 gene locus_tag LOCUS_22570 9574 10365 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091510.1 protein_id gnl|my_center|LOCUS_22570 10367 11506 gene locus_tag LOCUS_22580 10367 11506 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_22580 11918 11544 gene locus_tag LOCUS_22590 11918 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 12098 13252 gene locus_tag LOCUS_22600 12098 13252 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_22600 16281 13249 gene locus_tag LOCUS_22610 16281 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 17088 16288 gene locus_tag LOCUS_22620 17088 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 17523 17140 gene locus_tag LOCUS_22630 gene gloA 17523 17140 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_22630 18275 17538 gene locus_tag LOCUS_22640 18275 17538 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_22640 19005 18253 gene locus_tag LOCUS_22650 19005 18253 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_22650 19553 19002 gene locus_tag LOCUS_22660 gene gmhB 19553 19002 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_22660 <20928 19567 gene locus_tag LOCUS_22670 <20928 19567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189008.1:glycine--tRNA ligase subunit beta >Feature sequence46 1558 1657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1670 1897 gene locus_tag LOCUS_22680 1670 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1907 2095 gene locus_tag LOCUS_22690 1907 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3087 2110 gene locus_tag LOCUS_22700 gene cas1f 3087 2110 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_22700 3619 3242 gene locus_tag LOCUS_22710 3619 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3893 7219 gene locus_tag LOCUS_22720 3893 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 7701 7324 gene locus_tag LOCUS_22730 7701 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 9567 7780 gene locus_tag LOCUS_22740 9567 7780 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399374.1 protein_id gnl|my_center|LOCUS_22740 9940 10722 gene locus_tag LOCUS_22750 9940 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 10719 11657 gene locus_tag LOCUS_22760 10719 11657 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966742.1 protein_id gnl|my_center|LOCUS_22760 11659 12384 gene locus_tag LOCUS_22770 11659 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 12381 14684 gene locus_tag LOCUS_22780 12381 14684 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038570.1 protein_id gnl|my_center|LOCUS_22780 14681 16024 gene locus_tag LOCUS_22790 14681 16024 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966731.1 protein_id gnl|my_center|LOCUS_22790 16021 16668 gene locus_tag LOCUS_22800 gene uvrY 16021 16668 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071972.1 protein_id gnl|my_center|LOCUS_22800 16915 19065 gene locus_tag LOCUS_22810 16915 19065 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113760.1 protein_id gnl|my_center|LOCUS_22810 19342 20466 gene locus_tag LOCUS_22820 19342 20466 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927133.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence47 <1 560 gene locus_tag LOCUS_22830 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039191.1:DUF2946 family protein 1484 561 gene locus_tag LOCUS_22840 gene dnaJ 1484 561 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816474.1 protein_id gnl|my_center|LOCUS_22840 2465 1572 gene locus_tag LOCUS_22850 gene rocF 2465 1572 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258791.1 protein_id gnl|my_center|LOCUS_22850 2909 2514 gene locus_tag LOCUS_22860 2909 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3124 2912 gene locus_tag LOCUS_22870 gene nqrM 3124 2912 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 protein_id gnl|my_center|LOCUS_22870 4369 3143 gene locus_tag LOCUS_22880 gene nqrF 4369 3143 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_22880 4993 4385 gene locus_tag LOCUS_22890 gene nqrE 4993 4385 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_22890 5663 4995 gene locus_tag LOCUS_22900 gene nqrD 5663 4995 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_22900 6454 5666 gene locus_tag LOCUS_22910 6454 5666 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_22910 7658 6444 gene locus_tag LOCUS_22920 7658 6444 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_22920 8998 7661 gene locus_tag LOCUS_22930 8998 7661 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_22930 9548 9455 gene locus_tag LOCUS_t00380 9548 9455 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10822 9602 gene locus_tag LOCUS_22940 10822 9602 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 protein_id gnl|my_center|LOCUS_22940 11833 10907 gene locus_tag LOCUS_22950 11833 10907 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_22950 11953 12879 gene locus_tag LOCUS_22960 11953 12879 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_22960 12887 13840 gene locus_tag LOCUS_22970 12887 13840 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_22970 13837 15789 gene locus_tag LOCUS_22980 gene tgpA 13837 15789 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_22980 15786 16775 gene locus_tag LOCUS_22990 gene mltB 15786 16775 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_22990 17750 16812 gene locus_tag LOCUS_23000 gene rpoS 17750 16812 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 protein_id gnl|my_center|LOCUS_23000 18625 17747 gene locus_tag LOCUS_23010 18625 17747 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039995.1 protein_id gnl|my_center|LOCUS_23010 19272 18622 gene locus_tag LOCUS_23020 19272 18622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 20020 19280 gene locus_tag LOCUS_23030 gene surE 20020 19280 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_23030 20347 20024 gene locus_tag LOCUS_23040 20347 20024 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337920.