>Feature sequence001 89 165 gene locus_tag LOCUS_t00010 89 165 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 545 1432 gene locus_tag LOCUS_00010 545 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1420 2424 gene locus_tag LOCUS_00020 gene amrS 1420 2424 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583380.1 protein_id gnl|my_center|LOCUS_00020 2414 2779 gene locus_tag LOCUS_00030 2414 2779 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_00030 2788 4692 gene locus_tag LOCUS_00040 2788 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4677 5438 gene locus_tag LOCUS_00050 4677 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5496 6773 gene locus_tag LOCUS_00060 gene miaB 5496 6773 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_00060 6893 7771 gene locus_tag LOCUS_00070 6893 7771 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387384.1 protein_id gnl|my_center|LOCUS_00070 7761 8198 gene locus_tag LOCUS_00080 7761 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8203 10470 gene locus_tag LOCUS_00090 gene rnr 8203 10470 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434984.1 protein_id gnl|my_center|LOCUS_00090 10470 11273 gene locus_tag LOCUS_00100 gene murI 10470 11273 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_00100 11304 12137 gene locus_tag LOCUS_00110 11304 12137 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_00110 12147 14408 gene locus_tag LOCUS_00120 12147 14408 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_00120 14418 15209 gene locus_tag LOCUS_00130 14418 15209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15209 16210 gene locus_tag LOCUS_00140 15209 16210 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081951.1 protein_id gnl|my_center|LOCUS_00140 16207 16983 gene locus_tag LOCUS_00150 gene folE2 16207 16983 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_00150 16980 19565 gene locus_tag LOCUS_00160 16980 19565 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524115.1 protein_id gnl|my_center|LOCUS_00160 19568 20326 gene locus_tag LOCUS_00170 19568 20326 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_00170 20323 21081 gene locus_tag LOCUS_00180 20323 21081 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986889.1 protein_id gnl|my_center|LOCUS_00180 22148 21138 gene locus_tag LOCUS_00190 gene tsaD 22148 21138 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_00190 23011 22145 gene locus_tag LOCUS_00200 23011 22145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24434 23013 gene locus_tag LOCUS_00210 24434 23013 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_00210 25640 24447 gene locus_tag LOCUS_00220 25640 24447 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_00220 26993 25650 gene locus_tag LOCUS_00230 26993 25650 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_00230 29026 26990 gene locus_tag LOCUS_00240 29026 26990 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_00240 29907 29176 gene locus_tag LOCUS_00250 29907 29176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30204 31814 gene locus_tag LOCUS_00260 30204 31814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31811 33784 gene locus_tag LOCUS_00270 31811 33784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34257 33781 gene locus_tag LOCUS_00280 gene folA 34257 33781 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_00280 35000 34257 gene locus_tag LOCUS_00290 35000 34257 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_00290 36070 34997 gene locus_tag LOCUS_00300 36070 34997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 38237 36075 gene locus_tag LOCUS_00310 38237 36075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39417 38251 gene locus_tag LOCUS_00320 39417 38251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40786 39428 gene locus_tag LOCUS_00330 40786 39428 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791938.1 protein_id gnl|my_center|LOCUS_00330 42799 40808 gene locus_tag LOCUS_00340 42799 40808 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869356.1 protein_id gnl|my_center|LOCUS_00340 44087 42789 gene locus_tag LOCUS_00350 44087 42789 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927762.1 protein_id gnl|my_center|LOCUS_00350 44964 44332 gene locus_tag LOCUS_00360 gene coaE 44964 44332 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181518.1 protein_id gnl|my_center|LOCUS_00360 45694 44948 gene locus_tag LOCUS_00370 gene cdaA 45694 44948 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_00370 46485 45694 gene locus_tag LOCUS_00380 gene folP 46485 45694 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_00380 47210 46530 gene locus_tag LOCUS_00390 47210 46530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47611 47210 gene locus_tag LOCUS_00400 47611 47210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 48182 47601 gene locus_tag LOCUS_00410 48182 47601 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_00410 49386 48301 gene locus_tag LOCUS_00420 gene serC 49386 48301 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_00420 49526 50119 gene locus_tag LOCUS_00430 49526 50119 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_00430 50116 51600 gene locus_tag LOCUS_00440 50116 51600 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583434.1 protein_id gnl|my_center|LOCUS_00440 51587 52150 gene locus_tag LOCUS_00450 51587 52150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52147 53571 gene locus_tag LOCUS_00460 gene gltX 52147 53571 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435581.1 protein_id gnl|my_center|LOCUS_00460 53736 59189 gene locus_tag LOCUS_00470 53736 59189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 60914 59484 gene locus_tag LOCUS_00480 60914 59484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 60947 61046 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 62268 61570 gene locus_tag LOCUS_00490 gene cobB 62268 61570 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194688031.1 protein_id gnl|my_center|LOCUS_00490 65843 62265 gene locus_tag LOCUS_00500 65843 62265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 68085 65926 gene locus_tag LOCUS_00510 gene plpD 68085 65926 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_00510 68647 68096 gene locus_tag LOCUS_00520 68647 68096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 70878 68668 gene locus_tag LOCUS_00530 gene purL 70878 68668 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_00530 71865 70888 gene locus_tag LOCUS_00540 71865 70888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 72289 71984 gene locus_tag LOCUS_00550 72289 71984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 72343 72442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73698 72907 gene locus_tag LOCUS_00560 73698 72907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 75011 73923 gene locus_tag LOCUS_00570 75011 73923 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_00570 76336 75011 gene locus_tag LOCUS_00580 76336 75011 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_00580 78309 76333 gene locus_tag LOCUS_00590 gene ligA 78309 76333 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932145.1 protein_id gnl|my_center|LOCUS_00590 79754 78306 gene locus_tag LOCUS_00600 79754 78306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 78567 78666 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 80512 79994 gene locus_tag LOCUS_00610 80512 79994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 80937 80509 gene locus_tag LOCUS_00620 80937 80509 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080643.1 protein_id gnl|my_center|LOCUS_00620 81394 80939 gene locus_tag LOCUS_00630 81394 80939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 81657 81415 gene locus_tag LOCUS_00640 81657 81415 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 protein_id gnl|my_center|LOCUS_00640 82245 81907 gene locus_tag LOCUS_00650 82245 81907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 82549 82944 gene locus_tag LOCUS_00660 82549 82944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 84220 82952 gene locus_tag LOCUS_00670 84220 82952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_00670 86356 84227 gene locus_tag LOCUS_00680 gene topA 86356 84227 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_00680 89631 86458 gene locus_tag LOCUS_00690 gene secA 89631 86458 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_00690 91221 89776 gene locus_tag LOCUS_00700 gene malQ 91221 89776 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143306.1 protein_id gnl|my_center|LOCUS_00700 92234 91221 gene locus_tag LOCUS_00710 92234 91221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 93047 92235 gene locus_tag LOCUS_00720 gene uppP 93047 92235 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_00720 94339 93044 gene locus_tag LOCUS_00730 94339 93044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 94853 94326 gene locus_tag LOCUS_00740 94853 94326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 96661 95189 gene locus_tag LOCUS_00750 96661 95189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 99552 96658 gene locus_tag LOCUS_00760 99552 96658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 100769 99618 gene locus_tag LOCUS_00770 100769 99618 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_00770 102844 100766 gene locus_tag LOCUS_00780 102844 100766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 103032 102844 gene locus_tag LOCUS_00790 103032 102844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 103466 103314 gene locus_tag LOCUS_00800 103466 103314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 103678 104031 gene locus_tag LOCUS_00810 103678 104031 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_00810 104028 106103 gene locus_tag LOCUS_00820 104028 106103 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860727.1 protein_id gnl|my_center|LOCUS_00820 106258 108162 gene locus_tag LOCUS_00830 gene thrS 106258 108162 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_00830 108159 109127 gene locus_tag LOCUS_00840 108159 109127 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_00840 109271 112117 gene locus_tag LOCUS_00850 109271 112117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 118385 112146 gene locus_tag LOCUS_00860 118385 112146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 119185 118382 gene locus_tag LOCUS_00870 119185 118382 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_00870 120314 119484 gene locus_tag LOCUS_00880 120314 119484 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365054.1 protein_id gnl|my_center|LOCUS_00880 121240 120311 gene locus_tag LOCUS_00890 121240 120311 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532153.1 protein_id gnl|my_center|LOCUS_00890 121787 121278 gene locus_tag LOCUS_00900 121787 121278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 123154 122366 gene locus_tag LOCUS_00910 123154 122366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 124636 123299 gene locus_tag LOCUS_00920 gene gdhA 124636 123299 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_00920 125226 125325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 125374 126429 gene locus_tag LOCUS_00930 125374 126429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 126437 127546 gene locus_tag LOCUS_00940 gene ribD 126437 127546 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975998.1 protein_id gnl|my_center|LOCUS_00940 127762 128490 gene locus_tag LOCUS_00950 127762 128490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 128490 129749 gene locus_tag LOCUS_00960 gene rho 128490 129749 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668994.1 protein_id gnl|my_center|LOCUS_00960 129749 130951 gene locus_tag LOCUS_00970 129749 130951 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_00970 130933 132057 gene locus_tag LOCUS_00980 130933 132057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 132058 134688 gene locus_tag LOCUS_00990 gene mutS 132058 134688 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_00990 134685 136391 gene locus_tag LOCUS_01000 134685 136391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 >Feature sequence002 2195 207 gene locus_tag LOCUS_01010 2195 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 3322 2474 gene locus_tag LOCUS_01020 3322 2474 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311228.1 protein_id gnl|my_center|LOCUS_01020 3462 3539 gene locus_tag LOCUS_t00020 3462 3539 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3560 3635 gene locus_tag LOCUS_t00030 3560 3635 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3657 4622 gene locus_tag LOCUS_01030 3657 4622 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927122.1 protein_id gnl|my_center|LOCUS_01030 4595 6301 gene locus_tag LOCUS_01040 4595 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 6377 9892 gene locus_tag LOCUS_01050 6377 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 10053 10961 gene locus_tag LOCUS_01060 10053 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 11330 11701 gene locus_tag LOCUS_01070 11330 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 11879 12478 gene locus_tag LOCUS_01080 11879 12478 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080830.1 protein_id gnl|my_center|LOCUS_01080 12482 13873 gene locus_tag LOCUS_01090 12482 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 13874 14911 gene locus_tag LOCUS_01100 13874 14911 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_01100 14914 18003 gene locus_tag LOCUS_01110 14914 18003 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_01110 17987 18496 gene locus_tag LOCUS_01120 17987 18496 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787692.1 protein_id gnl|my_center|LOCUS_01120 18515 18742 gene locus_tag LOCUS_01130 18515 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 20887 18824 gene locus_tag LOCUS_01140 20887 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 21213 21785 gene locus_tag LOCUS_01150 21213 21785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 22566 21928 gene locus_tag LOCUS_01160 22566 21928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 22651 22750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23338 23550 gene locus_tag LOCUS_01170 23338 23550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 24218 23514 gene locus_tag LOCUS_01180 24218 23514 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_01180 26335 24215 gene locus_tag LOCUS_01190 26335 24215 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_01190 27244 26753 gene locus_tag LOCUS_01200 27244 26753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 27725 27824 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28391 28870 gene locus_tag LOCUS_01210 28391 28870 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_01210 28860 30098 gene locus_tag LOCUS_01220 gene nusA 28860 30098 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_01220 30216 30374 gene locus_tag LOCUS_01230 30216 30374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 30319 30633 gene locus_tag LOCUS_01240 30319 30633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 30646 33288 gene locus_tag LOCUS_01250 gene infB 30646 33288 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_01250 33285 33764 gene locus_tag LOCUS_01260 33285 33764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 33855 34844 gene locus_tag LOCUS_01270 33855 34844 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986790.1 protein_id gnl|my_center|LOCUS_01270 34841 35686 gene locus_tag LOCUS_01280 34841 35686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 35698 36594 gene locus_tag LOCUS_01290 35698 36594 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383736.1 protein_id gnl|my_center|LOCUS_01290 36591 38477 gene locus_tag LOCUS_01300 36591 38477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 38482 39429 gene locus_tag LOCUS_01310 38482 39429 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_01310 39442 40218 gene locus_tag LOCUS_01320 39442 40218 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_01320 40335 41195 gene locus_tag LOCUS_01330 40335 41195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 43647 41305 gene locus_tag LOCUS_01340 gene priA 43647 41305 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_01340 43808 44254 gene locus_tag LOCUS_01350 43808 44254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 44257 45342 gene locus_tag LOCUS_01360 44257 45342 CDS product alanine/ornithine racemase family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582642.1 protein_id gnl|my_center|LOCUS_01360 46996 45602 gene locus_tag LOCUS_01370 46996 45602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 47554 47009 gene locus_tag LOCUS_01380 47554 47009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 48085 47570 gene locus_tag LOCUS_01390 48085 47570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 48866 48090 gene locus_tag LOCUS_01400 48866 48090 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_01400 49141 48863 gene locus_tag LOCUS_01410 49141 48863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 54981 49138 gene locus_tag LOCUS_01420 54981 49138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 56278 55124 gene locus_tag LOCUS_01430 56278 55124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 56397 56756 gene locus_tag LOCUS_01440 56397 56756 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_01440 58118 56769 gene locus_tag LOCUS_01450 58118 56769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 59211 58096 gene locus_tag LOCUS_01460 59211 58096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 62638 59204 gene locus_tag LOCUS_01470 gene dnaE 62638 59204 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403739.1 