>Feature sequence01 347 1048 gene locus_tag LOCUS_00010 347 1048 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 protein_id gnl|my_center|LOCUS_00010 1077 1478 gene locus_tag LOCUS_00020 1077 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2122 1430 gene locus_tag LOCUS_00030 2122 1430 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376795.1 protein_id gnl|my_center|LOCUS_00030 2230 2583 gene locus_tag LOCUS_00040 2230 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2603 3544 gene locus_tag LOCUS_00050 2603 3544 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_00050 3555 4112 gene locus_tag LOCUS_00060 gene frr 3555 4112 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938332.1 protein_id gnl|my_center|LOCUS_00060 4115 4723 gene locus_tag LOCUS_00070 gene pyrE 4115 4723 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 protein_id gnl|my_center|LOCUS_00070 4723 5202 gene locus_tag LOCUS_00080 4723 5202 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851998.1 protein_id gnl|my_center|LOCUS_00080 5202 6278 gene locus_tag LOCUS_00090 5202 6278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072975.1 protein_id gnl|my_center|LOCUS_00090 6307 8109 gene locus_tag LOCUS_00100 6307 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9077 8106 gene locus_tag LOCUS_00110 9077 8106 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_00110 9824 9087 gene locus_tag LOCUS_00120 9824 9087 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 protein_id gnl|my_center|LOCUS_00120 10249 9833 gene locus_tag LOCUS_00130 10249 9833 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816423.1 protein_id gnl|my_center|LOCUS_00130 10610 10326 gene locus_tag LOCUS_00140 10610 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10742 11131 gene locus_tag LOCUS_00150 10742 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11789 11142 gene locus_tag LOCUS_00160 11789 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 11901 12248 gene locus_tag LOCUS_00170 11901 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 12896 12249 gene locus_tag LOCUS_00180 12896 12249 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455256.1 protein_id gnl|my_center|LOCUS_00180 14364 12973 gene locus_tag LOCUS_00190 14364 12973 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_00190 16029 14383 gene locus_tag LOCUS_00200 16029 14383 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_00200 16321 16860 gene locus_tag LOCUS_00210 16321 16860 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350422.1 protein_id gnl|my_center|LOCUS_00210 16860 17477 gene locus_tag LOCUS_00220 16860 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 17474 18391 gene locus_tag LOCUS_00230 17474 18391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 18378 19034 gene locus_tag LOCUS_00240 18378 19034 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_00240 19061 19282 gene locus_tag LOCUS_00250 19061 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 19337 19762 gene locus_tag LOCUS_00260 19337 19762 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461111.1 protein_id gnl|my_center|LOCUS_00260 19762 20913 gene locus_tag LOCUS_00270 19762 20913 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694302.1 protein_id gnl|my_center|LOCUS_00270 21324 20941 gene locus_tag LOCUS_00280 21324 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 21508 22344 gene locus_tag LOCUS_00290 21508 22344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 22400 22750 gene locus_tag LOCUS_00300 22400 22750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 22863 24011 gene locus_tag LOCUS_00310 22863 24011 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209266.1 protein_id gnl|my_center|LOCUS_00310 24016 27159 gene locus_tag LOCUS_00320 24016 27159 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815450.1 protein_id gnl|my_center|LOCUS_00320 27161 28585 gene locus_tag LOCUS_00330 27161 28585 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815451.1 protein_id gnl|my_center|LOCUS_00330 28658 30076 gene locus_tag LOCUS_00340 28658 30076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30084 30275 gene locus_tag LOCUS_00350 30084 30275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 31426 30494 gene locus_tag LOCUS_00360 31426 30494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 32691 31465 gene locus_tag LOCUS_00370 32691 31465 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_00370 33098 32784 gene locus_tag LOCUS_00380 33098 32784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 33312 34580 gene locus_tag LOCUS_00390 33312 34580 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853122.1 protein_id gnl|my_center|LOCUS_00390 34585 34998 gene locus_tag LOCUS_00400 34585 34998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 35011 35943 gene locus_tag LOCUS_00410 gene cysK 35011 35943 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_00410 35975 36205 gene locus_tag LOCUS_00420 35975 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 36215 36916 gene locus_tag LOCUS_00430 36215 36916 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_00430 36928 37839 gene locus_tag LOCUS_00440 gene cysD 36928 37839 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707309.1 protein_id gnl|my_center|LOCUS_00440 37841 39298 gene locus_tag LOCUS_00450 gene cysN 37841 39298 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206077.1 protein_id gnl|my_center|LOCUS_00450 39298 40392 gene locus_tag LOCUS_00460 39298 40392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 40498 41799 gene locus_tag LOCUS_00470 40498 41799 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864147.1 protein_id gnl|my_center|LOCUS_00470 42082 42975 gene locus_tag LOCUS_00480 42082 42975 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908758.1 protein_id gnl|my_center|LOCUS_00480 43526 43113 gene locus_tag LOCUS_00490 43526 43113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 43810 47175 gene locus_tag LOCUS_00500 43810 47175 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085761.1 protein_id gnl|my_center|LOCUS_00500 47176 49665 gene locus_tag LOCUS_00510 47176 49665 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_00510 49668 50561 gene locus_tag LOCUS_00520 49668 50561 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_00520 52551 50569 gene locus_tag LOCUS_00530 52551 50569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 53759 52698 gene locus_tag LOCUS_00540 53759 52698 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510777.1 protein_id gnl|my_center|LOCUS_00540 54635 53775 gene locus_tag LOCUS_00550 gene cysW 54635 53775 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534651.1 protein_id gnl|my_center|LOCUS_00550 55486 54632 gene locus_tag LOCUS_00560 gene cysT 55486 54632 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_00560 56769 55840 gene locus_tag LOCUS_00570 gene cysK 56769 55840 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_00570 56959 56792 gene locus_tag LOCUS_00580 56959 56792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57239 56946 gene locus_tag LOCUS_00590 57239 56946 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948127.1 protein_id gnl|my_center|LOCUS_00590 58005 57250 gene locus_tag LOCUS_00600 58005 57250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 59255 58008 gene locus_tag LOCUS_00610 59255 58008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 60918 59581 gene locus_tag LOCUS_00620 60918 59581 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880096.1 protein_id gnl|my_center|LOCUS_00620 62457 60922 gene locus_tag LOCUS_00630 62457 60922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 63370 62426 gene locus_tag LOCUS_00640 63370 62426 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_00640 64559 63390 gene locus_tag LOCUS_00650 gene moeB 64559 63390 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_00650 64834 64559 gene locus_tag LOCUS_00660 64834 64559 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143402.1 protein_id gnl|my_center|LOCUS_00660 65256 64837 gene locus_tag LOCUS_00670 65256 64837 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_00670 66164 65253 gene locus_tag LOCUS_00680 66164 65253 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_00680 67261 66188 gene locus_tag LOCUS_00690 67261 66188 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928929.1 protein_id gnl|my_center|LOCUS_00690 67913 67452 gene locus_tag LOCUS_00700 67913 67452 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868963.1 protein_id gnl|my_center|LOCUS_00700 68927 67995 gene locus_tag LOCUS_00710 68927 67995 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_00710 69870 68914 gene locus_tag LOCUS_00720 69870 68914 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_00720 70535 69870 gene locus_tag LOCUS_00730 70535 69870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 71901 70537 gene locus_tag LOCUS_00740 71901 70537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 73980 72166 gene locus_tag LOCUS_00750 gene typA 73980 72166 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_00750 74149 75771 gene locus_tag LOCUS_00760 74149 75771 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 protein_id gnl|my_center|LOCUS_00760 75749 76459 gene locus_tag LOCUS_00770 75749 76459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 76437 76826 gene locus_tag LOCUS_00780 76437 76826 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072235.1 protein_id gnl|my_center|LOCUS_00780 76885 77286 gene locus_tag LOCUS_00790 76885 77286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 77297 77809 gene locus_tag LOCUS_00800 77297 77809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 77820 78593 gene locus_tag LOCUS_00810 77820 78593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 78613 78936 gene locus_tag LOCUS_00820 78613 78936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00820 78902 79285 gene locus_tag LOCUS_00830 78902 79285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 79278 79940 gene locus_tag LOCUS_00840 gene arsR 79278 79940 CDS product acid response regulator transcription factor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573710.1 protein_id gnl|my_center|LOCUS_00840 79944 81134 gene locus_tag LOCUS_00850 79944 81134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 82695 81118 gene locus_tag LOCUS_00860 82695 81118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 82803 83645 gene locus_tag LOCUS_00870 82803 83645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 83645 84562 gene locus_tag LOCUS_00880 83645 84562 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314081.1 protein_id gnl|my_center|LOCUS_00880 84616 85230 gene locus_tag LOCUS_00890 84616 85230 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979664.1 protein_id gnl|my_center|LOCUS_00890 85302 85757 gene locus_tag LOCUS_00900 85302 85757 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073835.1 protein_id gnl|my_center|LOCUS_00900 86347 85769 gene locus_tag LOCUS_00910 gene purN 86347 85769 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_00910 86856 86392 gene locus_tag LOCUS_00920 gene ruvC 86856 86392 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 protein_id gnl|my_center|LOCUS_00920 87091 87327 gene locus_tag LOCUS_00930 87091 87327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 87394 89076 gene locus_tag LOCUS_00940 87394 89076 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880685.1 protein_id gnl|my_center|LOCUS_00940 89073 90368 gene locus_tag LOCUS_00950 89073 90368 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 protein_id gnl|my_center|LOCUS_00950 90358 91689 gene locus_tag LOCUS_00960 90358 91689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 91771 93087 gene locus_tag LOCUS_00970 gene dnaA 91771 93087 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 protein_id gnl|my_center|LOCUS_00970 93256 94326 gene locus_tag LOCUS_00980 gene dnaN 93256 94326 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_00980 94356 96677 gene locus_tag LOCUS_00990 gene gyrB 94356 96677 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858833.1 protein_id gnl|my_center|LOCUS_00990 97712 96711 gene locus_tag LOCUS_01000 97712 96711 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856867.1 protein_id gnl|my_center|LOCUS_01000 97846 98229 gene locus_tag LOCUS_01010 gene queF 97846 98229 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 protein_id gnl|my_center|LOCUS_01010 98240 98851 gene locus_tag LOCUS_01020 98240 98851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 99097 99504 gene locus_tag LOCUS_01030 99097 99504 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534270.1 protein_id gnl|my_center|LOCUS_01030 99918 99532 gene locus_tag LOCUS_01040 99918 99532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 101235 99979 gene locus_tag LOCUS_01050 gene clpX 101235 99979 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_01050 102052 101228 gene locus_tag LOCUS_01060 102052 101228 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388754.1 protein_id gnl|my_center|LOCUS_01060 102569 102045 gene locus_tag LOCUS_01070 102569 102045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 104088 102559 gene locus_tag LOCUS_01080 104088 102559 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 protein_id gnl|my_center|LOCUS_01080 104386 104177 gene locus_tag LOCUS_01090 104386 104177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 106036 104390 gene locus_tag LOCUS_01100 gene sdhA 106036 104390 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_01100 107143 106037 gene locus_tag LOCUS_01110 107143 106037 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_01110 108136 107291 gene locus_tag LOCUS_01120 gene modD 108136 107291 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814376.1 protein_id gnl|my_center|LOCUS_01120 109001 108147 gene locus_tag LOCUS_01130 109001 108147 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_01130 109696 108998 gene locus_tag LOCUS_01140 gene modB 109696 108998 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_01140 110090 109689 gene locus_tag LOCUS_01150 110090 109689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 110833 110087 gene locus_tag LOCUS_01160 gene modA 110833 110087 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_01160 111625 110843 gene locus_tag LOCUS_01170 111625 110843 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_01170 113291 111747 gene locus_tag LOCUS_01180 gene nifK 113291 111747 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_01180 114759 113302 gene locus_tag LOCUS_01190 gene nifD 114759 113302 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_01190 115152 114793 gene locus_tag LOCUS_01200 115152 114793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 116110 115196 gene locus_tag LOCUS_01210 gene nifH 116110 115196 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084578.1 protein_id gnl|my_center|LOCUS_01210 117836 116418 gene locus_tag LOCUS_01220 117836 116418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 119209 117962 gene locus_tag LOCUS_01230 119209 117962 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996418.1 protein_id gnl|my_center|LOCUS_01230 119560 119264 gene locus_tag LOCUS_01240 gene fdxC 119560 119264 CDS product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_01240 119915 119571 gene locus_tag LOCUS_01250 119915 119571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 120403 120011 gene locus_tag LOCUS_01260 120403 120011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 120728 120393 gene locus_tag LOCUS_01270 120728 120393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 121261 120740 gene locus_tag LOCUS_01280 gene fldA 121261 120740 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793355.1 protein_id gnl|my_center|LOCUS_01280 121703 121272 gene locus_tag LOCUS_01290 121703 121272 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565962.1 protein_id gnl|my_center|LOCUS_01290 122098 121703 gene locus_tag LOCUS_01300 122098 121703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 123415 122162 gene locus_tag LOCUS_01310 123415 122162 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_01310 123842 123399 gene locus_tag LOCUS_01320 123842 123399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 124365 123844 gene locus_tag LOCUS_01330 124365 123844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 125725 124430 gene locus_tag LOCUS_01340 gene nifN 125725 124430 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533487.1 protein_id gnl|my_center|LOCUS_01340 125840 129022 gene locus_tag LOCUS_01350 125840 129022 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_01350 129027 129353 gene locus_tag LOCUS_01360 129027 129353 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_01360 129356 129721 gene locus_tag LOCUS_01370 129356 129721 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_01370 131061 129718 gene locus_tag LOCUS_01380 gene nifE 131061 129718 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_01380 131267 132004 gene locus_tag LOCUS_01390 131267 132004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 132001 132360 gene locus_tag LOCUS_01400 gene nifX 132001 132360 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545689.1 protein_id gnl|my_center|LOCUS_01400 132357 133595 gene locus_tag LOCUS_01410 132357 133595 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 protein_id gnl|my_center|LOCUS_01410 134493 133666 gene locus_tag LOCUS_01420 gene czcR 134493 133666 CDS product LysR family transcriptional regulator CzcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398672.1 protein_id gnl|my_center|LOCUS_01420 134591 135769 gene locus_tag LOCUS_01430 134591 135769 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359221.1 protein_id gnl|my_center|LOCUS_01430 136007 135786 gene locus_tag LOCUS_01440 136007 135786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 136076 137524 gene locus_tag LOCUS_01450 gene nifB 136076 137524 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_01450 137634 138749 gene locus_tag LOCUS_01460 gene nifV 137634 138749 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941605.1 protein_id gnl|my_center|LOCUS_01460 138731 139537 gene locus_tag LOCUS_01470 138731 139537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 139547 139756 gene locus_tag LOCUS_01480 139547 139756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 139767 140009 gene locus_tag LOCUS_01490 139767 140009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 140013 141008 gene locus_tag LOCUS_01500 140013 141008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 141018 141467 gene locus_tag LOCUS_01510 141018 141467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 142738 141476 gene locus_tag LOCUS_01520 142738 141476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 143133 142747 gene locus_tag LOCUS_01530 143133 142747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 144135 143239 gene locus_tag LOCUS_01540 144135 143239 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_01540 144282 145610 gene locus_tag LOCUS_01550 gene purB 144282 145610 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865088.1 protein_id gnl|my_center|LOCUS_01550 145625 148009 gene locus_tag LOCUS_01560 145625 148009 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865087.1 protein_id gnl|my_center|LOCUS_01560 148086 149105 gene locus_tag LOCUS_01570 148086 149105 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851758.1 protein_id gnl|my_center|LOCUS_01570 149336 149458 gene locus_tag LOCUS_01580 149336 149458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 149556 149984 gene locus_tag LOCUS_01590 149556 149984 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_01590 150735 150007 gene locus_tag LOCUS_01600 150735 150007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 151239 150745 gene locus_tag LOCUS_01610 151239 150745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 151327 151797 gene locus_tag LOCUS_01620 151327 151797 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_01620 153143 151818 gene locus_tag LOCUS_01630 gene hcp 153143 151818 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110272.1 protein_id gnl|my_center|LOCUS_01630 153285 153542 gene locus_tag LOCUS_01640 153285 153542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 154759 153539 gene locus_tag LOCUS_01650 154759 153539 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_01650 154915 155961 gene locus_tag LOCUS_01660 154915 155961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 155966 156451 gene locus_tag LOCUS_01670 155966 156451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 157448 156462 gene locus_tag LOCUS_01680 157448 156462 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_01680 157561 157902 gene locus_tag LOCUS_01690 157561 157902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 158585 157899 gene locus_tag LOCUS_01700 gene fetB 158585 157899 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926980.1 protein_id gnl|my_center|LOCUS_01700 159288 158614 gene locus_tag LOCUS_01710 159288 158614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 160196 159300 gene locus_tag LOCUS_01720 160196 159300 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 protein_id gnl|my_center|LOCUS_01720 161629 160196 gene locus_tag LOCUS_01730 gene gatB 161629 160196 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 protein_id gnl|my_center|LOCUS_01730 162463 161639 gene locus_tag LOCUS_01740 162463 161639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 165376 162536 gene locus_tag LOCUS_01750 165376 162536 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 protein_id gnl|my_center|LOCUS_01750 166942 165587 gene locus_tag LOCUS_01760 166942 165587 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_01760 167547 166939 gene locus_tag LOCUS_01770 167547 166939 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_01770 168731 167667 gene locus_tag LOCUS_01780 168731 167667 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918468.1 protein_id gnl|my_center|LOCUS_01780 169461 168817 gene locus_tag LOCUS_01790 gene crdR 169461 168817 CDS product copper response regulator transcription factor CrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_01790 171656 169464 gene locus_tag LOCUS_01800 171656 169464 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545732.1 protein_id gnl|my_center|LOCUS_01800 172269 171682 gene locus_tag LOCUS_01810 172269 171682 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922085.1 protein_id gnl|my_center|LOCUS_01810 173641 172259 gene locus_tag LOCUS_01820 173641 172259 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_01820 174387 173638 gene locus_tag LOCUS_01830 174387 173638 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_01830 175024 174449 gene locus_tag LOCUS_01840 175024 174449 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477331.1 protein_id gnl|my_center|LOCUS_01840 175442 175011 gene locus_tag LOCUS_01850 175442 175011 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_01850 175602 176069 gene locus_tag LOCUS_01860 gene accB 175602 176069 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946212.1 protein_id gnl|my_center|LOCUS_01860 176079 177431 gene locus_tag LOCUS_01870 176079 177431 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858001.1 protein_id gnl|my_center|LOCUS_01870 177671 179260 gene locus_tag LOCUS_01880 177671 179260 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 protein_id gnl|my_center|LOCUS_01880 179418 181004 gene locus_tag LOCUS_01890 179418 181004 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_01890 181259 181993 gene locus_tag LOCUS_01900 181259 181993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 181999 183789 gene locus_tag LOCUS_01910 gene asnB 181999 183789 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_01910 183848 184150 gene locus_tag LOCUS_01920 183848 184150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 184150 184770 gene locus_tag LOCUS_01930 gene bluB 184150 184770 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_01930 184826 185893 gene locus_tag LOCUS_01940 184826 185893 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123234.1 protein_id gnl|my_center|LOCUS_01940 186640 185909 gene locus_tag LOCUS_01950 186640 185909 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706985.1 protein_id gnl|my_center|LOCUS_01950 188240 186630 gene locus_tag LOCUS_01960 gene sdhA 188240 186630 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_01960 188623 188243 gene locus_tag LOCUS_01970 188623 188243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 190330 188924 gene locus_tag LOCUS_01980 190330 188924 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460344.1 protein_id gnl|my_center|LOCUS_01980 190848 190330 gene locus_tag LOCUS_01990 gene hemJ 190848 190330 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506456.1 protein_id gnl|my_center|LOCUS_01990 192042 190852 gene locus_tag LOCUS_02000 192042 190852 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060246.1 protein_id gnl|my_center|LOCUS_02000 192856 192026 gene locus_tag LOCUS_02010 192856 192026 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398405.1 protein_id gnl|my_center|LOCUS_02010 193818 192856 gene locus_tag LOCUS_02020 193818 192856 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121932.1 protein_id gnl|my_center|LOCUS_02020 195758 193833 gene locus_tag LOCUS_02030 195758 193833 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864793.1 protein_id gnl|my_center|LOCUS_02030 196539 195745 gene locus_tag LOCUS_02040 gene rsmA 196539 195745 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_02040 196613 197374 gene locus_tag LOCUS_02050 gene hisF 196613 197374 CDS product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880108.1 protein_id gnl|my_center|LOCUS_02050 197376 198062 gene locus_tag LOCUS_02060 197376 198062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 198059 198595 gene locus_tag LOCUS_02070 198059 198595 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853142.1 protein_id gnl|my_center|LOCUS_02070 198615 199697 gene locus_tag LOCUS_02080 gene rlmN 198615 199697 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_02080 199788 201197 gene locus_tag LOCUS_02090 gene gltX 199788 201197 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 protein_id gnl|my_center|LOCUS_02090 201251 201517 gene locus_tag LOCUS_02100 201251 201517 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791868.1 protein_id gnl|my_center|LOCUS_02100 201742 202404 gene locus_tag LOCUS_02110 gene dccR 201742 202404 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_02110 202379 203533 gene locus_tag LOCUS_02120 gene crdS 202379 203533 CDS product copper-sensing histidine kinase CrdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951935.1 protein_id gnl|my_center|LOCUS_02120 203597 203980 gene locus_tag LOCUS_02130 203597 203980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 203980 205176 gene locus_tag LOCUS_02140 gene crdB 203980 205176 CDS product copper resistance outer membrane protein CrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948089.1 protein_id gnl|my_center|LOCUS_02140 205173 206177 gene locus_tag LOCUS_02150 205173 206177 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822204.1 protein_id gnl|my_center|LOCUS_02150 206184 209285 gene locus_tag LOCUS_02160 206184 209285 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570460.1 protein_id gnl|my_center|LOCUS_02160 209335 209913 gene locus_tag LOCUS_02170 209335 209913 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_02170 209955 210278 gene locus_tag LOCUS_02180 209955 210278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 211667 210309 gene locus_tag LOCUS_02190 211667 210309 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930455.1 protein_id gnl|my_center|LOCUS_02190 212945 211683 gene locus_tag LOCUS_02200 212945 211683 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746824.1 protein_id gnl|my_center|LOCUS_02200 214169 212955 gene locus_tag LOCUS_02210 214169 212955 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851675.1 protein_id gnl|my_center|LOCUS_02210 214985 214176 gene locus_tag LOCUS_02220 214985 214176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 215687 214998 gene locus_tag LOCUS_02230 gene rlmB 215687 214998 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149319.1 protein_id gnl|my_center|LOCUS_02230 216436 215684 gene locus_tag LOCUS_02240 gene rsmI 216436 215684 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_02240 216718 216515 gene locus_tag LOCUS_02250 gene rpmE 216718 216515 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_02250 217675 216800 gene locus_tag LOCUS_02260 gene miaA 217675 216800 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851982.1 protein_id gnl|my_center|LOCUS_02260 217875 217672 gene locus_tag LOCUS_02270 217875 217672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 217967 218830 gene locus_tag LOCUS_02280 217967 218830 CDS product 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851905.1 protein_id gnl|my_center|LOCUS_02280 218937 218861 gene locus_tag LOCUS_t00010 218937 218861 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 219010 219630 gene locus_tag LOCUS_02290 219010 219630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 219807 220517 gene locus_tag LOCUS_02300 219807 220517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 220626 221330 gene locus_tag LOCUS_02310 220626 221330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 221327 222085 gene locus_tag LOCUS_02320 221327 222085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 222082 222831 gene locus_tag LOCUS_02330 222082 222831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 222901 226179 gene locus_tag LOCUS_02340 222901 226179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 226188 227849 gene locus_tag LOCUS_02350 226188 227849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 227852 228868 gene locus_tag LOCUS_02360 227852 228868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 228880 230571 gene locus_tag LOCUS_02370 228880 230571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 230559 231308 gene locus_tag LOCUS_02380 230559 231308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 231305 231796 gene locus_tag LOCUS_02390 231305 231796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 231793 233907 gene locus_tag LOCUS_02400 231793 233907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 233926 234903 gene locus_tag LOCUS_02410 233926 234903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 234913 235989 gene locus_tag LOCUS_02420 234913 235989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 237183 236014 gene locus_tag LOCUS_02430 gene purT 237183 236014 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496844.1 protein_id gnl|my_center|LOCUS_02430 237960 237202 gene locus_tag LOCUS_02440 237960 237202 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851407.1 protein_id gnl|my_center|LOCUS_02440 238711 237971 gene locus_tag LOCUS_02450 gene dapF 238711 237971 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_02450 239298 238708 gene locus_tag LOCUS_02460 gene coaE 239298 238708 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 protein_id gnl|my_center|LOCUS_02460 239898 239350 gene locus_tag LOCUS_02470 239898 239350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 239998 240993 gene locus_tag LOCUS_02480 gene purM 239998 240993 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence02 2288 1914 gene locus_tag LOCUS_02490 2288 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 3699 2290 gene locus_tag LOCUS_02500 gene tlpD 3699 2290 CDS product chemotaxis chemoreceptor TlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467802.1 protein_id gnl|my_center|LOCUS_02500 4893 3784 gene locus_tag LOCUS_02510 4893 3784 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439209.1 protein_id gnl|my_center|LOCUS_02510 6170 4920 gene locus_tag LOCUS_02520 6170 4920 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_02520 6844 6167 gene locus_tag LOCUS_02530 6844 6167 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853196.1 protein_id gnl|my_center|LOCUS_02530 7425 6964 gene locus_tag LOCUS_02540 7425 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 7652 9691 gene locus_tag LOCUS_02550 7652 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 9688 10689 gene locus_tag LOCUS_02560 9688 10689 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063524.1 protein_id gnl|my_center|LOCUS_02560 13744 10757 gene locus_tag LOCUS_02570 13744 10757 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858240.1 protein_id gnl|my_center|LOCUS_02570 14049 13744 gene locus_tag LOCUS_02580 14049 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 14211 14447 gene locus_tag LOCUS_02590 14211 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 15176 14469 gene locus_tag LOCUS_02600 15176 14469 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_02600 15305 17017 gene locus_tag LOCUS_02610 15305 17017 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_02610 17549 17034 gene locus_tag LOCUS_02620 17549 17034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 19319 17688 gene locus_tag LOCUS_02630 19319 17688 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_02630 21452 19332 gene locus_tag LOCUS_02640 21452 19332 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260080.1 protein_id gnl|my_center|LOCUS_02640 22611 21439 gene locus_tag LOCUS_02650 22611 21439 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891906.1 protein_id gnl|my_center|LOCUS_02650 23135 22611 gene locus_tag LOCUS_02660 gene lptE 23135 22611 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202125.1 protein_id gnl|my_center|LOCUS_02660 25609 23144 gene locus_tag LOCUS_02670 gene leuS 25609 23144 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_02670 25953 25609 gene locus_tag LOCUS_02680 25953 25609 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383778.1 protein_id gnl|my_center|LOCUS_02680 27075 26107 gene locus_tag LOCUS_02690 gene secF 27075 26107 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_02690 28640 27075 gene locus_tag LOCUS_02700 gene secD 28640 27075 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_02700 28996 28721 gene locus_tag LOCUS_02710 gene yajC 28996 28721 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 protein_id gnl|my_center|LOCUS_02710 29025 30257 gene locus_tag LOCUS_02720 29025 30257 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237964.1 protein_id gnl|my_center|LOCUS_02720 32053 30254 gene locus_tag LOCUS_02730 32053 30254 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802731.1 protein_id gnl|my_center|LOCUS_02730 32465 32028 gene locus_tag LOCUS_02740 32465 32028 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_02740 33931 32534 gene locus_tag LOCUS_02750 33931 32534 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207256.1 protein_id gnl|my_center|LOCUS_02750 34766 33906 gene locus_tag LOCUS_02760 gene mscS 34766 33906 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_02760 36498 34777 gene locus_tag LOCUS_02770 36498 34777 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891863.1 protein_id gnl|my_center|LOCUS_02770 37814 36516 gene locus_tag LOCUS_02780 gene hemA 37814 36516 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878972.1 protein_id gnl|my_center|LOCUS_02780 38713 37814 gene locus_tag LOCUS_02790 38713 37814 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_02790 39025 38723 gene locus_tag LOCUS_02800 39025 38723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 40335 39040 gene locus_tag LOCUS_02810 gene hisD 40335 39040 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_02810 40845 40336 gene locus_tag LOCUS_02820 40845 40336 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164290.1 protein_id gnl|my_center|LOCUS_02820 40963 44103 gene locus_tag LOCUS_02830 40963 44103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 46027 44096 gene locus_tag LOCUS_02840 46027 44096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 46945 46070 gene locus_tag LOCUS_02850 46945 46070 CDS product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063177.1 protein_id gnl|my_center|LOCUS_02850 46968 47465 gene locus_tag LOCUS_02860 46968 47465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 47462 47854 gene locus_tag LOCUS_02870 47462 47854 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_02870 48687 47875 gene locus_tag LOCUS_02880 48687 47875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 50047 48980 gene locus_tag LOCUS_02890 gene fbaA 50047 48980 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034368.1 protein_id gnl|my_center|LOCUS_02890 50867 50058 gene locus_tag LOCUS_02900 gene cbf2 50867 50058 CDS product peptidylprolyl isomerase CBF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739470.1 protein_id gnl|my_center|LOCUS_02900 51084 51773 gene locus_tag LOCUS_02910 gene hsrA 51084 51773 CDS product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 protein_id gnl|my_center|LOCUS_02910 51796 53073 gene locus_tag LOCUS_02920 51796 53073 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_02920 53502 53074 gene locus_tag LOCUS_02930 53502 53074 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_02930 54620 53574 gene locus_tag LOCUS_02940 54620 53574 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612141.1 protein_id gnl|my_center|LOCUS_02940 54949 54620 gene locus_tag LOCUS_02950 54949 54620 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852609.1 protein_id gnl|my_center|LOCUS_02950 55446 55174 gene locus_tag LOCUS_02960 gene rpsO 55446 55174 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852579.1 protein_id gnl|my_center|LOCUS_02960 56059 55535 gene locus_tag LOCUS_02970 gene purE 56059 55535 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_02970 57207 56056 gene locus_tag LOCUS_02980 gene purK 57207 56056 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081519.1 protein_id gnl|my_center|LOCUS_02980 58388 57417 gene locus_tag LOCUS_02990 gene moaA 58388 57417 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868437.1 protein_id gnl|my_center|LOCUS_02990 59326 58409 gene locus_tag LOCUS_03000 59326 58409 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880083.1 protein_id gnl|my_center|LOCUS_03000 59414 60079 gene locus_tag LOCUS_03010 gene nssR 59414 60079 CDS product nitrosative stress-sensitive transcriptional regulator NssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851096.1 protein_id gnl|my_center|LOCUS_03010 60076 61089 gene locus_tag LOCUS_03020 60076 61089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 61144 61878 gene locus_tag LOCUS_03030 61144 61878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 61928 63550 gene locus_tag LOCUS_03040 61928 63550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 63667 66477 gene locus_tag LOCUS_03050 gene napA 63667 66477 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_03050 66495 67307 gene locus_tag LOCUS_03060 gene napG 66495 67307 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852504.1 protein_id gnl|my_center|LOCUS_03060 67304 68125 gene locus_tag LOCUS_03070 gene napH 67304 68125 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_03070 68112 68711 gene locus_tag LOCUS_03080 