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence48 60 2585 gene locus_tag LOCUS_23050 60 2585 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_23050 3530 2616 gene locus_tag LOCUS_23060 3530 2616 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_23060 4234 3527 gene locus_tag LOCUS_23070 4234 3527 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_23070 4258 4728 gene locus_tag LOCUS_23080 4258 4728 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188247.1 protein_id gnl|my_center|LOCUS_23080 4750 5448 gene locus_tag LOCUS_23090 4750 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 7135 5513 gene locus_tag LOCUS_23100 7135 5513 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538238.1 protein_id gnl|my_center|LOCUS_23100 7284 8570 gene locus_tag LOCUS_23110 gene gshA 7284 8570 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_23110 8573 9598 gene locus_tag LOCUS_23120 gene gshB 8573 9598 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 protein_id gnl|my_center|LOCUS_23120 9583 10620 gene locus_tag LOCUS_23130 9583 10620 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527101.1 protein_id gnl|my_center|LOCUS_23130 12622 10997 gene locus_tag LOCUS_23140 12622 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 15978 12619 gene locus_tag LOCUS_23150 15978 12619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 16987 15983 gene locus_tag LOCUS_23160 16987 15983 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_23160 17309 18700 gene locus_tag LOCUS_23170 17309 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence49 138 431 gene locus_tag LOCUS_23180 138 431 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 protein_id gnl|my_center|LOCUS_23180 638 1198 gene locus_tag LOCUS_23190 gene phaR 638 1198 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 protein_id gnl|my_center|LOCUS_23190 2030 1209 gene locus_tag LOCUS_23200 2030 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2494 2006 gene locus_tag LOCUS_23210 2494 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2832 2491 gene locus_tag LOCUS_23220 2832 2491 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_23220 3387 2842 gene locus_tag LOCUS_23230 3387 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 4165 3389 gene locus_tag LOCUS_23240 gene cysE 4165 3389 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_23240 5297 4158 gene locus_tag LOCUS_23250 gene nifV 5297 4158 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_23250 5968 5456 gene locus_tag LOCUS_23260 5968 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 7216 6080 gene locus_tag LOCUS_23270 7216 6080 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_23270 8722 7961 gene locus_tag LOCUS_23280 8722 7961 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070759.1 protein_id gnl|my_center|LOCUS_23280 10698 8719 gene locus_tag LOCUS_23290 10698 8719 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070758.1 protein_id gnl|my_center|LOCUS_23290 11523 10714 gene locus_tag LOCUS_23300 11523 10714 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183634.1 protein_id gnl|my_center|LOCUS_23300 11752 13677 gene locus_tag LOCUS_23310 11752 13677 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_23310 13674 14807 gene locus_tag LOCUS_23320 13674 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 14825 15328 gene locus_tag LOCUS_23330 gene mobB 14825 15328 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_23330 15325 16533 gene locus_tag LOCUS_23340 15325 16533 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192374.1 protein_id gnl|my_center|LOCUS_23340 16530 16778 gene locus_tag LOCUS_23350 gene moaD 16530 16778 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_23350 16811 17710 gene locus_tag LOCUS_23360 gene ylqF 16811 17710 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247909.1 protein_id gnl|my_center|LOCUS_23360 17809 17884 gene locus_tag LOCUS_t00390 17809 17884 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 18228 18010 gene locus_tag LOCUS_23370 18228 18010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 18501 18268 gene locus_tag LOCUS_23380 18501 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence50 205 483 gene locus_tag LOCUS_23390 205 483 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838298.1 protein_id gnl|my_center|LOCUS_23390 668 3493 gene locus_tag LOCUS_23400 gene uvrA 668 3493 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_23400 3490 3861 gene locus_tag LOCUS_23410 3490 3861 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 protein_id gnl|my_center|LOCUS_23410 3978 4682 gene locus_tag LOCUS_23420 3978 4682 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967508.1 protein_id gnl|my_center|LOCUS_23420 4689 7070 gene locus_tag LOCUS_23430 4689 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 7214 7044 gene locus_tag LOCUS_23440 7214 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 8857 7193 gene locus_tag LOCUS_23450 8857 7193 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036317.1 protein_id gnl|my_center|LOCUS_23450 12284 8922 gene locus_tag LOCUS_23460 12284 8922 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064283.1 protein_id gnl|my_center|LOCUS_23460 13440 12292 gene locus_tag LOCUS_23470 13440 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 16112 13437 gene locus_tag LOCUS_23480 16112 13437 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040291.1 protein_id gnl|my_center|LOCUS_23480 18295 16109 gene locus_tag LOCUS_23490 gene plpD 18295 16109 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence51 2212 419 gene locus_tag LOCUS_23500 2212 419 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_23500 3228 2242 gene locus_tag LOCUS_23510 3228 2242 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040637.1 protein_id gnl|my_center|LOCUS_23510 4886 3228 gene locus_tag LOCUS_23520 4886 3228 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810103.1 protein_id gnl|my_center|LOCUS_23520 5548 5033 gene locus_tag LOCUS_23530 5548 5033 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 protein_id gnl|my_center|LOCUS_23530 6774 5578 gene locus_tag LOCUS_23540 6774 5578 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039377.1 protein_id gnl|my_center|LOCUS_23540 9196 6797 gene locus_tag LOCUS_23550 9196 6797 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064157.1 protein_id gnl|my_center|LOCUS_23550 10733 9435 gene locus_tag LOCUS_23560 10733 9435 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_23560 12769 10868 gene locus_tag LOCUS_23570 12769 10868 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064156.1 protein_id gnl|my_center|LOCUS_23570 14123 12840 gene locus_tag LOCUS_23580 14123 12840 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810114.1 protein_id gnl|my_center|LOCUS_23580 16480 14126 