protein_id gnl|my_center|LOCUS_01470 62706 62805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63855 62812 gene locus_tag LOCUS_01480 gene lpxK 63855 62812 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206592.1 protein_id gnl|my_center|LOCUS_01480 64231 63848 gene locus_tag LOCUS_01490 64231 63848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 65112 64228 gene locus_tag LOCUS_01500 65112 64228 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_01500 66052 65105 gene locus_tag LOCUS_01510 66052 65105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 66376 66936 gene locus_tag LOCUS_01520 gene efp 66376 66936 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640346.1 protein_id gnl|my_center|LOCUS_01520 66948 67154 gene locus_tag LOCUS_01530 66948 67154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 67470 68348 gene locus_tag LOCUS_01540 67470 68348 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_01540 69117 68365 gene locus_tag LOCUS_01550 69117 68365 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_01550 69854 69117 gene locus_tag LOCUS_01560 69854 69117 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_01560 70867 69851 gene locus_tag LOCUS_01570 70867 69851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 71499 70867 gene locus_tag LOCUS_01580 71499 70867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 71904 71521 gene locus_tag LOCUS_01590 71904 71521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 72893 71901 gene locus_tag LOCUS_01600 72893 71901 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938297.1 protein_id gnl|my_center|LOCUS_01600 73680 72907 gene locus_tag LOCUS_01610 73680 72907 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111408924.1 protein_id gnl|my_center|LOCUS_01610 75609 73693 gene locus_tag LOCUS_01620 75609 73693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_01620 75732 75656 gene locus_tag LOCUS_t00040 75732 75656 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 76178 79078 gene locus_tag LOCUS_01630 76178 79078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence003 1300 473 gene locus_tag LOCUS_01640 1300 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2171 1287 gene locus_tag LOCUS_01650 2171 1287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957795.1 protein_id gnl|my_center|LOCUS_01650 2539 2168 gene locus_tag LOCUS_01660 2539 2168 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_01660 4508 2700 gene locus_tag LOCUS_01670 gene typA 4508 2700 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016545.1 protein_id gnl|my_center|LOCUS_01670 8730 4657 gene locus_tag LOCUS_01680 8730 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 9405 8737 gene locus_tag LOCUS_01690 gene lolD 9405 8737 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481886.1 protein_id gnl|my_center|LOCUS_01690 10628 9414 gene locus_tag LOCUS_01700 gene lolE 10628 9414 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168092.1 protein_id gnl|my_center|LOCUS_01700 11565 10621 gene locus_tag LOCUS_01710 11565 10621 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_01710 12169 11579 gene locus_tag LOCUS_01720 12169 11579 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933377.1 protein_id gnl|my_center|LOCUS_01720 13703 12174 gene locus_tag LOCUS_01730 13703 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 14902 13697 gene locus_tag LOCUS_01740 14902 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 15696 14899 gene locus_tag LOCUS_01750 15696 14899 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081106.1 protein_id gnl|my_center|LOCUS_01750 16478 15756 gene locus_tag LOCUS_01760 16478 15756 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_01760 17633 16482 gene locus_tag LOCUS_01770 gene dnaJ 17633 16482 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933150.1 protein_id gnl|my_center|LOCUS_01770 19676 17721 gene locus_tag LOCUS_01780 gene dnaK 19676 17721 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681815.1 protein_id gnl|my_center|LOCUS_01780 20261 19677 gene locus_tag LOCUS_01790 gene grpE 20261 19677 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_01790 21343 20270 gene locus_tag LOCUS_01800 gene hrcA 21343 20270 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405071.1 protein_id gnl|my_center|LOCUS_01800 22016 22189 gene locus_tag LOCUS_01810 22016 22189 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387504.1 protein_id gnl|my_center|LOCUS_01810 23229 22375 gene locus_tag LOCUS_01820 23229 22375 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964643.1 protein_id gnl|my_center|LOCUS_01820 23775 24191 gene locus_tag LOCUS_01830 23775 24191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 24200 25399 gene locus_tag LOCUS_01840 24200 25399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 25411 25728 gene locus_tag LOCUS_01850 25411 25728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 26489 25740 gene locus_tag LOCUS_01860 26489 25740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 26525 26624 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27326 27102 gene locus_tag LOCUS_01870 27326 27102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 27849 27559 gene locus_tag LOCUS_01880 27849 27559 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_01880 28279 29367 gene locus_tag LOCUS_01890 28279 29367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 29925 30024 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30118 30324 gene locus_tag LOCUS_01900 30118 30324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 30379 31692 gene locus_tag LOCUS_01910 gene ctpM 30379 31692 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_01910 32185 32397 gene locus_tag LOCUS_01920 gene rpmE 32185 32397 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_01920 32481 33449 gene locus_tag LOCUS_01930 32481 33449 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_01930 33453 34520 gene locus_tag LOCUS_01940 gene prfA 33453 34520 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_01940 34521 35780 gene locus_tag LOCUS_01950 34521 35780 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080781.1 protein_id gnl|my_center|LOCUS_01950 35816 37480 gene locus_tag LOCUS_01960 35816 37480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 37978 38523 gene locus_tag LOCUS_01970 37978 38523 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_01970 38520 39197 gene locus_tag LOCUS_01980 38520 39197 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 protein_id gnl|my_center|LOCUS_01980 39690 39187 gene locus_tag LOCUS_01990 gene tpx 39690 39187 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084375.1 protein_id gnl|my_center|LOCUS_01990 39974 41350 gene locus_tag LOCUS_02000 39974 41350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 41181 41280 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41347 42102 gene locus_tag LOCUS_02010 41347 42102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 42313 42119 gene locus_tag LOCUS_02020 42313 42119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 42442 44535 gene locus_tag LOCUS_02030 42442 44535 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047997.1 protein_id gnl|my_center|LOCUS_02030 44579 44962 gene locus_tag LOCUS_02040 gene ybeY 44579 44962 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_02040 44955 46214 gene locus_tag LOCUS_02050 44955 46214 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080781.1 protein_id gnl|my_center|LOCUS_02050 46211 46906 gene locus_tag LOCUS_02060 46211 46906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 46906 47268 gene locus_tag LOCUS_02070 46906 47268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 47265 47984 gene locus_tag LOCUS_02080 47265 47984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941593.1 protein_id gnl|my_center|LOCUS_02080 47981 48478 gene locus_tag LOCUS_02090 47981 48478 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902602.1 protein_id gnl|my_center|LOCUS_02090 48489 50561 gene locus_tag LOCUS_02100 48489 50561 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_02100 50573 51727 gene locus_tag LOCUS_02110 50573 51727 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_02110 51708 52901 gene locus_tag LOCUS_02120 51708 52901 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_02120 52902 53741 gene locus_tag LOCUS_02130 52902 53741 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_02130 53732 54751 gene locus_tag LOCUS_02140 gene rlmN 53732 54751 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_02140 54763 55536 gene locus_tag LOCUS_02150 gene deoC 54763 55536 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693439.1 protein_id gnl|my_center|LOCUS_02150 55546 56964 gene locus_tag LOCUS_02160 55546 56964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 57005 57081 gene locus_tag LOCUS_t00050 57005 57081 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57088 58290 gene locus_tag LOCUS_02170 57088 58290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 58137 58236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58293 59078 gene locus_tag LOCUS_02180 58293 59078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 59788 60261 gene locus_tag LOCUS_02190 59788 60261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 60293 60871 gene locus_tag LOCUS_02200 60293 60871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 62888 60954 gene locus_tag LOCUS_02210 62888 60954 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 protein_id gnl|my_center|LOCUS_02210 61113 61212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64152 62974 gene locus_tag LOCUS_02220 64152 62974 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_02220 65225 64164 gene locus_tag LOCUS_02230 65225 64164 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_02230 65682 65227 gene locus_tag LOCUS_02240 65682 65227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 66331 65687 gene locus_tag LOCUS_02250 66331 65687 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_02250 67102 66338 gene locus_tag LOCUS_02260 gene surE 67102 66338 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence004 586 661 gene locus_tag LOCUS_t00060 586 661 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 768 1187 gene locus_tag LOCUS_02270 768 1187 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_02270 2325 1162 gene locus_tag LOCUS_02280 2325 1162 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048106.1 protein_id gnl|my_center|LOCUS_02280 3776 2322 gene locus_tag LOCUS_02290 3776 2322 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_02290 5196 3760 gene locus_tag LOCUS_02300 5196 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 6536 5193 gene locus_tag LOCUS_02310 gene xseA 6536 5193 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937919.1 protein_id gnl|my_center|LOCUS_02310 7160 6591 gene locus_tag LOCUS_02320 7160 6591 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_02320 7567 7770 gene locus_tag LOCUS_02330 7567 7770 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_02330 7778 8857 gene locus_tag LOCUS_02340 7778 8857 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_02340 8868 9617 gene locus_tag LOCUS_02350 8868 9617 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869338.1 protein_id gnl|my_center|LOCUS_02350 9617 10156 gene locus_tag LOCUS_02360 9617 10156 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_02360 10233 11021 gene locus_tag LOCUS_02370 10233 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 11021 12421 gene locus_tag LOCUS_02380 11021 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 12418 13017 gene locus_tag LOCUS_02390 gene rnhB 12418 13017 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021956.1 protein_id gnl|my_center|LOCUS_02390 14312 13026 gene locus_tag LOCUS_02400 14312 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 14989 14312 gene locus_tag LOCUS_02410 14989 14312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 15273 15016 gene locus_tag LOCUS_02420 gene rpsT 15273 15016 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_02420 16560 15346 gene locus_tag LOCUS_02430 16560 15346 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_02430 17642 16560 gene locus_tag LOCUS_02440 17642 16560 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_02440 18629 17646 gene locus_tag LOCUS_02450 18629 17646 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402184.1 protein_id gnl|my_center|LOCUS_02450 19288 18626 gene locus_tag LOCUS_02460 gene queC 19288 18626 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_02460 19428 20369 gene locus_tag LOCUS_02470 gene trxB 19428 20369 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_02470 20362 22956 gene locus_tag LOCUS_02480 gene alaS 20362 22956 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815643.1 protein_id gnl|my_center|LOCUS_02480 22956 23915 gene locus_tag LOCUS_02490 22956 23915 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_02490 24373 24636 gene locus_tag LOCUS_02500 24373 24636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 27248 24786 gene locus_tag LOCUS_02510 27248 24786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 28757 27408 gene locus_tag LOCUS_02520 28757 27408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 30043 28754 gene locus_tag LOCUS_02530 gene aroC 30043 28754 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_02530 30848 30033 gene locus_tag LOCUS_02540 30848 30033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 31771 30872 gene locus_tag LOCUS_02550 gene miaA 31771 30872 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_02550 33666 31768 gene locus_tag LOCUS_02560 gene mutL 33666 31768 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_02560 35357 33696 gene locus_tag LOCUS_02570 35357 33696 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963991.1 protein_id gnl|my_center|LOCUS_02570 35488 36450 gene locus_tag LOCUS_02580 35488 36450 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_02580 39058 36428 gene locus_tag LOCUS_02590 39058 36428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 43604 39075 gene locus_tag LOCUS_02600 43604 39075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 44986 44015 gene locus_tag LOCUS_02610 44986 44015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 45216 45476 gene locus_tag LOCUS_02620 45216 45476 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079987.1 protein_id gnl|my_center|LOCUS_02620 45473 46882 gene locus_tag LOCUS_02630 gene hydG 45473 46882 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079985.1 protein_id gnl|my_center|LOCUS_02630 47564 46920 gene locus_tag LOCUS_02640 gene rhaD 47564 46920 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080415.1 protein_id gnl|my_center|LOCUS_02640 49093 47564 gene locus_tag LOCUS_02650 49093 47564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 49742 49104 gene locus_tag LOCUS_02660 49742 49104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 50563 49739 gene locus_tag LOCUS_02670 50563 49739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 51258 50560 gene locus_tag LOCUS_02680 51258 50560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 52187 51255 gene locus_tag LOCUS_02690 52187 51255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 53281 52484 gene locus_tag LOCUS_02700 53281 52484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 56555 53292 gene locus_tag LOCUS_02710 56555 53292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 56873 56972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57277 57891 gene locus_tag LOCUS_02720 57277 57891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 58538 57969 gene locus_tag LOCUS_02730 58538 57969 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_02730 60142 58538 gene locus_tag LOCUS_02740 60142 58538 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_02740 60925 60452 gene locus_tag LOCUS_02750 60925 60452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 61165 61770 gene locus_tag LOCUS_02760 61165 61770 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_02760 61773 62876 gene locus_tag LOCUS_02770 61773 62876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 62873 64435 gene locus_tag LOCUS_02780 gene murJ 62873 64435 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_02780 64411 66222 gene locus_tag LOCUS_02790 gene uvrC 64411 66222 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_02790 66226 67347 gene locus_tag LOCUS_02800 66226 67347 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence005 410 1075 gene locus_tag LOCUS_02810 410 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 1072 1848 gene locus_tag LOCUS_02820 1072 1848 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263654.1 protein_id gnl|my_center|LOCUS_02820 1845 2282 gene locus_tag LOCUS_02830 1845 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2286 3101 gene locus_tag LOCUS_02840 2286 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 3213 5972 gene locus_tag LOCUS_02850 3213 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 6042 6116 gene locus_tag LOCUS_t00070 6042 6116 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6224 8440 gene locus_tag LOCUS_02860 6224 8440 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005309.1 protein_id gnl|my_center|LOCUS_02860 12363 8722 gene locus_tag LOCUS_02870 12363 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 13149 12541 gene locus_tag LOCUS_02880 gene wrbA 13149 12541 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_02880 14242 13217 gene locus_tag LOCUS_02890 14242 13217 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798984.1 protein_id gnl|my_center|LOCUS_02890 15111 14425 gene locus_tag LOCUS_02900 15111 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 16166 15189 gene locus_tag LOCUS_02910 16166 