68112 68711 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891887.1 protein_id gnl|my_center|LOCUS_03080 68711 69199 gene locus_tag LOCUS_03090 gene napF 68711 69199 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420459.1 protein_id gnl|my_center|LOCUS_03090 69211 70167 gene locus_tag LOCUS_03100 69211 70167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 70179 70565 gene locus_tag LOCUS_03110 70179 70565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 70567 71010 gene locus_tag LOCUS_03120 70567 71010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 71348 71022 gene locus_tag LOCUS_03130 71348 71022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 71426 71809 gene locus_tag LOCUS_03140 71426 71809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 73380 72142 gene locus_tag LOCUS_03150 gene serS 73380 72142 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858681.1 protein_id gnl|my_center|LOCUS_03150 73662 73456 gene locus_tag LOCUS_03160 73662 73456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 74701 73730 gene locus_tag LOCUS_03170 gene czcD 74701 73730 CDS product CDF family cation-efflux transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852858.1 protein_id gnl|my_center|LOCUS_03170 74837 75802 gene locus_tag LOCUS_03180 gene trpS 74837 75802 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_03180 75817 77154 gene locus_tag LOCUS_03190 75817 77154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 77759 77157 gene locus_tag LOCUS_03200 77759 77157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_03200 78513 77818 gene locus_tag LOCUS_03210 78513 77818 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440107.1 protein_id gnl|my_center|LOCUS_03210 79121 78513 gene locus_tag LOCUS_03220 gene hisG 79121 78513 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881046.1 protein_id gnl|my_center|LOCUS_03220 79725 79099 gene locus_tag LOCUS_03230 79725 79099 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864777.1 protein_id gnl|my_center|LOCUS_03230 80509 79766 gene locus_tag LOCUS_03240 80509 79766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 80809 80591 gene locus_tag LOCUS_03250 80809 80591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 81499 80813 gene locus_tag LOCUS_03260 81499 80813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 81860 81531 gene locus_tag LOCUS_03270 81860 81531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 81971 82744 gene locus_tag LOCUS_03280 81971 82744 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707144.1 protein_id gnl|my_center|LOCUS_03280 82746 83216 gene locus_tag LOCUS_03290 82746 83216 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707143.1 protein_id gnl|my_center|LOCUS_03290 85143 83332 gene locus_tag LOCUS_03300 85143 83332 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204347.1 protein_id gnl|my_center|LOCUS_03300 85234 86412 gene locus_tag LOCUS_03310 85234 86412 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_03310 86539 86901 gene locus_tag LOCUS_03320 gene ndhC 86539 86901 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 protein_id gnl|my_center|LOCUS_03320 86892 87407 gene locus_tag LOCUS_03330 86892 87407 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524416.1 protein_id gnl|my_center|LOCUS_03330 87400 89034 gene locus_tag LOCUS_03340 87400 89034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 89031 89516 gene locus_tag LOCUS_03350 gene nuoE 89031 89516 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_03350 89506 90756 gene locus_tag LOCUS_03360 gene nuoF 89506 90756 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_03360 90788 92074 gene locus_tag LOCUS_03370 90788 92074 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851494.1 protein_id gnl|my_center|LOCUS_03370 92108 93544 gene locus_tag LOCUS_03380 92108 93544 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_03380 93541 94815 gene locus_tag LOCUS_03390 gene nuoH 93541 94815 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_03390 94817 95317 gene locus_tag LOCUS_03400 gene nuoI 94817 95317 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_03400 95317 95838 gene locus_tag LOCUS_03410 95317 95838 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_03410 95841 96155 gene locus_tag LOCUS_03420 gene nuoK 95841 96155 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_03420 96152 98038 gene locus_tag LOCUS_03430 gene nuoL 96152 98038 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_03430 98040 99527 gene locus_tag LOCUS_03440 98040 99527 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_03440 99524 101044 gene locus_tag LOCUS_03450 99524 101044 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_03450 101254 102054 gene locus_tag LOCUS_03460 101254 102054 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854660.1 protein_id gnl|my_center|LOCUS_03460 102054 104039 gene locus_tag LOCUS_03470 102054 104039 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854193.1 protein_id gnl|my_center|LOCUS_03470 104039 104770 gene locus_tag LOCUS_03480 104039 104770 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854302.1 protein_id gnl|my_center|LOCUS_03480 104868 107219 gene locus_tag LOCUS_03490 104868 107219 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857319.1 protein_id gnl|my_center|LOCUS_03490 107219 109243 gene locus_tag LOCUS_03500 107219 109243 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858743.1 protein_id gnl|my_center|LOCUS_03500 109253 109744 gene locus_tag LOCUS_03510 109253 109744 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817239.1 protein_id gnl|my_center|LOCUS_03510 109822 110211 gene locus_tag LOCUS_03520 109822 110211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 110199 110714 gene locus_tag LOCUS_03530 110199 110714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 112873 110741 gene locus_tag LOCUS_03540 112873 110741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 113065 113628 gene locus_tag LOCUS_03550 113065 113628 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_03550 115737 113632 gene locus_tag LOCUS_03560 gene recQ 115737 113632 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_03560 116404 115817 gene locus_tag LOCUS_03570 116404 115817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 117742 116474 gene locus_tag LOCUS_03580 117742 116474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 117902 119122 gene locus_tag LOCUS_03590 117902 119122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 119129 120160 gene locus_tag LOCUS_03600 119129 120160 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858561.1 protein_id gnl|my_center|LOCUS_03600 121207 120281 gene locus_tag LOCUS_03610 121207 120281 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_03610 122194 121217 gene locus_tag LOCUS_03620 122194 121217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 122371 123255 gene locus_tag LOCUS_03630 gene prpB 122371 123255 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052184.1 protein_id gnl|my_center|LOCUS_03630 123307 124416 gene locus_tag LOCUS_03640 gene prpC 123307 124416 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103050.1 protein_id gnl|my_center|LOCUS_03640 124525 127122 gene locus_tag LOCUS_03650 gene acnD 124525 127122 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 protein_id gnl|my_center|LOCUS_03650 127228 128403 gene locus_tag LOCUS_03660 gene prpF 127228 128403 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267429.1 protein_id gnl|my_center|LOCUS_03660 128513 129517 gene locus_tag LOCUS_03670 128513 129517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 130066 129524 gene locus_tag LOCUS_03680 130066 129524 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_03680 131137 130199 gene locus_tag LOCUS_03690 gene hemC 131137 130199 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856753.1 protein_id gnl|my_center|LOCUS_03690 131989 131156 gene locus_tag LOCUS_03700 131989 131156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 134008 132056 gene locus_tag LOCUS_03710 134008 132056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 134790 134005 gene locus_tag LOCUS_03720 gene murI 134790 134005 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_03720 136368 135016 gene locus_tag LOCUS_03730 gene gdhA 136368 135016 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 protein_id gnl|my_center|LOCUS_03730 137836 136508 gene locus_tag LOCUS_03740 gene rho 137836 136508 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852852.1 protein_id gnl|my_center|LOCUS_03740 138608 138012 gene locus_tag LOCUS_03750 138608 138012 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_03750 138862 139134 gene locus_tag LOCUS_03760 138862 139134 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_03760 139246 139659 gene locus_tag LOCUS_03770 gene ndk 139246 139659 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_03770 139686 140063 gene locus_tag LOCUS_03780 139686 140063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 140075 140227 gene locus_tag LOCUS_03790 gene rpmF 140075 140227 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858674.1 protein_id gnl|my_center|LOCUS_03790 140227 141237 gene locus_tag LOCUS_03800 gene plsX 140227 141237 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 protein_id gnl|my_center|LOCUS_03800 141267 142265 gene locus_tag LOCUS_03810 141267 142265 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_03810 142604 142284 gene locus_tag LOCUS_03820 142604 142284 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658306.1 protein_id gnl|my_center|LOCUS_03820 143283 142597 gene locus_tag LOCUS_03830 143283 142597 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_03830 143730 143296 gene locus_tag LOCUS_03840 143730 143296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852822.1 protein_id gnl|my_center|LOCUS_03840 143771 144412 gene locus_tag LOCUS_03850 143771 144412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 144966 144394 gene locus_tag LOCUS_03860 144966 144394 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794135.1 protein_id gnl|my_center|LOCUS_03860 145941 144976 gene locus_tag LOCUS_03870 145941 144976 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_03870 146822 145944 gene locus_tag LOCUS_03880 146822 145944 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852714.1 protein_id gnl|my_center|LOCUS_03880 146920 149250 gene locus_tag LOCUS_03890 146920 149250 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263450.1 protein_id gnl|my_center|LOCUS_03890 149323 150522 gene locus_tag LOCUS_03900 149323 150522 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584130.1 protein_id gnl|my_center|LOCUS_03900 150494 151687 gene locus_tag LOCUS_03910 150494 151687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 153025 151712 gene locus_tag LOCUS_03920 153025 151712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 154392 153010 gene locus_tag LOCUS_03930 154392 153010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 155829 154453 gene locus_tag LOCUS_03940 155829 154453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 155958 157565 gene locus_tag LOCUS_03950 155958 157565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 157602 158198 gene locus_tag LOCUS_03960 gene crdR 157602 158198 CDS product copper response regulator transcription factor CrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_03960 159726 158260 gene locus_tag LOCUS_03970 gene pyk 159726 158260 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858708.1 protein_id gnl|my_center|LOCUS_03970 159856 160581 gene locus_tag LOCUS_03980 159856 160581 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927022.1 protein_id gnl|my_center|LOCUS_03980 160578 161585 gene locus_tag LOCUS_03990 160578 161585 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256047.1 protein_id gnl|my_center|LOCUS_03990 161638 161838 gene locus_tag LOCUS_04000 161638 161838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 161843 162175 gene locus_tag LOCUS_04010 161843 162175 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211699.1 protein_id gnl|my_center|LOCUS_04010 162357 163463 gene locus_tag LOCUS_04020 162357 163463 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491853.1 protein_id gnl|my_center|LOCUS_04020 163450 164103 gene locus_tag LOCUS_04030 163450 164103 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851887.1 protein_id gnl|my_center|LOCUS_04030 164093 164410 gene locus_tag LOCUS_04040 164093 164410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 164421 165482 gene locus_tag LOCUS_04050 gene mqnE 164421 165482 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858079.1 protein_id gnl|my_center|LOCUS_04050 167060 165489 gene locus_tag LOCUS_04060 167060 165489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 167693 167082 gene locus_tag LOCUS_04070 167693 167082 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_04070 168958 167693 gene locus_tag LOCUS_04080 gene miaB 168958 167693 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 protein_id gnl|my_center|LOCUS_04080 169266 169024 gene locus_tag LOCUS_04090 169266 169024 CDS product HP0268 family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859022.1 protein_id gnl|my_center|LOCUS_04090 169419 170588 gene locus_tag LOCUS_04100 gene nusA 169419 170588 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 protein_id gnl|my_center|LOCUS_04100 170594 171997 gene locus_tag LOCUS_04110 gene cysS 170594 171997 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471359.1 protein_id gnl|my_center|LOCUS_04110 172189 171992 gene locus_tag LOCUS_04120 172189 171992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 172530 172264 gene locus_tag LOCUS_04130 gene rpsR 172530 172264 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 protein_id gnl|my_center|LOCUS_04130 173054 172545 gene locus_tag LOCUS_04140 173054 172545 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865738.1 protein_id gnl|my_center|LOCUS_04140 173430 173074 gene locus_tag LOCUS_04150 gene rpsF 173430 173074 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216713.1 protein_id gnl|my_center|LOCUS_04150 174493 173513 gene locus_tag LOCUS_04160 174493 173513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 174554 174928 gene locus_tag LOCUS_04170 174554 174928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 176768 174918 gene locus_tag LOCUS_04180 176768 174918 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 protein_id gnl|my_center|LOCUS_04180 176903 177925 gene locus_tag LOCUS_04190 gene ilvC 176903 177925 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858483.1 protein_id gnl|my_center|LOCUS_04190 177971 179152 gene locus_tag LOCUS_04200 177971 179152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 179196 179969 gene locus_tag LOCUS_04210 gene dprA 179196 179969 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077645213.1 protein_id gnl|my_center|LOCUS_04210 181147 179966 gene locus_tag LOCUS_04220 gene nhaA 181147 179966 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002799206.1 protein_id gnl|my_center|LOCUS_04220 182509 181202 gene locus_tag LOCUS_04230 gene murC 182509 181202 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894779.1 protein_id gnl|my_center|LOCUS_04230 183091 182510 gene locus_tag LOCUS_04240 183091 182510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 184214 183084 gene locus_tag LOCUS_04250 184214 183084 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142409.1 protein_id gnl|my_center|LOCUS_04250 185659 184232 gene locus_tag LOCUS_04260 185659 184232 CDS product COG3400 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717228.1 protein_id gnl|my_center|LOCUS_04260 185765 186886 gene locus_tag LOCUS_04270 gene tgt 185765 186886 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853029.1 protein_id gnl|my_center|LOCUS_04270 186937 187227 gene locus_tag LOCUS_04280 gene gatC 186937 187227 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858734.1 protein_id gnl|my_center|LOCUS_04280 187231 187572 gene locus_tag LOCUS_04290 187231 187572 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693817.1 protein_id gnl|my_center|LOCUS_04290 188433 187594 gene locus_tag LOCUS_04300 188433 187594 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705056.1 protein_id gnl|my_center|LOCUS_04300 189872 188511 gene locus_tag LOCUS_04310 189872 188511 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268550.1 protein_id gnl|my_center|LOCUS_04310 190930 189938 gene locus_tag LOCUS_04320 gene tal 190930 189938 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155041.1 protein_id gnl|my_center|LOCUS_04320 191559 190933 gene locus_tag LOCUS_04330 gene serB 191559 190933 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_04330 191641 192552 gene locus_tag LOCUS_04340 191641 192552 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986764.1 protein_id gnl|my_center|LOCUS_04340 192549 192929 gene locus_tag LOCUS_04350 gene ruvX 192549 192929 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852281.1 protein_id gnl|my_center|LOCUS_04350 193283 192930 gene locus_tag LOCUS_04360 gene acpS 193283 192930 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857939.1 protein_id gnl|my_center|LOCUS_04360 193352 194272 gene locus_tag LOCUS_04370 193352 194272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_04370 194300 195118 gene locus_tag LOCUS_04380 gene panC 194300 195118 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264323.1 protein_id gnl|my_center|LOCUS_04380 195170 196504 gene locus_tag LOCUS_04390 gene rimO 195170 196504 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 protein_id gnl|my_center|LOCUS_04390 196507 197487 gene locus_tag LOCUS_04400 gene tilS 196507 197487 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851521.1 protein_id gnl|my_center|LOCUS_04400 197745 197476 gene locus_tag LOCUS_04410 197745 197476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 198077 197721 gene locus_tag LOCUS_04420 198077 197721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 199526 198180 gene locus_tag LOCUS_04430 199526 198180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 201438 199546 gene locus_tag LOCUS_04440 201438 199546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 202201 201494 gene locus_tag LOCUS_04450 gene flgH 202201 201494 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864738.1 protein_id gnl|my_center|LOCUS_04450 202619 202188 gene locus_tag LOCUS_04460 202619 202188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 203146 202619 gene locus_tag LOCUS_04470 203146 202619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 203642 203148 gene locus_tag LOCUS_04480 203642 203148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 204062 203646 gene locus_tag LOCUS_04490 204062 203646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 204312 204052 gene locus_tag LOCUS_04500 gene fliQ 204312 204052 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 protein_id gnl|my_center|LOCUS_04500 205532 204315 gene locus_tag LOCUS_04510 205532 204315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 205629 206678 gene locus_tag LOCUS_04520 205629 206678 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832067.1 protein_id gnl|my_center|LOCUS_04520 206680 207777 gene locus_tag LOCUS_04530 gene fliM 206680 207777 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851710.1 protein_id gnl|my_center|LOCUS_04530 208821 207793 gene locus_tag LOCUS_04540 gene pyrC 208821 207793 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852008.1 protein_id gnl|my_center|LOCUS_04540 209159 208821 gene locus_tag LOCUS_04550 gene glnB 209159 208821 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_04550 210435 209248 gene locus_tag LOCUS_04560 210435 209248 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_04560 210896 210558 gene locus_tag LOCUS_04570 210896 210558 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508042.1 protein_id gnl|my_center|LOCUS_04570 212124 210910 gene locus_tag LOCUS_04580 212124 210910 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_04580 212308 214233 gene locus_tag LOCUS_04590 212308 214233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 214327 215214 gene locus_tag LOCUS_04600 214327 215214 CDS product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 protein_id gnl|my_center|LOCUS_04600 217012 215255 gene locus_tag LOCUS_04610 217012 215255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 217203 217955 gene locus_tag LOCUS_04620 217203 217955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 217952 220492 gene locus_tag LOCUS_04630 217952 220492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 221243 220500 gene locus_tag LOCUS_04640 gene cas6 221243 220500 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986678.1 protein_id gnl|my_center|LOCUS_04640 224813 221334 gene locus_tag LOCUS_04650 224813 221334 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_04650 224946 226436 gene locus_tag LOCUS_04660 224946 226436 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_04660 226498 226902 gene locus_tag LOCUS_04670 226498 226902 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037960.1 protein_id gnl|my_center|LOCUS_04670 227245 226916 gene locus_tag LOCUS_04680 227245 226916 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971365.1 protein_id gnl|my_center|LOCUS_04680 227486 227253 gene locus_tag LOCUS_04690 227486 227253 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_04690 228450 227491 gene locus_tag LOCUS_04700 228450 227491 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_04700 228917 228507 gene locus_tag LOCUS_04710 228917 228507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 229400 228927 gene locus_tag LOCUS_04720 229400 228927 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_04720 230672 229422 gene locus_tag LOCUS_04730 gene arsB 230672 229422 CDS product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455949.1 protein_id gnl|my_center|LOCUS_04730 231029 230673 gene locus_tag LOCUS_04740 231029 230673 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_04740 231346 231032 gene locus_tag LOCUS_04750 231346 231032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 232146 231433 gene locus_tag LOCUS_04760 232146 231433 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266531.1 protein_id gnl|my_center|LOCUS_04760 232489 232136 gene locus_tag LOCUS_04770 232489 232136 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770109.1 protein_id gnl|my_center|LOCUS_04770 232897 232505 gene locus_tag LOCUS_04780 232897 232505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 233869 233015 gene locus_tag LOCUS_04790 233869 233015 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842785.1 protein_id gnl|my_center|LOCUS_04790 235912 233996 gene locus_tag LOCUS_04800 gene tkt 235912 233996 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_04800 <236714 235997 gene locus_tag LOCUS_04810 <236714 235997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:PAS domain-containing sensor histidine kinase >Feature sequence03 1297 329 gene locus_tag LOCUS_04820 1297 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_04820 1961 1290 gene locus_tag LOCUS_04830 1961 1290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_04830 3136 1958 gene locus_tag LOCUS_04840 3136 1958 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_04840 3344 3126 gene locus_tag LOCUS_04850 3344 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3595 3966 gene locus_tag LOCUS_04860 gene dksA 3595 3966 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_04860 3963 4961 gene locus_tag LOCUS_04870 gene truD 3963 4961 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851259.1 protein_id gnl|my_center|LOCUS_04870 5994 5011 gene locus_tag LOCUS_04880 5994 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 6582 6004 gene locus_tag LOCUS_04890 6582 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851102.1 protein_id gnl|my_center|LOCUS_04890 6697 7992 gene locus_tag LOCUS_04900 6697 7992 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856815.1 protein_id gnl|my_center|LOCUS_04900 8004 8957 gene locus_tag LOCUS_04910 8004 8957 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996787.1 protein_id gnl|my_center|LOCUS_04910 9029 9274 gene locus_tag LOCUS_04920 gene purS 9029 9274 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 protein_id gnl|my_center|LOCUS_04920 9276 9947 gene locus_tag LOCUS_04930 gene purQ 9276 9947 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858528.1 protein_id gnl|my_center|LOCUS_04930 9982 11052 gene locus_tag LOCUS_04940 9982 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 11039 11725 gene locus_tag LOCUS_04950 11039 11725 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858620.1 protein_id gnl|my_center|LOCUS_04950 11715 12101 gene locus_tag LOCUS_04960 gene crcB 11715 12101 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858490.1 protein_id gnl|my_center|LOCUS_04960 12171 12401 gene locus_tag LOCUS_04970 gene tatA 12171 12401 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785095.1 protein_id gnl|my_center|LOCUS_04970 12411 14000 gene locus_tag LOCUS_04980 gene argS 12411 14000 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891916.1 protein_id gnl|my_center|LOCUS_04980 14000 14122 gene locus_tag LOCUS_04990 14000 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 14465 14139 gene locus_tag LOCUS_05000 gene rsfS 14465 14139 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858238.1 protein_id gnl|my_center|LOCUS_05000 15010 14462 gene locus_tag LOCUS_05010 gene nadD 15010 14462 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780449.1 protein_id gnl|my_center|LOCUS_05010 15101 16096 gene locus_tag LOCUS_05020 gene gap 15101 16096 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780453.1 protein_id gnl|my_center|LOCUS_05020 16115 17317 gene locus_tag LOCUS_05030 16115 17317 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891932.1 protein_id gnl|my_center|LOCUS_05030 17317 18027 gene locus_tag LOCUS_05040 17317 18027 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855528.1 protein_id gnl|my_center|LOCUS_05040 18029 18853 gene locus_tag LOCUS_05050 gene fabI 18029 18853 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780456.1 protein_id gnl|my_center|LOCUS_05050 18950 20158 gene locus_tag LOCUS_05060 gene lysA 18950 20158 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858733.1 protein_id gnl|my_center|LOCUS_05060 20169 21248 gene locus_tag LOCUS_05070 gene pheA 20169 21248 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_05070 21262 22368 gene locus_tag LOCUS_05080 gene hisC 21262 22368 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 protein_id gnl|my_center|LOCUS_05080 22381 24186 gene locus_tag LOCUS_05090 gene dxs 22381 24186 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858717.1 protein_id gnl|my_center|LOCUS_05090 24308 25333 gene locus_tag LOCUS_05100 24308 25333 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857587.1 protein_id gnl|my_center|LOCUS_05100 25575 26600 gene locus_tag LOCUS_05110 25575 26600 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857587.1 protein_id gnl|my_center|LOCUS_05110 27173 26628 gene locus_tag LOCUS_05120 27173 26628 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_05120 27249 28136 gene locus_tag LOCUS_05130 27249 28136 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_05130 28138 29427 gene locus_tag LOCUS_05140 28138 29427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_05140 29594 30520 gene locus_tag LOCUS_05150 29594 30520 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886296.1 protein_id gnl|my_center|LOCUS_05150 31185 30532 gene locus_tag LOCUS_05160 31185 30532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 31832 31209 gene locus_tag LOCUS_05170 31832 31209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 31995 32525 gene locus_tag LOCUS_05180 31995 32525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 33011 32532 gene locus_tag LOCUS_05190 33011 32532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 35577 33022 gene locus_tag LOCUS_05200 gene alaS 35577 33022 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858583.1 protein_id gnl|my_center|LOCUS_05200 35761 36078 gene locus_tag LOCUS_05210 gene trxA 35761 36078 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 protein_id gnl|my_center|LOCUS_05210 36291 37220 gene locus_tag LOCUS_05220 gene trxB 36291 37220 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851648.1 protein_id gnl|my_center|LOCUS_05220 37235 38008 gene locus_tag LOCUS_05230 gene dapB 37235 38008 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_05230 38021 39370 gene locus_tag LOCUS_05240 gene purF 38021 39370 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 protein_id gnl|my_center|LOCUS_05240 39370 40332 gene locus_tag LOCUS_05250 39370 40332 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928968.1 protein_id gnl|my_center|LOCUS_05250 41254 40358 gene locus_tag LOCUS_05260 41254 40358 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 protein_id gnl|my_center|LOCUS_05260 41371 43425 gene locus_tag LOCUS_05270 41371 43425 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_05270 43438 44295 gene locus_tag LOCUS_05280 gene truB 43438 44295 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 protein_id gnl|my_center|LOCUS_05280 44285 45061 gene locus_tag LOCUS_05290 44285 45061 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 protein_id gnl|my_center|LOCUS_05290 45051 45527 gene locus_tag LOCUS_05300 gene smpB 45051 45527 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_05300 45691 47157 gene locus_tag LOCUS_05310 gene ccoN 45691 47157 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_05310 47172 47837 gene locus_tag LOCUS_05320 gene ccoO 47172 47837 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 protein_id gnl|my_center|LOCUS_05320 47847 48071 gene locus_tag LOCUS_05330 47847 48071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 48073 48963 gene locus_tag LOCUS_05340 48073 48963 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851306.1 protein_id gnl|my_center|LOCUS_05340 48965 49207 gene locus_tag LOCUS_05350 48965 49207 CDS product DUF4006 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864471.1 protein_id gnl|my_center|LOCUS_05350 49341 49940 gene locus_tag LOCUS_05360 49341 49940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 49945 50502 gene locus_tag LOCUS_05370 49945 50502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 50579 52861 gene locus_tag LOCUS_05380 50579 52861 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891938.1 protein_id gnl|my_center|LOCUS_05380 53963 52863 gene locus_tag LOCUS_05390 gene prfB 53963 52863 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851475.1 protein_id gnl|my_center|LOCUS_05390 54686 54063 gene locus_tag LOCUS_05400 54686 54063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 56054 54807 gene locus_tag LOCUS_05410 gene porA 56054 54807 CDS product group 1 major outer membrane porin protein PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891919.1 protein_id gnl|my_center|LOCUS_05410 56619 56305 gene locus_tag LOCUS_05420 56619 56305 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854273.1 protein_id gnl|my_center|LOCUS_05420 57239 56616 gene locus_tag LOCUS_05430 gene plsY 57239 56616 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 protein_id gnl|my_center|LOCUS_05430 57329 58318 gene locus_tag LOCUS_05440 gene nadA 57329 58318 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141770.1 protein_id gnl|my_center|LOCUS_05440 58315 59136 gene locus_tag LOCUS_05450 gene nadC 58315 59136 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405980.1 protein_id gnl|my_center|LOCUS_05450 59203 60189 gene locus_tag LOCUS_05460 59203 60189 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_05460 60173 61558 gene locus_tag LOCUS_05470 60173 61558 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 protein_id gnl|my_center|LOCUS_05470 61555 62460 gene locus_tag LOCUS_05480 gene lpxC 61555 62460 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815275.1 protein_id gnl|my_center|LOCUS_05480 62464 62916 gene locus_tag LOCUS_05490 62464 62916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 62928 63809 gene locus_tag LOCUS_05500 gene thrB 62928 63809 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888538.1 protein_id gnl|my_center|LOCUS_05500 63846 64121 gene locus_tag LOCUS_05510 63846 64121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 64111 66810 gene locus_tag LOCUS_05520 gene infB 64111 66810 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864659.1 protein_id gnl|my_center|LOCUS_05520 66810 67169 gene locus_tag LOCUS_05530 gene rbfA 66810 67169 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778650.1 protein_id gnl|my_center|LOCUS_05530 67166 67594 gene locus_tag LOCUS_05540 gene rimP 67166 67594 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 protein_id gnl|my_center|LOCUS_05540 67691 68695 gene locus_tag LOCUS_05550 gene ribD 67691 68695 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891948.1 protein_id gnl|my_center|LOCUS_05550 69267 68707 gene locus_tag LOCUS_05560 gene efp 69267 68707 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855210.1 protein_id gnl|my_center|LOCUS_05560 70860 69277 gene locus_tag LOCUS_05570 gene serA 70860 69277 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 protein_id gnl|my_center|LOCUS_05570 72526 70874 gene locus_tag LOCUS_05580 72526 70874 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852520.1 protein_id gnl|my_center|LOCUS_05580 73430 72594 gene locus_tag LOCUS_05590 73430 72594 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_05590 74719 73439 gene locus_tag LOCUS_05600 gene aroA 74719 73439 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852577.1 protein_id gnl|my_center|LOCUS_05600 77056 74735 gene locus_tag LOCUS_05610 gene pheT 77056 74735 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915726.1 protein_id gnl|my_center|LOCUS_05610 78045 77053 gene locus_tag LOCUS_05620 gene pheS 78045 77053 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 protein_id gnl|my_center|LOCUS_05620 78176 78520 gene locus_tag LOCUS_05630 78176 78520 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100349.1 protein_id gnl|my_center|LOCUS_05630 79468 78530 gene locus_tag LOCUS_05640 gene accA 79468 78530 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_05640 80794 79535 gene locus_tag LOCUS_05650 80794 79535 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 protein_id gnl|my_center|LOCUS_05650 81132 80902 gene locus_tag LOCUS_05660 gene acpP 81132 80902 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854831.1 protein_id gnl|my_center|LOCUS_05660 81969 81226 gene locus_tag LOCUS_05670 gene fabG 81969 81226 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_05670 82805 82041 gene locus_tag LOCUS_05680 82805 82041 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775643.1 protein_id gnl|my_center|LOCUS_05680 83331 82798 gene locus_tag LOCUS_05690 83331 82798 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880124.1 protein_id gnl|my_center|LOCUS_05690 84011 83331 gene locus_tag LOCUS_05700 gene queC 84011 83331 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779268.1 protein_id gnl|my_center|LOCUS_05700 85227 84004 gene locus_tag LOCUS_05710 85227 84004 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856962.1 protein_id gnl|my_center|LOCUS_05710 85310 85714 gene locus_tag LOCUS_05720 85310 85714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 85714 86385 gene locus_tag LOCUS_05730 85714 86385 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851903.1 protein_id gnl|my_center|LOCUS_05730 86816 86421 gene locus_tag LOCUS_05740 86816 86421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 87732 86848 gene locus_tag LOCUS_05750 87732 86848 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657605.1 protein_id gnl|my_center|LOCUS_05750 88979 87729 gene locus_tag LOCUS_05760 88979 87729 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852758.1 protein_id gnl|my_center|LOCUS_05760 89490 88990 gene locus_tag LOCUS_05770 gene petA 89490 88990 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852880.1 protein_id gnl|my_center|LOCUS_05770 91131 89650 gene locus_tag LOCUS_05780 gene thrC 91131 89650 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117321.1 protein_id gnl|my_center|LOCUS_05780 92054 91140 gene locus_tag LOCUS_05790 gene argB 92054 91140 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982628.1 protein_id gnl|my_center|LOCUS_05790 92146 94878 gene locus_tag LOCUS_05800 92146 94878 CDS product RecB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864468.1 protein_id gnl|my_center|LOCUS_05800 95429 94875 gene locus_tag LOCUS_05810 gene thiE 95429 94875 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545604.1 protein_id gnl|my_center|LOCUS_05810 96195 95509 gene locus_tag LOCUS_05820 96195 95509 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858390.1 protein_id gnl|my_center|LOCUS_05820 97493 96288 gene locus_tag LOCUS_05830 gene ilvA 97493 96288 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_05830 99862 97592 gene locus_tag LOCUS_05840 gene metE 99862 97592 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_05840 100258 99914 gene locus_tag LOCUS_05850 100258 99914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 100367 101056 gene locus_tag LOCUS_05860 gene trmD 100367 101056 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868040.1 protein_id gnl|my_center|LOCUS_05860 101112 101468 gene locus_tag LOCUS_05870 gene rplS 101112 101468 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852307.1 protein_id gnl|my_center|LOCUS_05870 101500 102018 gene locus_tag LOCUS_05880 101500 102018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 102029 102634 gene locus_tag LOCUS_05890 102029 102634 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_05890 103851 102745 gene locus_tag LOCUS_05900 103851 102745 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707233.1 protein_id gnl|my_center|LOCUS_05900 103975 104853 gene locus_tag LOCUS_05910 103975 104853 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263669.1 protein_id gnl|my_center|LOCUS_05910 104888 105670 gene locus_tag LOCUS_05920 104888 105670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 105710 106093 gene locus_tag LOCUS_05930 105710 106093 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_05930 106173 108212 gene locus_tag LOCUS_05940 106173 108212 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893374.1 protein_id gnl|my_center|LOCUS_05940 108667 108233 gene locus_tag LOCUS_05950 108667 108233 CDS product CopD family copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338876.1 protein_id gnl|my_center|LOCUS_05950 110842 108737 gene locus_tag LOCUS_05960 110842 108737 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_05960 111575 110865 gene locus_tag LOCUS_05970 111575 110865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 112004 111600 gene locus_tag LOCUS_05980 112004 111600 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143455.1 protein_id gnl|my_center|LOCUS_05980 112218 111988 gene locus_tag LOCUS_05990 112218 111988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 113346 112261 gene locus_tag LOCUS_06000 113346 112261 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 