gene locus_tag LOCUS_23590 16480 14126 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810115.1 protein_id gnl|my_center|LOCUS_23590 17209 16547 gene locus_tag LOCUS_23600 17209 16547 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039381.1 protein_id gnl|my_center|LOCUS_23600 17420 17226 gene locus_tag LOCUS_23610 17420 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 17881 17806 gene locus_tag LOCUS_t00400 17881 17806 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence52 70 1839 gene locus_tag LOCUS_23620 gene msbA 70 1839 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186431.1 protein_id gnl|my_center|LOCUS_23620 1836 2939 gene locus_tag LOCUS_23630 1836 2939 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_23630 2943 4814 gene locus_tag LOCUS_23640 2943 4814 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_23640 4807 5937 gene locus_tag LOCUS_23650 4807 5937 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185786.1 protein_id gnl|my_center|LOCUS_23650 5934 7091 gene locus_tag LOCUS_23660 5934 7091 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 protein_id gnl|my_center|LOCUS_23660 7088 8239 gene locus_tag LOCUS_23670 7088 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 8318 10330 gene locus_tag LOCUS_23680 8318 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 10356 11075 gene locus_tag LOCUS_23690 10356 11075 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975947.1 protein_id gnl|my_center|LOCUS_23690 11107 12204 gene locus_tag LOCUS_23700 11107 12204 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546733.1 protein_id gnl|my_center|LOCUS_23700 14355 12244 gene locus_tag LOCUS_23710 14355 12244 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895699.1 protein_id gnl|my_center|LOCUS_23710 16286 14352 gene locus_tag LOCUS_23720 16286 14352 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400611.1 protein_id gnl|my_center|LOCUS_23720 <18102 16327 gene locus_tag LOCUS_23730 <18102 16327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190446.1:DNA polymerase I >Feature sequence53 82 7 gene locus_tag LOCUS_t00410 82 7 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 192 557 gene locus_tag LOCUS_23740 192 557 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_23740 1543 545 gene locus_tag LOCUS_23750 1543 545 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_23750 2682 1543 gene locus_tag LOCUS_23760 2682 1543 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930406.1 protein_id gnl|my_center|LOCUS_23760 3250 2753 gene locus_tag LOCUS_23770 gene purE 3250 2753 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_23770 4107 3250 gene locus_tag LOCUS_23780 gene folD 4107 3250 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_23780 4395 7061 gene locus_tag LOCUS_23790 gene aceE 4395 7061 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199569.1 protein_id gnl|my_center|LOCUS_23790 7077 8720 gene locus_tag LOCUS_23800 gene aceF 7077 8720 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193075.1 protein_id gnl|my_center|LOCUS_23800 8733 10529 gene locus_tag LOCUS_23810 gene lpdA 8733 10529 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225155.1 protein_id gnl|my_center|LOCUS_23810 11684 10668 gene locus_tag LOCUS_23820 gene ppk2 11684 10668 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819675.1 protein_id gnl|my_center|LOCUS_23820 12298 11843 gene locus_tag LOCUS_23830 gene sixA 12298 11843 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_23830 12439 12705 gene locus_tag LOCUS_23840 12439 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 12743 13942 gene locus_tag LOCUS_23850 12743 13942 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275363.1 protein_id gnl|my_center|LOCUS_23850 14151 14077 gene locus_tag LOCUS_t00420 14151 14077 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14146 14310 gene locus_tag LOCUS_23860 14146 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 16572 14728 gene locus_tag LOCUS_23870 16572 14728 CDS product M10 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104426.1 protein_id gnl|my_center|LOCUS_23870 15130 15229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17117 16785 gene locus_tag LOCUS_23880 17117 16785 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence54 730 227 gene locus_tag LOCUS_23890 730 227 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809464.1 protein_id gnl|my_center|LOCUS_23890 2202 727 gene locus_tag LOCUS_23900 gene ubiD 2202 727 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691687.1 protein_id gnl|my_center|LOCUS_23900 3120 2203 gene locus_tag LOCUS_23910 3120 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 4007 3120 gene locus_tag LOCUS_23920 gene ubiA 4007 3120 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_23920 4851 4090 gene locus_tag LOCUS_23930 4851 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 6311 4920 gene locus_tag LOCUS_23940 6311 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 6449 7342 gene locus_tag LOCUS_23950 6449 7342 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_23950 9446 7401 gene locus_tag LOCUS_23960 gene recG 9446 7401 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23960 9832 9452 gene locus_tag LOCUS_23970 9832 9452 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_23970 9873 10202 gene locus_tag LOCUS_23980 9873 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 11086 10199 gene locus_tag LOCUS_23990 11086 10199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 11612 11073 gene locus_tag LOCUS_24000 11612 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 12803 11619 gene locus_tag LOCUS_24010 12803 11619 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_24010 13263 12850 gene locus_tag LOCUS_24020 13263 12850 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152611757.1 protein_id gnl|my_center|LOCUS_24020 13355 15181 gene locus_tag LOCUS_24030 13355 15181 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_24030 15299 16834 gene locus_tag LOCUS_24040 15299 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence55 978 1190 gene locus_tag LOCUS_24050 978 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1786 1148 gene locus_tag LOCUS_24060 1786 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2037 1795 gene locus_tag LOCUS_24070 2037 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2330 2082 gene locus_tag