15189 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_02910 17894 16170 gene locus_tag LOCUS_02920 17894 16170 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_02920 18298 17897 gene locus_tag LOCUS_02930 18298 17897 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143335.1 protein_id gnl|my_center|LOCUS_02930 18857 19969 gene locus_tag LOCUS_02940 18857 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 19987 20787 gene locus_tag LOCUS_02950 19987 20787 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_02950 20946 21806 gene locus_tag LOCUS_02960 gene pstC 20946 21806 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_02960 21803 22654 gene locus_tag LOCUS_02970 gene pstA 21803 22654 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_02970 22648 23400 gene locus_tag LOCUS_02980 gene pstB 22648 23400 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_02980 23458 24093 gene locus_tag LOCUS_02990 gene phoU 23458 24093 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880553.1 protein_id gnl|my_center|LOCUS_02990 24098 24784 gene locus_tag LOCUS_03000 gene baeR 24098 24784 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137862.1 protein_id gnl|my_center|LOCUS_03000 24786 26090 gene locus_tag LOCUS_03010 24786 26090 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_03010 26063 26584 gene locus_tag LOCUS_03020 26063 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 26682 29114 gene locus_tag LOCUS_03030 26682 29114 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_03030 29330 29166 gene locus_tag LOCUS_03040 29330 29166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 29486 30733 gene locus_tag LOCUS_03050 29486 30733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 30595 30694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30793 37506 gene locus_tag LOCUS_03060 30793 37506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 37632 38486 gene locus_tag LOCUS_03070 37632 38486 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249187.1 protein_id gnl|my_center|LOCUS_03070 38695 44025 gene locus_tag LOCUS_03080 38695 44025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 44341 45798 gene locus_tag LOCUS_03090 44341 45798 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680394.1 protein_id gnl|my_center|LOCUS_03090 45774 46676 gene locus_tag LOCUS_03100 45774 46676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 46699 47346 gene locus_tag LOCUS_03110 46699 47346 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_03110 48062 47343 gene locus_tag LOCUS_03120 48062 47343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 49012 48059 gene locus_tag LOCUS_03130 gene hemW 49012 48059 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_03130 50064 49144 gene locus_tag LOCUS_03140 gene lepB 50064 49144 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880589.1 protein_id gnl|my_center|LOCUS_03140 52250 50241 gene locus_tag LOCUS_03150 52250 50241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 53135 52251 gene locus_tag LOCUS_03160 53135 52251 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_03160 53773 53171 gene locus_tag LOCUS_03170 53773 53171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 55262 53766 gene locus_tag LOCUS_03180 55262 53766 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_03180 56815 55259 gene locus_tag LOCUS_03190 56815 55259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 57521 56760 gene locus_tag LOCUS_03200 gene mazG 57521 56760 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975271.1 protein_id gnl|my_center|LOCUS_03200 58809 57514 gene locus_tag LOCUS_03210 58809 57514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 59991 58822 gene locus_tag LOCUS_03220 59991 58822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 61269 60010 gene locus_tag LOCUS_03230 gene serS 61269 60010 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947906.1 protein_id gnl|my_center|LOCUS_03230 62049 61279 gene locus_tag LOCUS_03240 gene tpiA 62049 61279 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643975.1 protein_id gnl|my_center|LOCUS_03240 <63766 62531 gene locus_tag LOCUS_03250 <63766 62531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113966250.1:T9SS type A sorting domain-containing protein >Feature sequence006 201 2912 gene locus_tag LOCUS_03260 201 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6131 3390 gene locus_tag LOCUS_03270 6131 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 7347 6085 gene locus_tag LOCUS_03280 7347 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 7946 7347 gene locus_tag LOCUS_03290 7946 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 10137 7915 gene locus_tag LOCUS_03300 10137 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 11486 10137 gene locus_tag LOCUS_03310 gene fslC 11486 10137 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_03310 12558 11491 gene locus_tag LOCUS_03320 12558 11491 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_03320 12806 12558 gene locus_tag LOCUS_03330 12806 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 13151 15286 gene locus_tag LOCUS_03340 13151 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 15509 16489 gene locus_tag LOCUS_03350 15509 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 16482 17294 gene locus_tag LOCUS_03360 16482 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 17803 17333 gene locus_tag LOCUS_03370 17803 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 18414 17800 gene locus_tag LOCUS_03380 18414 17800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 18907 18407 gene locus_tag LOCUS_03390 18907 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 19275 18901 gene locus_tag LOCUS_03400 19275 18901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 19396 22710 gene locus_tag LOCUS_03410 19396 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 26140 22769 gene locus_tag LOCUS_03420 gene mfd 26140 22769 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_03420 27412 26156 gene locus_tag LOCUS_03430 gene hisS 27412 26156 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 protein_id gnl|my_center|LOCUS_03430 28205 27417 gene locus_tag LOCUS_03440 gene truA 28205 27417 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_03440 28854 28222 gene locus_tag LOCUS_03450 28854 28222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 31589 28851 gene locus_tag LOCUS_03460 31589 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 33150 31621 gene locus_tag LOCUS_03470 gene hutH 33150 31621 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017128.1 protein_id gnl|my_center|LOCUS_03470 35914 33464 gene locus_tag LOCUS_03480 35914 33464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 36136 37194 gene locus_tag LOCUS_03490 gene kdd 36136 37194 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_03490 37204 38448 gene locus_tag LOCUS_03500 gene ablA 37204 38448 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_03500 38453 39451 gene locus_tag LOCUS_03510 38453 39451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 39454 40377 gene locus_tag LOCUS_03520 39454 40377 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_03520 40374 41603 gene locus_tag LOCUS_03530 40374 41603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 42091 41612 gene locus_tag LOCUS_03540 42091 41612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 45065 42192 gene locus_tag LOCUS_03550 45065 42192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 45361 46017 gene locus_tag LOCUS_03560 45361 46017 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582946.1 protein_id gnl|my_center|LOCUS_03560 46240 46389 gene locus_tag LOCUS_03570 46240 46389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 47278 48699 gene locus_tag LOCUS_03580 47278 48699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 48865 51117 gene locus_tag LOCUS_03590 gene bamA 48865 51117 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_03590 51119 52066 gene locus_tag LOCUS_03600 51119 52066 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015868484.1 protein_id gnl|my_center|LOCUS_03600 52054 52761 gene locus_tag LOCUS_03610 gene ispD 52054 52761 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288292.1 protein_id gnl|my_center|LOCUS_03610 52767 55499 gene locus_tag LOCUS_03620 52767 55499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 55501 55983 gene locus_tag LOCUS_03630 gene ispF 55501 55983 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_03630 55980 56729 gene locus_tag LOCUS_03640 gene mobB 55980 56729 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867211.1 protein_id gnl|my_center|LOCUS_03640 56726 57337 gene locus_tag LOCUS_03650 56726 57337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 57373 57528 gene locus_tag LOCUS_03660 57373 57528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 58141 57515 gene locus_tag LOCUS_03670 58141 57515 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_03670 59337 58141 gene locus_tag LOCUS_03680 59337 58141 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455556.1 protein_id gnl|my_center|LOCUS_03680 60524 59334 gene locus_tag LOCUS_03690 60524 59334 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_03690 62495 60876 gene locus_tag LOCUS_03700 gene pruA 62495 60876 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence007 3671 1614 gene locus_tag LOCUS_03710 3671 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5492 4293 gene locus_tag LOCUS_03720 5492 4293 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_03720 6052 7170 gene locus_tag LOCUS_03730 6052 7170 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_03730 8410 7556 gene locus_tag LOCUS_03740 8410 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8796 9941 gene locus_tag LOCUS_03750 8796 9941 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_03750 11950 10211 gene locus_tag LOCUS_03760 gene rpoD 11950 10211 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_03760 13705 11978 gene locus_tag LOCUS_03770 gene dnaG 13705 11978 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546187.1 protein_id gnl|my_center|LOCUS_03770 16083 13744 gene locus_tag LOCUS_03780 16083 13744 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_03780 16616 16080 gene locus_tag LOCUS_03790 16616 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 16907 16701 gene locus_tag LOCUS_03800 gene rpsU 16907 16701 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_03800 17164 21957 gene locus_tag LOCUS_03810 17164 21957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 22483 22582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22651 22920 gene locus_tag LOCUS_03820 22651 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 23193 24068 gene locus_tag LOCUS_03830 gene dapA 23193 24068 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_03830 24082 27006 gene locus_tag LOCUS_03840 24082 27006 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_03840 27003 28067 gene locus_tag LOCUS_03850 27003 28067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 28064 28948 gene locus_tag LOCUS_03860 28064 28948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 28948 30663 gene locus_tag LOCUS_03870 gene recN 28948 30663 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_03870 30647 31543 gene locus_tag LOCUS_03880 30647 31543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 31556 31996 gene locus_tag LOCUS_03890 31556 31996 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_03890 32796 32017 gene locus_tag LOCUS_03900 gene rnc 32796 32017 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797266.1 protein_id gnl|my_center|LOCUS_03900 34104 32860 gene locus_tag LOCUS_03910 gene fabF 34104 32860 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_03910 34481 34248 gene locus_tag LOCUS_03920 gene acpP 34481 34248 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_03920 35300 34554 gene locus_tag LOCUS_03930 gene fabG 35300 34554 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_03930 36278 35346 gene locus_tag LOCUS_03940 gene fabD 36278 35346 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989819.1 protein_id gnl|my_center|LOCUS_03940 37279 36287 gene locus_tag LOCUS_03950 37279 36287 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_03950 38274 37279 gene locus_tag LOCUS_03960 gene plsX 38274 37279 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_03960 38456 38277 gene locus_tag LOCUS_03970 gene rpmF 38456 38277 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_03970 38793 41897 gene locus_tag LOCUS_03980 38793 41897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 42216 42593 gene locus_tag LOCUS_03990 42216 42593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 42590 43465 gene locus_tag LOCUS_04000 42590 43465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 44787 43462 gene locus_tag LOCUS_04010 44787 43462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 44918 46009 gene locus_tag LOCUS_04020 44918 46009 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_04020 46011 46748 gene locus_tag LOCUS_04030 46011 46748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 46784 48229 gene locus_tag LOCUS_04040 46784 48229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 48274 48843 gene locus_tag LOCUS_04050 48274 48843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 48853 49284 gene locus_tag LOCUS_04060 48853 49284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 49289 51469 gene locus_tag LOCUS_04070 gene pcrA 49289 51469 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 protein_id gnl|my_center|LOCUS_04070 51963 51493 gene locus_tag LOCUS_04080 51963 51493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 52341 53099 gene locus_tag LOCUS_04090 52341 53099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 53243 54475 gene locus_tag LOCUS_04100 53243 54475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 54714 54511 gene locus_tag LOCUS_04110 54714 54511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 <56214 54985 gene locus_tag LOCUS_04120 <56214 54985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence008 381 2279 gene locus_tag LOCUS_04130 gene gyrB 381 2279 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_04130 2292 4919 gene locus_tag LOCUS_04140 gene gyrA 2292 4919 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_04140 4903 5460 gene locus_tag LOCUS_04150 4903 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6153 5623 gene locus_tag LOCUS_04160 6153 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7414 6167 gene locus_tag LOCUS_04170 gene clpX 7414 6167 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_04170 8015 7416 gene locus_tag LOCUS_04180 gene clpP 8015 7416 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_04180 9322 8012 gene locus_tag LOCUS_04190 gene tig 9322 8012 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_04190 9438 9352 gene locus_tag LOCUS_t00080 9438 9352 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9923 9519 gene locus_tag LOCUS_04200 9923 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 9969 10068 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11186 10284 gene locus_tag LOCUS_04210 11186 10284 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_04210 12058 11192 gene locus_tag LOCUS_04220 12058 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 13589 12198 gene locus_tag LOCUS_04230 13589 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 14315 13599 gene locus_tag LOCUS_04240 14315 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 15032 14316 gene locus_tag LOCUS_04250 15032 14316 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_04250 16490 15045 gene locus_tag LOCUS_04260 16490 15045 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047913.1 protein_id gnl|my_center|LOCUS_04260 18827 16500 gene locus_tag LOCUS_04270 gene lon 18827 16500 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_04270 19063 20514 gene locus_tag LOCUS_04280 gene htrA 19063 20514 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872209.1 protein_id gnl|my_center|LOCUS_04280 21738 20671 gene locus_tag LOCUS_04290 21738 20671 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789721.1 protein_id gnl|my_center|LOCUS_04290 22060 22494 gene locus_tag LOCUS_04300 22060 22494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 22506 23294 gene locus_tag LOCUS_04310 22506 23294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 24054 23281 gene locus_tag LOCUS_04320 gene xth 24054 23281 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_04320 24855 24091 gene locus_tag LOCUS_04330 24855 24091 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_04330 26559 24868 gene locus_tag LOCUS_04340 26559 24868 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_04340 27784 26621 gene locus_tag LOCUS_04350 27784 26621 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_04350 28515 27781 gene locus_tag LOCUS_04360 28515 27781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 29783 28512 gene locus_tag LOCUS_04370 29783 28512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 30960 29785 gene locus_tag LOCUS_04380 30960 29785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 31636 30938 gene locus_tag LOCUS_04390 31636 30938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_04390 32674 31646 gene locus_tag LOCUS_04400 32674 31646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 33279 32671 gene locus_tag LOCUS_04410 33279 32671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 33381 33480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36730 33866 gene locus_tag LOCUS_04420 36730 33866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 37003 38244 gene locus_tag LOCUS_04430 37003 38244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 39286 38351 gene locus_tag