protein_id gnl|my_center|LOCUS_06000 113756 115342 gene locus_tag LOCUS_06010 gene sirA 113756 115342 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_06010 117636 115354 gene locus_tag LOCUS_06020 117636 115354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 118616 117684 gene locus_tag LOCUS_06030 118616 117684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354394.1 protein_id gnl|my_center|LOCUS_06030 120181 118613 gene locus_tag LOCUS_06040 120181 118613 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852018.1 protein_id gnl|my_center|LOCUS_06040 121179 120172 gene locus_tag LOCUS_06050 121179 120172 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857563.1 protein_id gnl|my_center|LOCUS_06050 121561 122676 gene locus_tag LOCUS_06060 121561 122676 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005029109.1 protein_id gnl|my_center|LOCUS_06060 122689 123288 gene locus_tag LOCUS_06070 122689 123288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 124132 124431 gene locus_tag LOCUS_06080 124132 124431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 124431 124661 gene locus_tag LOCUS_06090 124431 124661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 124658 125632 gene locus_tag LOCUS_06100 124658 125632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 125689 125841 gene locus_tag LOCUS_06110 125689 125841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 125859 125978 gene locus_tag LOCUS_06120 125859 125978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 126182 127318 gene locus_tag LOCUS_06130 126182 127318 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_06130 127468 128091 gene locus_tag LOCUS_06140 127468 128091 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_06140 128094 128321 gene locus_tag LOCUS_06150 128094 128321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 128442 130622 gene locus_tag LOCUS_06160 128442 130622 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_06160 130609 132045 gene locus_tag LOCUS_06170 130609 132045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 132046 132636 gene locus_tag LOCUS_06180 132046 132636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283202.1 protein_id gnl|my_center|LOCUS_06180 132629 133570 gene locus_tag LOCUS_06190 132629 133570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 133563 135053 gene locus_tag LOCUS_06200 133563 135053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 135486 135728 gene locus_tag LOCUS_06210 135486 135728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 135725 137140 gene locus_tag LOCUS_06220 135725 137140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 137464 138033 gene locus_tag LOCUS_06230 137464 138033 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_06230 138039 139235 gene locus_tag LOCUS_06240 138039 139235 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_06240 139232 139846 gene locus_tag LOCUS_06250 139232 139846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence04 1162 896 gene locus_tag LOCUS_06260 1162 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1541 1466 gene locus_tag LOCUS_t00020 1541 1466 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2056 1613 gene locus_tag LOCUS_06270 2056 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851686.1 protein_id gnl|my_center|LOCUS_06270 5304 2059 gene locus_tag LOCUS_06280 gene carB 5304 2059 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858661.1 protein_id gnl|my_center|LOCUS_06280 6004 5378 gene locus_tag LOCUS_06290 6004 5378 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932936.1 protein_id gnl|my_center|LOCUS_06290 6688 6005 gene locus_tag LOCUS_06300 6688 6005 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_06300 6837 7631 gene locus_tag LOCUS_06310 6837 7631 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648073.1 protein_id gnl|my_center|LOCUS_06310 7825 7637 gene locus_tag LOCUS_06320 7825 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 7915 9519 gene locus_tag LOCUS_06330 7915 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 10626 9520 gene locus_tag LOCUS_06340 10626 9520 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_06340 11142 10693 gene locus_tag LOCUS_06350 11142 10693 CDS product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 protein_id gnl|my_center|LOCUS_06350 11217 11714 gene locus_tag LOCUS_06360 11217 11714 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112637.1 protein_id gnl|my_center|LOCUS_06360 11711 12760 gene locus_tag LOCUS_06370 11711 12760 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263412.1 protein_id gnl|my_center|LOCUS_06370 12753 13016 gene locus_tag LOCUS_06380 12753 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 13019 14113 gene locus_tag LOCUS_06390 13019 14113 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_06390 15313 14174 gene locus_tag LOCUS_06400 gene ftsZ 15313 14174 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 protein_id gnl|my_center|LOCUS_06400 16707 15313 gene locus_tag LOCUS_06410 gene ftsA 16707 15313 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_06410 18174 16711 gene locus_tag LOCUS_06420 18174 16711 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574070.1 protein_id gnl|my_center|LOCUS_06420 20563 18233 gene locus_tag LOCUS_06430 20563 18233 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_06430 20928 20563 gene locus_tag LOCUS_06440 20928 20563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 21275 20925 gene locus_tag LOCUS_06450 gene arsC 21275 20925 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 protein_id gnl|my_center|LOCUS_06450 22226 21363 gene locus_tag LOCUS_06460 22226 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 23942 22287 gene locus_tag LOCUS_06470 23942 22287 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_06470 24433 23939 gene locus_tag LOCUS_06480 24433 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 24476 26155 gene locus_tag LOCUS_06490 24476 26155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 26157 26480 gene locus_tag LOCUS_06500 26157 26480 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 protein_id gnl|my_center|LOCUS_06500 26542 26982 gene locus_tag LOCUS_06510 26542 26982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 26979 28772 gene locus_tag LOCUS_06520 gene mrdA 26979 28772 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 protein_id gnl|my_center|LOCUS_06520 28834 29562 gene locus_tag LOCUS_06530 gene fliP 28834 29562 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_06530 29685 31040 gene locus_tag LOCUS_06540 29685 31040 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_06540 31040 31798 gene locus_tag LOCUS_06550 31040 31798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 31809 33368 gene locus_tag LOCUS_06560 31809 33368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06560 33378 35033 gene locus_tag LOCUS_06570 33378 35033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06570 35639 35040 gene locus_tag LOCUS_06580 35639 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 35729 37135 gene locus_tag LOCUS_06590 35729 37135 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_06590 37143 38096 gene locus_tag LOCUS_06600 gene argC 37143 38096 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_06600 38827 38345 gene locus_tag LOCUS_06610 38827 38345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06610 39308 38847 gene locus_tag LOCUS_06620 39308 38847 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_06620 39900 39298 gene locus_tag LOCUS_06630 gene yihA 39900 39298 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852258.1 protein_id gnl|my_center|LOCUS_06630 40391 39897 gene locus_tag LOCUS_06640 40391 39897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 40933 40388 gene locus_tag LOCUS_06650 40933 40388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 41421 40924 gene locus_tag LOCUS_06660 41421 40924 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858506.1 protein_id gnl|my_center|LOCUS_06660 41990 41418 gene locus_tag LOCUS_06670 gene hisB 41990 41418 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528350.1 protein_id gnl|my_center|LOCUS_06670 42985 41999 gene locus_tag LOCUS_06680 42985 41999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 44255 42969 gene locus_tag LOCUS_06690 44255 42969 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852087.1 protein_id gnl|my_center|LOCUS_06690 44875 44291 gene locus_tag LOCUS_06700 44875 44291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 45398 45093 gene locus_tag LOCUS_06710 45398 45093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 46777 45449 gene locus_tag LOCUS_06720 gene hslU 46777 45449 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 protein_id gnl|my_center|LOCUS_06720 47320 46784 gene locus_tag LOCUS_06730 gene hslV 47320 46784 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 protein_id gnl|my_center|LOCUS_06730 47771 47325 gene locus_tag LOCUS_06740 gene rplI 47771 47325 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781628.1 protein_id gnl|my_center|LOCUS_06740 48474 47842 gene locus_tag LOCUS_06750 48474 47842 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_06750 48686 49240 gene locus_tag LOCUS_06760 48686 49240 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780126.1 protein_id gnl|my_center|LOCUS_06760 49244 49744 gene locus_tag LOCUS_06770 gene coaD 49244 49744 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852633.1 protein_id gnl|my_center|LOCUS_06770 49729 50298 gene locus_tag LOCUS_06780 gene tmk 49729 50298 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852526.1 protein_id gnl|my_center|LOCUS_06780 50288 51529 gene locus_tag LOCUS_06790 gene hisS 50288 51529 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 protein_id gnl|my_center|LOCUS_06790 51532 53343 gene locus_tag LOCUS_06800 gene speA 51532 53343 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891885.1 protein_id gnl|my_center|LOCUS_06800 53333 54082 gene locus_tag LOCUS_06810 gene cysE 53333 54082 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852612.1 protein_id gnl|my_center|LOCUS_06810 54085 54819 gene locus_tag LOCUS_06820 54085 54819 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858695.1 protein_id gnl|my_center|LOCUS_06820 56045 54822 gene locus_tag LOCUS_06830 56045 54822 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_06830 56914 56741 gene locus_tag LOCUS_06840 56914 56741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 59298 56911 gene locus_tag LOCUS_06850 gene acnA 59298 56911 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846424.1 protein_id gnl|my_center|LOCUS_06850 59523 61697 gene locus_tag LOCUS_06860 59523 61697 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477305.1 protein_id gnl|my_center|LOCUS_06860 61789 64605 gene locus_tag LOCUS_06870 gene uvrA 61789 64605 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858721.1 protein_id gnl|my_center|LOCUS_06870 64602 64946 gene locus_tag LOCUS_06880 64602 64946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 65336 64965 gene locus_tag LOCUS_06890 65336 64965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 65522 66577 gene locus_tag LOCUS_06900 65522 66577 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_06900 66667 69033 gene locus_tag LOCUS_06910 66667 69033 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_06910 69030 69527 gene locus_tag LOCUS_06920 gene hutZ 69030 69527 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372763.1 protein_id gnl|my_center|LOCUS_06920 70605 69544 gene locus_tag LOCUS_06930 70605 69544 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 protein_id gnl|my_center|LOCUS_06930 70791 71339 gene locus_tag LOCUS_06940 70791 71339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 71423 73198 gene locus_tag LOCUS_06950 71423 73198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 74296 73208 gene locus_tag LOCUS_06960 74296 73208 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_06960 75534 74404 gene locus_tag LOCUS_06970 75534 74404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 75661 78555 gene locus_tag LOCUS_06980 75661 78555 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_06980 78578 78739 gene locus_tag LOCUS_06990 78578 78739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 78820 79671 gene locus_tag LOCUS_07000 gene rhuM 78820 79671 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_07000 79829 79677 gene locus_tag LOCUS_07010 79829 79677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 79861 80682 gene locus_tag LOCUS_07020 79861 80682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 81378 80677 gene locus_tag LOCUS_07030 81378 80677 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502010.1 protein_id gnl|my_center|LOCUS_07030 81489 82178 gene locus_tag LOCUS_07040 81489 82178 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_07040 83454 82204 gene locus_tag LOCUS_07050 83454 82204 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938460.1 protein_id gnl|my_center|LOCUS_07050 84425 83514 gene locus_tag LOCUS_07060 84425 83514 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 protein_id gnl|my_center|LOCUS_07060 84897 84418 gene locus_tag LOCUS_07070 gene greA 84897 84418 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475533.1 protein_id gnl|my_center|LOCUS_07070 85069 85995 gene locus_tag LOCUS_07080 85069 85995 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117124.1 protein_id gnl|my_center|LOCUS_07080 86041 87423 gene locus_tag LOCUS_07090 86041 87423 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_07090 87433 88425 gene locus_tag LOCUS_07100 87433 88425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 89613 88456 gene locus_tag LOCUS_07110 89613 88456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 90207 89776 gene locus_tag LOCUS_07120 90207 89776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 90375 91070 gene locus_tag LOCUS_07130 gene sfsA 90375 91070 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388493.1 protein_id gnl|my_center|LOCUS_07130 91102 91785 gene locus_tag LOCUS_07140 91102 91785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 92500 91799 gene locus_tag LOCUS_07150 92500 91799 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 protein_id gnl|my_center|LOCUS_07150 92666 92860 gene locus_tag LOCUS_07160 92666 92860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 94210 92894 gene locus_tag LOCUS_07170 94210 92894 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940453.1 protein_id gnl|my_center|LOCUS_07170 94862 94296 gene locus_tag LOCUS_07180 94862 94296 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_07180 95204 94875 gene locus_tag LOCUS_07190 95204 94875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 95483 95211 gene locus_tag LOCUS_07200 95483 95211 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_07200 96099 95581 gene locus_tag LOCUS_07210 96099 95581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 97063 96284 gene locus_tag LOCUS_07220 97063 96284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 97475 97110 gene locus_tag LOCUS_07230 97475 97110 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152368.1 protein_id gnl|my_center|LOCUS_07230 97674 99365 gene locus_tag LOCUS_07240 97674 99365 CDS product protein adenylyltransferase SelO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 protein_id gnl|my_center|LOCUS_07240 99899 99465 gene locus_tag LOCUS_07250 99899 99465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 101585 100050 gene locus_tag LOCUS_07260 gene guaA 101585 100050 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853189.1 protein_id gnl|my_center|LOCUS_07260 103104 101719 gene locus_tag LOCUS_07270 gene nhaD 103104 101719 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 protein_id gnl|my_center|LOCUS_07270 104558 103101 gene locus_tag LOCUS_07280 gene nadB 104558 103101 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_07280 104701 104555 gene locus_tag LOCUS_07290 104701 104555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 104672 105088 gene locus_tag LOCUS_07300 104672 105088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 105665 105072 gene locus_tag LOCUS_07310 105665 105072 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_07310 105752 106921 gene locus_tag LOCUS_07320 105752 106921 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967300.1 protein_id gnl|my_center|LOCUS_07320 106921 107808 gene locus_tag LOCUS_07330 106921 107808 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853697.1 protein_id gnl|my_center|LOCUS_07330 108423 107830 gene locus_tag LOCUS_07340 108423 107830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858686.1 protein_id gnl|my_center|LOCUS_07340 108592 110541 gene locus_tag LOCUS_07350 108592 110541 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 protein_id gnl|my_center|LOCUS_07350 110587 111030 gene locus_tag LOCUS_07360 110587 111030 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858625.1 protein_id gnl|my_center|LOCUS_07360 111062 112183 gene locus_tag LOCUS_07370 111062 112183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 112760 112197 gene locus_tag LOCUS_07380 112760 112197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 113974 112832 gene locus_tag LOCUS_07390 113974 112832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 114623 113964 gene locus_tag LOCUS_07400 gene dccR 114623 113964 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_07400 115555 114620 gene locus_tag LOCUS_07410 115555 114620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 116588 115608 gene locus_tag LOCUS_07420 116588 115608 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930443.1 protein_id gnl|my_center|LOCUS_07420 117758 116877 gene locus_tag LOCUS_07430 117758 116877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 118540 117758 gene locus_tag LOCUS_07440 118540 117758 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_07440 118610 119431 gene locus_tag LOCUS_07450 118610 119431 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019314.1 protein_id gnl|my_center|LOCUS_07450 120069 119428 gene locus_tag LOCUS_07460 120069 119428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 120882 120082 gene locus_tag LOCUS_07470 120882 120082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_07470 121480 120887 gene locus_tag LOCUS_07480 121480 120887 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 protein_id gnl|my_center|LOCUS_07480 123045 121501 gene locus_tag LOCUS_07490 gene rny 123045 121501 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 protein_id gnl|my_center|LOCUS_07490 123595 123056 gene locus_tag LOCUS_07500 123595 123056 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875342.1 protein_id gnl|my_center|LOCUS_07500 123657 124214 gene locus_tag LOCUS_07510 123657 124214 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858112.1 protein_id gnl|my_center|LOCUS_07510 124223 125278 gene locus_tag LOCUS_07520 gene ftsY 124223 125278 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864556.1 protein_id gnl|my_center|LOCUS_07520 125293 126066 gene locus_tag LOCUS_07530 125293 126066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 127822 126098 gene locus_tag LOCUS_07540 127822 126098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 128678 127815 gene locus_tag LOCUS_07550 128678 127815 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099334852.1 protein_id gnl|my_center|LOCUS_07550 129627 128806 gene locus_tag LOCUS_07560 129627 128806 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence05 1129 344 gene locus_tag LOCUS_07570 1129 344 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438284.1 protein_id gnl|my_center|LOCUS_07570 1739 1164 gene locus_tag LOCUS_07580 gene sodB 1739 1164 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 protein_id gnl|my_center|LOCUS_07580 2779 1859 gene locus_tag LOCUS_07590 2779 1859 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073874.1 protein_id gnl|my_center|LOCUS_07590 3457 2858 gene locus_tag LOCUS_07600 3457 2858 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_07600 3954 3460 gene locus_tag LOCUS_07610 3954 3460 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_07610 5363 3951 gene locus_tag LOCUS_07620 gene aspA 5363 3951 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_07620 6110 5430 gene locus_tag LOCUS_07630 6110 5430 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_07630 7238 6114 gene locus_tag LOCUS_07640 7238 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8747 7311 gene locus_tag LOCUS_07650 8747 7311 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244998.1 protein_id gnl|my_center|LOCUS_07650 9575 8880 gene locus_tag LOCUS_07660 gene pfs 9575 8880 CDS product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859787.1 protein_id gnl|my_center|LOCUS_07660 10497 9568 gene locus_tag LOCUS_07670 gene fabD 10497 9568 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 protein_id gnl|my_center|LOCUS_07670 11213 10638 gene locus_tag LOCUS_07680 11213 10638 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851661.1 protein_id gnl|my_center|LOCUS_07680 12214 11240 gene locus_tag LOCUS_07690 12214 11240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 12756 12220 gene locus_tag LOCUS_07700 gene pal 12756 12220 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851617.1 protein_id gnl|my_center|LOCUS_07700 12905 13420 gene locus_tag LOCUS_07710 12905 13420 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_07710 14720 13449 gene locus_tag LOCUS_07720 gene tolB 14720 13449 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_07720 15363 14725 gene locus_tag LOCUS_07730 15363 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 15843 15454 gene locus_tag LOCUS_07740 15843 15454 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858790.1 protein_id gnl|my_center|LOCUS_07740 16408 15848 gene locus_tag LOCUS_07750 16408 15848 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854361.1 protein_id gnl|my_center|LOCUS_07750 16792 16415 gene locus_tag LOCUS_07760 gene atpC 16792 16415 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851752.1 protein_id gnl|my_center|LOCUS_07760 18208 16814 gene locus_tag LOCUS_07770 gene atpD 18208 16814 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 protein_id gnl|my_center|LOCUS_07770 19111 18227 gene locus_tag LOCUS_07780 gene atpG 19111 18227 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 protein_id gnl|my_center|LOCUS_07780 20639 19122 gene locus_tag LOCUS_07790 gene atpA 20639 19122 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_07790 21191 20661 gene locus_tag LOCUS_07800 21191 20661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 21703 21191 gene locus_tag LOCUS_07810 21703 21191 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 protein_id gnl|my_center|LOCUS_07810 22143 21721 gene locus_tag LOCUS_07820 22143 21721 CDS product FoF1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851812.1 protein_id gnl|my_center|LOCUS_07820 23114 22257 gene locus_tag LOCUS_07830 23114 22257 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034353519.1 protein_id gnl|my_center|LOCUS_07830 23912 23136 gene locus_tag LOCUS_07840 23912 23136 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_07840 24559 23909 gene locus_tag LOCUS_07850 24559 23909 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 protein_id gnl|my_center|LOCUS_07850 24618 25511 gene locus_tag LOCUS_07860 24618 25511 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880900.1 protein_id gnl|my_center|LOCUS_07860 26447 25527 gene locus_tag LOCUS_07870 gene fmt 26447 25527 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223483.1 protein_id gnl|my_center|LOCUS_07870 27258 26461 gene locus_tag LOCUS_07880 gene proB 27258 26461 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851769.1 protein_id gnl|my_center|LOCUS_07880 28349 27258 gene locus_tag LOCUS_07890 gene obgE 28349 27258 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851611.1 protein_id gnl|my_center|LOCUS_07890 28753 28496 gene locus_tag LOCUS_07900 gene rpmA 28753 28496 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_07900 29098 28781 gene locus_tag LOCUS_07910 gene rplU 29098 28781 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778820.1 protein_id gnl|my_center|LOCUS_07910 29598 29215 gene locus_tag LOCUS_07920 29598 29215 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832217.1 protein_id gnl|my_center|LOCUS_07920 31315 29681 gene locus_tag LOCUS_07930 gene dnaG 31315 29681 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601638.1 protein_id gnl|my_center|LOCUS_07930 31403 32452 gene locus_tag LOCUS_07940 31403 32452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851401.1 protein_id gnl|my_center|LOCUS_07940 32536 33210 gene locus_tag LOCUS_07950 gene rnc 32536 33210 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_07950 33216 34292 gene locus_tag LOCUS_07960 gene aroC 33216 34292 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094036.1 protein_id gnl|my_center|LOCUS_07960 34267 35025 gene locus_tag LOCUS_07970 34267 35025 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 protein_id gnl|my_center|LOCUS_07970 35959 35099 gene locus_tag LOCUS_07980 gene htpX 35959 35099 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_07980 36929 36015 gene locus_tag LOCUS_07990 36929 36015 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_07990 37057 37536 gene locus_tag LOCUS_08000 37057 37536 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_08000 37973 37566 gene locus_tag LOCUS_08010 37973 37566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 39333 37993 gene locus_tag LOCUS_08020 gene mnmE 39333 37993 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853397.1 protein_id gnl|my_center|LOCUS_08020 40202 39336 gene locus_tag LOCUS_08030 40202 39336 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 protein_id gnl|my_center|LOCUS_08030 41824 40211 gene locus_tag LOCUS_08040 gene yidC 41824 40211 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853384.1 protein_id gnl|my_center|LOCUS_08040 42158 41811 gene locus_tag LOCUS_08050 gene yidD 42158 41811 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853395.1 protein_id gnl|my_center|LOCUS_08050 42301 42155 gene locus_tag LOCUS_08060 42301 42155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 42612 42478 gene locus_tag LOCUS_08070 gene rpmH 42612 42478 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776864.1 protein_id gnl|my_center|LOCUS_08070 45257 42678 gene locus_tag LOCUS_08080 45257 42678 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858618.1 protein_id gnl|my_center|LOCUS_08080 47469 45319 gene locus_tag LOCUS_08090 47469 45319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 48569 47466 gene locus_tag LOCUS_08100 48569 47466 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_08100 50284 49610 gene locus_tag LOCUS_08110 50284 49610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 50671 50285 gene locus_tag LOCUS_08120 50671 50285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 50937 50668 gene locus_tag LOCUS_08130 50937 50668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 51210 50947 gene locus_tag LOCUS_08140 51210 50947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 52028 51387 gene locus_tag LOCUS_08150 52028 51387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 53150 52047 gene locus_tag LOCUS_08160 53150 52047 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005029109.1 protein_id gnl|my_center|LOCUS_08160 53349 53927 gene locus_tag LOCUS_08170 53349 53927 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853153.1 protein_id gnl|my_center|LOCUS_08170 54243 53929 gene locus_tag LOCUS_08180 54243 53929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 54387 54725 gene locus_tag LOCUS_08190 54387 54725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 55204 54722 gene locus_tag LOCUS_08200 55204 54722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 55581 55363 gene locus_tag LOCUS_08210 55581 55363 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 protein_id gnl|my_center|LOCUS_08210 56163 55801 gene locus_tag LOCUS_08220 56163 55801 CDS product methionine-R-sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853613.1 protein_id gnl|my_center|LOCUS_08220 57320 56178 gene locus_tag LOCUS_08230 57320 56178 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_08230 57735 57331 gene locus_tag LOCUS_08240 57735 57331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 60889 57719 gene locus_tag LOCUS_08250 60889 57719 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122622.1 protein_id gnl|my_center|LOCUS_08250 61561 60947 gene locus_tag LOCUS_08260 61561 60947 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261691.1 protein_id gnl|my_center|LOCUS_08260 61624 61965 gene locus_tag LOCUS_08270 61624 61965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 62618 61962 gene locus_tag LOCUS_08280 62618 61962 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 protein_id gnl|my_center|LOCUS_08280 63886 62621 gene locus_tag LOCUS_08290 gene bioA 63886 62621 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263576.1 protein_id gnl|my_center|LOCUS_08290 66560 63951 gene locus_tag LOCUS_08300 66560 63951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 68214 66682 gene locus_tag LOCUS_08310 gene purH 68214 66682 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853339.1 protein_id gnl|my_center|LOCUS_08310 70508 68295 gene locus_tag LOCUS_08320 gene purL 70508 68295 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858406.1 protein_id gnl|my_center|LOCUS_08320 71528 70572 gene locus_tag LOCUS_08330 gene csd6 71528 70572 CDS product cell shape-determining L,D-carboxypeptidase Csd6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757130.1 protein_id gnl|my_center|LOCUS_08330 71611 72801 gene locus_tag LOCUS_08340 71611 72801 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 protein_id gnl|my_center|LOCUS_08340 72841 73011 gene locus_tag LOCUS_08350 72841 73011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 74423 73851 gene locus_tag LOCUS_08360 gene folE 74423 73851 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 protein_id gnl|my_center|LOCUS_08360 75415 74462 gene locus_tag LOCUS_08370 gene corA 75415 74462 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_08370 76618 75428 gene locus_tag LOCUS_08380 76618 75428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 77979 76618 gene locus_tag LOCUS_08390 77979 76618 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864463.1 protein_id gnl|my_center|LOCUS_08390 78631 77951 gene locus_tag LOCUS_08400 78631 77951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 79493 78612 gene locus_tag LOCUS_08410 79493 78612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 80470 79586 gene locus_tag LOCUS_08420 gene era 80470 79586 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852114.1 protein_id gnl|my_center|LOCUS_08420 82058 80541 gene locus_tag LOCUS_08430 82058 80541 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851902.1 protein_id gnl|my_center|LOCUS_08430 82217 82597 gene locus_tag LOCUS_08440 82217 82597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 83120 82605 gene locus_tag LOCUS_08450 gene def 83120 82605 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851936.1 protein_id gnl|my_center|LOCUS_08450 83716 83132 gene locus_tag LOCUS_08460 gene clpP 83716 83132 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806309.1 protein_id gnl|my_center|LOCUS_08460 85032 83731 gene locus_tag LOCUS_08470 gene tig 85032 83731 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 protein_id gnl|my_center|LOCUS_08470 85124 86797 gene locus_tag LOCUS_08480 85124 86797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 87925 86807 gene locus_tag LOCUS_08490 87925 86807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 88866 87925 gene locus_tag LOCUS_08500 gene ppk2 88866 87925 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_08500 90024 88876 gene locus_tag LOCUS_08510 gene nspC 90024 88876 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_08510 90178 90014 gene locus_tag LOCUS_08520 90178 90014 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763586.1 protein_id gnl|my_center|LOCUS_08520 91399 90206 gene locus_tag LOCUS_08530 91399 90206 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852026.1 protein_id gnl|my_center|LOCUS_08530 92342 92184 gene locus_tag LOCUS_08540 92342 92184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 92775 92410 gene locus_tag LOCUS_08550 92775 92410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 93555 92818 gene locus_tag LOCUS_08560 93555 92818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 93716 93552 gene locus_tag LOCUS_08570 93716 93552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 93848 94999 gene locus_tag LOCUS_08580 93848 94999 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_08580 95000 96499 gene locus_tag LOCUS_08590 95000 96499 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_08590 96620 97999 gene locus_tag LOCUS_08600 96620 97999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 98015 98410 gene locus_tag LOCUS_08610 98015 98410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 99300 98425 gene locus_tag LOCUS_08620 99300 98425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 99380 100210 gene locus_tag LOCUS_08630 99380 100210 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351696.1 protein_id gnl|my_center|LOCUS_08630 101236 100370 gene locus_tag LOCUS_08640 101236 100370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 101643 101215 gene locus_tag LOCUS_08650 101643 101215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 103013 101685 gene locus_tag LOCUS_08660 103013 101685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 104410 103010 gene locus_tag LOCUS_08670 104410 103010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 105159 104494 gene locus_tag LOCUS_08680 105159 104494 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596556.1 protein_id gnl|my_center|LOCUS_08680 105262 105816 gene locus_tag LOCUS_08690 105262 105816 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619543.1 protein_id gnl|my_center|LOCUS_08690 107286 105826 gene locus_tag LOCUS_08700 107286 105826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 108179 107283 gene locus_tag LOCUS_08710 108179 107283 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_08710 108301 108678 gene locus_tag LOCUS_08720 108301 108678 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760530.1 protein_id gnl|my_center|LOCUS_08720 108675 109967 gene locus_tag LOCUS_08730 gene nhaA 108675 109967 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_08730 110171 109992 gene locus_tag LOCUS_08740 110171 109992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 110923 110219 gene locus_tag LOCUS_08750 110923 110219 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807508.1 protein_id gnl|my_center|LOCUS_08750 111022 112911 gene locus_tag LOCUS_08760 111022 112911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 114222 113101 gene locus_tag LOCUS_08770 114222 113101 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651618.1 protein_id gnl|my_center|LOCUS_08770 115126 114164 gene locus_tag LOCUS_08780 115126 114164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 116079 115132 gene locus_tag LOCUS_08790 116079 115132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 117470 116079 gene locus_tag LOCUS_08800 117470 116079 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_08800 118797 117448 gene locus_tag LOCUS_08810 118797 117448 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457828.1 protein_id gnl|my_center|LOCUS_08810 120968 118899 gene locus_tag LOCUS_08820 120968 118899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 121148 121462 gene locus_tag LOCUS_08830 121148 121462 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853292.1 protein_id gnl|my_center|LOCUS_08830 121704 121826 gene locus_tag LOCUS_08840 121704 121826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 121950 122034 gene locus_tag LOCUS_t00030 121950 122034 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 122271 122423 gene locus_tag LOCUS_08850 122271 122423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 122410 122904 gene locus_tag LOCUS_08860 122410 122904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 123013 126720 gene locus_tag LOCUS_08870 123013 126720 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864285.