LOCUS_24080 2330 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2969 2667 gene locus_tag LOCUS_24090 2969 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3650 3162 gene locus_tag LOCUS_24100 gene cadR 3650 3162 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 protein_id gnl|my_center|LOCUS_24100 4005 3667 gene locus_tag LOCUS_24110 4005 3667 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193459.1 protein_id gnl|my_center|LOCUS_24110 4248 6335 gene locus_tag LOCUS_24120 4248 6335 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901093.1 protein_id gnl|my_center|LOCUS_24120 6841 8139 gene locus_tag LOCUS_24130 6841 8139 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_24130 8151 8711 gene locus_tag LOCUS_24140 8151 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 8708 9730 gene locus_tag LOCUS_24150 8708 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 9743 12862 gene locus_tag LOCUS_24160 9743 12862 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_24160 12888 13271 gene locus_tag LOCUS_24170 12888 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 13697 13308 gene locus_tag LOCUS_24180 13697 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 <16686 13694 gene locus_tag LOCUS_24190 <16686 13694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244431.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence56 492 1082 gene locus_tag LOCUS_24200 492 1082 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195598.1 protein_id gnl|my_center|LOCUS_24200 1174 2328 gene locus_tag LOCUS_24210 1174 2328 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 protein_id gnl|my_center|LOCUS_24210 2376 3401 gene locus_tag LOCUS_24220 2376 3401 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 protein_id gnl|my_center|LOCUS_24220 3447 3857 gene locus_tag LOCUS_24230 3447 3857 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383115.1 protein_id gnl|my_center|LOCUS_24230 3874 4551 gene locus_tag LOCUS_24240 3874 4551 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_24240 5084 5602 gene locus_tag LOCUS_24250 5084 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 5611 5880 gene locus_tag LOCUS_24260 5611 5880 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_24260 5893 7449 gene locus_tag LOCUS_24270 5893 7449 CDS product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_24270 7508 7864 gene locus_tag LOCUS_24280 7508 7864 CDS product phenol hydroxylase subunit P4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 protein_id gnl|my_center|LOCUS_24280 7893 8999 gene locus_tag LOCUS_24290 7893 8999 CDS product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 protein_id gnl|my_center|LOCUS_24290 9126 9458 gene locus_tag LOCUS_24300 9126 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 10185 9472 gene locus_tag LOCUS_24310 10185 9472 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402117.1 protein_id gnl|my_center|LOCUS_24310 10405 11292 gene locus_tag LOCUS_24320 gene hpaD 10405 11292 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 protein_id gnl|my_center|LOCUS_24320 11292 11714 gene locus_tag LOCUS_24330 11292 11714 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521540.1 protein_id gnl|my_center|LOCUS_24330 11745 13199 gene locus_tag LOCUS_24340 11745 13199 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_24340 13212 14036 gene locus_tag LOCUS_24350 13212 14036 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_24350 14054 14836 gene locus_tag LOCUS_24360 14054 14836 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence57 947 2098 gene locus_tag LOCUS_24370 947 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2406 2140 gene locus_tag LOCUS_24380 2406 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24380 3335 2418 gene locus_tag LOCUS_24390 3335 2418 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_24390 8566 3332 gene locus_tag LOCUS_24400 8566 3332 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235238.1 protein_id gnl|my_center|LOCUS_24400 9282 10856 gene locus_tag LOCUS_24410 9282 10856 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940814.1 protein_id gnl|my_center|LOCUS_24410 10917 11375 gene locus_tag LOCUS_24420 gene moaE 10917 11375 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_24420 13081 11462 gene locus_tag LOCUS_24430 13081 11462 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941068.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence58 80 574 gene locus_tag LOCUS_24440 80 574 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705365.1 protein_id gnl|my_center|LOCUS_24440 590 853 gene locus_tag LOCUS_24450 590 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 916 1044 gene locus_tag LOCUS_24460 916 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1218 1128 gene locus_tag LOCUS_t00430 1218 1128 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1528 1256 gene locus_tag LOCUS_24470 1528 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1803 1543 gene locus_tag LOCUS_24480 1803 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 3842 1803 gene locus_tag LOCUS_24490 3842 1803 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_24490 4512 3847 gene locus_tag LOCUS_24500 4512 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 6496 4514 gene locus_tag LOCUS_24510 6496 4514 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_24510 8699 6540 gene locus_tag LOCUS_24520 8699 6540 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_24520 9133 8762 gene locus_tag LOCUS_24530 9133 8762 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 protein_id gnl|my_center|LOCUS_24530 11863 9152 gene locus_tag LOCUS_24540 11863 9152 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_24540 12059 11865 gene locus_tag LOCUS_24550 12059 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 12863 12330 gene locus_tag LOCUS_24560 12863 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence59 159 72 gene locus_tag LOCUS_t00440 159 72 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 315 1007 gene locus_tag LOCUS_24570 315 1007 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191933.1 protein_id gnl|my_center|LOCUS_24570 2351 1053 gene locus_tag LOCUS_24580 gene rlmD 2351 1053 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_24580 2590 2844 gene locus_tag LOCUS_24590 2590 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 4043 2910 gene locus_tag LOCUS_24600 