LOCUS_04440 39286 38351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_04440 39806 39264 gene locus_tag LOCUS_04450 39806 39264 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_04450 40141 39803 gene locus_tag LOCUS_04460 40141 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 41288 40143 gene locus_tag LOCUS_04470 41288 40143 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_04470 42360 41674 gene locus_tag LOCUS_04480 42360 41674 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211607.1 protein_id gnl|my_center|LOCUS_04480 42717 42370 gene locus_tag LOCUS_04490 42717 42370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 43019 42714 gene locus_tag LOCUS_04500 43019 42714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 43979 43029 gene locus_tag LOCUS_04510 43979 43029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 44349 45590 gene locus_tag LOCUS_04520 gene rocD 44349 45590 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_04520 45639 46523 gene locus_tag LOCUS_04530 gene era 45639 46523 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_04530 46569 48458 gene locus_tag LOCUS_04540 46569 48458 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870698.1 protein_id gnl|my_center|LOCUS_04540 48710 49867 gene locus_tag LOCUS_04550 gene rsxC 48710 49867 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_04550 49869 50969 gene locus_tag LOCUS_04560 49869 50969 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_04560 50966 51511 gene locus_tag LOCUS_04570 50966 51511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 51508 52098 gene locus_tag LOCUS_04580 51508 52098 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_04580 52098 52706 gene locus_tag LOCUS_04590 gene rsxA 52098 52706 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_04590 52716 53738 gene locus_tag LOCUS_04600 52716 53738 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence009 80 7 gene locus_tag LOCUS_t00090 80 7 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 170 96 gene locus_tag LOCUS_t00100 170 96 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 272 182 gene locus_tag LOCUS_t00110 272 182 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 388 303 gene locus_tag LOCUS_t00120 388 303 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 792 1652 gene locus_tag LOCUS_04610 792 1652 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394087.1 protein_id gnl|my_center|LOCUS_04610 1725 2558 gene locus_tag LOCUS_04620 1725 2558 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109283.1 protein_id gnl|my_center|LOCUS_04620 2759 4291 gene locus_tag LOCUS_04630 2759 4291 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084529509.1 protein_id gnl|my_center|LOCUS_04630 4388 5569 gene locus_tag LOCUS_04640 gene mrfB 4388 5569 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_04640 6493 5885 gene locus_tag LOCUS_04650 6493 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6876 6490 gene locus_tag LOCUS_04660 6876 6490 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_04660 8333 6873 gene locus_tag LOCUS_04670 8333 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9715 8375 gene locus_tag LOCUS_04680 9715 8375 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_04680 11451 9715 gene locus_tag LOCUS_04690 gene ptsP 11451 9715 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722867.1 protein_id gnl|my_center|LOCUS_04690 11720 11457 gene locus_tag LOCUS_04700 11720 11457 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_04700 12669 11689 gene locus_tag LOCUS_04710 gene hprK 12669 11689 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_04710 13336 12800 gene locus_tag LOCUS_04720 gene raiA 13336 12800 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583763.1 protein_id gnl|my_center|LOCUS_04720 14748 13348 gene locus_tag LOCUS_04730 gene lpdA 14748 13348 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_04730 16218 14758 gene locus_tag LOCUS_04740 gene rpoN 16218 14758 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_04740 16964 16215 gene locus_tag LOCUS_04750 gene lptB 16964 16215 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_04750 18076 16997 gene locus_tag LOCUS_04760 18076 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 18572 18054 gene locus_tag LOCUS_04770 18572 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 19156 18587 gene locus_tag LOCUS_04780 19156 18587 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021132.1 protein_id gnl|my_center|LOCUS_04780 19964 19158 gene locus_tag LOCUS_04790 gene kdsA 19964 19158 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946916.1 protein_id gnl|my_center|LOCUS_04790 21134 19974 gene locus_tag LOCUS_04800 gene metK 21134 19974 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_04800 21376 21301 gene locus_tag LOCUS_t00130 21376 21301 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22915 21812 gene locus_tag LOCUS_04810 22915 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 23648 22926 gene locus_tag LOCUS_04820 23648 22926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 25701 24550 gene locus_tag LOCUS_04830 25701 24550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 26061 27386 gene locus_tag LOCUS_04840 26061 27386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 27399 33125 gene locus_tag LOCUS_04850 27399 33125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 33241 33789 gene locus_tag LOCUS_04860 33241 33789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 33776 34354 gene locus_tag LOCUS_04870 33776 34354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 34351 34773 gene locus_tag LOCUS_04880 gene ruvX 34351 34773 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597453.1 protein_id gnl|my_center|LOCUS_04880 34766 35752 gene locus_tag LOCUS_04890 gene mltG 34766 35752 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671179.1 protein_id gnl|my_center|LOCUS_04890 35848 36408 gene locus_tag LOCUS_04900 35848 36408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 37356 36886 gene locus_tag LOCUS_04910 gene rpsG 37356 36886 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507761.1 protein_id gnl|my_center|LOCUS_04910 37744 37367 gene locus_tag LOCUS_04920 gene rpsL 37744 37367 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_04920 42265 37787 gene locus_tag LOCUS_04930 gene rpoC 42265 37787 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_04930 46057 42278 gene locus_tag LOCUS_04940 gene rpoB 46057 42278 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_04940 46639 46262 gene locus_tag LOCUS_04950 gene rplL 46639 46262 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_04950 47209 46673 gene locus_tag LOCUS_04960 gene rplJ 47209 46673 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_04960 47929 47225 gene locus_tag LOCUS_04970 gene rplA 47929 47225 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_04970 48399 47968 gene locus_tag LOCUS_04980 gene rplK 48399 47968 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_04980 48968 48429 gene locus_tag LOCUS_04990 gene nusG 48968 48429 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316434.1 protein_id gnl|my_center|LOCUS_04990 49165 48980 gene locus_tag LOCUS_05000 49165 48980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 49271 49196 gene locus_tag LOCUS_t00140 49271 49196 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 50641 49457 gene locus_tag LOCUS_05010 gene tuf 50641 49457 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_05010 50811 50736 gene locus_tag LOCUS_t00150 50811 50736 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 50921 50845 gene locus_tag LOCUS_t00160 50921 50845 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51023 50938 gene locus_tag LOCUS_t00170 51023 50938 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 51105 51031 gene locus_tag LOCUS_t00180 51105 51031 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 52440 51700 gene locus_tag LOCUS_05020 52440 51700 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_05020 53323 52412 gene locus_tag LOCUS_05030 53323 52412 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence010 326 1516 gene locus_tag LOCUS_05040 326 1516 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_05040 1532 2581 gene locus_tag LOCUS_05050 1532 2581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_05050 2578 3300 gene locus_tag LOCUS_05060 2578 3300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_05060 3302 4864 gene locus_tag LOCUS_05070 3302 4864 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114912.1 protein_id gnl|my_center|LOCUS_05070 4857 5780 gene locus_tag LOCUS_05080 4857 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5777 6199 gene locus_tag LOCUS_05090 5777 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6199 7512 gene locus_tag LOCUS_05100 gene trmFO 6199 7512 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 protein_id gnl|my_center|LOCUS_05100 7574 7906 gene locus_tag LOCUS_05110 7574 7906 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_05110 7915 8994 gene locus_tag LOCUS_05120 7915 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 9095 12265 gene locus_tag LOCUS_05130 9095 12265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 12778 12266 gene locus_tag LOCUS_05140 12778 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13415 12819 gene locus_tag LOCUS_05150 gene rsmD 13415 12819 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_05150 14147 13584 gene locus_tag LOCUS_05160 14147 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 14574 15638 gene locus_tag LOCUS_05170 14574 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 15849 15604 gene locus_tag LOCUS_05180 15849 15604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 16211 18196 gene locus_tag LOCUS_05190 16211 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 18715 20037 gene locus_tag LOCUS_05200 gene ssnA 18715 20037 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_05200 20096 21289 gene locus_tag LOCUS_05210 20096 21289 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107117.1 protein_id gnl|my_center|LOCUS_05210 21286 22479 gene locus_tag LOCUS_05220 21286 22479 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_05220 22469 23458 gene locus_tag LOCUS_05230 22469 23458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 23475 25718 gene locus_tag LOCUS_05240 23475 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 25715 26176 gene locus_tag LOCUS_05250 25715 26176 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_05250 26196 27362 gene locus_tag LOCUS_05260 gene ygeW 26196 27362 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_05260 27981 28406 gene locus_tag LOCUS_05270 27981 28406 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_05270 28735 30180 gene locus_tag LOCUS_05280 28735 30180 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_05280 30248 30661 gene locus_tag LOCUS_05290 30248 30661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 30751 31311 gene locus_tag LOCUS_05300 30751 31311 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_05300 31646 32248 gene locus_tag LOCUS_05310 31646 32248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 32238 32576 gene locus_tag LOCUS_05320 32238 32576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 34443 32773 gene locus_tag LOCUS_05330 34443 32773 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_05330 34638 36860 gene locus_tag LOCUS_05340 34638 36860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 38563 37124 gene locus_tag LOCUS_05350 38563 37124 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_05350 39904 38576 gene locus_tag LOCUS_05360 39904 38576 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_05360 41190 39925 gene locus_tag LOCUS_05370 41190 39925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 41954 41190 gene locus_tag LOCUS_05380 gene fabI 41954 41190 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383908.1 protein_id gnl|my_center|LOCUS_05380 42817 41957 gene locus_tag LOCUS_05390 42817 41957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 43895 42807 gene locus_tag LOCUS_05400 43895 42807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 44600 43941 gene locus_tag LOCUS_05410 44600 43941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 45361 44597 gene locus_tag LOCUS_05420 45361 44597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 45730 45380 gene locus_tag LOCUS_05430 45730 45380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 46313 46239 gene locus_tag LOCUS_t00190 46313 46239 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 46413 46337 gene locus_tag LOCUS_t00200 46413 46337 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 46498 46422 gene locus_tag LOCUS_t00210 46498 46422 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 46618 46543 gene locus_tag LOCUS_t00220 46618 46543 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 47629 46889 gene locus_tag LOCUS_05440 gene phnC 47629 46889 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_05440 48552 47629 gene locus_tag LOCUS_05450 48552 47629 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915065.1 protein_id gnl|my_center|LOCUS_05450 <52418 48847 gene locus_tag LOCUS_05460 <52418 48847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114304.1:ExeM/NucH family extracellular endonuclease >Feature sequence011 406 2046 gene locus_tag LOCUS_05470 406 2046 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_05470 2161 3339 gene locus_tag LOCUS_05480 2161 3339 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_05480 3361 4095 gene locus_tag LOCUS_05490 3361 4095 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073618.1 protein_id gnl|my_center|LOCUS_05490 4108 5004 gene locus_tag LOCUS_05500 4108 5004 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_05500 5026 5376 gene locus_tag LOCUS_05510 5026 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 5382 5469 gene locus_tag LOCUS_t00230 5382 5469 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7241 5562 gene locus_tag LOCUS_05520 7241 5562 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_05520 7506 7294 gene locus_tag LOCUS_05530 7506 7294 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966272.1 protein_id gnl|my_center|LOCUS_05530 7681 8043 gene locus_tag LOCUS_05540 7681 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 8040 8978 gene locus_tag LOCUS_05550 8040 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 8975 9910 gene locus_tag LOCUS_05560 8975 9910 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869986.1 protein_id gnl|my_center|LOCUS_05560 9925 11025 gene locus_tag LOCUS_05570 9925 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 11039 11716 gene locus_tag LOCUS_05580 11039 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 11728 14094 gene locus_tag LOCUS_05590 11728 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 14182 16080 gene locus_tag LOCUS_05600 14182 16080 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_05600 16257 16054 gene locus_tag LOCUS_05610 16257 16054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 16307 16406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16560 16838 gene locus_tag LOCUS_05620 16560 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 16867 17049 gene locus_tag LOCUS_05630 16867 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 18151 17150 gene locus_tag LOCUS_05640 gene argF 18151 17150 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986907.1 protein_id gnl|my_center|LOCUS_05640 18518 19762 gene locus_tag LOCUS_05650 18518 19762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 19766 21106 gene locus_tag LOCUS_05660 19766 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 21106 21855 gene locus_tag LOCUS_05670 21106 21855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_05670 21859 23070 gene locus_tag LOCUS_05680 21859 23070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_05680 23329 25440 gene locus_tag LOCUS_05690 gene fusA 23329 25440 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_05690 25506 25814 gene locus_tag LOCUS_05700 25506 25814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 25818 26744 gene locus_tag LOCUS_05710 25818 26744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 26734 27537 gene locus_tag LOCUS_05720 gene prmC 26734 27537 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104948.1 protein_id gnl|my_center|LOCUS_05720 27539 28792 gene locus_tag LOCUS_05730 gene murA 27539 28792 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_05730 32755 28865 gene locus_tag LOCUS_05740 32755 28865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 32926 33501 gene locus_tag LOCUS_05750 32926 33501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 33501 34634 gene locus_tag LOCUS_05760 gene lpxB 33501 34634 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931972.1 protein_id gnl|my_center|LOCUS_05760 34627 35229 gene locus_tag LOCUS_05770 34627 35229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 36717 35428 gene locus_tag LOCUS_05780 36717 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 37443 36925 gene locus_tag LOCUS_05790 37443 36925 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562679.1 protein_id gnl|my_center|LOCUS_05790 39246 37465 gene locus_tag LOCUS_05800 39246 37465 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_05800 39848 39243 gene locus_tag LOCUS_05810 39848 39243 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681263.1 protein_id gnl|my_center|LOCUS_05810 41155 39833 gene locus_tag LOCUS_05820 41155 39833 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_05820 41361 41155 gene locus_tag LOCUS_05830 41361 41155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 43136 41358 gene locus_tag LOCUS_05840 43136 41358 