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence06 1258 155 gene locus_tag LOCUS_08880 1258 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1638 2111 gene locus_tag LOCUS_08890 1638 2111 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 protein_id gnl|my_center|LOCUS_08890 3779 2184 gene locus_tag LOCUS_08900 3779 2184 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942070.1 protein_id gnl|my_center|LOCUS_08900 5367 3871 gene locus_tag LOCUS_08910 5367 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 9318 5518 gene locus_tag LOCUS_08920 9318 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 9474 10382 gene locus_tag LOCUS_08930 9474 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 11138 10386 gene locus_tag LOCUS_08940 11138 10386 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_08940 12187 11150 gene locus_tag LOCUS_08950 12187 11150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 12379 12212 gene locus_tag LOCUS_08960 12379 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12571 13623 gene locus_tag LOCUS_08970 12571 13623 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 protein_id gnl|my_center|LOCUS_08970 15273 13627 gene locus_tag LOCUS_08980 15273 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 16169 15270 gene locus_tag LOCUS_08990 16169 15270 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_08990 16897 16208 gene locus_tag LOCUS_09000 16897 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 17666 17031 gene locus_tag LOCUS_09010 17666 17031 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185732.1 protein_id gnl|my_center|LOCUS_09010 18738 17707 gene locus_tag LOCUS_09020 gene namA 18738 17707 CDS product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086174.1 protein_id gnl|my_center|LOCUS_09020 19316 18735 gene locus_tag LOCUS_09030 19316 18735 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212179.1 protein_id gnl|my_center|LOCUS_09030 19447 19818 gene locus_tag LOCUS_09040 19447 19818 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_09040 19822 20718 gene locus_tag LOCUS_09050 19822 20718 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 protein_id gnl|my_center|LOCUS_09050 22033 20750 gene locus_tag LOCUS_09060 22033 20750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 22243 22977 gene locus_tag LOCUS_09070 22243 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 24003 23002 gene locus_tag LOCUS_09080 24003 23002 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766269.1 protein_id gnl|my_center|LOCUS_09080 24101 24985 gene locus_tag LOCUS_09090 24101 24985 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852976.1 protein_id gnl|my_center|LOCUS_09090 25497 24973 gene locus_tag LOCUS_09100 25497 24973 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 protein_id gnl|my_center|LOCUS_09100 26316 25507 gene locus_tag LOCUS_09110 26316 25507 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946265.1 protein_id gnl|my_center|LOCUS_09110 27207 26326 gene locus_tag LOCUS_09120 27207 26326 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214197.1 protein_id gnl|my_center|LOCUS_09120 27412 27729 gene locus_tag LOCUS_09130 gene sugE 27412 27729 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932066.1 protein_id gnl|my_center|LOCUS_09130 28362 27745 gene locus_tag LOCUS_09140 28362 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 protein_id gnl|my_center|LOCUS_09140 28784 28434 gene locus_tag LOCUS_09150 gene phnA 28784 28434 CDS product alkylphosphonate utilization operon protein PhnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 protein_id gnl|my_center|LOCUS_09150 29296 28856 gene locus_tag LOCUS_09160 29296 28856 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925670.1 protein_id gnl|my_center|LOCUS_09160 29382 30170 gene locus_tag LOCUS_09170 29382 30170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_09170 30421 30185 gene locus_tag LOCUS_09180 30421 30185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 30872 30390 gene locus_tag LOCUS_09190 30872 30390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09190 31604 30984 gene locus_tag LOCUS_09200 31604 30984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 33000 31900 gene locus_tag LOCUS_09210 gene dapE 33000 31900 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854067.1 protein_id gnl|my_center|LOCUS_09210 33111 36110 gene locus_tag LOCUS_09220 33111 36110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 36200 36748 gene locus_tag LOCUS_09230 36200 36748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 36769 37167 gene locus_tag LOCUS_09240 36769 37167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_09240 39397 37178 gene locus_tag LOCUS_09250 39397 37178 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 protein_id gnl|my_center|LOCUS_09250 40759 39425 gene locus_tag LOCUS_09260 40759 39425 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_09260 41307 40771 gene locus_tag LOCUS_09270 gene mog 41307 40771 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707146.1 protein_id gnl|my_center|LOCUS_09270 41822 41304 gene locus_tag LOCUS_09280 41822 41304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 43278 41809 gene locus_tag LOCUS_09290 43278 41809 CDS product ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852990.1 protein_id gnl|my_center|LOCUS_09290 44527 43259 gene locus_tag LOCUS_09300 gene mtaB 44527 43259 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_09300 46289 44544 gene locus_tag LOCUS_09310 46289 44544 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852957.1 protein_id gnl|my_center|LOCUS_09310 47325 46291 gene locus_tag LOCUS_09320 gene aroB 47325 46291 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852978.1 protein_id gnl|my_center|LOCUS_09320 47578 48759 gene locus_tag LOCUS_09330 47578 48759 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 protein_id gnl|my_center|LOCUS_09330 49695 48760 gene locus_tag LOCUS_09340 gene hemH 49695 48760 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364269.1 protein_id gnl|my_center|LOCUS_09340 50146 49697 gene locus_tag LOCUS_09350 50146 49697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 50948 50238 gene locus_tag LOCUS_09360 50948 50238 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 protein_id gnl|my_center|LOCUS_09360 51959 50973 gene locus_tag LOCUS_09370 51959 50973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 53367 51946 gene locus_tag LOCUS_09380 53367 51946 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931874.1 protein_id gnl|my_center|LOCUS_09380 54706 53354 gene locus_tag LOCUS_09390 54706 53354 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_09390 55662 54706 gene locus_tag LOCUS_09400 55662 54706 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478143.1 protein_id gnl|my_center|LOCUS_09400 56242 55727 gene locus_tag LOCUS_09410 56242 55727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 56374 57201 gene locus_tag LOCUS_09420 56374 57201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 57658 57230 gene locus_tag LOCUS_09430 57658 57230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 58070 57732 gene locus_tag LOCUS_09440 58070 57732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 59251 58064 gene locus_tag LOCUS_09450 gene dccS 59251 58064 CDS product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 protein_id gnl|my_center|LOCUS_09450 59879 59208 gene locus_tag LOCUS_09460 gene dccR 59879 59208 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_09460 60114 59869 gene locus_tag LOCUS_09470 60114 59869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 60298 60597 gene locus_tag LOCUS_09480 60298 60597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 60615 61262 gene locus_tag LOCUS_09490 60615 61262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 61267 63039 gene locus_tag LOCUS_09500 61267 63039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480797.1 protein_id gnl|my_center|LOCUS_09500 63076 64116 gene locus_tag LOCUS_09510 63076 64116 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_09510 64119 64997 gene locus_tag LOCUS_09520 64119 64997 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530444.1 protein_id gnl|my_center|LOCUS_09520 64994 66973 gene locus_tag LOCUS_09530 64994 66973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 68074 66977 gene locus_tag LOCUS_09540 68074 66977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 68510 68094 gene locus_tag LOCUS_09550 68510 68094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 68788 68522 gene locus_tag LOCUS_09560 68788 68522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 68888 69511 gene locus_tag LOCUS_09570 68888 69511 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_09570 71231 69540 gene locus_tag LOCUS_09580 71231 69540 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626068.1 protein_id gnl|my_center|LOCUS_09580 73767 71356 gene locus_tag LOCUS_09590 73767 71356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 74566 73781 gene locus_tag LOCUS_09600 74566 73781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 74739 75209 gene locus_tag LOCUS_09610 74739 75209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 77332 75212 gene locus_tag LOCUS_09620 77332 75212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 78678 77332 gene locus_tag LOCUS_09630 78678 77332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 89176 78701 gene locus_tag LOCUS_09640 89176 78701 CDS product tandem-95 repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477759.1 protein_id gnl|my_center|LOCUS_09640 89911 89192 gene locus_tag LOCUS_09650 89911 89192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 91419 89923 gene locus_tag LOCUS_09660 91419 89923 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926923.1 protein_id gnl|my_center|LOCUS_09660 91674 92168 gene locus_tag LOCUS_09670 91674 92168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 92867 92184 gene locus_tag LOCUS_09680 92867 92184 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963772.1 protein_id gnl|my_center|LOCUS_09680 94481 92922 gene locus_tag LOCUS_09690 94481 92922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 94614 103250 gene locus_tag LOCUS_09700 94614 103250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 103132 103231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 103804 104211 gene locus_tag LOCUS_09710 103804 104211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 104211 105866 gene locus_tag LOCUS_09720 104211 105866 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941814.1 protein_id gnl|my_center|LOCUS_09720 105892 106590 gene locus_tag LOCUS_09730 105892 106590 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_09730 106682 107101 gene locus_tag LOCUS_09740 106682 107101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 108574 107129 gene locus_tag LOCUS_09750 gene guaB 108574 107129 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852968.1 protein_id gnl|my_center|LOCUS_09750 109956 108595 gene locus_tag LOCUS_09760 gene gatA 109956 108595 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853884.1 protein_id gnl|my_center|LOCUS_09760 110452 110102 gene locus_tag LOCUS_09770 gene rplQ 110452 110102 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_09770 111464 110466 gene locus_tag LOCUS_09780 111464 110466 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851403.1 protein_id gnl|my_center|LOCUS_09780 112108 111482 gene locus_tag LOCUS_09790 gene rpsD 112108 111482 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 protein_id gnl|my_center|LOCUS_09790 112511 112119 gene locus_tag LOCUS_09800 gene rpsK 112511 112119 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779544.1 protein_id gnl|my_center|LOCUS_09800 112890 112522 gene locus_tag LOCUS_09810 gene rpsM 112890 112522 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 protein_id gnl|my_center|LOCUS_09810 113272 113634 gene locus_tag LOCUS_09820 113272 113634 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence07 2146 278 gene locus_tag LOCUS_09830 gene mnmG 2146 278 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864546.1 protein_id gnl|my_center|LOCUS_09830 2306 2926 gene locus_tag LOCUS_09840 2306 2926 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 protein_id gnl|my_center|LOCUS_09840 3681 2923 gene locus_tag LOCUS_09850 gene mreC 3681 2923 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864583.1 protein_id gnl|my_center|LOCUS_09850 4772 3741 gene locus_tag LOCUS_09860 4772 3741 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_09860 6003 4786 gene locus_tag LOCUS_09870 gene clpX 6003 4786 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_09870 6798 6016 gene locus_tag LOCUS_09880 gene lpxA 6798 6016 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095662.1 protein_id gnl|my_center|LOCUS_09880 7250 6807 gene locus_tag LOCUS_09890 gene fabZ 7250 6807 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 protein_id gnl|my_center|LOCUS_09890 8345 7302 gene locus_tag LOCUS_09900 gene lpxB 8345 7302 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142178.1 protein_id gnl|my_center|LOCUS_09900 9415 8342 gene locus_tag LOCUS_09910 9415 8342 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 protein_id gnl|my_center|LOCUS_09910 9595 9870 gene locus_tag LOCUS_09920 9595 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 11234 9888 gene locus_tag LOCUS_09930 11234 9888 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858451.1 protein_id gnl|my_center|LOCUS_09930 12646 11423 gene locus_tag LOCUS_09940 12646 11423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 12940 13785 gene locus_tag LOCUS_09950 gene nfo 12940 13785 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873890.1 protein_id gnl|my_center|LOCUS_09950 15560 13929 gene locus_tag LOCUS_09960 gene dauA 15560 13929 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 protein_id gnl|my_center|LOCUS_09960 16174 15557 gene locus_tag LOCUS_09970 16174 15557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 16314 16892 gene locus_tag LOCUS_09980 16314 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 17549 16902 gene locus_tag LOCUS_09990 17549 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 18167 17553 gene locus_tag LOCUS_10000 18167 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 18267 18611 gene locus_tag LOCUS_10010 18267 18611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 18619 20352 gene locus_tag LOCUS_10020 18619 20352 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858720.1 protein_id gnl|my_center|LOCUS_10020 20664 21053 gene locus_tag LOCUS_10030 20664 21053 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183543.1 protein_id gnl|my_center|LOCUS_10030 21035 21544 gene locus_tag LOCUS_10040 21035 21544 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183511.1 protein_id gnl|my_center|LOCUS_10040 21544 22347 gene locus_tag LOCUS_10050 21544 22347 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864416.1 protein_id gnl|my_center|LOCUS_10050 22354 23580 gene locus_tag LOCUS_10060 gene nuoD 22354 23580 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864417.1 protein_id gnl|my_center|LOCUS_10060 23577 23855 gene locus_tag LOCUS_10070 23577 23855 CDS product NADH-ubiquinone oxidoreductase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819168.1 protein_id gnl|my_center|LOCUS_10070 23848 24636 gene locus_tag LOCUS_10080 23848 24636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 24636 27110 gene locus_tag LOCUS_10090 24636 27110 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 protein_id gnl|my_center|LOCUS_10090 27112 28104 gene locus_tag LOCUS_10100 gene nuoH 27112 28104 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277308.1 protein_id gnl|my_center|LOCUS_10100 28114 28734 gene locus_tag LOCUS_10110 gene nuoI 28114 28734 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851456.1 protein_id gnl|my_center|LOCUS_10110 28744 29322 gene locus_tag LOCUS_10120 28744 29322 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464208.1 protein_id gnl|my_center|LOCUS_10120 29322 29621 gene locus_tag LOCUS_10130 gene nuoK 29322 29621 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_10130 29624 31480 gene locus_tag LOCUS_10140 gene nuoL 29624 31480 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200192.1 protein_id gnl|my_center|LOCUS_10140 31493 33019 gene locus_tag LOCUS_10150 31493 33019 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 protein_id gnl|my_center|LOCUS_10150 33019 34521 gene locus_tag LOCUS_10160 gene nuoN 33019 34521 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904307.1 protein_id gnl|my_center|LOCUS_10160 34577 35065 gene locus_tag LOCUS_10170 34577 35065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 35117 35980 gene locus_tag LOCUS_10180 35117 35980 CDS product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857964.1 protein_id gnl|my_center|LOCUS_10180 35984 36769 gene locus_tag LOCUS_10190 35984 36769 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858257.1 protein_id gnl|my_center|LOCUS_10190 36791 39172 gene locus_tag LOCUS_10200 gene topA 36791 39172 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_10200 39169 39684 gene locus_tag LOCUS_10210 39169 39684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 39674 40525 gene locus_tag LOCUS_10220 39674 40525 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851400.1 protein_id gnl|my_center|LOCUS_10220 40537 41697 gene locus_tag LOCUS_10230 40537 41697 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855678.1 protein_id gnl|my_center|LOCUS_10230 42399 41671 gene locus_tag LOCUS_10240 42399 41671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 42635 42396 gene locus_tag LOCUS_10250 42635 42396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 43920 42643 gene locus_tag LOCUS_10260 gene eno 43920 42643 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955673.1 protein_id gnl|my_center|LOCUS_10260 45103 44054 gene locus_tag LOCUS_10270 gene recA 45103 44054 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851424.1 protein_id gnl|my_center|LOCUS_10270 45434 45201 gene locus_tag LOCUS_10280 45434 45201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 46846 45548 gene locus_tag LOCUS_10290 46846 45548 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_10290 48302 47016 gene locus_tag LOCUS_10300 48302 47016 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_10300 49530 48409 gene locus_tag LOCUS_10310 gene trmA 49530 48409 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206575.1 protein_id gnl|my_center|LOCUS_10310 49586 51157 gene locus_tag LOCUS_10320 49586 51157 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948968.1 protein_id gnl|my_center|LOCUS_10320 51218 53152 gene locus_tag LOCUS_10330 51218 53152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 53163 54461 gene locus_tag LOCUS_10340 gene glmU 53163 54461 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852530.1 protein_id gnl|my_center|LOCUS_10340 54465 55736 gene locus_tag LOCUS_10350 gene coaBC 54465 55736 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009984.1 protein_id gnl|my_center|LOCUS_10350 55729 56415 gene locus_tag LOCUS_10360 55729 56415 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_10360 56375 57175 gene locus_tag LOCUS_10370 56375 57175 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_10370 57172 58188 gene locus_tag LOCUS_10380 57172 58188 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589921.1 protein_id gnl|my_center|LOCUS_10380 58194 58916 gene locus_tag LOCUS_10390 gene truA 58194 58916 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203260.1 protein_id gnl|my_center|LOCUS_10390 58925 61450 gene locus_tag LOCUS_10400 58925 61450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 61500 62225 gene locus_tag LOCUS_10410 gene vncR 61500 62225 CDS product response regulator transcription factor VncR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697960.1 protein_id gnl|my_center|LOCUS_10410 64357 62249 gene locus_tag LOCUS_10420 64357 62249 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_10420 65423 64464 gene locus_tag LOCUS_10430 65423 64464 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454688.1 protein_id gnl|my_center|LOCUS_10430 65693 66496 gene locus_tag LOCUS_10440 65693 66496 CDS product HrcA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891884.1 protein_id gnl|my_center|LOCUS_10440 66506 67063 gene locus_tag LOCUS_10450 gene grpE 66506 67063 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780052.1 protein_id gnl|my_center|LOCUS_10450 67158 69041 gene locus_tag LOCUS_10460 gene dnaK 67158 69041 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826316.1 protein_id gnl|my_center|LOCUS_10460 69053 69352 gene locus_tag LOCUS_10470 69053 69352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 69352 70470 gene locus_tag LOCUS_10480 69352 70470 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947710.1 protein_id gnl|my_center|LOCUS_10480 70720 70478 gene locus_tag LOCUS_10490 70720 70478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 70843 71646 gene locus_tag LOCUS_10500 70843 71646 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226149.1 protein_id gnl|my_center|LOCUS_10500 71664 73715 gene locus_tag LOCUS_10510 71664 73715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 73774 73998 gene locus_tag LOCUS_10520 73774 73998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 74057 74482 gene locus_tag LOCUS_10530 74057 74482 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_10530 74495 75427 gene locus_tag LOCUS_10540 gene rimK 74495 75427 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 protein_id gnl|my_center|LOCUS_10540 75811 75443 gene locus_tag LOCUS_10550 75811 75443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 75956 76318 gene locus_tag LOCUS_10560 gene trxA 75956 76318 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453775.1 protein_id gnl|my_center|LOCUS_10560 76329 78080 gene locus_tag LOCUS_10570 76329 78080 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852245.1 protein_id gnl|my_center|LOCUS_10570 78126 78872 gene locus_tag LOCUS_10580 78126 78872 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212540.1 protein_id gnl|my_center|LOCUS_10580 80305 78899 gene locus_tag LOCUS_10590 gene ttdT 80305 78899 CDS product L-tartrate/succinate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804928.1 protein_id gnl|my_center|LOCUS_10590 80438 81502 gene locus_tag LOCUS_10600 80438 81502 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 protein_id gnl|my_center|LOCUS_10600 81506 82129 gene locus_tag LOCUS_10610 81506 82129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 82153 82752 gene locus_tag LOCUS_10620 82153 82752 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939073.1 protein_id gnl|my_center|LOCUS_10620 82752 83246 gene locus_tag LOCUS_10630 gene cobU 82752 83246 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680310.1 protein_id gnl|my_center|LOCUS_10630 83243 83989 gene locus_tag LOCUS_10640 83243 83989 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718969.1 protein_id gnl|my_center|LOCUS_10640 83986 84999 gene locus_tag LOCUS_10650 83986 84999 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545158.1 protein_id gnl|my_center|LOCUS_10650 84993 85595 gene locus_tag LOCUS_10660 84993 85595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 85601 86287 gene locus_tag LOCUS_10670 85601 86287 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_10670 86297 87520 gene locus_tag LOCUS_10680 86297 87520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 88794 87529 gene locus_tag LOCUS_10690 88794 87529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 89013 90419 gene locus_tag LOCUS_10700 89013 90419 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989707.1 protein_id gnl|my_center|LOCUS_10700 91834 90416 gene locus_tag LOCUS_10710 91834 90416 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_10710 91927 92817 gene locus_tag LOCUS_10720 gene cbiB 91927 92817 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_10720 92814 93233 gene locus_tag LOCUS_10730 92814 93233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 94464 93241 gene locus_tag LOCUS_10740 94464 93241 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_10740 95123 94461 gene locus_tag LOCUS_10750 95123 94461 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853196.1 protein_id gnl|my_center|LOCUS_10750 96571 95150 gene locus_tag LOCUS_10760 gene htrA 96571 95150 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853235.1 protein_id gnl|my_center|LOCUS_10760 98375 96687 gene locus_tag LOCUS_10770 gene ilvD 98375 96687 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 protein_id gnl|my_center|LOCUS_10770 98566 98652 gene locus_tag LOCUS_t00040 98566 98652 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 98664 98752 gene locus_tag LOCUS_t00050 98664 98752 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 99168 100856 gene locus_tag LOCUS_10780 99168 100856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 101398 100883 gene locus_tag LOCUS_10790 101398 100883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 102087 102449 gene locus_tag LOCUS_10800 102087 102449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 102454 103314 gene locus_tag LOCUS_10810 102454 103314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 103577 103311 gene locus_tag LOCUS_10820 103577 103311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 104401 103577 gene locus_tag LOCUS_10830 104401 103577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 105080 104613 gene locus_tag LOCUS_10840 105080 104613 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025397.1 protein_id gnl|my_center|LOCUS_10840 105732 106859 gene locus_tag LOCUS_10850 105732 106859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 107102 107177 gene locus_tag LOCUS_t00060 107102 107177 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 107378 107875 gene locus_tag LOCUS_10860 107378 107875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence08 1221 181 gene locus_tag LOCUS_10870 gene hemE 1221 181 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 protein_id gnl|my_center|LOCUS_10870 1769 1263 gene locus_tag LOCUS_10880 1769 1263 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_10880 2808 1771 gene locus_tag LOCUS_10890 2808 1771 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 protein_id gnl|my_center|LOCUS_10890 5406 2812 gene locus_tag LOCUS_10900 gene gyrA 5406 2812 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857904.1 protein_id gnl|my_center|LOCUS_10900 5771 5556 gene locus_tag LOCUS_10910 5771 5556 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468330.1 protein_id gnl|my_center|LOCUS_10910 7040 5850 gene locus_tag LOCUS_10920 gene argJ 7040 5850 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 protein_id gnl|my_center|LOCUS_10920 8169 7042 gene locus_tag LOCUS_10930 8169 7042 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461981.1 protein_id gnl|my_center|LOCUS_10930 8381 8193 gene locus_tag LOCUS_10940 gene rpmB 8381 8193 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_10940 9312 8443 gene locus_tag LOCUS_10950 9312 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 9623 9916 gene locus_tag LOCUS_10960 9623 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 9903 10910 gene locus_tag LOCUS_10970 gene rfaD 9903 10910 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858041.1 protein_id gnl|my_center|LOCUS_10970 10907 12340 gene locus_tag LOCUS_10980 gene rfaE1 10907 12340 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_10980 12324 12890 gene locus_tag LOCUS_10990 gene gmhA 12324 12890 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566736.1 protein_id gnl|my_center|LOCUS_10990 13481 12912 gene locus_tag LOCUS_11000 13481 12912 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966303.1 protein_id gnl|my_center|LOCUS_11000 14413 13481 gene locus_tag LOCUS_11010 14413 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 15490 14447 gene locus_tag LOCUS_11020 gene rfbB 15490 14447 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548761.1 protein_id gnl|my_center|LOCUS_11020 16423 15509 gene locus_tag LOCUS_11030 gene rfbD 16423 15509 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_11030 17000 16416 gene locus_tag LOCUS_11040 gene rfbC 17000 16416 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_11040 17892 17002 gene locus_tag LOCUS_11050 gene rfbA 17892 17002 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107280.1 protein_id gnl|my_center|LOCUS_11050 19067 17889 gene locus_tag LOCUS_11060 19067 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 20034 19060 gene locus_tag LOCUS_11070 20034 19060 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_11070 21015 20047 gene locus_tag LOCUS_11080 21015 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 22010 21012 gene locus_tag LOCUS_11090 22010 21012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 23095 22013 gene locus_tag LOCUS_11100 23095 22013 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_11100 23977 23099 gene locus_tag LOCUS_11110 23977 23099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 24860 23952 gene locus_tag LOCUS_11120 24860 23952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 26329 24860 gene locus_tag LOCUS_11130 26329 24860 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074267.1 protein_id gnl|my_center|LOCUS_11130 26583 26329 gene locus_tag LOCUS_11140 26583 26329 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055463.1 protein_id gnl|my_center|LOCUS_11140 27376 26627 gene locus_tag LOCUS_11150 27376 26627 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851687.1 protein_id gnl|my_center|LOCUS_11150 28758 27382 gene locus_tag LOCUS_11160 gene gltD 28758 27382 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081695.1 protein_id gnl|my_center|LOCUS_11160 33199 28763 gene locus_tag LOCUS_11170 gene gltB 33199 28763 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_11170 33479 34471 gene locus_tag LOCUS_11180 33479 34471 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089174.1 protein_id gnl|my_center|LOCUS_11180 34484 35029 gene locus_tag LOCUS_11190 34484 35029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 35031 36311 gene locus_tag LOCUS_11200 gene dctM 35031 36311 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_11200 37048 36341 gene locus_tag LOCUS_11210 37048 36341 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_11210 38624 37035 gene locus_tag LOCUS_11220 38624 37035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 38690 39376 gene locus_tag LOCUS_11230 38690 39376 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_11230 40192 39362 gene locus_tag LOCUS_11240 40192 39362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 40985 40194 gene locus_tag LOCUS_11250 40985 40194 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_11250 41189 41512 gene locus_tag LOCUS_11260 41189 41512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 42246 41509 gene locus_tag LOCUS_11270 42246 41509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 42791 42255 gene locus_tag LOCUS_11280 42791 42255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 42905 46312 gene locus_tag LOCUS_11290 42905 46312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 46312 47001 gene locus_tag LOCUS_11300 46312 47001 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358569.1 protein_id gnl|my_center|LOCUS_11300 47014 48606 gene locus_tag LOCUS_11310 47014 48606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 48778 50013 gene locus_tag LOCUS_11320 48778 50013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 50026 50424 gene locus_tag LOCUS_11330 50026 50424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 50688 52160 gene locus_tag LOCUS_11340 50688 52160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 52329 52255 gene locus_tag LOCUS_t00070 52329 52255 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 52425 52349 gene locus_tag LOCUS_t00080 52425 52349 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 52517 52441 gene locus_tag LOCUS_t00090 52517 52441 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 52601 52525 gene locus_tag LOCUS_t00100 52601 52525 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 52713 52637 gene locus_tag LOCUS_t00110 52713 52637 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 54557 52791 gene locus_tag LOCUS_11350 gene pglF 54557 52791 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (configuration-retaining) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858054.1 protein_id gnl|my_center|LOCUS_11350 55773 54667 gene locus_tag LOCUS_11360 gene pglE 55773 54667 CDS product UDP-N-acetylbacillosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852877.1 protein_id gnl|my_center|LOCUS_11360 56371 55766 gene locus_tag LOCUS_11370 gene pglD 56371 55766 CDS product UDP-N-acetylbacillosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852865.1 protein_id gnl|my_center|LOCUS_11370 56963 56364 gene locus_tag LOCUS_11380 56963 56364 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_11380 58087 56960 gene locus_tag LOCUS_11390 58087 56960 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147499.1 protein_id gnl|my_center|LOCUS_11390 58883 58089 gene locus_tag LOCUS_11400 58883 58089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 59893 58880 gene locus_tag LOCUS_11410 59893 58880 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693601.1 protein_id gnl|my_center|LOCUS_11410 61389 59890 gene locus_tag LOCUS_11420 61389 59890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 62383 61367 gene locus_tag LOCUS_11430 62383 61367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 63378 62380 gene locus_tag LOCUS_11440 63378 62380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 64376 63375 gene locus_tag LOCUS_11450 64376 63375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 65704 64376 gene locus_tag LOCUS_11460 gene rfbH 65704 64376 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_11460 66633 65710 gene locus_tag LOCUS_11470 66633 65710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 68387 66636 gene locus_tag LOCUS_11480 68387 66636 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261041.1 protein_id gnl|my_center|LOCUS_11480 68542 68384 gene locus_tag LOCUS_11490 68542 68384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 69509 68511 gene locus_tag LOCUS_11500 69509 68511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 70393 69506 gene locus_tag LOCUS_11510 70393 69506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 71490 70393 gene locus_tag LOCUS_11520 gene rfbG 71490 70393 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_11520 72263 71490 gene locus_tag LOCUS_11530 gene rfbF 72263 71490 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816873.1 protein_id gnl|my_center|LOCUS_11530 73423 72260 gene locus_tag LOCUS_11540 73423 72260 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_11540 74345 73413 gene locus_tag LOCUS_11550 74345 73413 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002442.1 protein_id gnl|my_center|LOCUS_11550 75503 74358 gene locus_tag LOCUS_11560 gene gmd 75503 74358 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659810.1 protein_id gnl|my_center|LOCUS_11560 75961 75518 gene locus_tag LOCUS_11570 75961 75518 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706696.1 protein_id gnl|my_center|LOCUS_11570 77288 75978 gene locus_tag LOCUS_11580 77288 75978 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_11580 78379 77351 gene locus_tag LOCUS_11590 gene galE 78379 77351 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_11590 79103 79027 gene locus_tag LOCUS_t00120 79103 79027 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 79198 79108 gene locus_tag LOCUS_t00130 79198 79108 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 79986 79288 gene locus_tag LOCUS_11600 gene pyrF 79986 79288 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_11600 80385 79990 gene locus_tag LOCUS_11610 gene nusB 80385 79990 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_11610 80858 80388 gene locus_tag LOCUS_11620 gene ribE 80858 80388 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 protein_id gnl|my_center|LOCUS_11620 81688 80888 gene locus_tag LOCUS_11630 gene kdsA 81688 80888 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858652.1 protein_id gnl|my_center|LOCUS_11630 83238 81685 gene locus_tag LOCUS_11640 83238 81685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 83761 83384 gene locus_tag LOCUS_11650 83761 83384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 85484 83748 gene locus_tag LOCUS_11660 85484 83748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 86372 85488 gene locus_tag LOCUS_11670 86372 85488 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 protein_id gnl|my_center|LOCUS_11670 86499 87764 gene locus_tag LOCUS_11680 gene murA 86499 87764 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857102.1 protein_id gnl|my_center|LOCUS_11680 87863 88957 gene locus_tag LOCUS_11690 87863 88957 CDS product DUF5644 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851142.1 protein_id gnl|my_center|LOCUS_11690 88968 89591 gene locus_tag LOCUS_11700 88968 89591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 91299 89593 gene locus_tag LOCUS_11710 91299 89593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 91858 91343 gene locus_tag LOCUS_11720 91858 91343 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858665.1 protein_id gnl|my_center|LOCUS_11720 91930 92640 gene locus_tag LOCUS_11730 91930 92640 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852328.1 protein_id gnl|my_center|LOCUS_11730 92603 93454 gene locus_tag LOCUS_11740 92603 93454 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931634.1 protein_id gnl|my_center|LOCUS_11740 93479 94192 gene locus_tag LOCUS_11750 gene cmoA 93479 94192 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_11750 94206 94712 gene locus_tag LOCUS_11760 gene bcp 94206 94712 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_11760 94724 95722 gene locus_tag LOCUS_11770 94724 95722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 95722 97110 gene locus_tag LOCUS_11780 95722 97110 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852810.1 protein_id gnl|my_center|LOCUS_11780 97117 97911 gene locus_tag LOCUS_11790 97117 97911 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence09 1349 153 gene locus_tag LOCUS_11800 1349 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 2694 1360 gene locus_tag LOCUS_11810 2694 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3094 2918 gene locus_tag LOCUS_11820 3094 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3560 3243 gene locus_tag LOCUS_11830 3560 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3818 4021 gene locus_tag LOCUS_11840 3818 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 4156 4323 gene locus_tag LOCUS_11850 4156 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4323 4541 gene locus_tag LOCUS_11860 4323 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4737 4871 gene locus_tag LOCUS_11870 4737 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4947 5411 gene locus_tag LOCUS_11880 4947 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5588 6766 gene locus_tag LOCUS_11890 5588 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 6777 7112 gene locus_tag LOCUS_11900 6777 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 7109 7843 gene locus_tag LOCUS_11910 7109 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7821 8150 gene locus_tag LOCUS_11920 7821 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 8555 8803 gene locus_tag LOCUS_11930 8555 8803 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_11930 8843 9178 gene locus_tag LOCUS_11940 8843 9178 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_11940 9182 9559 gene locus_tag LOCUS_11950 9182 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 9549 9920 gene locus_tag LOCUS_11960 9549 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 10545 9943 gene locus_tag LOCUS_11970 10545 9943 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727134.1 protein_id gnl|my_center|LOCUS_11970 10654 11595 gene locus_tag LOCUS_11980 gene rlmF 10654 11595 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666006.1 protein_id gnl|my_center|LOCUS_11980 12260 11592 gene locus_tag LOCUS_11990 gene aat 12260 11592 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_11990 12323 13009 gene locus_tag LOCUS_12000 12323 13009 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 protein_id gnl|my_center|LOCUS_12000 13167 13006 gene locus_tag LOCUS_12010 13167 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 13800 13177 gene locus_tag LOCUS_12020 13800 13177 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853160.1 protein_id gnl|my_center|LOCUS_12020 14102 14605 gene locus_tag LOCUS_12030 14102 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 14605 15315 gene locus_tag LOCUS_12040 14605 15315 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851528.1 protein_id gnl|my_center|LOCUS_12040 15349 15528 gene locus_tag LOCUS_12050 15349 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 15552 17369 gene locus_tag LOCUS_12060 15552 17369 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262804.1 protein_id gnl|my_center|LOCUS_12060 17371 18204 gene locus_tag LOCUS_12070 17371 18204 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545710.1 protein_id gnl|my_center|LOCUS_12070 18179 18877 gene locus_tag LOCUS_12080 18179 18877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016638.1 protein_id gnl|my_center|LOCUS_12080 18874 19833 gene locus_tag LOCUS_12090 18874 19833 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903477.1 protein_id gnl|my_center|LOCUS_12090 20329 19838 gene locus_tag LOCUS_12100 20329 19838 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_12100 20944 20330 gene locus_tag LOCUS_12110 20944 20330 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_12110 21217 22308 gene locus_tag LOCUS_12120 gene cfbB 21217 