gene bamC 4043 2910 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 protein_id gnl|my_center|LOCUS_24600 4935 4057 gene locus_tag LOCUS_24610 gene dapA 4935 4057 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_24610 5943 5014 gene locus_tag LOCUS_24620 5943 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 6916 5948 gene locus_tag LOCUS_24630 6916 5948 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_24630 7593 6976 gene locus_tag LOCUS_24640 7593 6976 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810006.1 protein_id gnl|my_center|LOCUS_24640 7695 8876 gene locus_tag LOCUS_24650 7695 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 9522 8881 gene locus_tag LOCUS_24660 9522 8881 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389275.1 protein_id gnl|my_center|LOCUS_24660 9650 10489 gene locus_tag LOCUS_24670 9650 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 12405 10486 gene locus_tag LOCUS_24680 12405 10486 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence60 666 178 gene locus_tag LOCUS_24690 gene cadR 666 178 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 protein_id gnl|my_center|LOCUS_24690 1021 683 gene locus_tag LOCUS_24700 1021 683 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 protein_id gnl|my_center|LOCUS_24700 1111 3330 gene locus_tag LOCUS_24710 1111 3330 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901093.1 protein_id gnl|my_center|LOCUS_24710 3345 3827 gene locus_tag LOCUS_24720 gene lspA 3345 3827 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157006.1 protein_id gnl|my_center|LOCUS_24720 3848 4339 gene locus_tag LOCUS_24730 3848 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 4407 4844 gene locus_tag LOCUS_24740 4407 4844 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 protein_id gnl|my_center|LOCUS_24740 4979 5335 gene locus_tag LOCUS_24750 4979 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 5472 6770 gene locus_tag LOCUS_24760 5472 6770 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_24760 6782 7342 gene locus_tag LOCUS_24770 6782 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 7339 8361 gene locus_tag LOCUS_24780 7339 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 8374 11493 gene locus_tag LOCUS_24790 8374 11493 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_24790 11519 11890 gene locus_tag LOCUS_24800 11519 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence61 565 807 gene locus_tag LOCUS_24810 565 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1557 859 gene locus_tag LOCUS_24820 1557 859 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975912.1 protein_id gnl|my_center|LOCUS_24820 2989 1550 gene locus_tag LOCUS_24830 gene dacB 2989 1550 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408519.1 protein_id gnl|my_center|LOCUS_24830 5142 3058 gene locus_tag LOCUS_24840 5142 3058 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942023.1 protein_id gnl|my_center|LOCUS_24840 5661 5951 gene locus_tag LOCUS_24850 gene groES 5661 5951 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_24850 6000 7652 gene locus_tag LOCUS_24860 gene groL 6000 7652 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_24860 7776 8093 gene locus_tag LOCUS_24870 7776 8093 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 protein_id gnl|my_center|LOCUS_24870 8093 9772 gene locus_tag LOCUS_24880 8093 9772 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 protein_id gnl|my_center|LOCUS_24880 10028 10699 gene locus_tag LOCUS_24890 10028 10699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_24890 10647 12188 gene locus_tag LOCUS_24900 10647 12188 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136386085.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence62 239 1876 gene locus_tag LOCUS_24910 239 1876 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_24910 1982 2296 gene locus_tag LOCUS_24920 1982 2296 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091547.1 protein_id gnl|my_center|LOCUS_24920 2293 3966 gene locus_tag LOCUS_24930 2293 3966 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_24930 4064 5101 gene locus_tag LOCUS_24940 4064 5101 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064415.1 protein_id gnl|my_center|LOCUS_24940 5098 5730 gene locus_tag LOCUS_24950 5098 5730 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064417.1 protein_id gnl|my_center|LOCUS_24950 5919 6018 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6078 7715 gene locus_tag LOCUS_24960 6078 7715 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_24960 7740 10136 gene locus_tag LOCUS_24970 7740 10136 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039378.1 protein_id gnl|my_center|LOCUS_24970 10154 11353 gene locus_tag LOCUS_24980 10154 11353 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810108.1 protein_id gnl|my_center|LOCUS_24980 11364 11498 gene locus_tag LOCUS_24990 11364 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence63 465 34 gene locus_tag LOCUS_25000 465 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 770 468 gene locus_tag LOCUS_25010 770 468 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_25010 1866 1024 gene locus_tag LOCUS_25020 gene queF 1866 1024 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114774.1 protein_id gnl|my_center|LOCUS_25020 3502 1892 gene locus_tag LOCUS_25030 gene menD 3502 1892 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_25030 3747 3565 gene locus_tag LOCUS_25040 3747 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 4316 3741 gene locus_tag LOCUS_25050 4316 3741 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194486.1 protein_id gnl|my_center|LOCUS_25050 4561 4486 gene locus_tag LOCUS_t00450 4561 4486 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4727 5119 gene locus_tag LOCUS_25060 4727 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 5838 5149 gene locus_tag LOCUS_25070 5838 5149 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268342.1 protein_id gnl|my_center|LOCUS_25070 6487 5867 gene locus_tag LOCUS_25080 6487 5867 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948424.1 protein_id gnl|my_center|LOCUS_25080 6938 6489 gene locus_tag LOCUS_25090 gene smpB 6938 6489 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063759.1 protein_id gnl|my_center|LOCUS_25090 7000 7446 gene locus_tag LOCUS_25100 7000 7446 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_25100 7436 7756 gene locus_tag LOCUS_25110 7436 7756 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705345.1 protein_id gnl|my_center|LOCUS_25110 7850 9313 gene locus_tag LOCUS_25120 gene guaB 7850 9313 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192833.