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538526.1 protein_id gnl|my_center|LOCUS_05840 41377 41476 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44026 43148 gene locus_tag LOCUS_05850 44026 43148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 44628 44029 gene locus_tag LOCUS_05860 44628 44029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 45884 44760 gene locus_tag LOCUS_05870 45884 44760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 45962 46061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46586 46843 gene locus_tag LOCUS_05880 46586 46843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 48491 46734 gene locus_tag LOCUS_05890 48491 46734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229520.1 protein_id gnl|my_center|LOCUS_05890 48761 48684 gene locus_tag LOCUS_t00240 48761 48684 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 50197 48806 gene locus_tag LOCUS_05900 50197 48806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence012 3323 2271 gene locus_tag LOCUS_05910 3323 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4963 3371 gene locus_tag LOCUS_05920 gene dnaX 4963 3371 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_05920 5097 6314 gene locus_tag LOCUS_05930 5097 6314 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_05930 8468 6318 gene locus_tag LOCUS_05940 8468 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 11374 8471 gene locus_tag LOCUS_05950 gene uvrA 11374 8471 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257559.1 protein_id gnl|my_center|LOCUS_05950 12284 11775 gene locus_tag LOCUS_05960 12284 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 12526 12625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13986 12655 gene locus_tag LOCUS_05970 gene ffh 13986 12655 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_05970 14630 13986 gene locus_tag LOCUS_05980 gene rpe 14630 13986 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082234.1 protein_id gnl|my_center|LOCUS_05980 14989 14627 gene locus_tag LOCUS_05990 14989 14627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 15565 14990 gene locus_tag LOCUS_06000 15565 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 16031 15582 gene locus_tag LOCUS_06010 gene rplI 16031 15582 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881335.1 protein_id gnl|my_center|LOCUS_06010 16864 16028 gene locus_tag LOCUS_06020 16864 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 17105 16869 gene locus_tag LOCUS_06030 17105 16869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 17554 17114 gene locus_tag LOCUS_06040 17554 17114 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_06040 17857 17567 gene locus_tag LOCUS_06050 gene rpsF 17857 17567 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855074.1 protein_id gnl|my_center|LOCUS_06050 18452 17802 gene locus_tag LOCUS_06060 gene pth 18452 17802 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722742.1 protein_id gnl|my_center|LOCUS_06060 19065 18463 gene locus_tag LOCUS_06070 19065 18463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 20032 19085 gene locus_tag LOCUS_06080 20032 19085 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_06080 20718 20017 gene locus_tag LOCUS_06090 gene ispE 20718 20017 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_06090 23107 20822 gene locus_tag LOCUS_06100 23107 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 23605 23123 gene locus_tag LOCUS_06110 23605 23123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 24549 23782 gene locus_tag LOCUS_06120 24549 23782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 25568 24558 gene locus_tag LOCUS_06130 25568 24558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 30598 25580 gene locus_tag LOCUS_06140 30598 25580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 31844 30609 gene locus_tag LOCUS_06150 gene purD 31844 30609 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101936.1 protein_id gnl|my_center|LOCUS_06150 33073 31841 gene locus_tag LOCUS_06160 33073 31841 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_06160 34600 33077 gene locus_tag LOCUS_06170 gene proS 34600 33077 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_06170 37381 35024 gene locus_tag LOCUS_06180 37381 35024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 38319 37402 gene locus_tag LOCUS_06190 gene folD 38319 37402 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_06190 39105 38320 gene locus_tag LOCUS_06200 gene ymdB 39105 38320 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_06200 40671 39106 gene locus_tag LOCUS_06210 gene rny 40671 39106 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965122.1 protein_id gnl|my_center|LOCUS_06210 40655 40903 gene locus_tag LOCUS_06220 40655 40903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 41166 40900 gene locus_tag LOCUS_06230 41166 40900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 41493 41170 gene locus_tag LOCUS_06240 41493 41170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 44006 41496 gene locus_tag LOCUS_06250 gene pheT 44006 41496 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_06250 45011 44007 gene locus_tag LOCUS_06260 gene pheS 45011 44007 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458978.1 protein_id gnl|my_center|LOCUS_06260 45508 45158 gene locus_tag LOCUS_06270 gene rplT 45508 45158 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 protein_id gnl|my_center|LOCUS_06270 45715 45521 gene locus_tag LOCUS_06280 gene rpmI 45715 45521 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_06280 46394 45786 gene locus_tag LOCUS_06290 gene infC 46394 45786 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216580.1 protein_id gnl|my_center|LOCUS_06290 48045 47362 gene locus_tag LOCUS_06300 48045 47362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_06300 48641 48042 gene locus_tag LOCUS_06310 48641 48042 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769285.1 protein_id gnl|my_center|LOCUS_06310 48792 48718 gene locus_tag LOCUS_t00250 48792 48718 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 48888 48802 gene locus_tag LOCUS_t00260 48888 48802 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49016 48943 gene locus_tag LOCUS_t00270 49016 48943 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 49100 49026 gene locus_tag LOCUS_t00280 49100 49026 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 2721 1885 gene locus_tag LOCUS_06320 2721 1885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383350.1 protein_id gnl|my_center|LOCUS_06320 4221 3136 gene locus_tag LOCUS_06330 gene meaB 4221 3136 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 protein_id gnl|my_center|LOCUS_06330 6349 4214 gene locus_tag LOCUS_06340 gene scpA 6349 4214 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_06340 8232 6346 gene locus_tag LOCUS_06350 gene mutA 8232 6346 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 protein_id gnl|my_center|LOCUS_06350 9537 8251 gene locus_tag LOCUS_06360 9537 8251 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_06360 10158 11624 gene locus_tag LOCUS_06370 10158 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 11621 13051 gene locus_tag LOCUS_06380 11621 13051 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 protein_id gnl|my_center|LOCUS_06380 13048 15498 gene locus_tag LOCUS_06390 13048 15498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 15505 16158 gene locus_tag LOCUS_06400 gene udk 15505 16158 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_06400 17023 16160 gene locus_tag LOCUS_06410 17023 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 20226 17023 gene locus_tag LOCUS_06420 20226 17023 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839665.1 protein_id gnl|my_center|LOCUS_06420 21525 20245 gene locus_tag LOCUS_06430 21525 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 22210 21518 gene locus_tag LOCUS_06440 22210 21518 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852800.1 protein_id gnl|my_center|LOCUS_06440 23505 22207 gene locus_tag LOCUS_06450 23505 22207 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583021.1 protein_id gnl|my_center|LOCUS_06450 24860 23505 gene locus_tag LOCUS_06460 gene hslU 24860 23505 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_06460 25401 24862 gene locus_tag LOCUS_06470 gene hslV 25401 24862 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_06470 27568 25394 gene locus_tag LOCUS_06480 gene ftsH 27568 25394 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_06480 28110 27565 gene locus_tag LOCUS_06490 gene hpt 28110 27565 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_06490 29542 28091 gene locus_tag LOCUS_06500 gene tilS 29542 28091 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_06500 30388 29642 gene locus_tag LOCUS_06510 30388 29642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 31414 30641 gene locus_tag LOCUS_06520 31414 30641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 32189 31428 gene locus_tag LOCUS_06530 32189 31428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 32592 33482 gene locus_tag LOCUS_06540 32592 33482 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_06540 33577 34278 gene locus_tag LOCUS_06550 33577 34278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 34271 35248 gene locus_tag LOCUS_06560 34271 35248 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946498.1 protein_id gnl|my_center|LOCUS_06560 35248 36093 gene locus_tag LOCUS_06570 35248 36093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 36086 37099 gene locus_tag LOCUS_06580 36086 37099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 37083 38057 gene locus_tag LOCUS_06590 37083 38057 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_06590 38089 39021 gene locus_tag LOCUS_06600 38089 39021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 39024 39123 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40062 39241 gene locus_tag LOCUS_06610 40062 39241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 41450 40062 gene locus_tag LOCUS_06620 gene cysS 41450 40062 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966454.1 protein_id gnl|my_center|LOCUS_06620 45328 41462 gene locus_tag LOCUS_06630 gene porU 45328 41462 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_06630 45477 45325 gene locus_tag LOCUS_06640 45477 45325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 45952 45488 gene locus_tag LOCUS_06650 gene rlmH 45952 45488 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 protein_id gnl|my_center|LOCUS_06650 46852 45953 gene locus_tag LOCUS_06660 gene ptb 46852 45953 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_06660 47753 46866 gene locus_tag LOCUS_06670 47753 46866 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_06670 48864 47764 gene locus_tag LOCUS_06680 48864 47764 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065597567.1 protein_id gnl|my_center|LOCUS_06680 49135 48866 gene locus_tag LOCUS_06690 49135 48866 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243829.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence014 1109 8050 gene locus_tag LOCUS_06700 1109 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 8177 8482 gene locus_tag LOCUS_06710 gene trxA 8177 8482 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_06710 8498 9382 gene locus_tag LOCUS_06720 8498 9382 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_06720 10163 9441 gene locus_tag LOCUS_06730 10163 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 10217 10316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10432 12786 gene locus_tag LOCUS_06740 10432 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 13148 13247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13253 14782 gene locus_tag LOCUS_06750 13253 14782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 14788 15519 gene locus_tag LOCUS_06760 14788 15519 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_06760 15556 15903 gene locus_tag LOCUS_06770 gene bldG 15556 15903 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_06770 15930 17339 gene locus_tag LOCUS_06780 15930 17339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 17336 18475 gene locus_tag LOCUS_06790 17336 18475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 18475 19611 gene locus_tag LOCUS_06800 18475 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 19604 21601 gene locus_tag LOCUS_06810 19604 21601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 21567 22658 gene locus_tag LOCUS_06820 21567 22658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 22702 24105 gene locus_tag LOCUS_06830 22702 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 24098 24505 gene locus_tag LOCUS_06840 24098 24505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 24502 25686 gene locus_tag LOCUS_06850 24502 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 25683 26480 gene locus_tag LOCUS_06860 25683 26480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 26487 28064 gene locus_tag LOCUS_06870 26487 28064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 31332 28270 gene locus_tag LOCUS_06880 31332 28270 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_06880 32492 31329 gene locus_tag LOCUS_06890 32492 31329 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_06890 33646 32633 gene locus_tag LOCUS_06900 33646 32633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 34875 33817 gene locus_tag LOCUS_06910 34875 33817 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_06910 35280 34885 gene locus_tag LOCUS_06920 35280 34885 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_06920 36011 35430 gene locus_tag LOCUS_06930 36011 35430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 37341 36025 gene locus_tag LOCUS_06940 37341 36025 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_06940 37934 37338 gene locus_tag LOCUS_06950 gene ruvA 37934 37338 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_06950 38416 37931 gene locus_tag LOCUS_06960 gene ruvC 38416 37931 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022509.1 protein_id gnl|my_center|LOCUS_06960 39171 38422 gene locus_tag LOCUS_06970 39171 38422 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_06970 41243 39186 gene locus_tag LOCUS_06980 gene fusA 41243 39186 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_06980 41397 41669 gene locus_tag LOCUS_06990 41397 41669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 42638 41889 gene locus_tag LOCUS_07000 42638 41889 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_07000 43075 42656 gene locus_tag LOCUS_07010 43075 42656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 44342 43131 gene locus_tag LOCUS_07020 44342 43131 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_07020 45757 44462 gene locus_tag LOCUS_07030 gene asnS 45757 44462 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_07030 46760 45762 gene locus_tag LOCUS_07040 46760 45762 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_07040 47722 46769 gene locus_tag LOCUS_07050 47722 46769 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence015 3886 602 gene locus_tag LOCUS_07060 3886 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 6066 3964 gene locus_tag LOCUS_07070 gene recG 6066 3964 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403048.1 protein_id gnl|my_center|LOCUS_07070 6791 6162 gene locus_tag LOCUS_07080 6791 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 8390 6798 gene locus_tag LOCUS_07090 8390 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 9013 8402 gene locus_tag LOCUS_07100 gene tmk 9013 8402 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_07100 10628 9027 gene locus_tag LOCUS_07110 gene nadB 10628 9027 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_07110 11074 10625 gene locus_tag LOCUS_07120 gene rimI 11074 10625 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_07120 12733 11081 gene locus_tag LOCUS_07130 gene argS 12733 11081 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_07130 13083 12730 gene locus_tag LOCUS_07140 gene rsfS 13083 12730 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938909.1 protein_id gnl|my_center|LOCUS_07140 13444 13100 gene locus_tag LOCUS_07150 13444 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 14051 13548 gene locus_tag LOCUS_07160 14051 13548 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583739.1 protein_id gnl|my_center|LOCUS_07160 15072 14044 gene locus_tag LOCUS_07170 15072 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 15542 15069 gene locus_tag LOCUS_07180 gene folK 15542 15069 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_07180 15898 15539 gene locus_tag LOCUS_07190 gene folB 15898 15539 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733322.1 protein_id gnl|my_center|LOCUS_07190 16304 15879 gene locus_tag LOCUS_07200 16304 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 16783 16304 gene locus_tag LOCUS_07210 16783 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07210 17756 16770 gene locus_tag LOCUS_07220 gene rfaE1 17756 16770 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_07220 18984 17740 gene locus_tag LOCUS_07230 gene purF 18984 17740 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_07230 18991 19090 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20668 19322 gene locus_tag LOCUS_07240 gene der 20668 19322 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_07240 21044 22633 gene locus_tag LOCUS_07250 21044 22633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 22664 23731 gene locus_tag LOCUS_07260 22664 23731 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211853.1 protein_id gnl|my_center|LOCUS_07260 23748 24083 gene locus_tag LOCUS_07270 23748 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 24722 24222 gene locus_tag LOCUS_07280 