22308 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496825.1 protein_id gnl|my_center|LOCUS_12120 22609 22394 gene locus_tag LOCUS_12130 22609 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 22665 23642 gene locus_tag LOCUS_12140 22665 23642 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_12140 23697 24107 gene locus_tag LOCUS_12150 23697 24107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 24177 25196 gene locus_tag LOCUS_12160 24177 25196 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_12160 25270 27810 gene locus_tag LOCUS_12170 25270 27810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 29348 27852 gene locus_tag LOCUS_12180 29348 27852 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_12180 29668 29405 gene locus_tag LOCUS_12190 29668 29405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 31707 29761 gene locus_tag LOCUS_12200 31707 29761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 32169 31780 gene locus_tag LOCUS_12210 32169 31780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 32731 32949 gene locus_tag LOCUS_12220 32731 32949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 33053 34573 gene locus_tag LOCUS_12230 33053 34573 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_12230 34570 35997 gene locus_tag LOCUS_12240 34570 35997 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948261.1 protein_id gnl|my_center|LOCUS_12240 36145 37350 gene locus_tag LOCUS_12250 36145 37350 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851154.1 protein_id gnl|my_center|LOCUS_12250 37347 38402 gene locus_tag LOCUS_12260 37347 38402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127329.1 protein_id gnl|my_center|LOCUS_12260 38395 38877 gene locus_tag LOCUS_12270 38395 38877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 38870 40705 gene locus_tag LOCUS_12280 38870 40705 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214431.1 protein_id gnl|my_center|LOCUS_12280 40702 46101 gene locus_tag LOCUS_12290 40702 46101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 46098 47045 gene locus_tag LOCUS_12300 46098 47045 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_12300 47050 47913 gene locus_tag LOCUS_12310 gene dinD 47050 47913 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_12310 47960 51091 gene locus_tag LOCUS_12320 47960 51091 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_12320 51383 51180 gene locus_tag LOCUS_12330 51383 51180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 52339 51413 gene locus_tag LOCUS_12340 52339 51413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 52622 52428 gene locus_tag LOCUS_12350 52622 52428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 53220 52882 gene locus_tag LOCUS_12360 53220 52882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 53628 53221 gene locus_tag LOCUS_12370 53628 53221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 54142 53621 gene locus_tag LOCUS_12380 54142 53621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 54237 54416 gene locus_tag LOCUS_12390 54237 54416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 55121 54411 gene locus_tag LOCUS_12400 55121 54411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 55248 55880 gene locus_tag LOCUS_12410 55248 55880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 55892 57301 gene locus_tag LOCUS_12420 55892 57301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 57374 57736 gene locus_tag LOCUS_12430 57374 57736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 57733 58911 gene locus_tag LOCUS_12440 57733 58911 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_12440 58945 59307 gene locus_tag LOCUS_12450 58945 59307 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_12450 59317 59787 gene locus_tag LOCUS_12460 59317 59787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 59845 61071 gene locus_tag LOCUS_12470 59845 61071 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884428.1 protein_id gnl|my_center|LOCUS_12470 61072 62529 gene locus_tag LOCUS_12480 gene rmuC 61072 62529 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260923.1 protein_id gnl|my_center|LOCUS_12480 62533 63597 gene locus_tag LOCUS_12490 62533 63597 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_12490 64487 63591 gene locus_tag LOCUS_12500 64487 63591 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_12500 65707 64487 gene locus_tag LOCUS_12510 65707 64487 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_12510 65915 65715 gene locus_tag LOCUS_12520 65915 65715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 66096 66884 gene locus_tag LOCUS_12530 66096 66884 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 protein_id gnl|my_center|LOCUS_12530 66881 67375 gene locus_tag LOCUS_12540 66881 67375 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069669028.1 protein_id gnl|my_center|LOCUS_12540 67810 67379 gene locus_tag LOCUS_12550 gene trxC 67810 67379 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 protein_id gnl|my_center|LOCUS_12550 68052 67813 gene locus_tag LOCUS_12560 68052 67813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 68536 68042 gene locus_tag LOCUS_12570 68536 68042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 68635 69747 gene locus_tag LOCUS_12580 68635 69747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 69744 70301 gene locus_tag LOCUS_12590 69744 70301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 70310 71230 gene locus_tag LOCUS_12600 70310 71230 CDS product bifunctional 3-dehydroquinate synthase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545527.1 protein_id gnl|my_center|LOCUS_12600 72030 71227 gene locus_tag LOCUS_12610 72030 71227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 72166 73857 gene locus_tag LOCUS_12620 72166 73857 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852093.1 protein_id gnl|my_center|LOCUS_12620 73857 74354 gene locus_tag LOCUS_12630 gene ilvN 73857 74354 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852211.1 protein_id gnl|my_center|LOCUS_12630 74391 75338 gene locus_tag LOCUS_12640 gene lpxD 74391 75338 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852180.1 protein_id gnl|my_center|LOCUS_12640 75433 77595 gene locus_tag LOCUS_12650 75433 77595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 77707 78249 gene locus_tag LOCUS_12660 gene raiA 77707 78249 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599094.1 protein_id gnl|my_center|LOCUS_12660 78342 79808 gene locus_tag LOCUS_12670 gene der 78342 79808 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858744.1 protein_id gnl|my_center|LOCUS_12670 79826 81397 gene locus_tag LOCUS_12680 79826 81397 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_12680 81390 82043 gene locus_tag LOCUS_12690 81390 82043 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858312.1 protein_id gnl|my_center|LOCUS_12690 82261 83526 gene locus_tag LOCUS_12700 gene purD 82261 83526 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853212.1 protein_id gnl|my_center|LOCUS_12700 83534 83971 gene locus_tag LOCUS_12710 83534 83971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 83964 86087 gene locus_tag LOCUS_12720 83964 86087 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 protein_id gnl|my_center|LOCUS_12720 86087 86737 gene locus_tag LOCUS_12730 86087 86737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 86744 88918 gene locus_tag LOCUS_12740 86744 88918 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853182.1 protein_id gnl|my_center|LOCUS_12740 89086 89454 gene locus_tag LOCUS_12750 89086 89454 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_12750 89471 91561 gene locus_tag LOCUS_12760 gene cheA 89471 91561 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096053.1 protein_id gnl|my_center|LOCUS_12760 91567 92412 gene locus_tag LOCUS_12770 91567 92412 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 protein_id gnl|my_center|LOCUS_12770 92409 93086 gene locus_tag LOCUS_12780 92409 93086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 93106 94179 gene locus_tag LOCUS_12790 93106 94179 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210874.1 protein_id gnl|my_center|LOCUS_12790 94191 94490 gene locus_tag LOCUS_12800 94191 94490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence10 1622 378 gene locus_tag LOCUS_12810 1622 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2479 1619 gene locus_tag LOCUS_12820 2479 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3332 2472 gene locus_tag LOCUS_12830 3332 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5220 3325 gene locus_tag LOCUS_12840 5220 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5326 5721 gene locus_tag LOCUS_12850 5326 5721 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_12850 5981 6259 gene locus_tag LOCUS_12860 5981 6259 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461513.1 protein_id gnl|my_center|LOCUS_12860 7591 6299 gene locus_tag LOCUS_12870 7591 6299 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853369.1 protein_id gnl|my_center|LOCUS_12870 10437 7630 gene locus_tag LOCUS_12880 10437 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11153 10434 gene locus_tag LOCUS_12890 11153 10434 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_12890 14023 11282 gene locus_tag LOCUS_12900 gene ccsA 14023 11282 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793250.1 protein_id gnl|my_center|LOCUS_12900 14157 15071 gene locus_tag LOCUS_12910 gene cmoB 14157 15071 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_12910 16062 15088 gene locus_tag LOCUS_12920 16062 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 16973 16071 gene locus_tag LOCUS_12930 16973 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 17580 16987 gene locus_tag LOCUS_12940 17580 16987 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852433.1 protein_id gnl|my_center|LOCUS_12940 17634 18452 gene locus_tag LOCUS_12950 17634 18452 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890476.1 protein_id gnl|my_center|LOCUS_12950 18452 19111 gene locus_tag LOCUS_12960 18452 19111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 19701 19108 gene locus_tag LOCUS_12970 19701 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 20933 19716 gene locus_tag LOCUS_12980 gene trpB 20933 19716 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_12980 22085 20967 gene locus_tag LOCUS_12990 gene dnaJ 22085 20967 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853203.1 protein_id gnl|my_center|LOCUS_12990 22175 22747 gene locus_tag LOCUS_13000 gene recR 22175 22747 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853214.1 protein_id gnl|my_center|LOCUS_13000 22751 22927 gene locus_tag LOCUS_13010 22751 22927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 22931 24412 gene locus_tag LOCUS_13020 22931 24412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 24422 25348 gene locus_tag LOCUS_13030 24422 25348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 25874 25374 gene locus_tag LOCUS_13040 25874 25374 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851622.1 protein_id gnl|my_center|LOCUS_13040 27223 25982 gene locus_tag LOCUS_13050 27223 25982 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 protein_id gnl|my_center|LOCUS_13050 27425 30952 gene locus_tag LOCUS_13060 27425 30952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 31086 31958 gene locus_tag LOCUS_13070 gene cas1 31086 31958 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797819.1 protein_id gnl|my_center|LOCUS_13070 31963 32325 gene locus_tag LOCUS_13080 gene cas2 31963 32325 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_13080 32500 32599 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32600 34350 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attatatcaaatggggatttgaaagtaggttaaagc 34373 34648 gene locus_tag LOCUS_13090 34373 34648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 34773 35339 gene locus_tag LOCUS_13100 34773 35339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 35970 35704 gene locus_tag LOCUS_13110 35970 35704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 36364 35963 gene locus_tag LOCUS_13120 36364 35963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 37030 37278 gene locus_tag LOCUS_13130 37030 37278 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 protein_id gnl|my_center|LOCUS_13130 37278 38261 gene locus_tag LOCUS_13140 gene trpD 37278 38261 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087577.1 protein_id gnl|my_center|LOCUS_13140 38270 38686 gene locus_tag LOCUS_13150 gene tsaE 38270 38686 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202493.1 protein_id gnl|my_center|LOCUS_13150 38679 39401 gene locus_tag LOCUS_13160 gene lptB 38679 39401 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855252.1 protein_id gnl|my_center|LOCUS_13160 40738 39419 gene locus_tag LOCUS_13170 40738 39419 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023204.1 protein_id gnl|my_center|LOCUS_13170 42711 40735 gene locus_tag LOCUS_13180 42711 40735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 43535 42810 gene locus_tag LOCUS_13190 gene kdsB 43535 42810 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852502.1 protein_id gnl|my_center|LOCUS_13190 43620 46307 gene locus_tag LOCUS_13200 gene polA 43620 46307 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858644.1 protein_id gnl|my_center|LOCUS_13200 46401 47105 gene locus_tag LOCUS_13210 46401 47105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 47145 47339 gene locus_tag LOCUS_13220 47145 47339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 47339 47611 gene locus_tag LOCUS_13230 47339 47611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 48429 47614 gene locus_tag LOCUS_13240 gene lgt 48429 47614 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854600.1 protein_id gnl|my_center|LOCUS_13240 49731 48433 gene locus_tag LOCUS_13250 49731 48433 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 protein_id gnl|my_center|LOCUS_13250 50829 49843 gene locus_tag LOCUS_13260 50829 49843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 50964 51443 gene locus_tag LOCUS_13270 50964 51443 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420773.1 protein_id gnl|my_center|LOCUS_13270 51446 52012 gene locus_tag LOCUS_13280 51446 52012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 52013 54235 gene locus_tag LOCUS_13290 52013 54235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 54232 56325 gene locus_tag LOCUS_13300 gene ovoA 54232 56325 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_13300 56378 57616 gene locus_tag LOCUS_13310 56378 57616 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873165.1 protein_id gnl|my_center|LOCUS_13310 58345 57605 gene locus_tag LOCUS_13320 gene exoX 58345 57605 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816172.1 protein_id gnl|my_center|LOCUS_13320 59377 58355 gene locus_tag LOCUS_13330 gene queA 59377 58355 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_13330 60114 59380 gene locus_tag LOCUS_13340 gene tatC 60114 59380 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852171.1 protein_id gnl|my_center|LOCUS_13340 60491 60114 gene locus_tag LOCUS_13350 gene tatB 60491 60114 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852097.1 protein_id gnl|my_center|LOCUS_13350 60582 61337 gene locus_tag LOCUS_13360 60582 61337 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853334.1 protein_id gnl|my_center|LOCUS_13360 61341 61577 gene locus_tag LOCUS_13370 61341 61577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 61570 61800 gene locus_tag LOCUS_13380 61570 61800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 61803 62015 gene locus_tag LOCUS_13390 61803 62015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 62037 62798 gene locus_tag LOCUS_13400 62037 62798 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852555.1 protein_id gnl|my_center|LOCUS_13400 62802 63941 gene locus_tag LOCUS_13410 gene pseC 62802 63941 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_13410 64077 64901 gene locus_tag LOCUS_13420 64077 64901 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833936.1 protein_id gnl|my_center|LOCUS_13420 64903 65106 gene locus_tag LOCUS_13430 64903 65106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 66488 65121 gene locus_tag LOCUS_13440 gene hemN 66488 65121 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 protein_id gnl|my_center|LOCUS_13440 67418 66489 gene locus_tag LOCUS_13450 gene argF 67418 66489 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858026.1 protein_id gnl|my_center|LOCUS_13450 67631 69745 gene locus_tag LOCUS_13460 67631 69745 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111559.1 protein_id gnl|my_center|LOCUS_13460 69723 69887 gene locus_tag LOCUS_13470 69723 69887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 69838 70542 gene locus_tag LOCUS_13480 69838 70542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 71196 70519 gene locus_tag LOCUS_13490 71196 70519 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_13490 72423 71200 gene locus_tag LOCUS_13500 72423 71200 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 protein_id gnl|my_center|LOCUS_13500 73399 72425 gene locus_tag LOCUS_13510 gene hemB 73399 72425 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 protein_id gnl|my_center|LOCUS_13510 73459 74034 gene locus_tag LOCUS_13520 gene ribA 73459 74034 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_13520 74031 74612 gene locus_tag LOCUS_13530 gene rsmG 74031 74612 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068828.1 protein_id gnl|my_center|LOCUS_13530 74615 74830 gene locus_tag LOCUS_13540 74615 74830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 74840 75217 gene locus_tag LOCUS_13550 74840 75217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 75266 75424 gene locus_tag LOCUS_13560 75266 75424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 75417 77432 gene locus_tag LOCUS_13570 gene glyS 75417 77432 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858294.1 protein_id gnl|my_center|LOCUS_13570 77736 77660 gene locus_tag LOCUS_t00140 77736 77660 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 77839 77763 gene locus_tag LOCUS_t00150 77839 77763 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78484 78155 gene locus_tag LOCUS_13580 78484 78155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 78856 78500 gene locus_tag LOCUS_13590 78856 78500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 79052 79552 gene locus_tag LOCUS_13600 79052 79552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 79549 80682 gene locus_tag LOCUS_13610 79549 80682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 80695 81057 gene locus_tag LOCUS_13620 80695 81057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 81551 81961 gene locus_tag LOCUS_13630 81551 81961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 82017 83405 gene locus_tag LOCUS_13640 82017 83405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 83408 83602 gene locus_tag LOCUS_13650 83408 83602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 83606 84064 gene locus_tag LOCUS_13660 83606 84064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 84066 84299 gene locus_tag LOCUS_13670 84066 84299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 84301 85512 gene locus_tag LOCUS_13680 84301 85512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 85648 86559 gene locus_tag LOCUS_13690 85648 86559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 86632 87402 gene locus_tag LOCUS_13700 86632 87402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 87469 88200 gene locus_tag LOCUS_13710 87469 88200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 88377 88784 gene locus_tag LOCUS_13720 88377 88784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 88879 90078 gene locus_tag LOCUS_13730 88879 90078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 90090 90233 gene locus_tag LOCUS_13740 90090 90233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 90329 90253 gene locus_tag LOCUS_t00160 90329 90253 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 90423 90349 gene locus_tag LOCUS_t00170 90423 90349 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 90543 91574 gene locus_tag LOCUS_13750 90543 91574 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601458.1 protein_id gnl|my_center|LOCUS_13750 92082 91588 gene locus_tag LOCUS_13760 92082 91588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 93747 92167 gene locus_tag LOCUS_13770 gene pckA 93747 92167 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence11 1034 63 gene locus_tag LOCUS_13780 1034 63 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815235.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13780 1315 1046 gene locus_tag LOCUS_13790 1315 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13790 2433 1402 gene locus_tag LOCUS_13800 gene gap 2433 1402 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948756.1 protein_id gnl|my_center|LOCUS_13800 3189 2491 gene locus_tag LOCUS_13810 3189 2491 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399305.1 protein_id gnl|my_center|LOCUS_13810 3962 3186 gene locus_tag LOCUS_13820 3962 3186 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964169.1 protein_id gnl|my_center|LOCUS_13820 4549 3983 gene locus_tag LOCUS_13830 4549 3983 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_13830 5065 4613 gene locus_tag LOCUS_13840 gene mhqR 5065 4613 CDS product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 protein_id gnl|my_center|LOCUS_13840 5754 5131 gene locus_tag LOCUS_13850 5754 5131 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096365.1 protein_id gnl|my_center|LOCUS_13850 5875 6981 gene locus_tag LOCUS_13860 5875 6981 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924085.1 protein_id gnl|my_center|LOCUS_13860 6987 7832 gene locus_tag LOCUS_13870 6987 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 7835 9085 gene locus_tag LOCUS_13880 7835 9085 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 protein_id gnl|my_center|LOCUS_13880 9091 9642 gene locus_tag LOCUS_13890 9091 9642 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851269.1 protein_id gnl|my_center|LOCUS_13890 9643 10761 gene locus_tag LOCUS_13900 gene carA 9643 10761 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851156.1 protein_id gnl|my_center|LOCUS_13900 11298 10822 gene locus_tag LOCUS_13910 11298 10822 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357337.1 protein_id gnl|my_center|LOCUS_13910 12200 11310 gene locus_tag LOCUS_13920 12200 11310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_13920 13321 12197 gene locus_tag LOCUS_13930 13321 12197 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_13930 14200 13370 gene locus_tag LOCUS_13940 14200 13370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 16194 14215 gene locus_tag LOCUS_13950 16194 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 16347 17699 gene locus_tag LOCUS_13960 gene thiC 16347 17699 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_13960 17765 18955 gene locus_tag LOCUS_13970 17765 18955 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 protein_id gnl|my_center|LOCUS_13970 19243 18986 gene locus_tag LOCUS_13980 19243 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 20008 19325 gene locus_tag LOCUS_13990 gene hisIE 20008 19325 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_13990 20282 20022 gene locus_tag LOCUS_14000 20282 20022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 21388 20318 gene locus_tag LOCUS_14010 21388 20318 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_14010 22354 21434 gene locus_tag LOCUS_14020 gene ilvE 22354 21434 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 protein_id gnl|my_center|LOCUS_14020 22491 23093 gene locus_tag LOCUS_14030 22491 23093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 23157 23732 gene locus_tag LOCUS_14040 gene ribA 23157 23732 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_14040 25777 23762 gene locus_tag LOCUS_14050 25777 23762 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253032.1 protein_id gnl|my_center|LOCUS_14050 25895 26494 gene locus_tag LOCUS_14060 25895 26494 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041261.1 protein_id gnl|my_center|LOCUS_14060 26577 30056 gene locus_tag LOCUS_14070 gene metH 26577 30056 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_14070 30107 30973 gene locus_tag LOCUS_14080 30107 30973 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975006.1 protein_id gnl|my_center|LOCUS_14080 31410 30970 gene locus_tag LOCUS_14090 31410 30970 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_14090 31508 32641 gene locus_tag LOCUS_14100 31508 32641 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160754.1 protein_id gnl|my_center|LOCUS_14100 33257 32661 gene locus_tag LOCUS_14110 33257 32661 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_14110 35709 33250 gene locus_tag LOCUS_14120 35709 33250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 35882 36379 gene locus_tag LOCUS_14130 35882 36379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852223.1 protein_id gnl|my_center|LOCUS_14130 37155 36388 gene locus_tag LOCUS_14140 37155 36388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 38043 37294 gene locus_tag LOCUS_14150 38043 37294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 38502 38059 gene locus_tag LOCUS_14160 38502 38059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 39021 38506 gene locus_tag LOCUS_14170 gene luxS 39021 38506 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130210.1 protein_id gnl|my_center|LOCUS_14170 39485 39090 gene locus_tag LOCUS_14180 39485 39090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 39650 41278 gene locus_tag LOCUS_14190 39650 41278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 41275 42210 gene locus_tag LOCUS_14200 41275 42210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 42755 42213 gene locus_tag LOCUS_14210 42755 42213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 43178 42822 gene locus_tag LOCUS_14220 43178 42822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 43548 44660 gene locus_tag LOCUS_14230 43548 44660 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 protein_id gnl|my_center|LOCUS_14230 44661 45398 gene locus_tag LOCUS_14240 44661 45398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531884.1 protein_id gnl|my_center|LOCUS_14240 45398 46318 gene locus_tag LOCUS_14250 45398 46318 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851168.1 protein_id gnl|my_center|LOCUS_14250 46302 46889 gene locus_tag LOCUS_14260 46302 46889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 47921 46863 gene locus_tag LOCUS_14270 47921 46863 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_14270 49012 48044 gene locus_tag LOCUS_14280 49012 48044 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238135.1 protein_id gnl|my_center|LOCUS_14280 50250 49009 gene locus_tag LOCUS_14290 50250 49009 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129867.1 protein_id gnl|my_center|LOCUS_14290 50660 50250 gene locus_tag LOCUS_14300 50660 50250 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656174.1 protein_id gnl|my_center|LOCUS_14300 51235 50672 gene locus_tag LOCUS_14310 51235 50672 CDS product pyruvate flavodoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486467.1 protein_id gnl|my_center|LOCUS_14310 52221 51565 gene locus_tag LOCUS_14320 52221 51565 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851542.1 protein_id gnl|my_center|LOCUS_14320 53747 52245 gene locus_tag LOCUS_14330 53747 52245 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_14330 54320 53931 gene locus_tag LOCUS_14340 gene rpsI 54320 53931 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851459.1 protein_id gnl|my_center|LOCUS_14340 54661 54326 gene locus_tag LOCUS_14350 54661 54326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 54609 54618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56177 54792 gene locus_tag LOCUS_14360 56177 54792 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852536.1 protein_id gnl|my_center|LOCUS_14360 56845 56171 gene locus_tag LOCUS_14370 56845 56171 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860529.1 protein_id gnl|my_center|LOCUS_14370 57287 56838 gene locus_tag LOCUS_14380 57287 56838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 57977 57309 gene locus_tag LOCUS_14390 57977 57309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 58750 57977 gene locus_tag LOCUS_14400 gene pstB 58750 57977 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_14400 59949 58762 gene locus_tag LOCUS_14410 gene pstA 59949 58762 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864528.1 protein_id gnl|my_center|LOCUS_14410 60875 59946 gene locus_tag LOCUS_14420 60875 59946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 62662 60935 gene locus_tag LOCUS_14430 62662 60935 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971176.1 protein_id gnl|my_center|LOCUS_14430 63833 62778 gene locus_tag LOCUS_14440 63833 62778 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_14440 64097 63909 gene locus_tag LOCUS_14450 64097 63909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 65185 64118 gene locus_tag LOCUS_14460 gene prfA 65185 64118 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851189.1 protein_id gnl|my_center|LOCUS_14460 65469 65209 gene locus_tag LOCUS_14470 gene rpsT 65469 65209 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851317.1 protein_id gnl|my_center|LOCUS_14470 65552 66886 gene locus_tag LOCUS_14480 gene glmM 65552 66886 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860288.1 protein_id gnl|my_center|LOCUS_14480 66883 67350 gene locus_tag LOCUS_14490 gene lspA 66883 67350 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921378.1 protein_id gnl|my_center|LOCUS_14490 67421 68701 gene locus_tag LOCUS_14500 gene leuC 67421 68701 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_14500 68701 69303 gene locus_tag LOCUS_14510 68701 69303 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867312.1 protein_id gnl|my_center|LOCUS_14510 69384 70850 gene locus_tag LOCUS_14520 69384 70850 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_14520 70860 71084 gene locus_tag LOCUS_14530 70860 71084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 71081 72271 gene locus_tag LOCUS_14540 71081 72271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 72702 72346 gene locus_tag LOCUS_14550 gene rplT 72702 72346 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_14550 73003 72806 gene locus_tag LOCUS_14560 gene rpmI 73003 72806 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125542.1 protein_id gnl|my_center|LOCUS_14560 73675 73148 gene locus_tag LOCUS_14570 gene infC 73675 73148 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 protein_id gnl|my_center|LOCUS_14570 75480 73672 gene locus_tag LOCUS_14580 gene thrS 75480 73672 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 protein_id gnl|my_center|LOCUS_14580 75590 76108 gene locus_tag LOCUS_14590 75590 76108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 77750 76131 gene locus_tag LOCUS_14600 77750 76131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 78170 77850 gene locus_tag LOCUS_14610 78170 77850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 78258 79586 gene locus_tag LOCUS_14620 78258 79586 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864240.1 protein_id gnl|my_center|LOCUS_14620 79653 80393 gene locus_tag LOCUS_14630 79653 80393 CDS product complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367168.1 protein_id gnl|my_center|LOCUS_14630 80558 80917 gene locus_tag LOCUS_14640 80558 80917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 80923 82740 gene locus_tag LOCUS_14650 80923 82740 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_14650 82809 83567 gene locus_tag LOCUS_14660 82809 83567 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656886.1 protein_id gnl|my_center|LOCUS_14660 83564 84631 gene locus_tag LOCUS_14670 gene dxr 83564 84631 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864243.1 protein_id gnl|my_center|LOCUS_14670 84621 84905 gene locus_tag LOCUS_14680 84621 84905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 84905 85330 gene locus_tag LOCUS_14690 84905 85330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 85341 85913 gene locus_tag LOCUS_14700 85341 85913 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240413.1 protein_id gnl|my_center|LOCUS_14700 85910 86911 gene locus_tag LOCUS_14710 gene tsaD 85910 86911 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864246.1 protein_id gnl|my_center|LOCUS_14710 86911 87258 gene locus_tag LOCUS_14720 86911 87258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 87277 88662 gene locus_tag LOCUS_14730 87277 88662 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678947.1 protein_id gnl|my_center|LOCUS_14730 88659 88970 gene locus_tag LOCUS_14740 88659 88970 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044286901.1 protein_id gnl|my_center|LOCUS_14740 88967 89746 gene locus_tag LOCUS_14750 88967 89746 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881431.1 protein_id gnl|my_center|LOCUS_14750 89862 89939 gene locus_tag LOCUS_t00180 89862 89939 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 89962 90038 gene locus_tag LOCUS_t00190 89962 90038 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 90052 90128 gene locus_tag LOCUS_t00200 90052 90128 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 90176 90260 gene locus_tag LOCUS_t00210 90176 90260 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 90270 90346 gene locus_tag LOCUS_t00220 90270 90346 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 90415 90491 gene locus_tag LOCUS_t00230 90415 90491 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 90496 90572 gene locus_tag LOCUS_t00240 90496 90572 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 681 499 gene locus_tag LOCUS_14760 681 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1115 2479 gene locus_tag LOCUS_14770 1115 2479 CDS product IS4-like element ISDha5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272295.1 protein_id gnl|my_center|LOCUS_14770 2457 2735 gene locus_tag LOCUS_14780 2457 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3102 3929 gene locus_tag LOCUS_14790 3102 3929 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228551.1 protein_id gnl|my_center|LOCUS_14790 3940 5076 gene locus_tag LOCUS_14800 3940 5076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 protein_id gnl|my_center|LOCUS_14800 5376 5107 gene locus_tag LOCUS_14810 5376 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 5974 5378 gene locus_tag LOCUS_14820 5974 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6202 6924 gene locus_tag LOCUS_14830 6202 6924 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_14830 6933 7538 gene locus_tag LOCUS_14840 gene cbiM 6933 7538 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_14840 7532 8017 gene locus_tag LOCUS_14850 7532 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 8014 8661 gene locus_tag LOCUS_14860 8014 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 8658 9311 gene locus_tag LOCUS_14870 8658 9311 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989290.1 protein_id gnl|my_center|LOCUS_14870 9385 9831 gene locus_tag LOCUS_14880 9385 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 9857 10672 gene locus_tag LOCUS_14890 9857 10672 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470596.1 protein_id gnl|my_center|LOCUS_14890 11826 10675 gene locus_tag LOCUS_14900 gene araJ 11826 10675 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_14900 12065 12448 gene locus_tag LOCUS_14910 gene rpsL 12065 12448 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782934.1 protein_id gnl|my_center|LOCUS_14910 12465 12932 gene locus_tag LOCUS_14920 gene rpsG 12465 12932 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779471.1 protein_id gnl|my_center|LOCUS_14920 12942 15047 gene locus_tag LOCUS_14930 gene fusA 12942 15047 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779472.1 protein_id gnl|my_center|LOCUS_14930 15189 16055 gene locus_tag LOCUS_14940 15189 16055 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 protein_id gnl|my_center|LOCUS_14940 16059 17588 gene locus_tag LOCUS_14950 16059 17588 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871805.1 protein_id gnl|my_center|LOCUS_14950 17655 20528 gene locus_tag LOCUS_14960 17655 20528 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793192.1 protein_id gnl|my_center|LOCUS_14960 20656 21945 gene locus_tag LOCUS_14970 20656 21945 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077422.1 protein_id gnl|my_center|LOCUS_14970 21959 23218 gene locus_tag LOCUS_14980 21959 23218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 23258 23752 gene locus_tag LOCUS_14990 gene purE 23258 23752 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_14990 23752 23982 gene locus_tag LOCUS_15000 23752 23982 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_15000 23983 24912 gene locus_tag LOCUS_15010 gene glyQ 23983 24912 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150920.1 protein_id gnl|my_center|LOCUS_15010 24909 25664 gene locus_tag LOCUS_15020 24909 25664 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_15020 25657 26376 gene locus_tag LOCUS_15030 25657 26376 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_15030 26378 27526 gene locus_tag LOCUS_15040 gene waaA 26378 27526 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472177.1 protein_id gnl|my_center|LOCUS_15040 27517 28272 gene locus_tag LOCUS_15050 27517 28272 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852134.1 protein_id gnl|my_center|LOCUS_15050 28427 29779 gene locus_tag LOCUS_15060 gene ffh 28427 29779 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852163.1 protein_id gnl|my_center|LOCUS_15060 29863 30090 gene locus_tag LOCUS_15070 gene rpsP 29863 30090 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216125.1 protein_id gnl|my_center|LOCUS_15070 30109 30348 gene locus_tag LOCUS_15080 30109 30348 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852144.1 protein_id gnl|my_center|LOCUS_15080 30353 30886 gene locus_tag LOCUS_15090 gene rimM 30353 30886 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852323.1 protein_id gnl|my_center|LOCUS_15090 31887 30889 gene locus_tag LOCUS_15100 31887 30889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 32273 31890 gene locus_tag LOCUS_15110 32273 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 33085 32297 gene locus_tag LOCUS_15120 gene flgG 33085 32297 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946438.1 protein_id gnl|my_center|LOCUS_15120 33250 33621 gene locus_tag LOCUS_15130 33250 33621 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_15130 33636 34598 gene locus_tag LOCUS_15140 gene cheZ 33636 34598 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191026.1 protein_id gnl|my_center|LOCUS_15140 34614 35333 gene locus_tag LOCUS_15150 34614 35333 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858501.1 protein_id gnl|my_center|LOCUS_15150 35333 35740 gene locus_tag LOCUS_15160 gene flgB 35333 35740 