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence64 213 491 gene locus_tag LOCUS_25130 213 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1808 501 gene locus_tag LOCUS_25140 1808 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2164 1805 gene locus_tag LOCUS_25150 gene flgB 2164 1805 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884702.1 protein_id gnl|my_center|LOCUS_25150 2721 2479 gene locus_tag LOCUS_25160 2721 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 3014 2766 gene locus_tag LOCUS_25170 3014 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 3348 3091 gene locus_tag LOCUS_25180 3348 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214913.1 protein_id gnl|my_center|LOCUS_25180 3650 3354 gene locus_tag LOCUS_25190 3650 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 4056 3796 gene locus_tag LOCUS_25200 4056 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 4502 4113 gene locus_tag LOCUS_25210 4502 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 7633 4499 gene locus_tag LOCUS_25220 7633 4499 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_25220 9234 7645 gene locus_tag LOCUS_25230 9234 7645 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_25230 10502 9231 gene locus_tag LOCUS_25240 10502 9231 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_25240 10927 10583 gene locus_tag LOCUS_25250 10927 10583 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967545.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence65 169 939 gene locus_tag LOCUS_25260 169 939 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_25260 1235 954 gene locus_tag LOCUS_25270 1235 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1750 1292 gene locus_tag LOCUS_25280 1750 1292 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_25280 2750 1782 gene locus_tag LOCUS_25290 gene thiL 2750 1782 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_25290 3242 2754 gene locus_tag LOCUS_25300 gene nusB 3242 2754 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_25300 3712 3239 gene locus_tag LOCUS_25310 gene ribH 3712 3239 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_25310 4832 3717 gene locus_tag LOCUS_25320 gene ribBA 4832 3717 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186115.1 protein_id gnl|my_center|LOCUS_25320 6751 4991 gene locus_tag LOCUS_25330 6751 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 7875 6784 gene locus_tag LOCUS_25340 gene ychF 7875 6784 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_25340 8463 7885 gene locus_tag LOCUS_25350 gene pth 8463 7885 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931308.1 protein_id gnl|my_center|LOCUS_25350 9138 8533 gene locus_tag LOCUS_25360 9138 8533 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_25360 10152 9202 gene locus_tag LOCUS_25370 10152 9202 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_25370 10318 10242 gene locus_tag LOCUS_t00460 10318 10242 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence66 2408 1515 gene locus_tag LOCUS_25380 gene nifH 2408 1515 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_25380 2660 3421 gene locus_tag LOCUS_25390 2660 3421 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943429.1 protein_id gnl|my_center|LOCUS_25390 3517 4455 gene locus_tag LOCUS_25400 3517 4455 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479359.1 protein_id gnl|my_center|LOCUS_25400 4612 5448 gene locus_tag LOCUS_25410 4612 5448 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338304.1 protein_id gnl|my_center|LOCUS_25410 7871 5466 gene locus_tag LOCUS_25420 7871 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 8119 8676 gene locus_tag LOCUS_25430 8119 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 8676 8930 gene locus_tag LOCUS_25440 8676 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 10077 8860 gene locus_tag LOCUS_25450 10077 8860 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359221.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence67 429 124 gene locus_tag LOCUS_25460 429 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1238 576 gene locus_tag LOCUS_25470 1238 576 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527196.1 protein_id gnl|my_center|LOCUS_25470 2017 1235 gene locus_tag LOCUS_25480 2017 1235 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448020.1 protein_id gnl|my_center|LOCUS_25480 2387 2025 gene locus_tag LOCUS_25490 2387 2025 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_25490 3419 2394 gene locus_tag LOCUS_25500 3419 2394 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_25500 4024 3416 gene locus_tag LOCUS_25510 gene tmk 4024 3416 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_25510 5013 4021 gene locus_tag LOCUS_25520 gene mltG 5013 4021 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 protein_id gnl|my_center|LOCUS_25520 5107 6123 gene locus_tag LOCUS_25530 5107 6123 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_25530 6133 6894 gene locus_tag LOCUS_25540 6133 6894 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_25540 7334 6852 gene locus_tag LOCUS_25550 7334 6852 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_25550 7816 7331 gene locus_tag LOCUS_25560 7816 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 9683 7809 gene locus_tag LOCUS_25570 9683 7809 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence68 493 1524 gene locus_tag LOCUS_25580 gene dmpG 493 1524 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 protein_id gnl|my_center|LOCUS_25580 1521 2309 gene locus_tag LOCUS_25590 1521 2309 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_25590 2328 2519 gene locus_tag LOCUS_25600 2328 2519 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723612.1 protein_id gnl|my_center|LOCUS_25600 2773 3738 gene locus_tag LOCUS_25610 2773 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 3759 6149 gene locus_tag LOCUS_25620 3759 6149 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_25620 6212 8179 gene locus_tag LOCUS_25630 6212 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 8198 9505 gene locus_tag LOCUS_25640 