24722 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 25932 24733 gene locus_tag LOCUS_07290 25932 24733 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675897.1 protein_id gnl|my_center|LOCUS_07290 26514 25936 gene locus_tag LOCUS_07300 26514 25936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 27291 26515 gene locus_tag LOCUS_07310 27291 26515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 28513 27281 gene locus_tag LOCUS_07320 28513 27281 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869755.1 protein_id gnl|my_center|LOCUS_07320 29538 28507 gene locus_tag LOCUS_07330 29538 28507 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927015.1 protein_id gnl|my_center|LOCUS_07330 30280 29522 gene locus_tag LOCUS_07340 30280 29522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 30989 30285 gene locus_tag LOCUS_07350 30989 30285 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_07350 32690 31002 gene locus_tag LOCUS_07360 32690 31002 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173427597.1 protein_id gnl|my_center|LOCUS_07360 33326 32694 gene locus_tag LOCUS_07370 33326 32694 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 protein_id gnl|my_center|LOCUS_07370 33760 33371 gene locus_tag LOCUS_07380 gene acpS 33760 33371 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048318.1 protein_id gnl|my_center|LOCUS_07380 34224 33760 gene locus_tag LOCUS_07390 34224 33760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 34659 34306 gene locus_tag LOCUS_07400 gene rplS 34659 34306 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068669.1 protein_id gnl|my_center|LOCUS_07400 35614 34931 gene locus_tag LOCUS_07410 gene trmD 35614 34931 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724048.1 protein_id gnl|my_center|LOCUS_07410 36155 35604 gene locus_tag LOCUS_07420 36155 35604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 36386 36156 gene locus_tag LOCUS_07430 36386 36156 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_07430 36685 36410 gene locus_tag LOCUS_07440 gene rpsP 36685 36410 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813195.1 protein_id gnl|my_center|LOCUS_07440 37814 36906 gene locus_tag LOCUS_07450 37814 36906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 39775 37811 gene locus_tag LOCUS_07460 gene asnB 39775 37811 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence016 <1 790 gene locus_tag LOCUS_07470 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000384831.1:class I SAM-dependent DNA methyltransferase 938 1336 gene locus_tag LOCUS_07480 938 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1352 2152 gene locus_tag LOCUS_07490 1352 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2165 2641 gene locus_tag LOCUS_07500 2165 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4583 2865 gene locus_tag LOCUS_07510 4583 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4993 6267 gene locus_tag LOCUS_07520 4993 6267 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_07520 6264 7439 gene locus_tag LOCUS_07530 6264 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 7436 8560 gene locus_tag LOCUS_07540 7436 8560 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876410.1 protein_id gnl|my_center|LOCUS_07540 8557 8868 gene locus_tag LOCUS_07550 8557 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 8868 10541 gene locus_tag LOCUS_07560 8868 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 10586 11689 gene locus_tag LOCUS_07570 gene ugpC 10586 11689 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_07570 11742 12446 gene locus_tag LOCUS_07580 11742 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 12368 13915 gene locus_tag LOCUS_07590 12368 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 14551 14015 gene locus_tag LOCUS_07600 14551 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 17011 14738 gene locus_tag LOCUS_07610 gene xdhB 17011 14738 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_07610 18455 17004 gene locus_tag LOCUS_07620 gene xdhA 18455 17004 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972218.1 protein_id gnl|my_center|LOCUS_07620 18889 18575 gene locus_tag LOCUS_07630 18889 18575 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409908.1 protein_id gnl|my_center|LOCUS_07630 19228 18890 gene locus_tag LOCUS_07640 19228 18890 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 protein_id gnl|my_center|LOCUS_07640 19334 19501 gene locus_tag LOCUS_07650 19334 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 19632 20411 gene locus_tag LOCUS_07660 19632 20411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 20408 21709 gene locus_tag LOCUS_07670 20408 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 22053 23249 gene locus_tag LOCUS_07680 22053 23249 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392801.1 protein_id gnl|my_center|LOCUS_07680 23246 23758 gene locus_tag LOCUS_07690 23246 23758 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_07690 23822 24832 gene locus_tag LOCUS_07700 23822 24832 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461076.1 protein_id gnl|my_center|LOCUS_07700 24657 24756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24787 25032 gene locus_tag LOCUS_07710 24787 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 26460 25180 gene locus_tag LOCUS_07720 gene eno 26460 25180 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_07720 26989 26549 gene locus_tag LOCUS_07730 26989 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 29560 26999 gene locus_tag LOCUS_07740 29560 26999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 29813 29643 gene locus_tag LOCUS_07750 29813 29643 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869128.1 protein_id gnl|my_center|LOCUS_07750 30076 31407 gene locus_tag LOCUS_07760 30076 31407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 33925 31592 gene locus_tag LOCUS_07770 33925 31592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 35060 34032 gene locus_tag LOCUS_07780 35060 34032 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680378.1 protein_id gnl|my_center|LOCUS_07780 36230 35082 gene locus_tag LOCUS_07790 36230 35082 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989733.1 protein_id gnl|my_center|LOCUS_07790 37171 36224 gene locus_tag LOCUS_07800 37171 36224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 37300 37225 gene locus_tag LOCUS_t00290 37300 37225 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <39769 37359 gene locus_tag LOCUS_07810 <39769 37359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392105.1:leucine--tRNA ligase >Feature sequence017 341 2002 gene locus_tag LOCUS_07820 341 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1999 2388 gene locus_tag LOCUS_07830 1999 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2385 4445 gene locus_tag LOCUS_07840 2385 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4483 8277 gene locus_tag LOCUS_07850 4483 8277 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257283.1 protein_id gnl|my_center|LOCUS_07850 8497 9117 gene locus_tag LOCUS_07860 8497 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 9142 11961 gene locus_tag LOCUS_07870 9142 11961 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_07870 14621 12090 gene locus_tag LOCUS_07880 14621 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 15758 14640 gene locus_tag LOCUS_07890 15758 14640 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404032.1 protein_id gnl|my_center|LOCUS_07890 16638 15769 gene locus_tag LOCUS_07900 16638 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 18806 16635 gene locus_tag LOCUS_07910 18806 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 20038 18830 gene locus_tag LOCUS_07920 20038 18830 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838690.1 protein_id gnl|my_center|LOCUS_07920 20918 20049 gene locus_tag LOCUS_07930 20918 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 21874 20915 gene locus_tag LOCUS_07940 21874 20915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 23083 21884 gene locus_tag LOCUS_07950 23083 21884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 23667 23095 gene locus_tag LOCUS_07960 23667 23095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 24095 23667 gene locus_tag LOCUS_07970 24095 23667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 25877 24099 gene locus_tag LOCUS_07980 25877 24099 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404025.1 protein_id gnl|my_center|LOCUS_07980 27218 25878 gene locus_tag LOCUS_07990 27218 25878 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840114.1 protein_id gnl|my_center|LOCUS_07990 27950 27525 gene locus_tag LOCUS_08000 27950 27525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 29856 28495 gene locus_tag LOCUS_08010 gene rmuC 29856 28495 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_08010 30137 30236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31820 30522 gene locus_tag LOCUS_08020 31820 30522 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_08020 32251 31817 gene locus_tag LOCUS_08030 gene rpiB 32251 31817 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_08030 33156 32248 gene locus_tag LOCUS_08040 33156 32248 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763574.1 protein_id gnl|my_center|LOCUS_08040 34063 33161 gene locus_tag LOCUS_08050 gene ptb 34063 33161 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_08050 35380 34094 gene locus_tag LOCUS_08060 35380 34094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 36091 35489 gene locus_tag LOCUS_08070 36091 35489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 36919 36479 gene locus_tag LOCUS_08080 36919 36479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 37493 37089 gene locus_tag LOCUS_08090 37493 37089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence018 1091 426 gene locus_tag LOCUS_08100 1091 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1934 1167 gene locus_tag LOCUS_08110 1934 1167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 protein_id gnl|my_center|LOCUS_08110 2038 2137 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2293 3690 gene locus_tag LOCUS_08120 2293 3690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070728.1 protein_id gnl|my_center|LOCUS_08120 3855 4769 gene locus_tag LOCUS_08130 3855 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 4756 5397 gene locus_tag LOCUS_08140 4756 5397 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_08140 5415 6188 gene locus_tag LOCUS_08150 5415 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 6294 6518 gene locus_tag LOCUS_08160 6294 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6520 7410 gene locus_tag LOCUS_08170 6520 7410 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_08170 7407 7841 gene locus_tag LOCUS_08180 gene dut 7407 7841 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597580.1 protein_id gnl|my_center|LOCUS_08180 7810 8751 gene locus_tag LOCUS_08190 gene nadA 7810 8751 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_08190 8761 9372 gene locus_tag LOCUS_08200 8761 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 9375 10217 gene locus_tag LOCUS_08210 9375 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 10210 10767 gene locus_tag LOCUS_08220 gene pgsA 10210 10767 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_08220 10769 11821 gene locus_tag LOCUS_08230 10769 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 11829 13529 gene locus_tag LOCUS_08240 11829 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 14932 13610 gene locus_tag LOCUS_08250 gene mnmE 14932 13610 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_08250 16806 14929 gene locus_tag LOCUS_08260 gene dxs 16806 14929 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_08260 18734 16803 gene locus_tag LOCUS_08270 18734 16803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 19778 18738 gene locus_tag LOCUS_08280 19778 18738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 20597 19779 gene locus_tag LOCUS_08290 20597 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 21777 20656 gene locus_tag LOCUS_08300 21777 20656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_08300 22431 21787 gene locus_tag LOCUS_08310 22431 21787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 23138 22428 gene locus_tag LOCUS_08320 23138 22428 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_08320 26759 23148 gene locus_tag LOCUS_08330 26759 23148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 27218 27317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27604 28089 gene locus_tag LOCUS_08340 27604 28089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 28189 29844 gene locus_tag LOCUS_08350 28189 29844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 29926 31026 gene locus_tag LOCUS_08360 29926 31026 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080642.1 protein_id gnl|my_center|LOCUS_08360 31023 31370 gene locus_tag LOCUS_08370 31023 31370 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_08370 31686 31357 gene locus_tag LOCUS_08380 31686 31357 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940209.1 protein_id gnl|my_center|LOCUS_08380 32509 31688 gene locus_tag LOCUS_08390 gene yidA 32509 31688 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377829.1 protein_id gnl|my_center|LOCUS_08390 33333 32506 gene locus_tag LOCUS_08400 33333 32506 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964930.1 protein_id gnl|my_center|LOCUS_08400 34111 33338 gene locus_tag LOCUS_08410 34111 33338 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228806.1 protein_id gnl|my_center|LOCUS_08410 34746 34108 gene locus_tag LOCUS_08420 34746 34108 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931900.1 protein_id gnl|my_center|LOCUS_08420 35175 34747 gene locus_tag LOCUS_08430 35175 34747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 35798 35175 gene locus_tag LOCUS_08440 gene gmk 35798 35175 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence019 <1 1239 gene locus_tag LOCUS_08450 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399687.1:DNA repair protein RadA 2186 1236 gene locus_tag LOCUS_08460 2186 1236 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_08460 2953 2171 gene locus_tag LOCUS_08470 2953 2171 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_08470 4224 2953 gene locus_tag LOCUS_08480 4224 2953 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_08480 5173 4241 gene locus_tag LOCUS_08490 5173 4241 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_08490 5439 6524 gene locus_tag LOCUS_08500 5439 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 6542 7453 gene locus_tag LOCUS_08510 6542 7453 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250986.1 protein_id gnl|my_center|LOCUS_08510 8676 7525 gene locus_tag LOCUS_08520 8676 7525 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_08520 9084 11036 gene locus_tag LOCUS_08530 9084 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 10808 10907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12447 11479 gene locus_tag LOCUS_08540 12447 11479 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081482.1 protein_id gnl|my_center|LOCUS_08540 13407 12475 gene locus_tag LOCUS_08550 gene xerD 13407 12475 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_08550 14815 13361 gene locus_tag LOCUS_08560 gene guaB 14815 13361 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_08560 16558 14837 gene locus_tag LOCUS_08570 16558 14837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 19710 16555 gene locus_tag LOCUS_08580 19710 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 19765 19864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20971 19871 gene locus_tag LOCUS_08590 20971 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 22139 21051 gene locus_tag LOCUS_08600 22139 21051 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_08600 23326 22151 gene locus_tag LOCUS_08610 23326 22151 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022687.1 protein_id gnl|my_center|LOCUS_08610 23754 24953 gene locus_tag LOCUS_08620 23754 24953 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_08620 24955 26199 gene locus_tag LOCUS_08630 gene hemL 24955 26199 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_08630 26212 27804 gene locus_tag LOCUS_08640 26212 27804 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_08640 27805 28980 gene locus_tag LOCUS_08650 27805 28980 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229564.1 protein_id gnl|my_center|LOCUS_08650 28977 30986 gene locus_tag LOCUS_08660 gene metG 28977 30986 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_08660 30986 32446 gene locus_tag LOCUS_08670 30986 32446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 32466 33317 gene locus_tag LOCUS_08680 gene hslO 32466 33317 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048141.