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965464.1 protein_id gnl|my_center|LOCUS_15160 35757 37475 gene locus_tag LOCUS_15170 gene fliF 35757 37475 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364750.1 protein_id gnl|my_center|LOCUS_15170 37486 38493 gene locus_tag LOCUS_15180 gene fliG 37486 38493 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_15180 38493 39152 gene locus_tag LOCUS_15190 38493 39152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 39228 39515 gene locus_tag LOCUS_15200 39228 39515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 39525 40205 gene locus_tag LOCUS_15210 39525 40205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 40215 41684 gene locus_tag LOCUS_15220 gene flgE 40215 41684 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_15220 41763 44819 gene locus_tag LOCUS_15230 41763 44819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 44873 45202 gene locus_tag LOCUS_15240 44873 45202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 45212 47209 gene locus_tag LOCUS_15250 gene pflB 45212 47209 CDS product motility protein PflB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858651.1 protein_id gnl|my_center|LOCUS_15250 47287 47601 gene locus_tag LOCUS_15260 47287 47601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 47611 48486 gene locus_tag LOCUS_15270 gene fliY 47611 48486 CDS product flagellar motor switch protein FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150629.1 protein_id gnl|my_center|LOCUS_15270 48490 49245 gene locus_tag LOCUS_15280 48490 49245 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_15280 49255 50034 gene locus_tag LOCUS_15290 49255 50034 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 protein_id gnl|my_center|LOCUS_15290 50034 50333 gene locus_tag LOCUS_15300 50034 50333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 50345 50722 gene locus_tag LOCUS_15310 50345 50722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 50706 51101 gene locus_tag LOCUS_15320 50706 51101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 51098 52249 gene locus_tag LOCUS_15330 51098 52249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 52252 53070 gene locus_tag LOCUS_15340 gene flhG 52252 53070 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_15340 53134 53469 gene locus_tag LOCUS_15350 53134 53469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 53480 53776 gene locus_tag LOCUS_15360 gene fliE 53480 53776 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851122.1 protein_id gnl|my_center|LOCUS_15360 53789 54253 gene locus_tag LOCUS_15370 gene flgC 53789 54253 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858484.1 protein_id gnl|my_center|LOCUS_15370 54260 56362 gene locus_tag LOCUS_15380 54260 56362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 56362 57111 gene locus_tag LOCUS_15390 56362 57111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 57127 58176 gene locus_tag LOCUS_15400 gene flhB 57127 58176 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_15400 58180 60174 gene locus_tag LOCUS_15410 58180 60174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 60174 61478 gene locus_tag LOCUS_15420 gene fliI 60174 61478 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851735.1 protein_id gnl|my_center|LOCUS_15420 61475 62806 gene locus_tag LOCUS_15430 61475 62806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 62920 64935 gene locus_tag LOCUS_15440 gene flhA 62920 64935 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852599.1 protein_id gnl|my_center|LOCUS_15440 64938 66386 gene locus_tag LOCUS_15450 64938 66386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 66395 67102 gene locus_tag LOCUS_15460 66395 67102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 67089 68795 gene locus_tag LOCUS_15470 67089 68795 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877176.1 protein_id gnl|my_center|LOCUS_15470 68782 69963 gene locus_tag LOCUS_15480 68782 69963 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858477.1 protein_id gnl|my_center|LOCUS_15480 69954 70178 gene locus_tag LOCUS_15490 69954 70178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 70189 70752 gene locus_tag LOCUS_15500 70189 70752 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132255.1 protein_id gnl|my_center|LOCUS_15500 71216 70785 gene locus_tag LOCUS_15510 gene mscL 71216 70785 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_15510 71101 71319 gene locus_tag LOCUS_15520 71101 71319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 71417 74338 gene locus_tag LOCUS_15530 71417 74338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 75187 74351 gene locus_tag LOCUS_15540 75187 74351 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 protein_id gnl|my_center|LOCUS_15540 76820 75327 gene locus_tag LOCUS_15550 76820 75327 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_15550 77989 77006 gene locus_tag LOCUS_15560 77989 77006 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_15560 79080 78022 gene locus_tag LOCUS_15570 79080 78022 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 protein_id gnl|my_center|LOCUS_15570 81610 79091 gene locus_tag LOCUS_15580 81610 79091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 82760 81630 gene locus_tag LOCUS_15590 82760 81630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 83704 83069 gene locus_tag LOCUS_15600 gene bioD 83704 83069 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545503.1 protein_id gnl|my_center|LOCUS_15600 83777 84076 gene locus_tag LOCUS_15610 gene clpS 83777 84076 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 protein_id gnl|my_center|LOCUS_15610 84079 86307 gene locus_tag LOCUS_15620 gene clpA 84079 86307 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072574.1 protein_id gnl|my_center|LOCUS_15620 86380 87018 gene locus_tag LOCUS_15630 86380 87018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence13 769 164 gene locus_tag LOCUS_15640 769 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2139 766 gene locus_tag LOCUS_15650 2139 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 4515 2200 gene locus_tag LOCUS_15660 4515 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 5932 4925 gene locus_tag LOCUS_15670 5932 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 6426 5965 gene locus_tag LOCUS_15680 6426 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 7714 6584 gene locus_tag LOCUS_15690 7714 6584 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263020.1 protein_id gnl|my_center|LOCUS_15690 9893 8385 gene locus_tag LOCUS_15700 9893 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 10371 10030 gene locus_tag LOCUS_15710 gene hypA 10371 10030 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 protein_id gnl|my_center|LOCUS_15710 11413 10415 gene locus_tag LOCUS_15720 gene hypE 11413 10415 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072154.1 protein_id gnl|my_center|LOCUS_15720 11770 11414 gene locus_tag LOCUS_15730 11770 11414 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770099.1 protein_id gnl|my_center|LOCUS_15730 12904 11780 gene locus_tag LOCUS_15740 gene hypD 12904 11780 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 protein_id gnl|my_center|LOCUS_15740 13190 12909 gene locus_tag LOCUS_15750 13190 12909 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776342.1 protein_id gnl|my_center|LOCUS_15750 14011 13190 gene locus_tag LOCUS_15760 gene hypB 14011 13190 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072157.1 protein_id gnl|my_center|LOCUS_15760 14524 14132 gene locus_tag LOCUS_15770 14524 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 14616 15260 gene locus_tag LOCUS_15780 14616 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 16722 15472 gene locus_tag LOCUS_15790 16722 15472 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558883.1 protein_id gnl|my_center|LOCUS_15790 16775 17890 gene locus_tag LOCUS_15800 16775 17890 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_15800 18674 17973 gene locus_tag LOCUS_15810 18674 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 20198 18675 gene locus_tag LOCUS_15820 20198 18675 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 protein_id gnl|my_center|LOCUS_15820 20266 20568 gene locus_tag LOCUS_15830 20266 20568 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_15830 20569 21033 gene locus_tag LOCUS_15840 20569 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 22918 21065 gene locus_tag LOCUS_15850 22918 21065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 23353 22961 gene locus_tag LOCUS_15860 23353 22961 CDS product DUF3465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044128232.1 protein_id gnl|my_center|LOCUS_15860 24831 23353 gene locus_tag LOCUS_15870 gene thiI 24831 23353 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705585.1 protein_id gnl|my_center|LOCUS_15870 24970 25161 gene locus_tag LOCUS_15880 24970 25161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 25172 25423 gene locus_tag LOCUS_15890 25172 25423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 25506 25859 gene locus_tag LOCUS_15900 25506 25859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 26222 25875 gene locus_tag LOCUS_15910 26222 25875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 27719 26265 gene locus_tag LOCUS_15920 27719 26265 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_15920 27857 28681 gene locus_tag LOCUS_15930 27857 28681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 30202 28721 gene locus_tag LOCUS_15940 30202 28721 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_15940 30592 30206 gene locus_tag LOCUS_15950 30592 30206 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933699.1 protein_id gnl|my_center|LOCUS_15950 30949 30602 gene locus_tag LOCUS_15960 30949 30602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 31790 30951 gene locus_tag LOCUS_15970 31790 30951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 31942 32337 gene locus_tag LOCUS_15980 31942 32337 CDS product DUF3010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269228.1 protein_id gnl|my_center|LOCUS_15980 34467 32371 gene locus_tag LOCUS_15990 gene fdhF 34467 32371 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_15990 34949 34533 gene locus_tag LOCUS_16000 34949 34533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 37509 35263 gene locus_tag LOCUS_16010 gene hypF 37509 35263 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_16010 38508 37627 gene locus_tag LOCUS_16020 38508 37627 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_16020 40121 38589 gene locus_tag LOCUS_16030 40121 38589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 40695 40105 gene locus_tag LOCUS_16040 gene hydD 40695 40105 CDS product hydrogenase biosynthesis protein HydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078602.1 protein_id gnl|my_center|LOCUS_16040 41485 40781 gene locus_tag LOCUS_16050 gene cybH 41485 40781 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072161.1 protein_id gnl|my_center|LOCUS_16050 43220 41478 gene locus_tag LOCUS_16060 43220 41478 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038087.1 protein_id gnl|my_center|LOCUS_16060 44455 43220 gene locus_tag LOCUS_16070 gene hyaA 44455 43220 CDS product nickel-dependent hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072163.1 protein_id gnl|my_center|LOCUS_16070 46066 44711 gene locus_tag LOCUS_16080 46066 44711 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880487.1 protein_id gnl|my_center|LOCUS_16080 46962 46069 gene locus_tag LOCUS_16090 46962 46069 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880486.1 protein_id gnl|my_center|LOCUS_16090 47437 46952 gene locus_tag LOCUS_16100 47437 46952 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880156.1 protein_id gnl|my_center|LOCUS_16100 48207 47635 gene locus_tag LOCUS_16110 48207 47635 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 protein_id gnl|my_center|LOCUS_16110 50898 48322 gene locus_tag LOCUS_16120 gene acnB 50898 48322 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932230.1 protein_id gnl|my_center|LOCUS_16120 51208 51648 gene locus_tag LOCUS_16130 51208 51648 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932147.1 protein_id gnl|my_center|LOCUS_16130 52633 51638 gene locus_tag LOCUS_16140 52633 51638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 52759 52893 gene locus_tag LOCUS_16150 52759 52893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 52932 53111 gene locus_tag LOCUS_16160 52932 53111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 53263 54993 gene locus_tag LOCUS_16170 53263 54993 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_16170 55002 56276 gene locus_tag LOCUS_16180 55002 56276 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_16180 56278 58383 gene locus_tag LOCUS_16190 gene fadJ 56278 58383 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369794.1 protein_id gnl|my_center|LOCUS_16190 58371 60731 gene locus_tag LOCUS_16200 58371 60731 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421594.1 protein_id gnl|my_center|LOCUS_16200 60728 62854 gene locus_tag LOCUS_16210 60728 62854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 62858 63682 gene locus_tag LOCUS_16220 62858 63682 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_16220 64415 63705 gene locus_tag LOCUS_16230 64415 63705 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_16230 64588 65319 gene locus_tag LOCUS_16240 64588 65319 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 protein_id gnl|my_center|LOCUS_16240 65323 65910 gene locus_tag LOCUS_16250 65323 65910 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 protein_id gnl|my_center|LOCUS_16250 65912 68398 gene locus_tag LOCUS_16260 65912 68398 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_16260 68398 68961 gene locus_tag LOCUS_16270 68398 68961 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 protein_id gnl|my_center|LOCUS_16270 69177 69812 gene locus_tag LOCUS_16280 69177 69812 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_16280 70381 69809 gene locus_tag LOCUS_16290 70381 69809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 70677 70381 gene locus_tag LOCUS_16300 70677 70381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 71862 70681 gene locus_tag LOCUS_16310 71862 70681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 72519 71872 gene locus_tag LOCUS_16320 72519 71872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 72958 72509 gene locus_tag LOCUS_16330 72958 72509 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_16330 73247 72963 gene locus_tag LOCUS_16340 73247 72963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 74243 73311 gene locus_tag LOCUS_16350 74243 73311 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888311.1 protein_id gnl|my_center|LOCUS_16350 74458 74895 gene locus_tag LOCUS_16360 gene rraA 74458 74895 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266027.1 protein_id gnl|my_center|LOCUS_16360 75051 77582 gene locus_tag LOCUS_16370 75051 77582 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087385.1 protein_id gnl|my_center|LOCUS_16370 77693 78469 gene locus_tag LOCUS_16380 77693 78469 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873837.1 protein_id gnl|my_center|LOCUS_16380 79098 78466 gene locus_tag LOCUS_16390 79098 78466 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929263.1 protein_id gnl|my_center|LOCUS_16390 79181 79468 gene locus_tag LOCUS_16400 79181 79468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 81086 79473 gene locus_tag LOCUS_16410 81086 79473 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_16410 81215 81538 gene locus_tag LOCUS_16420 81215 81538 CDS product DUF6172 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275192.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence14 1164 985 gene locus_tag LOCUS_16430 1164 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1267 1115 gene locus_tag LOCUS_16440 1267 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1429 1674 gene locus_tag LOCUS_16450 1429 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1687 2061 gene locus_tag LOCUS_16460 1687 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2458 2712 gene locus_tag LOCUS_16470 2458 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2687 2932 gene locus_tag LOCUS_16480 2687 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3045 3800 gene locus_tag LOCUS_16490 3045 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4044 4223 gene locus_tag LOCUS_16500 4044 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4216 4452 gene locus_tag LOCUS_16510 4216 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 5164 4457 gene locus_tag LOCUS_16520 5164 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5264 5836 gene locus_tag LOCUS_16530 5264 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 5855 7180 gene locus_tag LOCUS_16540 5855 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 7182 7370 gene locus_tag LOCUS_16550 7182 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 7457 7374 gene locus_tag LOCUS_t00250 7457 7374 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7944 7666 gene locus_tag LOCUS_16560 7944 7666 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859562.1 protein_id gnl|my_center|LOCUS_16560 8644 8066 gene locus_tag LOCUS_16570 8644 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 8706 9608 gene locus_tag LOCUS_16580 gene rsmH 8706 9608 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891880.1 protein_id gnl|my_center|LOCUS_16580 9601 9906 gene locus_tag LOCUS_16590 9601 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 9884 12967 gene locus_tag LOCUS_16600 9884 12967 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017033.1 protein_id gnl|my_center|LOCUS_16600 14269 12995 gene locus_tag LOCUS_16610 14269 12995 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080877.1 protein_id gnl|my_center|LOCUS_16610 14387 14785 gene locus_tag LOCUS_16620 14387 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 15092 14817 gene locus_tag LOCUS_16630 15092 14817 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939104.1 protein_id gnl|my_center|LOCUS_16630 16778 15207 gene locus_tag LOCUS_16640 16778 15207 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 protein_id gnl|my_center|LOCUS_16640 17975 16791 gene locus_tag LOCUS_16650 17975 16791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 19336 17972 gene locus_tag LOCUS_16660 19336 17972 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583700.1 protein_id gnl|my_center|LOCUS_16660 19740 19333 gene locus_tag LOCUS_16670 gene glmS 19740 19333 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902997.1 protein_id gnl|my_center|LOCUS_16670 20123 19833 gene locus_tag LOCUS_16680 20123 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 21083 20136 gene locus_tag LOCUS_16690 gene mdh 21083 20136 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388965.1 protein_id gnl|my_center|LOCUS_16690 23375 21183 gene locus_tag LOCUS_16700 23375 21183 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142855.1 protein_id gnl|my_center|LOCUS_16700 24406 23501 gene locus_tag LOCUS_16710 gene mltG 24406 23501 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859067.1 protein_id gnl|my_center|LOCUS_16710 24678 27488 gene locus_tag LOCUS_16720 24678 27488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 28698 27493 gene locus_tag LOCUS_16730 28698 27493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 protein_id gnl|my_center|LOCUS_16730 31318 28700 gene locus_tag LOCUS_16740 gene secA 31318 28700 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858134.1 protein_id gnl|my_center|LOCUS_16740 31375 31902 gene locus_tag LOCUS_16750 31375 31902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 32401 33360 gene locus_tag LOCUS_16760 32401 33360 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668256.1 protein_id gnl|my_center|LOCUS_16760 33364 36060 gene locus_tag LOCUS_16770 33364 36060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 35478 35577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36310 37701 gene locus_tag LOCUS_16780 36310 37701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 37712 38929 gene locus_tag LOCUS_16790 37712 38929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 39101 41074 gene locus_tag LOCUS_16800 39101 41074 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893345.1 protein_id gnl|my_center|LOCUS_16800 42450 41272 gene locus_tag LOCUS_16810 42450 41272 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_16810 43130 42453 gene locus_tag LOCUS_16820 43130 42453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 45135 43228 gene locus_tag LOCUS_16830 45135 43228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 45265 46353 gene locus_tag LOCUS_16840 45265 46353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 47012 46839 gene locus_tag LOCUS_16850 47012 46839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 47886 47092 gene locus_tag LOCUS_16860 47886 47092 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 protein_id gnl|my_center|LOCUS_16860 48494 47886 gene locus_tag LOCUS_16870 48494 47886 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_16870 48554 49234 gene locus_tag LOCUS_16880 gene pgeF 48554 49234 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224821.1 protein_id gnl|my_center|LOCUS_16880 49420 50679 gene locus_tag LOCUS_16890 49420 50679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 50759 51592 gene locus_tag LOCUS_16900 gene purU 50759 51592 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020112.1 protein_id gnl|my_center|LOCUS_16900 51592 52056 gene locus_tag LOCUS_16910 51592 52056 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_16910 52276 52049 gene locus_tag LOCUS_16920 52276 52049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 54033 52273 gene locus_tag LOCUS_16930 54033 52273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 56148 54037 gene locus_tag LOCUS_16940 56148 54037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 56251 56913 gene locus_tag LOCUS_16950 gene dccR 56251 56913 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_16950 56903 57754 gene locus_tag LOCUS_16960 56903 57754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 57821 58750 gene locus_tag LOCUS_16970 57821 58750 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263064.1 protein_id gnl|my_center|LOCUS_16970 58743 59168 gene locus_tag LOCUS_16980 58743 59168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 59642 59199 gene locus_tag LOCUS_16990 59642 59199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 60887 59754 gene locus_tag LOCUS_17000 gene cydB 60887 59754 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851984.1 protein_id gnl|my_center|LOCUS_17000 62415 60889 gene locus_tag LOCUS_17010 62415 60889 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_17010 62639 62427 gene locus_tag LOCUS_17020 62639 62427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 62744 63334 gene locus_tag LOCUS_17030 62744 63334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 63795 63367 gene locus_tag LOCUS_17040 63795 63367 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932687.1 protein_id gnl|my_center|LOCUS_17040 65067 63907 gene locus_tag LOCUS_17050 65067 63907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256189.1 protein_id gnl|my_center|LOCUS_17050 65209 66060 gene locus_tag LOCUS_17060 65209 66060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 66164 66871 gene locus_tag LOCUS_17070 66164 66871 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 protein_id gnl|my_center|LOCUS_17070 67032 69116 gene locus_tag LOCUS_17080 67032 69116 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_17080 69364 69173 gene locus_tag LOCUS_17090 69364 69173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 69336 69788 gene locus_tag LOCUS_17100 69336 69788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 69798 72098 gene locus_tag LOCUS_17110 69798 72098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 72091 73071 gene locus_tag LOCUS_17120 72091 73071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 73068 74345 gene locus_tag LOCUS_17130 73068 74345 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869008.1 protein_id gnl|my_center|LOCUS_17130 74342 75148 gene locus_tag LOCUS_17140 gene hadI 74342 75148 CDS product 2-hydroxyisocaproyl-CoA dehydratase activator HadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888223.1 protein_id gnl|my_center|LOCUS_17140 75200 75625 gene locus_tag LOCUS_17150 gene exbB 75200 75625 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661840.1 protein_id gnl|my_center|LOCUS_17150 75606 75983 gene locus_tag LOCUS_17160 75606 75983 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881197.1 protein_id gnl|my_center|LOCUS_17160 75980 76756 gene locus_tag LOCUS_17170 75980 76756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 76804 77922 gene locus_tag LOCUS_17180 76804 77922 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870840.1 protein_id gnl|my_center|LOCUS_17180 77909 80278 gene locus_tag LOCUS_17190 77909 80278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 80434 80805 gene locus_tag LOCUS_17200 80434 80805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence15 383 1429 gene locus_tag LOCUS_17210 gene tsf 383 1429 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864836.1 protein_id gnl|my_center|LOCUS_17210 1478 2161 gene locus_tag LOCUS_17220 1478 2161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891917.1 protein_id gnl|my_center|LOCUS_17220 2158 2973 gene locus_tag LOCUS_17230 2158 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2977 3600 gene locus_tag LOCUS_17240 gene gmk 2977 3600 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860253.1 protein_id gnl|my_center|LOCUS_17240 5232 3610 gene locus_tag LOCUS_17250 5232 3610 CDS product REC domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348938.1 protein_id gnl|my_center|LOCUS_17250 5467 7779 gene locus_tag LOCUS_17260 5467 7779 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891913.1 protein_id gnl|my_center|LOCUS_17260 7789 8040 gene locus_tag LOCUS_17270 7789 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 8344 8054 gene locus_tag LOCUS_17280 8344 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 8625 9146 gene locus_tag LOCUS_17290 8625 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 9133 10071 gene locus_tag LOCUS_17300 gene hemH 9133 10071 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364269.1 protein_id gnl|my_center|LOCUS_17300 10081 10626 gene locus_tag LOCUS_17310 10081 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 10623 11609 gene locus_tag LOCUS_17320 gene amrS 10623 11609 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_17320 11606 12397 gene locus_tag LOCUS_17330 11606 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 12398 13141 gene locus_tag LOCUS_17340 gene elyC 12398 13141 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457224.1 protein_id gnl|my_center|LOCUS_17340 13199 13939 gene locus_tag LOCUS_17350 13199 13939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891839.1 protein_id gnl|my_center|LOCUS_17350 13949 14749 gene locus_tag LOCUS_17360 13949 14749 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891838.1 protein_id gnl|my_center|LOCUS_17360 14773 15597 gene locus_tag LOCUS_17370 14773 15597 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740539.1 protein_id gnl|my_center|LOCUS_17370 15702 16238 gene locus_tag LOCUS_17380 gene tpx 15702 16238 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852593.1 protein_id gnl|my_center|LOCUS_17380 16365 17099 gene locus_tag LOCUS_17390 16365 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 17169 18362 gene locus_tag LOCUS_17400 17169 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 18432 19391 gene locus_tag LOCUS_17410 gene msrP 18432 19391 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858649.1 protein_id gnl|my_center|LOCUS_17410 19391 19948 gene locus_tag LOCUS_17420 19391 19948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 21047 20001 gene locus_tag LOCUS_17430 21047 20001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 21334 21044 gene locus_tag LOCUS_17440 21334 21044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 22778 21432 gene locus_tag LOCUS_17450 22778 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 23143 22886 gene locus_tag LOCUS_17460 23143 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 24383 23283 gene locus_tag LOCUS_17470 24383 23283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 24578 25744 gene locus_tag LOCUS_17480 24578 25744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 26824 25970 gene locus_tag LOCUS_17490 26824 25970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 27526 29586 gene locus_tag LOCUS_17500 27526 29586 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852419.1 protein_id gnl|my_center|LOCUS_17500 29625 30791 gene locus_tag LOCUS_17510 29625 30791 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542869.1 protein_id gnl|my_center|LOCUS_17510 31027 32361 gene locus_tag LOCUS_17520 gene soxC 31027 32361 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_17520 32330 33514 gene locus_tag LOCUS_17530 32330 33514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 33529 33882 gene locus_tag LOCUS_17540 gene soxX 33529 33882 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 protein_id gnl|my_center|LOCUS_17540 33899 34351 gene locus_tag LOCUS_17550 gene soxY 33899 34351 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_17550 34416 34721 gene locus_tag LOCUS_17560 gene soxZ 34416 34721 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_17560 34756 35670 gene locus_tag LOCUS_17570 34756 35670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 35684 36106 gene locus_tag LOCUS_17580 35684 36106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 36268 38034 gene locus_tag LOCUS_17590 gene soxB 36268 38034 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_17590 38126 38923 gene locus_tag LOCUS_17600 38126 38923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 38924 39370 gene locus_tag LOCUS_17610 38924 39370 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228600.1 protein_id gnl|my_center|LOCUS_17610 39373 39813 gene locus_tag LOCUS_17620 39373 39813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 40028 40819 gene locus_tag LOCUS_17630 40028 40819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 41566 40832 gene locus_tag LOCUS_17640 gene kdgR 41566 40832 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705934.1 protein_id gnl|my_center|LOCUS_17640 42137 41571 gene locus_tag LOCUS_17650 42137 41571 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393578.1 protein_id gnl|my_center|LOCUS_17650 43175 42258 gene locus_tag LOCUS_17660 43175 42258 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881170.1 protein_id gnl|my_center|LOCUS_17660 43269 44321 gene locus_tag LOCUS_17670 43269 44321 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048260.1 protein_id gnl|my_center|LOCUS_17670 45020 44346 gene locus_tag LOCUS_17680 45020 44346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 45165 47852 gene locus_tag LOCUS_17690 45165 47852 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864150.1 protein_id gnl|my_center|LOCUS_17690 47927 48124 gene locus_tag LOCUS_17700 47927 48124 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_17700 48578 48156 gene locus_tag LOCUS_17710 48578 48156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 48687 49448 gene locus_tag LOCUS_17720 48687 49448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 49662 49537 gene locus_tag LOCUS_17730 49662 49537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 50130 49897 gene locus_tag LOCUS_17740 50130 49897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 50599 50805 gene locus_tag LOCUS_17750 50599 50805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 50828 50971 gene locus_tag LOCUS_17760 50828 50971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 50968 53328 gene locus_tag LOCUS_17770 50968 53328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 53328 55100 gene locus_tag LOCUS_17780 53328 55100 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787447.1 protein_id gnl|my_center|LOCUS_17780 55078 55896 gene locus_tag LOCUS_17790 55078 55896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 55907 56074 gene locus_tag LOCUS_17800 55907 56074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 56056 56301 gene locus_tag LOCUS_17810 56056 56301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_17810 56303 56569 gene locus_tag LOCUS_17820 56303 56569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 56573 57685 gene locus_tag LOCUS_17830 56573 57685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016095.1 protein_id gnl|my_center|LOCUS_17830 59940 57712 gene locus_tag LOCUS_17840 59940 57712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 60596 59955 gene locus_tag LOCUS_17850 60596 59955 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 protein_id gnl|my_center|LOCUS_17850 61964 60654 gene locus_tag LOCUS_17860 61964 60654 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_17860 62041 62640 gene locus_tag LOCUS_17870 gene rdgB 62041 62640 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_17870 62956 62630 gene locus_tag LOCUS_17880 62956 62630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 63294 62953 gene locus_tag LOCUS_17890 63294 62953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 63571 63284 gene locus_tag LOCUS_17900 63571 63284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 64322 63558 gene locus_tag LOCUS_17910 gene proC 64322 63558 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888161.1 protein_id gnl|my_center|LOCUS_17910 64418 65071 gene locus_tag LOCUS_17920 64418 65071 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237316.1 protein_id gnl|my_center|LOCUS_17920 65113 67533 gene locus_tag LOCUS_17930 gene lon 65113 67533 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868636.1 protein_id gnl|my_center|LOCUS_17930 67535 68122 gene locus_tag LOCUS_17940 67535 68122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 68106 68645 gene locus_tag LOCUS_17950 68106 68645 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853058.1 protein_id gnl|my_center|LOCUS_17950 68862 69074 gene locus_tag LOCUS_17960 68862 69074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 69087 69536 gene locus_tag LOCUS_17970 69087 69536 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250917.1 protein_id gnl|my_center|LOCUS_17970 69793 69548 gene locus_tag LOCUS_17980 69793 69548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 69931 70314 gene locus_tag LOCUS_17990 69931 70314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 70325 71617 gene locus_tag LOCUS_18000 70325 71617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 71620 72876 gene locus_tag LOCUS_18010 71620 72876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 72998 74821 gene locus_tag LOCUS_18020 72998 74821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence16 320 1273 gene locus_tag LOCUS_18030 320 1273 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_18030 1277 2110 gene locus_tag LOCUS_18040 1277 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2107 2502 gene locus_tag LOCUS_18050 2107 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2495 3397 gene locus_tag LOCUS_18060 2495 3397 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043308.1 protein_id gnl|my_center|LOCUS_18060 4790 3504 gene locus_tag LOCUS_18070 4790 3504 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 protein_id gnl|my_center|LOCUS_18070 5364 4771 gene locus_tag LOCUS_18080 5364 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168588.1 protein_id gnl|my_center|LOCUS_18080 5645 5367 gene locus_tag LOCUS_18090 5645 5367 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858971.1 protein_id gnl|my_center|LOCUS_18090 8586 5770 gene locus_tag LOCUS_18100 gene ileS 8586 5770 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907389.1 protein_id gnl|my_center|LOCUS_18100 8720 10078 gene locus_tag LOCUS_18110 8720 10078 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854402.1 protein_id gnl|my_center|LOCUS_18110 10195 10701 gene locus_tag LOCUS_18120 gene pncC 10195 10701 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478554.1 protein_id gnl|my_center|LOCUS_18120 10766 10841 gene locus_tag LOCUS_t00260 10766 10841 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10889 10988 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11037 11112 gene locus_tag LOCUS_t00270 11037 11112 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11177 11253 gene locus_tag LOCUS_t00280 11177 11253 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11274 11349 gene locus_tag LOCUS_t00290 11274 11349 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11373 11447 gene locus_tag LOCUS_t00300 11373 11447 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11467 11542 gene locus_tag LOCUS_t00310 11467 11542 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11564 11640 gene locus_tag LOCUS_t00320 11564 11640 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11726 13309 gene locus_tag LOCUS_18130 11726 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 13320 13952 gene locus_tag LOCUS_18140 gene dccR 13320 13952 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_18140 14107 14361 gene locus_tag LOCUS_18150 14107 14361 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 protein_id gnl|my_center|LOCUS_18150 14373 16268 gene locus_tag LOCUS_18160 14373 16268 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_18160 16365 18185 gene locus_tag LOCUS_18170 16365 18185 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086890.1 protein_id gnl|my_center|LOCUS_18170 18185 18817 gene locus_tag LOCUS_18180 18185 18817 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388391.1 protein_id gnl|my_center|LOCUS_18180 18997 19314 gene locus_tag LOCUS_18190 18997 19314 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_18190 19314 20972 gene locus_tag LOCUS_18200 19314 20972 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 protein_id gnl|my_center|LOCUS_18200 21240 21554 gene locus_tag LOCUS_18210 21240 21554 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_18210 21554 23203 gene locus_tag LOCUS_18220 21554 23203 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_18220 23300 25141 gene locus_tag LOCUS_18230 23300 25141 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086890.1 protein_id gnl|my_center|LOCUS_18230 25134 25748 gene locus_tag LOCUS_18240 25134 25748 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086891.1 protein_id gnl|my_center|LOCUS_18240 25772 26962 gene locus_tag LOCUS_18250 25772 26962 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016959.1 protein_id gnl|my_center|LOCUS_18250 27149 28336 gene locus_tag LOCUS_18260 27149 28336 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_18260 28622 29617 gene locus_tag LOCUS_18270 gene pta 28622 29617 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 protein_id gnl|my_center|LOCUS_18270 29645 30847 gene locus_tag LOCUS_18280 29645 30847 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016959.1 protein_id