8198 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence69 <1 2001 gene locus_tag LOCUS_25650 <1 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931493.1:AsmA family protein 2055 2483 gene locus_tag LOCUS_25660 2055 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2480 3364 gene locus_tag LOCUS_25670 2480 3364 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_25670 3819 3412 gene locus_tag LOCUS_25680 gene msrB 3819 3412 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114184.1 protein_id gnl|my_center|LOCUS_25680 3892 4587 gene locus_tag LOCUS_25690 3892 4587 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688556.1 protein_id gnl|my_center|LOCUS_25690 4825 4924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4961 6118 gene locus_tag LOCUS_25700 4961 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 7686 6154 gene locus_tag LOCUS_25710 7686 6154 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 protein_id gnl|my_center|LOCUS_25710 8225 7701 gene locus_tag LOCUS_25720 8225 7701 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25720 >Feature sequence70 1016 180 gene locus_tag LOCUS_25730 1016 180 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925699.1 protein_id gnl|my_center|LOCUS_25730 1888 1019 gene locus_tag LOCUS_25740 1888 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2977 1889 gene locus_tag LOCUS_25750 gene hisC 2977 1889 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_25750 4079 2988 gene locus_tag LOCUS_25760 gene pheA 4079 2988 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_25760 5169 4084 gene locus_tag LOCUS_25770 gene serC 5169 4084 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_25770 7811 5169 gene locus_tag LOCUS_25780 gene gyrA 7811 5169 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930095.1 protein_id gnl|my_center|LOCUS_25780 7928 9241 gene locus_tag LOCUS_25790 7928 9241 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957634.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence71 1225 104 gene locus_tag LOCUS_25800 1225 104 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705655.1 protein_id gnl|my_center|LOCUS_25800 1377 1646 gene locus_tag LOCUS_25810 1377 1646 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_25810 1649 2773 gene locus_tag LOCUS_25820 1649 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2810 4237 gene locus_tag LOCUS_25830 gene thrC 2810 4237 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_25830 5404 4295 gene locus_tag LOCUS_25840 5404 4295 CDS product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122578.1 protein_id gnl|my_center|LOCUS_25840 5566 6192 gene locus_tag LOCUS_25850 5566 6192 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_25850 6587 6204 gene locus_tag LOCUS_25860 6587 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 7452 6589 gene locus_tag LOCUS_25870 gene nadC 7452 6589 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770545.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence72 1009 107 gene locus_tag LOCUS_25880 1009 107 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_25880 2287 1097 gene locus_tag LOCUS_25890 2287 1097 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_25890 3469 2321 gene locus_tag LOCUS_25900 3469 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 4696 3524 gene locus_tag LOCUS_25910 4696 3524 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087191.1 protein_id gnl|my_center|LOCUS_25910 5228 4785 gene locus_tag LOCUS_25920 5228 4785 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_25920 5700 5314 gene locus_tag LOCUS_25930 5700 5314 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 protein_id gnl|my_center|LOCUS_25930 5801 6835 gene locus_tag LOCUS_25940 5801 6835 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189449.1 protein_id gnl|my_center|LOCUS_25940 6852 8690 gene locus_tag LOCUS_25950 gene phaC 6852 8690 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence73 771 142 gene locus_tag LOCUS_25960 771 142 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195230.1 protein_id gnl|my_center|LOCUS_25960 1384 773 gene locus_tag LOCUS_25970 1384 773 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707290.1 protein_id gnl|my_center|LOCUS_25970 1893 1381 gene locus_tag LOCUS_25980 1893 1381 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_25980 2272 1895 gene locus_tag LOCUS_25990 2272 1895 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015709088.1 protein_id gnl|my_center|LOCUS_25990 3198 2269 gene locus_tag LOCUS_26000 gene rapZ 3198 2269 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530937.1 protein_id gnl|my_center|LOCUS_26000 3185 4363 gene locus_tag LOCUS_26010 3185 4363 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_26010 5980 4367 gene locus_tag LOCUS_26020 5980 4367 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113347.1 protein_id gnl|my_center|LOCUS_26020 6980 6063 gene locus_tag LOCUS_26030 6980 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 7156 6977 gene locus_tag LOCUS_26040 7156 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 7347 7153 gene locus_tag LOCUS_26050 7347 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 8337 7348 gene locus_tag LOCUS_26060 8337 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence74 2425 17 gene locus_tag LOCUS_26070 gene cas3 2425 17 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_26070 3389 2418 gene locus_tag LOCUS_26080 3389 2418 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_26080 3994 5514 gene locus_tag LOCUS_26090 3994 5514 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_26090 5600 5971 gene locus_tag LOCUS_26100 5600 5971 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_26100 5989 6324 gene locus_tag LOCUS_26110 5989 6324 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196851.1 protein_id gnl|my_center|LOCUS_26110 6535 7395 gene locus_tag LOCUS_26120 6535 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 7420 7686 gene locus_tag LOCUS_26130 7420 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence75 436 8 gene locus_tag LOCUS_26140 436 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1238 441 gene locus_tag LOCUS_26150 gene folE2 1238 441 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_26150 3115 1235 gene locus_tag LOCUS_26160 gene dxs 3115 1235 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 protein_id