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence020 6979 5726 gene locus_tag LOCUS_08690 6979 5726 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_08690 8714 7005 gene locus_tag LOCUS_08700 gene pilB 8714 7005 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_08700 11164 8852 gene locus_tag LOCUS_08710 11164 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 12553 11165 gene locus_tag LOCUS_08720 12553 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 13119 12580 gene locus_tag LOCUS_08730 13119 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 13666 13121 gene locus_tag LOCUS_08740 13666 13121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 14253 13663 gene locus_tag LOCUS_08750 14253 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 15334 14264 gene locus_tag LOCUS_08760 gene pilM 15334 14264 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_08760 17323 15365 gene locus_tag LOCUS_08770 17323 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 18005 17355 gene locus_tag LOCUS_08780 18005 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 18466 18002 gene locus_tag LOCUS_08790 18466 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 19539 18484 gene locus_tag LOCUS_08800 gene pilT 19539 18484 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218487.1 protein_id gnl|my_center|LOCUS_08800 19995 19558 gene locus_tag LOCUS_08810 19995 19558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 20346 22376 gene locus_tag LOCUS_08820 20346 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 23155 22445 gene locus_tag LOCUS_08830 23155 22445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 24927 23152 gene locus_tag LOCUS_08840 24927 23152 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_08840 25508 24930 gene locus_tag LOCUS_08850 25508 24930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 26488 25505 gene locus_tag LOCUS_08860 26488 25505 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_08860 27492 26491 gene locus_tag LOCUS_08870 27492 26491 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_08870 28396 27479 gene locus_tag LOCUS_08880 28396 27479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 29283 28393 gene locus_tag LOCUS_08890 29283 28393 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_08890 30282 29296 gene locus_tag LOCUS_08900 30282 29296 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_08900 31763 30651 gene locus_tag LOCUS_08910 31763 30651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 32255 32527 gene locus_tag LOCUS_08920 32255 32527 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 protein_id gnl|my_center|LOCUS_08920 32524 33183 gene locus_tag LOCUS_08930 32524 33183 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence021 541 1719 gene locus_tag LOCUS_08940 541 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1773 2246 gene locus_tag LOCUS_08950 1773 2246 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986525.1 protein_id gnl|my_center|LOCUS_08950 2257 3153 gene locus_tag LOCUS_08960 2257 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3170 5269 gene locus_tag LOCUS_08970 gene glyS 3170 5269 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_08970 5270 6253 gene locus_tag LOCUS_08980 gene pta 5270 6253 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666863.1 protein_id gnl|my_center|LOCUS_08980 6276 7478 gene locus_tag LOCUS_08990 6276 7478 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_08990 7475 7690 gene locus_tag LOCUS_09000 7475 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7687 8580 gene locus_tag LOCUS_09010 7687 8580 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_09010 8562 9599 gene locus_tag LOCUS_09020 gene purM 8562 9599 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931788.1 protein_id gnl|my_center|LOCUS_09020 9802 12813 gene locus_tag LOCUS_09030 9802 12813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 12837 13586 gene locus_tag LOCUS_09040 12837 13586 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_09040 13605 14030 gene locus_tag LOCUS_09050 13605 14030 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619314.1 protein_id gnl|my_center|LOCUS_09050 14039 14473 gene locus_tag LOCUS_09060 14039 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 14483 15115 gene locus_tag LOCUS_09070 14483 15115 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179862255.1 protein_id gnl|my_center|LOCUS_09070 15130 18252 gene locus_tag LOCUS_09080 15130 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 18262 19293 gene locus_tag LOCUS_09090 gene porV 18262 19293 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_09090 19295 21490 gene locus_tag LOCUS_09100 19295 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 23993 22125 gene locus_tag LOCUS_09110 23993 22125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 24100 24025 gene locus_tag LOCUS_t00300 24100 24025 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24209 25189 gene locus_tag LOCUS_09120 24209 25189 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081884.1 protein_id gnl|my_center|LOCUS_09120 25189 26307 gene locus_tag LOCUS_09130 25189 26307 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081868.1 protein_id gnl|my_center|LOCUS_09130 27322 26330 gene locus_tag LOCUS_09140 gene aroB 27322 26330 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_09140 29886 27421 gene locus_tag LOCUS_09150 29886 27421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 30920 29883 gene locus_tag LOCUS_09160 30920 29883 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 protein_id gnl|my_center|LOCUS_09160 32101 30992 gene locus_tag LOCUS_09170 32101 30992 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_09170 33760 32102 gene locus_tag LOCUS_09180 33760 32102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence022 1863 610 gene locus_tag LOCUS_09190 gene hutI 1863 610 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_09190 2319 1972 gene locus_tag LOCUS_09200 2319 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2475 3557 gene locus_tag LOCUS_09210 gene buk 2475 3557 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_09210 3611 4858 gene locus_tag LOCUS_09220 3611 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4231 4330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5022 5759 gene locus_tag LOCUS_09230 5022 5759 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485784.1 protein_id gnl|my_center|LOCUS_09230 6119 7561 gene locus_tag LOCUS_09240 6119 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 7558 8847 gene locus_tag LOCUS_09250 7558 8847 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 protein_id gnl|my_center|LOCUS_09250 8844 10307 gene locus_tag LOCUS_09260 8844 10307 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_09260 10316 11464 gene locus_tag LOCUS_09270 gene manA 10316 11464 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170697.1 protein_id gnl|my_center|LOCUS_09270 14565 11542 gene locus_tag LOCUS_09280 14565 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 16543 14885 gene locus_tag LOCUS_09290 16543 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 17326 16607 gene locus_tag LOCUS_09300 17326 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 18363 17323 gene locus_tag LOCUS_09310 gene queA 18363 17323 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_09310 19118 18366 gene locus_tag LOCUS_09320 19118 18366 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_09320 19840 19115 gene locus_tag LOCUS_09330 19840 19115 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088823.1 protein_id gnl|my_center|LOCUS_09330 21012 19837 gene locus_tag LOCUS_09340 gene coaBC 21012 19837 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722165.1 protein_id gnl|my_center|LOCUS_09340 21660 21016 gene locus_tag LOCUS_09350 21660 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 22325 21672 gene locus_tag LOCUS_09360 22325 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 23290 22325 gene locus_tag LOCUS_09370 23290 22325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 26365 23300 gene locus_tag LOCUS_09380 26365 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 27557 26532 gene locus_tag LOCUS_09390 gene porV 27557 26532 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_09390 27832 27745 gene locus_tag LOCUS_t00310 27832 27745 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29162 27885 gene locus_tag LOCUS_09400 29162 27885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081252.1 protein_id gnl|my_center|LOCUS_09400 31201 29636 gene locus_tag LOCUS_09410 31201 29636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 30149 30248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32333 32052 gene locus_tag LOCUS_09420 32333 32052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 33041 32388 gene locus_tag LOCUS_09430 33041 32388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence023 596 4624 gene locus_tag LOCUS_09440 596 4624 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_09440 4656 5906 gene locus_tag LOCUS_09450 4656 5906 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_09450 6091 6579 gene locus_tag LOCUS_09460 6091 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 10640 6960 gene locus_tag LOCUS_09470 10640 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 14536 10760 gene locus_tag LOCUS_09480 14536 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 16743 14779 gene locus_tag LOCUS_09490 16743 14779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 17189 17905 gene locus_tag LOCUS_09500 17189 17905 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113309.1 protein_id gnl|my_center|LOCUS_09500 18898 18997 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19140 20849 gene locus_tag LOCUS_09510 19140 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 21095 21508 gene locus_tag LOCUS_09520 21095 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 21501 21716 gene locus_tag LOCUS_09530 21501 21716 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_09530 22058 22157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22281 23909 gene locus_tag LOCUS_09540 gene groL 22281 23909 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_09540 24121 25401 gene locus_tag LOCUS_09550 24121 25401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 25480 26577 gene locus_tag LOCUS_09560 25480 26577 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_09560 26611 27531 gene locus_tag LOCUS_09570 26611 27531 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_09570 28598 27603 gene locus_tag LOCUS_09580 gene trpS 28598 27603 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022349.1 protein_id gnl|my_center|LOCUS_09580 29892 28606 gene locus_tag LOCUS_09590 gene rimO 29892 28606 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880515.1 protein_id gnl|my_center|LOCUS_09590 31142 29892 gene locus_tag LOCUS_09600 31142 29892 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_09600 32435 31164 gene locus_tag LOCUS_09610 32435 31164 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence024 4859 3174 gene locus_tag LOCUS_09620 4859 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948590.1 protein_id gnl|my_center|LOCUS_09620 5496 5059 gene locus_tag LOCUS_09630 5496 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 8300 5613 gene locus_tag LOCUS_09640 8300 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 8700 8317 gene locus_tag LOCUS_09650 8700 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9031 10752 gene locus_tag LOCUS_09660 gene recJ 9031 10752 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_09660 10755 11576 gene locus_tag LOCUS_09670 10755 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 11560 13065 gene locus_tag LOCUS_09680 gene lnt 11560 13065 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_09680 13065 13445 gene locus_tag LOCUS_09690 13065 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 13445 14299 gene locus_tag LOCUS_09700 gene glyQ 13445 14299 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_09700 14296 14967 gene locus_tag LOCUS_09710 14296 14967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 14964 15752 gene locus_tag LOCUS_09720 14964 15752 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397831.1 protein_id gnl|my_center|LOCUS_09720 17948 15771 gene locus_tag LOCUS_09730 17948 15771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 18647 17985 gene locus_tag LOCUS_09740 18647 17985 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_09740 19237 18644 gene locus_tag LOCUS_09750 19237 18644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 19997 19278 gene locus_tag LOCUS_09760 gene bamD 19997 19278 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926787.1 protein_id gnl|my_center|LOCUS_09760 20579 20007 gene locus_tag LOCUS_09770 20579 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 21617 20610 gene locus_tag LOCUS_09780 21617 20610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 23048 21636 gene locus_tag LOCUS_09790 23048 21636 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_09790 23560 23078 gene locus_tag LOCUS_09800 gene greA 23560 23078 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_09800 24376 23567 gene locus_tag LOCUS_09810 24376 23567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 24882 24607 gene locus_tag LOCUS_09820 24882 24607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 27085 24884 gene locus_tag LOCUS_09830 gene feoB 27085 24884 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986795.1 protein_id gnl|my_center|LOCUS_09830 27506 27066 gene locus_tag LOCUS_09840 27506 27066 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_09840 28049 29644 gene locus_tag LOCUS_09850 28049 29644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 31619 30312 gene locus_tag LOCUS_09860 31619 30312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence025 1 798 gene locus_tag LOCUS_09870 1 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 809 2425 gene locus_tag LOCUS_09880 809 2425 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_09880 3769 2621 gene locus_tag LOCUS_09890 3769 2621 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_09890 4543 3800 gene locus_tag LOCUS_09900 4543 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 4753 5436 gene locus_tag LOCUS_09910 4753 5436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_09910 5417 6646 gene locus_tag LOCUS_09920 5417 6646 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125074.1 protein_id gnl|my_center|LOCUS_09920 6646 7722 gene locus_tag LOCUS_09930 6646 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 7715 9262 gene locus_tag LOCUS_09940 gene purH 7715 9262 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932012.1 protein_id gnl|my_center|LOCUS_09940 9311 9401 gene locus_tag LOCUS_t00320 9311 9401 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9512 11236 gene locus_tag LOCUS_09950 gene sppA 9512 11236 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_09950 11238 12755 gene locus_tag LOCUS_09960 gene rng 11238 12755 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_09960 13757 12807 gene locus_tag LOCUS_09970 13757 12807 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_09970 13990 14089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14785 14228 gene locus_tag LOCUS_09980 14785 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 16278 15514 gene locus_tag LOCUS_09990 16278 15514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 18506 16203 gene locus_tag LOCUS_10000 18506 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 18986 21313 gene locus_tag LOCUS_10010 18986 21313 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_10010 21310 22368 gene locus_tag LOCUS_10020 gene ispG 21310 22368 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_10020 22370 22891 gene locus_tag LOCUS_10030 22370 22891 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_10030 22888 23412 gene locus_tag LOCUS_10040 22888 23412 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_10040 23412 24422 gene locus_tag LOCUS_10050 23412 24422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 25235 26404 gene locus_tag LOCUS_10060 25235 26404 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_10060 27204 26584 gene locus_tag LOCUS_10070 27204 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 28231 27176 gene locus_tag LOCUS_10080 gene recA 28231 27176 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_10080 28794 28243 gene locus_tag LOCUS_10090 gene thpR 28794 28243 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_10090 29276 28794 gene locus_tag LOCUS_10100 29276 28794 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545207.