gnl|my_center|LOCUS_18280 31796 30912 gene locus_tag LOCUS_18290 gene sppA 31796 30912 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851869.1 protein_id gnl|my_center|LOCUS_18290 33012 31789 gene locus_tag LOCUS_18300 33012 31789 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_18300 33495 33025 gene locus_tag LOCUS_18310 gene aroQ 33495 33025 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_18310 33572 34597 gene locus_tag LOCUS_18320 33572 34597 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677174.1 protein_id gnl|my_center|LOCUS_18320 34672 35157 gene locus_tag LOCUS_18330 gene folK 34672 35157 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851803.1 protein_id gnl|my_center|LOCUS_18330 35204 36307 gene locus_tag LOCUS_18340 gene mnmA 35204 36307 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_18340 36319 37356 gene locus_tag LOCUS_18350 gene mnmA 36319 37356 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851977.1 protein_id gnl|my_center|LOCUS_18350 38530 37406 gene locus_tag LOCUS_18360 38530 37406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 38865 39797 gene locus_tag LOCUS_18370 38865 39797 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853293.1 protein_id gnl|my_center|LOCUS_18370 39857 40873 gene locus_tag LOCUS_18380 gene cadF 39857 40873 CDS product fibronectin-binding outer membrane protein CadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851185.1 protein_id gnl|my_center|LOCUS_18380 41012 42067 gene locus_tag LOCUS_18390 gene oprF 41012 42067 CDS product outer membrane porin OprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087843.1 protein_id gnl|my_center|LOCUS_18390 42198 43985 gene locus_tag LOCUS_18400 gene lepA 42198 43985 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002837927.1 protein_id gnl|my_center|LOCUS_18400 44032 44604 gene locus_tag LOCUS_18410 44032 44604 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 protein_id gnl|my_center|LOCUS_18410 44648 45256 gene locus_tag LOCUS_18420 gene hisH 44648 45256 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_18420 45273 46124 gene locus_tag LOCUS_18430 45273 46124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 46136 46843 gene locus_tag LOCUS_18440 gene hisA 46136 46843 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337342.1 protein_id gnl|my_center|LOCUS_18440 46926 48770 gene locus_tag LOCUS_18450 46926 48770 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880333.1 protein_id gnl|my_center|LOCUS_18450 51751 48797 gene locus_tag LOCUS_18460 gene mutS 51751 48797 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494923.1 protein_id gnl|my_center|LOCUS_18460 52170 51748 gene locus_tag LOCUS_18470 52170 51748 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_18470 52502 52173 gene locus_tag LOCUS_18480 52502 52173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 52708 52499 gene locus_tag LOCUS_18490 52708 52499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 52904 52671 gene locus_tag LOCUS_18500 52904 52671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 54511 52958 gene locus_tag LOCUS_18510 54511 52958 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_18510 56915 54936 gene locus_tag LOCUS_18520 gene ftsH 56915 54936 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852796.1 protein_id gnl|my_center|LOCUS_18520 57736 56918 gene locus_tag LOCUS_18530 57736 56918 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852657.1 protein_id gnl|my_center|LOCUS_18530 58729 57830 gene locus_tag LOCUS_18540 58729 57830 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346174.1 protein_id gnl|my_center|LOCUS_18540 59775 58762 gene locus_tag LOCUS_18550 59775 58762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 60291 59836 gene locus_tag LOCUS_18560 60291 59836 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869860.1 protein_id gnl|my_center|LOCUS_18560 60892 60281 gene locus_tag LOCUS_18570 gene thiE 60892 60281 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_18570 61762 60896 gene locus_tag LOCUS_18580 gene accD 61762 60896 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 protein_id gnl|my_center|LOCUS_18580 62989 61775 gene locus_tag LOCUS_18590 gene metK 62989 61775 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852836.1 protein_id gnl|my_center|LOCUS_18590 63393 63163 gene locus_tag LOCUS_18600 63393 63163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 65143 63371 gene locus_tag LOCUS_18610 65143 63371 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_18610 66950 65148 gene locus_tag LOCUS_18620 gene glmS 66950 65148 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858421.1 protein_id gnl|my_center|LOCUS_18620 67808 67035 gene locus_tag LOCUS_18630 67808 67035 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_18630 70496 67848 gene locus_tag LOCUS_18640 70496 67848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 70718 70987 gene locus_tag LOCUS_18650 70718 70987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence17 1663 146 gene locus_tag LOCUS_18660 gene lysS 1663 146 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858694.1 protein_id gnl|my_center|LOCUS_18660 2410 1676 gene locus_tag LOCUS_18670 2410 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4542 2467 gene locus_tag LOCUS_18680 4542 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4656 5717 gene locus_tag LOCUS_18690 gene ispG 4656 5717 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852250.1 protein_id gnl|my_center|LOCUS_18690 5717 7159 gene locus_tag LOCUS_18700 5717 7159 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858532.1 protein_id gnl|my_center|LOCUS_18700 7256 8500 gene locus_tag LOCUS_18710 7256 8500 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795347.1 protein_id gnl|my_center|LOCUS_18710 8568 8966 gene locus_tag LOCUS_18720 8568 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 9774 8971 gene locus_tag LOCUS_18730 9774 8971 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908473.1 protein_id gnl|my_center|LOCUS_18730 9910 10467 gene locus_tag LOCUS_18740 gene apt 9910 10467 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853297.1 protein_id gnl|my_center|LOCUS_18740 10484 11692 gene locus_tag LOCUS_18750 gene trpB 10484 11692 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082734.1 protein_id gnl|my_center|LOCUS_18750 11704 12405 gene locus_tag LOCUS_18760 11704 12405 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853249.1 protein_id gnl|my_center|LOCUS_18760 12395 13813 gene locus_tag LOCUS_18770 12395 13813 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853317.1 protein_id gnl|my_center|LOCUS_18770 14567 13839 gene locus_tag LOCUS_18780 14567 13839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 14941 14564 gene locus_tag LOCUS_18790 gene exbD 14941 14564 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851470.1 protein_id gnl|my_center|LOCUS_18790 15356 14922 gene locus_tag LOCUS_18800 gene exbB 15356 14922 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661840.1 protein_id gnl|my_center|LOCUS_18800 15504 16694 gene locus_tag LOCUS_18810 15504 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 16704 17975 gene locus_tag LOCUS_18820 16704 17975 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971885.1 protein_id gnl|my_center|LOCUS_18820 17965 18669 gene locus_tag LOCUS_18830 17965 18669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531071.1 protein_id gnl|my_center|LOCUS_18830 18669 19880 gene locus_tag LOCUS_18840 18669 19880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_18840 20169 19930 gene locus_tag LOCUS_18850 20169 19930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 22461 20353 gene locus_tag LOCUS_18860 22461 20353 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 protein_id gnl|my_center|LOCUS_18860 22811 22464 gene locus_tag LOCUS_18870 22811 22464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 23166 22804 gene locus_tag LOCUS_18880 23166 22804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 23363 23163 gene locus_tag LOCUS_18890 23363 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 24050 23367 gene locus_tag LOCUS_18900 24050 23367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 24364 24050 gene locus_tag LOCUS_18910 24364 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 24895 24446 gene locus_tag LOCUS_18920 24895 24446 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_18920 25044 24895 gene locus_tag LOCUS_18930 25044 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 25172 25564 gene locus_tag LOCUS_18940 25172 25564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 25678 25863 gene locus_tag LOCUS_18950 25678 25863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 27574 25880 gene locus_tag LOCUS_18960 27574 25880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 27644 28330 gene locus_tag LOCUS_18970 27644 28330 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_18970 28588 30708 gene locus_tag LOCUS_18980 28588 30708 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206936.1 protein_id gnl|my_center|LOCUS_18980 30742 31047 gene locus_tag LOCUS_18990 30742 31047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 31057 32610 gene locus_tag LOCUS_19000 31057 32610 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070804.1 protein_id gnl|my_center|LOCUS_19000 32625 33104 gene locus_tag LOCUS_19010 32625 33104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 33225 33359 gene locus_tag LOCUS_19020 33225 33359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 33452 35680 gene locus_tag LOCUS_19030 gene iha 33452 35680 CDS product bifunctional siderophore receptor/adhesin Iha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223350.1 protein_id gnl|my_center|LOCUS_19030 35828 36493 gene locus_tag LOCUS_19040 35828 36493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035508.1 protein_id gnl|my_center|LOCUS_19040 36504 37784 gene locus_tag LOCUS_19050 36504 37784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 38062 39687 gene locus_tag LOCUS_19060 gene ade 38062 39687 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_19060 40148 39981 gene locus_tag LOCUS_19070 40148 39981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 40295 41398 gene locus_tag LOCUS_19080 gene ychF 40295 41398 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 protein_id gnl|my_center|LOCUS_19080 41470 42294 gene locus_tag LOCUS_19090 41470 42294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 42910 42296 gene locus_tag LOCUS_19100 gene recO 42910 42296 CDS product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 protein_id gnl|my_center|LOCUS_19100 43182 42919 gene locus_tag LOCUS_19110 43182 42919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 43299 43613 gene locus_tag LOCUS_19120 43299 43613 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_19120 44762 43665 gene locus_tag LOCUS_19130 44762 43665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 46205 44826 gene locus_tag LOCUS_19140 46205 44826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 46738 46352 gene locus_tag LOCUS_19150 46738 46352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 46882 47703 gene locus_tag LOCUS_19160 46882 47703 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130232873.1 protein_id gnl|my_center|LOCUS_19160 47725 48789 gene locus_tag LOCUS_19170 gene truD 47725 48789 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052415.1 protein_id gnl|my_center|LOCUS_19170 48866 49219 gene locus_tag LOCUS_19180 48866 49219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 50698 49247 gene locus_tag LOCUS_19190 50698 49247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 50760 50930 gene locus_tag LOCUS_19200 50760 50930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence18 193 630 gene locus_tag LOCUS_19210 193 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 652 1029 gene locus_tag LOCUS_19220 652 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1035 1583 gene locus_tag LOCUS_19230 1035 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 1617 3089 gene locus_tag LOCUS_19240 1617 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3106 4638 gene locus_tag LOCUS_19250 3106 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4635 5462 gene locus_tag LOCUS_19260 4635 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 6748 5480 gene locus_tag LOCUS_19270 6748 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7511 6765 gene locus_tag LOCUS_19280 7511 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 9723 7552 gene locus_tag LOCUS_19290 9723 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 10658 9720 gene locus_tag LOCUS_19300 10658 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_19300 12271 10655 gene locus_tag LOCUS_19310 12271 10655 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317502.1 protein_id gnl|my_center|LOCUS_19310 13131 12310 gene locus_tag LOCUS_19320 gene cheP 13131 12310 CDS product cheVAW transcriptional regulator CheP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851703.1 protein_id gnl|my_center|LOCUS_19320 15034 13205 gene locus_tag LOCUS_19330 gene selB 15034 13205 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857930.1 protein_id gnl|my_center|LOCUS_19330 16389 15034 gene locus_tag LOCUS_19340 gene selA 16389 15034 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_19340 16447 16541 gene locus_tag LOCUS_t00330 16447 16541 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 16818 17276 gene locus_tag LOCUS_19350 16818 17276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 18281 17301 gene locus_tag LOCUS_19360 gene selD 18281 17301 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077699367.1 protein_id gnl|my_center|LOCUS_19360 18574 19668 gene locus_tag LOCUS_19370 18574 19668 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 protein_id gnl|my_center|LOCUS_19370 19665 19991 gene locus_tag LOCUS_19380 19665 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 19995 20273 gene locus_tag LOCUS_19390 19995 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 21141 20266 gene locus_tag LOCUS_19400 21141 20266 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_19400 21813 21151 gene locus_tag LOCUS_19410 21813 21151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 23392 21803 gene locus_tag LOCUS_19420 23392 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 24536 23382 gene locus_tag LOCUS_19430 24536 23382 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842634.1 protein_id gnl|my_center|LOCUS_19430 24679 26346 gene locus_tag LOCUS_19440 24679 26346 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857979.1 protein_id gnl|my_center|LOCUS_19440 26339 26950 gene locus_tag LOCUS_19450 26339 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 27029 27253 gene locus_tag LOCUS_19460 27029 27253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 27277 30078 gene locus_tag LOCUS_19470 27277 30078 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891941.1 transl_except (pos:27820..27822,aa:Sec) note codon on position 182 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_19470 30089 30682 gene locus_tag LOCUS_19480 gene fdh3B 30089 30682 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851264.1 protein_id gnl|my_center|LOCUS_19480 30691 31644 gene locus_tag LOCUS_19490 30691 31644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 31646 32476 gene locus_tag LOCUS_19500 gene fdhD 31646 32476 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851178.1 protein_id gnl|my_center|LOCUS_19500 32469 32891 gene locus_tag LOCUS_19510 32469 32891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 32884 33864 gene locus_tag LOCUS_19520 32884 33864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 35324 34041 gene locus_tag LOCUS_19530 35324 34041 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_19530 35633 35337 gene locus_tag LOCUS_19540 35633 35337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 35763 37034 gene locus_tag LOCUS_19550 35763 37034 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987090.1 protein_id gnl|my_center|LOCUS_19550 37092 37397 gene locus_tag LOCUS_19560 37092 37397 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323755.1 protein_id gnl|my_center|LOCUS_19560 38385 37417 gene locus_tag LOCUS_19570 38385 37417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 39264 38449 gene locus_tag LOCUS_19580 39264 38449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 39238 39378 gene locus_tag LOCUS_19590 39238 39378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 39489 41726 gene locus_tag LOCUS_19600 39489 41726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 41916 42059 gene locus_tag LOCUS_19610 41916 42059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 42316 42086 gene locus_tag LOCUS_19620 42316 42086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 42694 42317 gene locus_tag LOCUS_19630 42694 42317 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930621.1 protein_id gnl|my_center|LOCUS_19630 44356 42731 gene locus_tag LOCUS_19640 44356 42731 CDS product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650259.1 protein_id gnl|my_center|LOCUS_19640 44607 45950 gene locus_tag LOCUS_19650 gene rhlE 44607 45950 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_19650 46021 46173 gene locus_tag LOCUS_19660 46021 46173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 46224 46421 gene locus_tag LOCUS_19670 46224 46421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 46418 47296 gene locus_tag LOCUS_19680 46418 47296 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 protein_id gnl|my_center|LOCUS_19680 47373 48068 gene locus_tag LOCUS_19690 47373 48068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 48077 49249 gene locus_tag LOCUS_19700 48077 49249 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_19700 50091 49261 gene locus_tag LOCUS_19710 50091 49261 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence19 150 1160 gene locus_tag LOCUS_19720 150 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1173 2582 gene locus_tag LOCUS_19730 gene trpE 1173 2582 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_19730 2643 3428 gene locus_tag LOCUS_19740 2643 3428 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_19740 3421 4359 gene locus_tag LOCUS_19750 gene pdxA 3421 4359 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853162.1 protein_id gnl|my_center|LOCUS_19750 4356 5423 gene locus_tag LOCUS_19760 4356 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 5480 6187 gene locus_tag LOCUS_19770 gene pyrH 5480 6187 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148056.1 protein_id gnl|my_center|LOCUS_19770 6207 6425 gene locus_tag LOCUS_19780 6207 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 6464 8608 gene locus_tag LOCUS_19790 6464 8608 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 protein_id gnl|my_center|LOCUS_19790 8629 9837 gene locus_tag LOCUS_19800 gene tyrS 8629 9837 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_19800 9849 10928 gene locus_tag LOCUS_19810 gene fabX 9849 10928 CDS product decanoate oxidase/trans-2-decenoyl-[acyl-carrier protein] isomerase FabX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255244.1 protein_id gnl|my_center|LOCUS_19810 11090 12691 gene locus_tag LOCUS_19820 11090 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 13100 12654 gene locus_tag LOCUS_19830 13100 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 14185 13118 gene locus_tag LOCUS_19840 14185 13118 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858697.1 protein_id gnl|my_center|LOCUS_19840 14739 14188 gene locus_tag LOCUS_19850 gene pth 14739 14188 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858659.1 protein_id gnl|my_center|LOCUS_19850 15285 14749 gene locus_tag LOCUS_19860 15285 14749 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002791314.1 protein_id gnl|my_center|LOCUS_19860 15445 16305 gene locus_tag LOCUS_19870 gene folD 15445 16305 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_19870 16306 17091 gene locus_tag LOCUS_19880 gene lepB 16306 17091 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_19880 17093 17548 gene locus_tag LOCUS_19890 gene rpiB 17093 17548 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_19890 17663 18892 gene locus_tag LOCUS_19900 17663 18892 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_19900 20943 18913 gene locus_tag LOCUS_19910 20943 18913 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_19910 22599 21010 gene locus_tag LOCUS_19920 22599 21010 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389262.1 protein_id gnl|my_center|LOCUS_19920 22678 23088 gene locus_tag LOCUS_19930 22678 23088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 23743 23096 gene locus_tag LOCUS_19940 gene nth 23743 23096 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852225.1 protein_id gnl|my_center|LOCUS_19940 25534 23744 gene locus_tag LOCUS_19950 gene uvrB 25534 23744 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855027.1 protein_id gnl|my_center|LOCUS_19950 26264 25728 gene locus_tag LOCUS_19960 26264 25728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 26959 26249 gene locus_tag LOCUS_19970 26959 26249 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894935.1 protein_id gnl|my_center|LOCUS_19970 27496 27008 gene locus_tag LOCUS_19980 gene greA 27496 27008 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031337.1 protein_id gnl|my_center|LOCUS_19980 27558 28208 gene locus_tag LOCUS_19990 27558 28208 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612425.1 protein_id gnl|my_center|LOCUS_19990 28270 29178 gene locus_tag LOCUS_20000 28270 29178 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251148.1 protein_id gnl|my_center|LOCUS_20000 30608 29217 gene locus_tag LOCUS_20010 gene argH 30608 29217 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891895.1 protein_id gnl|my_center|LOCUS_20010 31935 30667 gene locus_tag LOCUS_20020 31935 30667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880562.1 protein_id gnl|my_center|LOCUS_20020 32372 31938 gene locus_tag LOCUS_20030 32372 31938 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_20030 32626 32435 gene locus_tag LOCUS_20040 32626 32435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 32711 33958 gene locus_tag LOCUS_20050 32711 33958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 34737 33970 gene locus_tag LOCUS_20060 34737 33970 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365312.1 protein_id gnl|my_center|LOCUS_20060 35444 34821 gene locus_tag LOCUS_20070 35444 34821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 37886 35508 gene locus_tag LOCUS_20080 37886 35508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 38346 37912 gene locus_tag LOCUS_20090 38346 37912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 39463 38483 gene locus_tag LOCUS_20100 39463 38483 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002840050.1 protein_id gnl|my_center|LOCUS_20100 40693 39497 gene locus_tag LOCUS_20110 40693 39497 CDS product NifS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941691.1 protein_id gnl|my_center|LOCUS_20110 41108 42544 gene locus_tag LOCUS_20120 gene sufB 41108 42544 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_20120 42548 43315 gene locus_tag LOCUS_20130 gene sufC 42548 43315 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367012.1 protein_id gnl|my_center|LOCUS_20130 43302 44333 gene locus_tag LOCUS_20140 43302 44333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 44326 45510 gene locus_tag LOCUS_20150 44326 45510 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_20150 45512 45922 gene locus_tag LOCUS_20160 45512 45922 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_20160 45934 46287 gene locus_tag LOCUS_20170 45934 46287 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence20 <1 1440 gene locus_tag LOCUS_20180 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391833.1:IS21 family transposase 1437 2276 gene locus_tag LOCUS_20190 gene istB 1437 2276 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 protein_id gnl|my_center|LOCUS_20190 2497 2333 gene locus_tag LOCUS_20200 2497 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3544 2645 gene locus_tag LOCUS_20210 3544 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3923 4192 gene locus_tag LOCUS_20220 3923 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 4487 5779 gene locus_tag LOCUS_20230 4487 5779 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505472.1 protein_id gnl|my_center|LOCUS_20230 5793 6239 gene locus_tag LOCUS_20240 5793 6239 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 protein_id gnl|my_center|LOCUS_20240 6252 6530 gene locus_tag LOCUS_20250 6252 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 6546 6929 gene locus_tag LOCUS_20260 6546 6929 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_20260 6930 7691 gene locus_tag LOCUS_20270 6930 7691 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_20270 8308 7688 gene locus_tag LOCUS_20280 gene upp 8308 7688 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941601.1 protein_id gnl|my_center|LOCUS_20280 8429 9661 gene locus_tag LOCUS_20290 8429 9661 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 protein_id gnl|my_center|LOCUS_20290 9703 10203 gene locus_tag LOCUS_20300 9703 10203 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 protein_id gnl|my_center|LOCUS_20300 10482 11060 gene locus_tag LOCUS_20310 10482 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 11123 11782 gene locus_tag LOCUS_20320 gene dccR 11123 11782 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_20320 11775 12959 gene locus_tag LOCUS_20330 gene dccS 11775 12959 CDS product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 protein_id gnl|my_center|LOCUS_20330 12974 13591 gene locus_tag LOCUS_20340 12974 13591 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119978.1 protein_id gnl|my_center|LOCUS_20340 13592 14041 gene locus_tag LOCUS_20350 13592 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 15056 14046 gene locus_tag LOCUS_20360 15056 14046 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 protein_id gnl|my_center|LOCUS_20360 15178 15819 gene locus_tag LOCUS_20370 gene rpe 15178 15819 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861474.1 protein_id gnl|my_center|LOCUS_20370 15821 16417 gene locus_tag LOCUS_20380 15821 16417 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 protein_id gnl|my_center|LOCUS_20380 16404 17222 gene locus_tag LOCUS_20390 16404 17222 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858535.1 protein_id gnl|my_center|LOCUS_20390 17227 17772 gene locus_tag LOCUS_20400 17227 17772 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258945.1 protein_id gnl|my_center|LOCUS_20400 18372 17800 gene locus_tag LOCUS_20410 18372 17800 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_20410 19216 18383 gene locus_tag LOCUS_20420 19216 18383 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854895.1 protein_id gnl|my_center|LOCUS_20420 20349 19219 gene locus_tag LOCUS_20430 20349 19219 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_20430 20682 20359 gene locus_tag LOCUS_20440 20682 20359 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851088.1 protein_id gnl|my_center|LOCUS_20440 20979 21695 gene locus_tag LOCUS_20450 20979 21695 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864161.1 protein_id gnl|my_center|LOCUS_20450 21688 22071 gene locus_tag LOCUS_20460 21688 22071 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864630.1 protein_id gnl|my_center|LOCUS_20460 22047 23363 gene locus_tag LOCUS_20470 22047 23363 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855132.1 protein_id gnl|my_center|LOCUS_20470 23360 24151 gene locus_tag LOCUS_20480 gene trpC 23360 24151 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854779.1 protein_id gnl|my_center|LOCUS_20480 24169 24384 gene locus_tag LOCUS_20490 24169 24384 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943568.1 protein_id gnl|my_center|LOCUS_20490 25088 24408 gene locus_tag LOCUS_20500 25088 24408 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888213.1 protein_id gnl|my_center|LOCUS_20500 26158 25100 gene locus_tag LOCUS_20510 gene rseP 26158 25100 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_20510 26710 26168 gene locus_tag LOCUS_20520 gene pgsA 26710 26168 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_20520 27486 26710 gene locus_tag LOCUS_20530 27486 26710 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891889.1 protein_id gnl|my_center|LOCUS_20530 28373 27486 gene locus_tag LOCUS_20540 gene dapA 28373 27486 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852574.1 protein_id gnl|my_center|LOCUS_20540 28843 28376 gene locus_tag LOCUS_20550 28843 28376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 30186 28843 gene locus_tag LOCUS_20560 30186 28843 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 protein_id gnl|my_center|LOCUS_20560 31250 30186 gene locus_tag LOCUS_20570 31250 30186 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_20570 33004 31295 gene locus_tag LOCUS_20580 33004 31295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858782.1 protein_id gnl|my_center|LOCUS_20580 34361 33060 gene locus_tag LOCUS_20590 gene murJ 34361 33060 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611242.1 protein_id gnl|my_center|LOCUS_20590 35935 34361 gene locus_tag LOCUS_20600 35935 34361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 36683 36024 gene locus_tag LOCUS_20610 36683 36024 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853081.1 protein_id gnl|my_center|LOCUS_20610 36950 37354 gene locus_tag LOCUS_20620 gene perR 36950 37354 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 protein_id gnl|my_center|LOCUS_20620 37810 37391 gene locus_tag LOCUS_20630 gene ybeY 37810 37391 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851664.1 protein_id gnl|my_center|LOCUS_20630 39205 37856 gene locus_tag LOCUS_20640 gene radA 39205 37856 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858434.1 protein_id gnl|my_center|LOCUS_20640 39303 39779 gene locus_tag LOCUS_20650 gene rnhA 39303 39779 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948171.1 protein_id gnl|my_center|LOCUS_20650 40771 39785 gene locus_tag LOCUS_20660 40771 39785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence21 301 1677 gene locus_tag LOCUS_20670 301 1677 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355104.1 protein_id gnl|my_center|LOCUS_20670 1680 2552 gene locus_tag LOCUS_20680 gene galU 1680 2552 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364457.1 protein_id gnl|my_center|LOCUS_20680 2553 3785 gene locus_tag LOCUS_20690 2553 3785 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855462.1 protein_id gnl|my_center|LOCUS_20690 3794 4282 gene locus_tag LOCUS_20700 3794 4282 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_20700 4284 5195 gene locus_tag LOCUS_20710 4284 5195 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_20710 5639 5184 gene locus_tag LOCUS_20720 5639 5184 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926982.1 protein_id gnl|my_center|LOCUS_20720 6336 5623 gene locus_tag LOCUS_20730 6336 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 6434 6682 gene locus_tag LOCUS_20740 6434 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 6682 7470 gene locus_tag LOCUS_20750 6682 7470 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851821.1 protein_id gnl|my_center|LOCUS_20750 9122 7467 gene locus_tag LOCUS_20760 9122 7467 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964136.1 protein_id gnl|my_center|LOCUS_20760 9213 9755 gene locus_tag LOCUS_20770 9213 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927105.1 protein_id gnl|my_center|LOCUS_20770 10234 9752 gene locus_tag LOCUS_20780 10234 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 10336 11568 gene locus_tag LOCUS_20790 10336 11568 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 protein_id gnl|my_center|LOCUS_20790 11565 12623 gene locus_tag LOCUS_20800 11565 12623 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263725.1 protein_id gnl|my_center|LOCUS_20800 12626 15754 gene locus_tag LOCUS_20810 12626 15754 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_20810 16053 15886 gene locus_tag LOCUS_20820 16053 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 16074 16550 gene locus_tag LOCUS_20830 16074 16550 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 protein_id gnl|my_center|LOCUS_20830 16604 17176 gene locus_tag LOCUS_20840 gene pnuC 16604 17176 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_20840 17166 17921 gene locus_tag LOCUS_20850 17166 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 18928 17894 gene locus_tag LOCUS_20860 18928 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 19101 20405 gene locus_tag LOCUS_20870 19101 20405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 21030 20389 gene locus_tag LOCUS_20880 21030 20389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 21137 22987 gene locus_tag LOCUS_20890 gene uvrC 21137 22987 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774319.1 protein_id gnl|my_center|LOCUS_20890 22990 24012 gene locus_tag LOCUS_20900 22990 24012 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852617.1 protein_id gnl|my_center|LOCUS_20900 24009 24677 gene locus_tag LOCUS_20910 24009 24677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 25437 24679 gene locus_tag LOCUS_20920 25437 24679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 26010 25441 gene locus_tag LOCUS_20930 26010 25441 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 protein_id gnl|my_center|LOCUS_20930 26140 26781 gene locus_tag LOCUS_20940 26140 26781 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 protein_id gnl|my_center|LOCUS_20940 28622 26856 gene locus_tag LOCUS_20950 28622 26856 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_20950 31279 28694 gene locus_tag LOCUS_20960 31279 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 32164 31385 gene locus_tag LOCUS_20970 32164 31385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 33955 32186 gene locus_tag LOCUS_20980 gene aspS 33955 32186 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871806.1 protein_id gnl|my_center|LOCUS_20980 35202 34000 gene locus_tag LOCUS_20990 35202 34000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 35867 35199 gene locus_tag LOCUS_21000 35867 35199 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946023.1 protein_id gnl|my_center|LOCUS_21000 35995 36207 gene locus_tag LOCUS_21010 35995 36207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 36588 36370 gene locus_tag LOCUS_21020 gene infA 36588 36370 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781436.1 protein_id gnl|my_center|LOCUS_21020 37364 36600 gene locus_tag LOCUS_21030 gene map 37364 36600 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858416.1 protein_id gnl|my_center|LOCUS_21030 <38432 37367 gene locus_tag LOCUS_21040 <38432 37367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864789.1:preprotein translocase subunit SecY >Feature sequence22 2191 404 gene locus_tag LOCUS_21050 2191 404 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_21050 3887 2286 gene locus_tag LOCUS_21060 3887 2286 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931645.1 protein_id gnl|my_center|LOCUS_21060 5193 4006 gene locus_tag LOCUS_21070 5193 4006 CDS product 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851311.1 protein_id gnl|my_center|LOCUS_21070 7099 5252 gene locus_tag LOCUS_21080 7099 5252 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852169.1 protein_id gnl|my_center|LOCUS_21080 7739 7530 gene locus_tag LOCUS_21090 7739 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 7932 7732 gene locus_tag LOCUS_21100 7932 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 8396 7983 gene locus_tag LOCUS_21110 8396 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 9783 8479 gene locus_tag LOCUS_21120 9783 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 10097 10693 gene locus_tag LOCUS_21130 10097 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 10859 11824 gene locus_tag LOCUS_21140 10859 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 14935 11939 gene locus_tag LOCUS_21150 14935 11939 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 protein_id gnl|my_center|LOCUS_21150 15593 14943 gene locus_tag LOCUS_21160 15593 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 16441 15590 gene locus_tag LOCUS_21170 16441 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 18307 16451 gene locus_tag LOCUS_21180 18307 16451 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_21180 19140 18400 gene locus_tag LOCUS_21190 19140 18400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 19975 19241 gene locus_tag LOCUS_21200 19975 19241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 23166 19975 gene locus_tag LOCUS_21210 23166 19975 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_21210 24407 23439 gene locus_tag LOCUS_21220 24407 23439 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263960.1 protein_id gnl|my_center|LOCUS_21220 25434 24487 gene locus_tag LOCUS_21230 25434 24487 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 protein_id gnl|my_center|LOCUS_21230 27512 25605 gene locus_tag LOCUS_21240 27512 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 28140 27532 gene locus_tag LOCUS_21250 28140 27532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 28786 28160 gene locus_tag LOCUS_21260 28786 28160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 29710 28859 gene locus_tag LOCUS_21270 29710 28859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 32322 29719 gene locus_tag LOCUS_21280 32322 29719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 35489 32343 gene locus_tag LOCUS_21290 35489 32343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence23 1094 111 gene locus_tag LOCUS_21300 1094 111 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_21300 2761 1097 gene locus_tag LOCUS_21310 2761 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2882 2956 gene locus_tag LOCUS_t00340 2882 2956 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2982 3066 gene locus_tag LOCUS_t00350 2982 3066 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3091 3166 gene locus_tag LOCUS_t00360 3091 3166 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3192 3278 gene locus_tag LOCUS_t00370 3192 3278 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3697 3368 gene locus_tag LOCUS_21320 3697 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5584 3773 gene locus_tag LOCUS_21330 5584 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 5735 6244 gene locus_tag LOCUS_21340 5735 6244 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124198.1 protein_id gnl|my_center|LOCUS_21340 7941 6253 gene locus_tag LOCUS_21350 7941 6253 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893345.1 protein_id gnl|my_center|LOCUS_21350 8073 9452 gene locus_tag LOCUS_21360 8073 9452 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358083.1 protein_id gnl|my_center|LOCUS_21360 9686 9459 gene locus_tag LOCUS_21370 9686 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 9862 11358 gene locus_tag LOCUS_21380 9862 11358 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762485.1 