gnl|my_center|LOCUS_26160 4017 3124 gene locus_tag LOCUS_26170 4017 3124 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525142.1 protein_id gnl|my_center|LOCUS_26170 4253 4014 gene locus_tag LOCUS_26180 4253 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 4357 5493 gene locus_tag LOCUS_26190 4357 5493 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_26190 5606 6457 gene locus_tag LOCUS_26200 5606 6457 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689718.1 protein_id gnl|my_center|LOCUS_26200 6536 6880 gene locus_tag LOCUS_26210 6536 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 6877 7722 gene locus_tag LOCUS_26220 6877 7722 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence76 58 405 gene locus_tag LOCUS_26230 58 405 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809062.1 protein_id gnl|my_center|LOCUS_26230 430 939 gene locus_tag LOCUS_26240 430 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 961 1374 gene locus_tag LOCUS_26250 961 1374 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_26250 1384 2457 gene locus_tag LOCUS_26260 gene arsB 1384 2457 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266245.1 protein_id gnl|my_center|LOCUS_26260 2468 2836 gene locus_tag LOCUS_26270 2468 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2847 4592 gene locus_tag LOCUS_26280 gene arsA 2847 4592 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389201.1 protein_id gnl|my_center|LOCUS_26280 4727 5794 gene locus_tag LOCUS_26290 4727 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 4951 5050 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5795 6073 gene locus_tag LOCUS_26300 5795 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence77 1922 294 gene locus_tag LOCUS_26310 1922 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2075 2174 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3029 2685 gene locus_tag LOCUS_26320 3029 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3488 3048 gene locus_tag LOCUS_26330 3488 3048 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552138.1 protein_id gnl|my_center|LOCUS_26330 4244 3585 gene locus_tag LOCUS_26340 4244 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 5683 4274 gene locus_tag LOCUS_26350 5683 4274 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence78 <1 811 gene locus_tag LOCUS_26360 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087853.1:LysR family transcriptional regulator 1780 827 gene locus_tag LOCUS_26370 gene draG 1780 827 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_26370 2331 1759 gene locus_tag LOCUS_26380 2331 1759 CDS product nitrogen fixation protein NifQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389936.1 protein_id gnl|my_center|LOCUS_26380 2712 2350 gene locus_tag LOCUS_26390 2712 2350 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563670.1 protein_id gnl|my_center|LOCUS_26390 3086 2799 gene locus_tag LOCUS_26400 gene fdxC 3086 2799 CDS product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_26400 4374 3103 gene locus_tag LOCUS_26410 4374 3103 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 protein_id gnl|my_center|LOCUS_26410 4828 4352 gene locus_tag LOCUS_26420 4828 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence79 343 741 gene locus_tag LOCUS_26430 343 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1265 738 gene locus_tag LOCUS_26440 1265 738 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074350.1 protein_id gnl|my_center|LOCUS_26440 1990 1268 gene locus_tag LOCUS_26450 1990 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2735 1983 gene locus_tag LOCUS_26460 2735 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074347.1 protein_id gnl|my_center|LOCUS_26460 3092 3736 gene locus_tag LOCUS_26470 3092 3736 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_26470 3840 4754 gene locus_tag LOCUS_26480 3840 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 4863 5138 gene locus_tag LOCUS_26490 4863 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence80 945 304 gene locus_tag LOCUS_26500 945 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1124 1801 gene locus_tag LOCUS_26510 1124 1801 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_26510 1798 3198 gene locus_tag LOCUS_26520 gene cusS 1798 3198 CDS product Cu(+)/Ag(+) sensor histidine kinase CusS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253793.1 protein_id gnl|my_center|LOCUS_26520 3704 4243 gene locus_tag LOCUS_26530 3704 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 4227 4652 gene locus_tag LOCUS_26540 4227 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 4731 5051 gene locus_tag LOCUS_26550 4731 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence81 921 1 gene locus_tag LOCUS_26560 921 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1850 939 gene locus_tag LOCUS_26570 1850 939 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063866.1 protein_id gnl|my_center|LOCUS_26570 1950 2831 gene locus_tag LOCUS_26580 1950 2831 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_26580 2917 3186 gene locus_tag LOCUS_26590 2917 3186 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence82 <1 2463 gene locus_tag LOCUS_26600 <1 2463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480405.1:Tn3 family transposase 3328 2471 gene locus_tag LOCUS_26610 3328 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3608 3330 gene locus_tag LOCUS_26620 3608 3330 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357604.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence83 1027 2724 gene locus_tag LOCUS_26630 gene nirS 1027 2724 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence84 54 127 gene locus_tag LOCUS_t00470 54 127 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 237 2177 gene locus_tag LOCUS_26640 237 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2230 2613 gene locus_tag LOCUS_26650 2230 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2614 3342 gene locus_tag LOCUS_26660 2614 3342 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083847.1 protein_id gnl|my_center|LOCUS_26660 3569 3883 gene locus_tag LOCUS_26670 3569 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence85 >Feature sequence86 143 1165 gene locus_tag LOCUS_26680 143 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1166 2197 gene locus_tag LOCUS_26690 1166 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690