protein_id gnl|my_center|LOCUS_21380 11410 12048 gene locus_tag LOCUS_21390 gene pdxH 11410 12048 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072804.1 protein_id gnl|my_center|LOCUS_21390 12126 12509 gene locus_tag LOCUS_21400 12126 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 12776 12495 gene locus_tag LOCUS_21410 12776 12495 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022320.1 protein_id gnl|my_center|LOCUS_21410 15219 12817 gene locus_tag LOCUS_21420 15219 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 16675 15308 gene locus_tag LOCUS_21430 gene dbpA 16675 15308 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263052.1 protein_id gnl|my_center|LOCUS_21430 17213 16677 gene locus_tag LOCUS_21440 17213 16677 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393406.1 protein_id gnl|my_center|LOCUS_21440 17864 17217 gene locus_tag LOCUS_21450 17864 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 18019 19047 gene locus_tag LOCUS_21460 18019 19047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21460 19062 19253 gene locus_tag LOCUS_21470 19062 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 19237 20022 gene locus_tag LOCUS_21480 19237 20022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 20926 20015 gene locus_tag LOCUS_21490 20926 20015 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261966.1 protein_id gnl|my_center|LOCUS_21490 21597 20923 gene locus_tag LOCUS_21500 gene pxpB 21597 20923 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_21500 22331 21597 gene locus_tag LOCUS_21510 22331 21597 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455327.1 protein_id gnl|my_center|LOCUS_21510 22682 22341 gene locus_tag LOCUS_21520 22682 22341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 22862 23671 gene locus_tag LOCUS_21530 22862 23671 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144308590.1 protein_id gnl|my_center|LOCUS_21530 24263 23688 gene locus_tag LOCUS_21540 24263 23688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 24845 24366 gene locus_tag LOCUS_21550 24845 24366 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974618.1 protein_id gnl|my_center|LOCUS_21550 25174 24845 gene locus_tag LOCUS_21560 25174 24845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 25475 25167 gene locus_tag LOCUS_21570 25475 25167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 26535 25510 gene locus_tag LOCUS_21580 26535 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 28610 26700 gene locus_tag LOCUS_21590 gene htpG 28610 26700 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 protein_id gnl|my_center|LOCUS_21590 29132 28719 gene locus_tag LOCUS_21600 29132 28719 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_21600 29370 29113 gene locus_tag LOCUS_21610 29370 29113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669791.1 protein_id gnl|my_center|LOCUS_21610 31912 29432 gene locus_tag LOCUS_21620 31912 29432 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_21620 33414 31912 gene locus_tag LOCUS_21630 33414 31912 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_21630 33991 33404 gene locus_tag LOCUS_21640 33991 33404 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_21640 34148 34336 gene locus_tag LOCUS_21650 34148 34336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence24 691 182 gene locus_tag LOCUS_21660 691 182 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869004.1 protein_id gnl|my_center|LOCUS_21660 2469 700 gene locus_tag LOCUS_21670 2469 700 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858598.1 protein_id gnl|my_center|LOCUS_21670 2792 3832 gene locus_tag LOCUS_21680 gene ftsW 2792 3832 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858324.1 protein_id gnl|my_center|LOCUS_21680 3829 4860 gene locus_tag LOCUS_21690 gene murG 3829 4860 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_21690 5607 4840 gene locus_tag LOCUS_21700 5607 4840 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002836742.1 protein_id gnl|my_center|LOCUS_21700 6267 5608 gene locus_tag LOCUS_21710 6267 5608 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210707.1 protein_id gnl|my_center|LOCUS_21710 6339 6560 gene locus_tag LOCUS_21720 6339 6560 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_21720 6562 7017 gene locus_tag LOCUS_21730 6562 7017 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 protein_id gnl|my_center|LOCUS_21730 7043 7834 gene locus_tag LOCUS_21740 7043 7834 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_21740 7943 9370 gene locus_tag LOCUS_21750 gene glnA 7943 9370 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858636.1 protein_id gnl|my_center|LOCUS_21750 11444 9465 gene locus_tag LOCUS_21760 11444 9465 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858576.1 protein_id gnl|my_center|LOCUS_21760 12142 11447 gene locus_tag LOCUS_21770 12142 11447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882852.1 protein_id gnl|my_center|LOCUS_21770 13628 12153 gene locus_tag LOCUS_21780 gene gpmI 13628 12153 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057737.1 protein_id gnl|my_center|LOCUS_21780 13762 14757 gene locus_tag LOCUS_21790 gene mraY 13762 14757 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 protein_id gnl|my_center|LOCUS_21790 14768 15946 gene locus_tag LOCUS_21800 gene murD 14768 15946 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_21800 15982 16057 gene locus_tag LOCUS_t00380 15982 16057 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 16074 16150 gene locus_tag LOCUS_t00390 16074 16150 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16212 16296 gene locus_tag LOCUS_t00400 16212 16296 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 16307 16383 gene locus_tag LOCUS_t00410 16307 16383 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16603 17811 gene locus_tag LOCUS_21810 gene tuf 16603 17811 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040579.1 protein_id gnl|my_center|LOCUS_21810 17823 17993 gene locus_tag LOCUS_21820 gene rpmG 17823 17993 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002793551.1 protein_id gnl|my_center|LOCUS_21820 18035 18110 gene locus_tag LOCUS_t00420 18035 18110 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 18193 18375 gene locus_tag LOCUS_21830 gene secE 18193 18375 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854985.1 protein_id gnl|my_center|LOCUS_21830 18385 18912 gene locus_tag LOCUS_21840 gene nusG 18385 18912 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851098.1 protein_id gnl|my_center|LOCUS_21840 19007 19432 gene locus_tag LOCUS_21850 gene rplK 19007 19432 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779452.1 protein_id gnl|my_center|LOCUS_21850 19510 20208 gene locus_tag LOCUS_21860 gene rplA 19510 20208 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854928.1 protein_id gnl|my_center|LOCUS_21860 20374 20862 gene locus_tag LOCUS_21870 gene rplJ 20374 20862 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858610.1 protein_id gnl|my_center|LOCUS_21870 20911 21282 gene locus_tag LOCUS_21880 gene rplL 20911 21282 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858569.1 protein_id gnl|my_center|LOCUS_21880 21453 25601 gene locus_tag LOCUS_21890 gene rpoB 21453 25601 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891860.1 protein_id gnl|my_center|LOCUS_21890 25591 30117 gene locus_tag LOCUS_21900 gene rpoC 25591 30117 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858508.1 protein_id gnl|my_center|LOCUS_21900 30361 30543 gene locus_tag LOCUS_21910 30361 30543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 30610 30897 gene locus_tag LOCUS_21920 30610 30897 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116400.1 protein_id gnl|my_center|LOCUS_21920 31053 32279 gene locus_tag LOCUS_21930 31053 32279 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817421.1 protein_id gnl|my_center|LOCUS_21930 32318 32611 gene locus_tag LOCUS_21940 32318 32611 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968800.1 protein_id gnl|my_center|LOCUS_21940 32614 32976 gene locus_tag LOCUS_21950 32614 32976 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence25 291 509 gene locus_tag LOCUS_21960 291 509 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076091.1 protein_id gnl|my_center|LOCUS_21960 601 1347 gene locus_tag LOCUS_21970 601 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2418 1366 gene locus_tag LOCUS_21980 2418 1366 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 protein_id gnl|my_center|LOCUS_21980 3452 2415 gene locus_tag LOCUS_21990 gene ruvB 3452 2415 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856258.1 protein_id gnl|my_center|LOCUS_21990 4261 3452 gene locus_tag LOCUS_22000 gene panB 4261 3452 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062669.1 protein_id gnl|my_center|LOCUS_22000 4440 5180 gene locus_tag LOCUS_22010 gene trpA 4440 5180 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_22010 5183 5920 gene locus_tag LOCUS_22020 5183 5920 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853863.1 protein_id gnl|my_center|LOCUS_22020 5886 6137 gene locus_tag LOCUS_22030 5886 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 6130 6513 gene locus_tag LOCUS_22040 6130 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 8657 6549 gene locus_tag LOCUS_22050 gene feoB 8657 6549 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_22050 8874 8647 gene locus_tag LOCUS_22060 8874 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 9017 9469 gene locus_tag LOCUS_22070 9017 9469 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_22070 10002 9505 gene locus_tag LOCUS_22080 gene fldB 10002 9505 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261228.1 protein_id gnl|my_center|LOCUS_22080 10782 10024 gene locus_tag LOCUS_22090 10782 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 11111 10776 gene locus_tag LOCUS_22100 11111 10776 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855637.1 protein_id gnl|my_center|LOCUS_22100 11853 11356 gene locus_tag LOCUS_22110 11853 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 12018 12227 gene locus_tag LOCUS_22120 12018 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 12963 12241 gene locus_tag LOCUS_22130 12963 12241 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880005.1 protein_id gnl|my_center|LOCUS_22130 14347 12938 gene locus_tag LOCUS_22140 gene pgmL 14347 12938 CDS product phosphoglucosamine mutase PgmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891933.1 protein_id gnl|my_center|LOCUS_22140 14870 14340 gene locus_tag LOCUS_22150 14870 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 14912 15592 gene locus_tag LOCUS_22160 14912 15592 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_22160 15585 16901 gene locus_tag LOCUS_22170 15585 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 18219 16903 gene locus_tag LOCUS_22180 gene ccoG 18219 16903 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_22180 18344 19033 gene locus_tag LOCUS_22190 18344 19033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 20951 19068 gene locus_tag LOCUS_22200 20951 19068 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_22200 22194 20959 gene locus_tag LOCUS_22210 22194 20959 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_22210 22515 22216 gene locus_tag LOCUS_22220 22515 22216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 22808 22590 gene locus_tag LOCUS_22230 22808 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 23189 23515 gene locus_tag LOCUS_22240 23189 23515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 23525 23911 gene locus_tag LOCUS_22250 23525 23911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 25766 23931 gene locus_tag LOCUS_22260 25766 23931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 27648 25759 gene locus_tag LOCUS_22270 27648 25759 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238108.1 protein_id gnl|my_center|LOCUS_22270 28081 27764 gene locus_tag LOCUS_22280 gene trxA 28081 27764 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 protein_id gnl|my_center|LOCUS_22280 28696 28100 gene locus_tag LOCUS_22290 28696 28100 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_22290 <30912 28855 gene locus_tag LOCUS_22300 <30912 28855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814129.1:catalase/peroxidase HPI >Feature sequence26 2103 289 gene locus_tag LOCUS_22310 2103 289 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_22310 2357 2109 gene locus_tag LOCUS_22320 2357 2109 CDS product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703617.1 protein_id gnl|my_center|LOCUS_22320 2686 3342 gene locus_tag LOCUS_22330 2686 3342 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858975.1 protein_id gnl|my_center|LOCUS_22330 4342 3344 gene locus_tag LOCUS_22340 4342 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 6300 4342 gene locus_tag LOCUS_22350 gene metG 6300 4342 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852639.1 protein_id gnl|my_center|LOCUS_22350 6521 6315 gene locus_tag LOCUS_22360 6521 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 7356 6514 gene locus_tag LOCUS_22370 7356 6514 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_22370 7856 7359 gene locus_tag LOCUS_22380 gene mobB 7856 7359 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 protein_id gnl|my_center|LOCUS_22380 8111 8593 gene locus_tag LOCUS_22390 8111 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 10223 8562 gene locus_tag LOCUS_22400 10223 8562 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864855.1 protein_id gnl|my_center|LOCUS_22400 10505 10233 gene locus_tag LOCUS_22410 10505 10233 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 protein_id gnl|my_center|LOCUS_22410 11803 10502 gene locus_tag LOCUS_22420 gene gltX 11803 10502 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_22420 13044 11806 gene locus_tag LOCUS_22430 13044 11806 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714010.1 protein_id gnl|my_center|LOCUS_22430 14178 13105 gene locus_tag LOCUS_22440 14178 13105 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_22440 16430 14178 gene locus_tag LOCUS_22450 gene bamA 16430 14178 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_22450 16534 17364 gene locus_tag LOCUS_22460 16534 17364 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611641.1 protein_id gnl|my_center|LOCUS_22460 18517 17378 gene locus_tag LOCUS_22470 gene folP 18517 17378 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858587.1 protein_id gnl|my_center|LOCUS_22470 19157 18528 gene locus_tag LOCUS_22480 19157 18528 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 protein_id gnl|my_center|LOCUS_22480 19711 19160 gene locus_tag LOCUS_22490 19711 19160 CDS product HobA family DNA replication regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852154.1 protein_id gnl|my_center|LOCUS_22490 20925 19714 gene locus_tag LOCUS_22500 20925 19714 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891865.1 protein_id gnl|my_center|LOCUS_22500 21440 20943 gene locus_tag LOCUS_22510 21440 20943 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_22510 21496 22563 gene locus_tag LOCUS_22520 gene hemW 21496 22563 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852262.1 protein_id gnl|my_center|LOCUS_22520 22681 23721 gene locus_tag LOCUS_22530 22681 23721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 23852 24355 gene locus_tag LOCUS_22540 23852 24355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 24339 26552 gene locus_tag LOCUS_22550 24339 26552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence27 158 976 gene locus_tag LOCUS_22560 158 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 973 1596 gene locus_tag LOCUS_22570 973 1596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871031.1 protein_id gnl|my_center|LOCUS_22570 1580 3163 gene locus_tag LOCUS_22580 1580 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3151 4116 gene locus_tag LOCUS_22590 3151 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4109 4645 gene locus_tag LOCUS_22600 4109 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4649 5104 gene locus_tag LOCUS_22610 4649 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074809182.1 protein_id gnl|my_center|LOCUS_22610 5101 5826 gene locus_tag LOCUS_22620 5101 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5831 6499 gene locus_tag LOCUS_22630 5831 6499 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263077.1 protein_id gnl|my_center|LOCUS_22630 6489 7865 gene locus_tag LOCUS_22640 6489 7865 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_22640 9296 8079 gene locus_tag LOCUS_22650 9296 8079 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965827.1 protein_id gnl|my_center|LOCUS_22650 11267 10005 gene locus_tag LOCUS_22660 11267 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 12395 11310 gene locus_tag LOCUS_22670 12395 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 14461 12827 gene locus_tag LOCUS_22680 gene groL 14461 12827 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858047.1 protein_id gnl|my_center|LOCUS_22680 14718 14461 gene locus_tag LOCUS_22690 gene groES 14718 14461 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 protein_id gnl|my_center|LOCUS_22690 15711 14851 gene locus_tag LOCUS_22700 15711 14851 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 protein_id gnl|my_center|LOCUS_22700 16035 15715 gene locus_tag LOCUS_22710 16035 15715 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851172.1 protein_id gnl|my_center|LOCUS_22710 16411 16028 gene locus_tag LOCUS_22720 gene panD 16411 16028 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 protein_id gnl|my_center|LOCUS_22720 16786 16424 gene locus_tag LOCUS_22730 16786 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 16936 17466 gene locus_tag LOCUS_22740 16936 17466 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641564.1 protein_id gnl|my_center|LOCUS_22740 18840 17488 gene locus_tag LOCUS_22750 18840 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 19333 18854 gene locus_tag LOCUS_22760 gene cheW 19333 18854 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811919.1 protein_id gnl|my_center|LOCUS_22760 20660 19407 gene locus_tag LOCUS_22770 gene xseA 20660 19407 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382848.1 protein_id gnl|my_center|LOCUS_22770 21390 20680 gene locus_tag LOCUS_22780 gene ubiE 21390 20680 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858648.1 protein_id gnl|my_center|LOCUS_22780 21666 21418 gene locus_tag LOCUS_22790 21666 21418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 22454 21663 gene locus_tag LOCUS_22800 22454 21663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 23357 22533 gene locus_tag LOCUS_22810 23357 22533 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_22810 25823 23403 gene locus_tag LOCUS_22820 25823 23403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence28 5191 275 gene locus_tag LOCUS_22830 5191 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6730 5303 gene locus_tag LOCUS_22840 6730 5303 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_22840 8893 6734 gene locus_tag LOCUS_22850 8893 6734 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060991856.1 protein_id gnl|my_center|LOCUS_22850 10691 8916 gene locus_tag LOCUS_22860 10691 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 10868 11572 gene locus_tag LOCUS_22870 10868 11572 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_22870 11644 14013 gene locus_tag LOCUS_22880 11644 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 14515 14015 gene locus_tag LOCUS_22890 14515 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 17407 14612 gene locus_tag LOCUS_22900 17407 14612 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986599.1 protein_id gnl|my_center|LOCUS_22900 17522 18016 gene locus_tag LOCUS_22910 17522 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 18019 18744 gene locus_tag LOCUS_22920 18019 18744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 18806 20863 gene locus_tag LOCUS_22930 18806 20863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 21890 20910 gene locus_tag LOCUS_22940 21890 20910 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_22940 22819 21944 gene locus_tag LOCUS_22950 22819 21944 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640518.1 protein_id gnl|my_center|LOCUS_22950 22967 23218 gene locus_tag LOCUS_22960 22967 23218 CDS product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703617.1 protein_id gnl|my_center|LOCUS_22960 23224 25038 gene locus_tag LOCUS_22970 23224 25038 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence29 532 942 gene locus_tag LOCUS_22980 532 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 953 2038 gene locus_tag LOCUS_22990 953 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2728 2141 gene locus_tag LOCUS_23000 2728 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 3888 2728 gene locus_tag LOCUS_23010 3888 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 4199 3885 gene locus_tag LOCUS_23020 4199 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 4314 4694 gene locus_tag LOCUS_23030 4314 4694 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205282.1 protein_id gnl|my_center|LOCUS_23030 4681 5301 gene locus_tag LOCUS_23040 4681 5301 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072503.1 protein_id gnl|my_center|LOCUS_23040 5298 6791 gene locus_tag LOCUS_23050 5298 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 6868 7737 gene locus_tag LOCUS_23060 6868 7737 CDS product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045822.1 protein_id gnl|my_center|LOCUS_23060 7752 8129 gene locus_tag LOCUS_23070 gene hspR 7752 8129 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_23070 8303 9103 gene locus_tag LOCUS_23080 8303 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 10511 9126 gene locus_tag LOCUS_23090 gene nhaD 10511 9126 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_23090 10778 10981 gene locus_tag LOCUS_23100 10778 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 12081 11014 gene locus_tag LOCUS_23110 12081 11014 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023287.1 protein_id gnl|my_center|LOCUS_23110 12846 12109 gene locus_tag LOCUS_23120 gene motB 12846 12109 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085308.1 protein_id gnl|my_center|LOCUS_23120 13607 12849 gene locus_tag LOCUS_23130 gene motA 13607 12849 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366185.1 protein_id gnl|my_center|LOCUS_23130 14164 15972 gene locus_tag LOCUS_23140 14164 15972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 15962 18100 gene locus_tag LOCUS_23150 15962 18100 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060991856.1 protein_id gnl|my_center|LOCUS_23150 18090 19424 gene locus_tag LOCUS_23160 18090 19424 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_23160 19421 19978 gene locus_tag LOCUS_23170 19421 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 <23154 19981 gene locus_tag LOCUS_23180 <23154 19981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040403.1:retention module-containing protein >Feature sequence30 <1 1086 gene locus_tag LOCUS_23190 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963596.1:2-isopropylmalate synthase 2176 1115 gene locus_tag LOCUS_23200 2176 1115 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_23200 2309 3553 gene locus_tag LOCUS_23210 2309 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 3641 3964 gene locus_tag LOCUS_23220 3641 3964 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703344.1 protein_id gnl|my_center|LOCUS_23220 3971 5056 gene locus_tag LOCUS_23230 3971 5056 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_23230 5040 5507 gene locus_tag LOCUS_23240 gene ybaK 5040 5507 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704619.1 protein_id gnl|my_center|LOCUS_23240 5680 5886 gene locus_tag LOCUS_23250 5680 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 5947 6429 gene locus_tag LOCUS_23260 5947 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 6449 7750 gene locus_tag LOCUS_23270 6449 7750 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880567.1 protein_id gnl|my_center|LOCUS_23270 10314 7756 gene locus_tag LOCUS_23280 10314 7756 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 protein_id gnl|my_center|LOCUS_23280 10903 10466 gene locus_tag LOCUS_23290 10903 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 11045 11641 gene locus_tag LOCUS_23300 11045 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 11642 12223 gene locus_tag LOCUS_23310 11642 12223 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_23310 12216 14879 gene locus_tag LOCUS_23320 12216 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 14949 15341 gene locus_tag LOCUS_23330 14949 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 15417 16529 gene locus_tag LOCUS_23340 15417 16529 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_23340 16531 21888 gene locus_tag LOCUS_23350 16531 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence31 1035 82 gene locus_tag LOCUS_23360 1035 82 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_23360 2146 1079 gene locus_tag LOCUS_23370 gene leuB 2146 1079 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_23370 2646 2146 gene locus_tag LOCUS_23380 gene leuD 2646 2146 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_23380 2822 4705 gene locus_tag LOCUS_23390 gene rpoD 2822 4705 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 protein_id gnl|my_center|LOCUS_23390 4710 5390 gene locus_tag LOCUS_23400 4710 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5998 5399 gene locus_tag LOCUS_23410 5998 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 6245 5934 gene locus_tag LOCUS_23420 6245 5934 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010071.1 protein_id gnl|my_center|LOCUS_23420 6563 6246 gene locus_tag LOCUS_23430 6563 6246 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454504.1 protein_id gnl|my_center|LOCUS_23430 7864 6581 gene locus_tag LOCUS_23440 gene hemL 7864 6581 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421462.1 protein_id gnl|my_center|LOCUS_23440 7916 8686 gene locus_tag LOCUS_23450 7916 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 8695 9396 gene locus_tag LOCUS_23460 8695 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 10528 9422 gene locus_tag LOCUS_23470 10528 9422 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 protein_id gnl|my_center|LOCUS_23470 10548 11534 gene locus_tag LOCUS_23480 10548 11534 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174316.1 protein_id gnl|my_center|LOCUS_23480 11482 12762 gene locus_tag LOCUS_23490 11482 12762 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108527784.1 protein_id gnl|my_center|LOCUS_23490 12777 13970 gene locus_tag LOCUS_23500 gene trmB 12777 13970 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858203.1 protein_id gnl|my_center|LOCUS_23500 13967 14629 gene locus_tag LOCUS_23510 13967 14629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 protein_id gnl|my_center|LOCUS_23510 14616 15434 gene locus_tag LOCUS_23520 14616 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 15427 16743 gene locus_tag LOCUS_23530 15427 16743 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 protein_id gnl|my_center|LOCUS_23530 16740 17189 gene locus_tag LOCUS_23540 16740 17189 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072803.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence32 795 70 gene locus_tag LOCUS_23550 795 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2074 1055 gene locus_tag LOCUS_23560 2074 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2268 3101 gene locus_tag LOCUS_23570 2268 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 3201 4583 gene locus_tag LOCUS_23580 gene ccoG 3201 4583 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_23580 4695 6311 gene locus_tag LOCUS_23590 4695 6311 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853102.1 protein_id gnl|my_center|LOCUS_23590 6311 7876 gene locus_tag LOCUS_23600 gene recJ 6311 7876 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 protein_id gnl|my_center|LOCUS_23600 8470 7871 gene locus_tag LOCUS_23610 8470 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 9139 8474 gene locus_tag LOCUS_23620 9139 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 9296 9841 gene locus_tag LOCUS_23630 9296 9841 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241407.1 protein_id gnl|my_center|LOCUS_23630 9916 10629 gene locus_tag LOCUS_23640 9916 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 10616 11377 gene locus_tag LOCUS_23650 10616 11377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 11403 14966 gene locus_tag LOCUS_23660 gene dnaE 11403 14966 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_23660 14941 15729 gene locus_tag LOCUS_23670 gene surE 14941 15729 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722451.1 protein_id gnl|my_center|LOCUS_23670 15741 16004 gene locus_tag LOCUS_23680 15741 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 16280 16017 gene locus_tag LOCUS_23690 16280 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 16756 16277 gene locus_tag LOCUS_23700 gene moaC 16756 16277 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851725.1 protein_id gnl|my_center|LOCUS_23700 16867 17079 gene locus_tag LOCUS_23710 gene rpsU 16867 17079 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780697.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence33 266 880 gene locus_tag LOCUS_23720 266 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2381 963 gene locus_tag LOCUS_23730 gene lidL 2381 963 CDS product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_23730 2585 2448 gene locus_tag LOCUS_23740 2585 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 5505 2629 gene locus_tag LOCUS_23750 5505 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 5744 5502 gene locus_tag LOCUS_23760 5744 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 6117 5764 gene locus_tag LOCUS_23770 6117 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 6586 6089 gene locus_tag LOCUS_23780 6586 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 7097 6588 gene locus_tag LOCUS_23790 7097 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 9179 7098 gene locus_tag LOCUS_23800 9179 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 10023 9181 gene locus_tag LOCUS_23810 10023 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 10928 10026 gene locus_tag LOCUS_23820 10928 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 11297 10932 gene locus_tag LOCUS_23830 11297 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 11532 11287 gene locus_tag LOCUS_23840 11532 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 11918 11535 gene locus_tag LOCUS_23850 11918 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 12672 11905 gene locus_tag LOCUS_23860 12672 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 13490 12855 gene locus_tag LOCUS_23870 13490 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 13801 13568 gene locus_tag LOCUS_23880 13801 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 14034 13813 gene locus_tag LOCUS_23890 14034 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence34 379 1629 gene locus_tag LOCUS_23900 379 1629 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485823.1 protein_id gnl|my_center|LOCUS_23900 1673 2908 gene locus_tag LOCUS_23910 1673 2908 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_23910 2905 3636 gene locus_tag LOCUS_23920 2905 3636 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109278.1 protein_id gnl|my_center|LOCUS_23920 3702 4223 gene locus_tag LOCUS_23930 3702 4223 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_23930 4227 4535 gene locus_tag LOCUS_23940 4227 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 4684 6135 gene locus_tag LOCUS_23950 gene accC 4684 6135 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880952.1 protein_id gnl|my_center|LOCUS_23950 6201 6416 gene locus_tag LOCUS_23960 6201 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6611 8563 gene locus_tag LOCUS_23970 6611 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 9421 8579 gene locus_tag LOCUS_23980 9421 8579 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207359.1 protein_id gnl|my_center|LOCUS_23980 10910 9456 gene locus_tag LOCUS_23990 10910 9456 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105279.1 protein_id gnl|my_center|LOCUS_23990 12046 11087 gene locus_tag LOCUS_24000 12046 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 13270 12239 gene locus_tag LOCUS_24010 13270 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24010 >Feature sequence35 642 82 gene locus_tag LOCUS_24020 642 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 739 1302 gene locus_tag LOCUS_24030 gene ruvA 739 1302 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852492.1 protein_id gnl|my_center|LOCUS_24030 1324 2364 gene locus_tag LOCUS_24040 1324 2364 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852516.1 protein_id gnl|my_center|LOCUS_24040 2368 3087 gene locus_tag LOCUS_24050 gene estV 2368 3087 CDS product lipase EstV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129409.1 protein_id gnl|my_center|LOCUS_24050 3074 4510 gene locus_tag LOCUS_24060 3074 4510 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852462.1 protein_id gnl|my_center|LOCUS_24060 4529 5017 gene locus_tag LOCUS_24070 4529 5017 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 protein_id gnl|my_center|LOCUS_24070 5108 6325 gene locus_tag LOCUS_24080 5108 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 7599 6349 gene locus_tag LOCUS_24090 7599 6349 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712480.1 protein_id gnl|my_center|LOCUS_24090 7775 8503 gene locus_tag LOCUS_24100 7775 8503 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_24100 8746 8513 gene locus_tag LOCUS_24110 8746 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 8804 9445 gene locus_tag LOCUS_24120 8804 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 10219 9515 gene locus_tag LOCUS_24130 10219 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 11030 10185 gene locus_tag LOCUS_24140 11030 10185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 11444 11758 gene locus_tag LOCUS_24150 gene rpsJ 11444 11758 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_24150 11775 12350 gene locus_tag LOCUS_24160 gene rplC 11775 12350 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence36 261 503 gene locus_tag LOCUS_24170 261 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1089 436 gene locus_tag LOCUS_24180 1089 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2906 1092 gene locus_tag LOCUS_24190 2906 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 5144 2916 gene locus_tag LOCUS_24200 5144 2916 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091102695.1 protein_id gnl|my_center|LOCUS_24200 7528 5159 gene locus_tag LOCUS_24210 gene rad50 7528 5159 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868338.1 protein_id gnl|my_center|LOCUS_24210 8633 7515 gene locus_tag LOCUS_24220 8633 7515 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881231.1 protein_id gnl|my_center|LOCUS_24220 9541 9669 gene locus_tag LOCUS_24230 9541 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 9919 10887 gene locus_tag LOCUS_24240 9919 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence37 4430 540 gene locus_tag LOCUS_24250 4430 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 6409 4427 gene locus_tag LOCUS_24260 6409 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence38 143 487 gene locus_tag LOCUS_24270 143 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 557 979 gene locus_tag LOCUS_24280 557 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1102 3027 gene locus_tag LOCUS_24290 1102 3027 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_24290 3027 3908 gene locus_tag LOCUS_24300 3027 3908 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_24300 3929 4687 gene locus_tag LOCUS_24310 3929 4687 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083549713.1 protein_id gnl|my_center|LOCUS_24310 4754 5485 gene locus_tag LOCUS_24320 4754 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963980.1 protein_id gnl|my_center|LOCUS_24320 5526 5768 gene locus_tag LOCUS_24330 5526 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence39 1584 382 gene locus_tag LOCUS_24340 1584 382 CDS product IS256-like element ISSod4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072296.1 protein_id gnl|my_center|LOCUS_24340 2793 1786 gene locus_tag LOCUS_24350 2793 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3157 2810 gene locus_tag LOCUS_24360 3157 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 3803 3375 gene locus_tag LOCUS_24370 3803 3375 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_24370 4408 3803 gene locus_tag LOCUS_24380 4408 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 4759 4412 gene locus_tag LOCUS_24390 4759 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 4916 5245 gene locus_tag LOCUS_24400 4916 5245 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254519.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence40 496 1452 gene locus_tag LOCUS_24410 496 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2303 1509 gene locus_tag LOCUS_24420 2303 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2876 2715 gene locus_tag LOCUS_24430 2876 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3124 3444 gene locus_tag LOCUS_24440 3124 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence41 <1 1098 gene locus_tag LOCUS_24450 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388484.1:MFS transporter 1157 1645 gene locus_tag LOCUS_24460 1157 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1642 2880 gene locus_tag LOCUS_24470 1642 2880 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_24470 2882 3634 gene locus_tag LOCUS_24480 2882 3634 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence42 2397 1534 gene locus_tag LOCUS_24490 2397 1534 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292110.1 protein_id gnl|my_center|LOCUS_24490 3254 2394 gene locus_tag LOCUS_24500 gene xerD 3254 2394 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence43 283 358 gene locus_tag LOCUS_t00430 283 358 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 428 1126 gene locus_tag LOCUS_24510 428 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1163 1627 gene locus_tag LOCUS_24520 1163 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2069 1845 gene locus_tag LOCUS_24530 2069 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24530 2817 2272 gene locus_tag LOCUS_24540 2817 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24540 >Feature sequence44 2688 2761 gene locus_tag LOCUS_t00440 2688 2761 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence45 170 1138 gene locus_tag LOCUS_24550 170 1138 CDS product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103357905.1 protein_id gnl|my_center|LOCUS_24550 1131 1322 gene locus_tag LOCUS_24560 1131 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1660 1343 gene locus_tag LOCUS_24570 1660 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570