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence026 4059 556 gene locus_tag LOCUS_10110 4059 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5281 4322 gene locus_tag LOCUS_10120 5281 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5670 5290 gene locus_tag LOCUS_10130 5670 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 6235 5663 gene locus_tag LOCUS_10140 6235 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 7325 8662 gene locus_tag LOCUS_10150 gene dnaA 7325 8662 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_10150 9090 10313 gene locus_tag LOCUS_10160 9090 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10325 11116 gene locus_tag LOCUS_10170 10325 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11125 12390 gene locus_tag LOCUS_10180 11125 12390 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_10180 12387 12875 gene locus_tag LOCUS_10190 12387 12875 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_10190 12885 13232 gene locus_tag LOCUS_10200 12885 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 13237 13785 gene locus_tag LOCUS_10210 gene def 13237 13785 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082176.1 protein_id gnl|my_center|LOCUS_10210 13791 14723 gene locus_tag LOCUS_10220 gene fmt 13791 14723 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081384.1 protein_id gnl|my_center|LOCUS_10220 14720 15469 gene locus_tag LOCUS_10230 14720 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 15469 16152 gene locus_tag LOCUS_10240 15469 16152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 16237 17076 gene locus_tag LOCUS_10250 16237 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 19199 17238 gene locus_tag LOCUS_10260 19199 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 20984 19380 gene locus_tag LOCUS_10270 20984 19380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 23503 20999 gene locus_tag LOCUS_10280 23503 20999 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_10280 24535 23930 gene locus_tag LOCUS_10290 24535 23930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 25161 24697 gene locus_tag LOCUS_10300 25161 24697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 25373 27694 gene locus_tag LOCUS_10310 25373 27694 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_10310 28435 27704 gene locus_tag LOCUS_10320 28435 27704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence027 1394 3145 gene locus_tag LOCUS_10330 1394 3145 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_10330 3145 4047 gene locus_tag LOCUS_10340 3145 4047 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_10340 4120 5625 gene locus_tag LOCUS_10350 4120 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 5622 6872 gene locus_tag LOCUS_10360 5622 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 6989 8854 gene locus_tag LOCUS_10370 6989 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 8888 9655 gene locus_tag LOCUS_10380 8888 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 9672 10121 gene locus_tag LOCUS_10390 9672 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 10161 10496 gene locus_tag LOCUS_10400 10161 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 10477 11574 gene locus_tag LOCUS_10410 10477 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 11253 11352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11677 12879 gene locus_tag LOCUS_10420 11677 12879 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_10420 12934 15840 gene locus_tag LOCUS_10430 12934 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 15800 16081 gene locus_tag LOCUS_10440 15800 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 16221 17018 gene locus_tag LOCUS_10450 16221 17018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 17721 17113 gene locus_tag LOCUS_10460 17721 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 18491 17709 gene locus_tag LOCUS_10470 gene dapF 18491 17709 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_10470 19225 18485 gene locus_tag LOCUS_10480 gene dapB 19225 18485 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838584.1 protein_id gnl|my_center|LOCUS_10480 20345 19227 gene locus_tag LOCUS_10490 20345 19227 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 protein_id gnl|my_center|LOCUS_10490 21040 21822 gene locus_tag LOCUS_10500 21040 21822 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_10500 21833 22717 gene locus_tag LOCUS_10510 21833 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 24654 22810 gene locus_tag LOCUS_10520 24654 22810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 <27098 24651 gene locus_tag LOCUS_10530 <27098 24651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905548.1:KxYKxGKxW signal peptide domain-containing protein >Feature sequence028 1314 580 gene locus_tag LOCUS_10540 1314 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2720 1311 gene locus_tag LOCUS_10550 2720 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2808 3677 gene locus_tag LOCUS_10560 2808 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 5734 3737 gene locus_tag LOCUS_10570 gene htpG 5734 3737 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141812.1 protein_id gnl|my_center|LOCUS_10570 6285 5845 gene locus_tag LOCUS_10580 6285 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6919 8370 gene locus_tag LOCUS_10590 6919 8370 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_10590 8370 9089 gene locus_tag LOCUS_10600 8370 9089 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_10600 9086 10996 gene locus_tag LOCUS_10610 9086 10996 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_10610 11272 11901 gene locus_tag LOCUS_10620 11272 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 11901 12533 gene locus_tag LOCUS_10630 11901 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 12533 13879 gene locus_tag LOCUS_10640 12533 13879 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_10640 13932 14007 gene locus_tag LOCUS_t00330 13932 14007 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14493 14119 gene locus_tag LOCUS_10650 14493 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 15220 14507 gene locus_tag LOCUS_10660 15220 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 15553 15476 gene locus_tag LOCUS_t00340 15553 15476 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15710 17617 gene locus_tag LOCUS_10670 15710 17617 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602146.1 protein_id gnl|my_center|LOCUS_10670 17610 18584 gene locus_tag LOCUS_10680 17610 18584 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460939.1 protein_id gnl|my_center|LOCUS_10680 18581 19657 gene locus_tag LOCUS_10690 gene mnmA 18581 19657 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_10690 21190 19658 gene locus_tag LOCUS_10700 gene guaA 21190 19658 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_10700 21822 21196 gene locus_tag LOCUS_10710 21822 21196 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_10710 22774 21830 gene locus_tag LOCUS_10720 22774 21830 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_10720 22806 22905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23063 22987 gene locus_tag LOCUS_t00350 23063 22987 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23730 23059 gene locus_tag LOCUS_10730 23730 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 26756 23802 gene locus_tag LOCUS_10740 26756 23802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence029 106 1722 gene locus_tag LOCUS_10750 106 1722 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_10750 3490 2084 gene locus_tag LOCUS_10760 3490 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3908 4228 gene locus_tag LOCUS_10770 3908 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4632 4351 gene locus_tag LOCUS_10780 4632 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 5485 4643 gene locus_tag LOCUS_10790 5485 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 6903 5497 gene locus_tag LOCUS_10800 6903 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 7458 6904 gene locus_tag LOCUS_10810 gene lspA 7458 6904 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245047.1 protein_id gnl|my_center|LOCUS_10810 7868 7467 gene locus_tag LOCUS_10820 7868 7467 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924922.1 protein_id gnl|my_center|LOCUS_10820 8758 7946 gene locus_tag LOCUS_10830 8758 7946 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263213.1 protein_id gnl|my_center|LOCUS_10830 9321 8758 gene locus_tag LOCUS_10840 9321 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 9599 9339 gene locus_tag LOCUS_10850 9599 9339 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_10850 10163 9600 gene locus_tag LOCUS_10860 10163 9600 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583168.1 protein_id gnl|my_center|LOCUS_10860 11443 10346 gene locus_tag LOCUS_10870 11443 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 13277 11496 gene locus_tag LOCUS_10880 13277 11496 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582597.1 protein_id gnl|my_center|LOCUS_10880 13796 13721 gene locus_tag LOCUS_t00360 13796 13721 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13843 14754 gene locus_tag LOCUS_10890 13843 14754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 15621 14929 gene locus_tag LOCUS_10900 gene aqpZ 15621 14929 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_10900 15875 17566 gene locus_tag LOCUS_10910 15875 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 18001 21216 gene locus_tag LOCUS_10920 18001 21216 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_10920 21677 23461 gene locus_tag LOCUS_10930 21677 23461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 23551 24906 gene locus_tag LOCUS_10940 gene glmM 23551 24906 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839748.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence030 1446 136 gene locus_tag LOCUS_10950 gene pdhC 1446 136 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863427.1 protein_id gnl|my_center|LOCUS_10950 2433 1456 gene locus_tag LOCUS_10960 2433 1456 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182937.1 protein_id gnl|my_center|LOCUS_10960 3527 2430 gene locus_tag LOCUS_10970 gene pdhA 3527 2430 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874749.1 protein_id gnl|my_center|LOCUS_10970 5777 3609 gene locus_tag LOCUS_10980 5777 3609 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 protein_id gnl|my_center|LOCUS_10980 6439 5774 gene locus_tag LOCUS_10990 6439 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 10991 6441 gene locus_tag LOCUS_11000 10991 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 11229 12185 gene locus_tag LOCUS_11010 11229 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 12754 15114 gene locus_tag LOCUS_11020 12754 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 15124 15681 gene locus_tag LOCUS_11030 15124 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 17751 15967 gene locus_tag LOCUS_11040 17751 15967 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_11040 19332 17770 gene locus_tag LOCUS_11050 gene nuoF 19332 17770 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584033.1 protein_id gnl|my_center|LOCUS_11050 19787 19332 gene locus_tag LOCUS_11060 gene nuoE 19787 19332 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_11060 21655 19799 gene locus_tag LOCUS_11070 gene nuoF 21655 19799 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_11070 22037 21672 gene locus_tag LOCUS_11080 22037 21672 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_11080 22606 22037 gene locus_tag LOCUS_11090 22606 22037 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_11090 23094 22612 gene locus_tag LOCUS_11100 23094 22612 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082449.1 protein_id gnl|my_center|LOCUS_11100 23800 23111 gene locus_tag LOCUS_11110 23800 23111 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_11110 24215 23874 gene locus_tag LOCUS_11120 24215 23874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 <24908 24237 gene locus_tag LOCUS_11130 <24908 24237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583277.1:[Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein >Feature sequence031 1077 43 gene locus_tag LOCUS_11140 1077 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1466 4381 gene locus_tag LOCUS_11150 1466 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4557 4384 gene locus_tag LOCUS_11160 4557 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4653 4752 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5125 8049 gene locus_tag LOCUS_11170 5125 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 8275 8523 gene locus_tag LOCUS_11180 gene purS 8275 8523 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_11180 8525 9214 gene locus_tag LOCUS_11190 gene purQ 8525 9214 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583773.1 protein_id gnl|my_center|LOCUS_11190 9162 9884 gene locus_tag LOCUS_11200 9162 9884 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_11200 9890 10288 gene locus_tag LOCUS_11210 9890 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 10300 12162 gene locus_tag LOCUS_11220 10300 12162 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_11220 12171 13301 gene locus_tag LOCUS_11230 12171 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 14056 13574 gene locus_tag LOCUS_11240 14056 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 15708 14053 gene locus_tag LOCUS_11250 15708 14053 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_11250 17155 15725 gene locus_tag LOCUS_11260 17155 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 19927 17168 gene locus_tag LOCUS_11270 19927 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 20180 22642 gene locus_tag LOCUS_11280 20180 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 22653 24749 gene locus_tag LOCUS_11290 22653 24749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence032 <1 1062 gene locus_tag LOCUS_11300 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 4456 1169 gene locus_tag LOCUS_11310 4456 1169 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016941.1 protein_id gnl|my_center|LOCUS_11310 7214 4443 gene locus_tag LOCUS_11320 7214 4443 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016942.1 protein_id gnl|my_center|LOCUS_11320 8792 7227 gene locus_tag LOCUS_11330 8792 7227 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_11330 10831 8870 gene locus_tag LOCUS_11340 10831 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 11827 12678 gene locus_tag LOCUS_11350 11827 12678 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932610.1 protein_id gnl|my_center|LOCUS_11350 12684 13598 gene locus_tag LOCUS_11360 12684 13598 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_11360 13744 15975 gene locus_tag LOCUS_11370 13744 15975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 16918 15968 gene locus_tag LOCUS_11380 16918 15968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 19236 16912 gene locus_tag LOCUS_11390 19236 16912 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_11390 19251 19350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19731 20021 gene locus_tag LOCUS_11400 19731 20021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 20026 21333 gene locus_tag LOCUS_11410 20026 21333 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_11410 21330 22037 gene locus_tag LOCUS_11420 21330 22037 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_11420 22051 22290 gene locus_tag LOCUS_11430 22051 22290 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_11430 22292 22714 gene locus_tag LOCUS_11440 22292 22714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 22719 23168 gene locus_tag LOCUS_11450 22719 23168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence033 <1 2691 gene locus_tag LOCUS_11460 <1 2691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681041.1:FlgD immunoglobulin-like domain containing protein 2878 6015 gene locus_tag LOCUS_11470 2878 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 6033 6935 gene locus_tag LOCUS_11480 6033 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6970 11145 gene locus_tag LOCUS_11490 6970 11145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 11263 12594 gene locus_tag LOCUS_11500 gene hflX 11263 12594 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_11500 12656 13321 gene locus_tag LOCUS_11510 12656 13321 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_11510 13314 13961 gene locus_tag LOCUS_11520 13314 13961 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 protein_id gnl|my_center|LOCUS_11520 14095 14194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15385 14306 gene locus_tag LOCUS_11530 15385 14306 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_11530 16085 15393 gene locus_tag LOCUS_11540 16085 15393 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_11540 16166 16810 gene locus_tag LOCUS_11550 16166 16810 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_11550 16829 17188 gene locus_tag LOCUS_11560 16829 17188 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_11560 17217 20207 gene locus_tag LOCUS_11570 17217 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 20446 21684 gene locus_tag LOCUS_11580 20446 21684 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_11580 21681 22493 gene locus_tag LOCUS_11590 21681 22493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence034 218 988 gene locus_tag LOCUS_11600 218 988 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066573.1 protein_id gnl|my_center|LOCUS_11600 1199 2551 gene locus_tag LOCUS_11610 1199 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2618 3706 gene locus_tag LOCUS_11620 gene eefA 2618 3706 CDS product multidrug efflux RND transporter periplasmic adaptor subunit EefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703858.1 protein_id gnl|my_center|LOCUS_11620 3716 6892 gene locus_tag LOCUS_11630 3716 6892 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_11630 6904 7431 gene locus_tag LOCUS_11640 6904 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 protein_id gnl|my_center|LOCUS_11640 7450 9729 gene locus_tag LOCUS_11650 7450 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9791 11368 gene locus_tag LOCUS_11660 9791 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 11361 12155 gene locus_tag LOCUS_11670 11361 12155 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403988.1 protein_id gnl|my_center|LOCUS_11670 12157 12612 gene locus_tag LOCUS_11680 12157 12612 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_11680 12626 13432 gene locus_tag LOCUS_11690 12626 13432 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173484.1 protein_id gnl|my_center|LOCUS_11690 13464 13563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14106 14882 gene locus_tag LOCUS_11700 14106 14882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 14879 16759 gene locus_tag LOCUS_11710 14879 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 17664 17035 gene locus_tag LOCUS_11720 17664 17035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 18935 17673 gene locus_tag LOCUS_11730 18935 17673 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_11730 19546 19785 gene locus_tag LOCUS_11740 19546 19785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 20690 21790 gene locus_tag LOCUS_11750 20690 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence035 <1 3530 gene locus_tag LOCUS_11760 <1 3530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244653.1:cell wall-associated protease WprA 3305 3404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3479 4555 gene locus_tag LOCUS_11770 3479 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4699 6738 gene locus_tag LOCUS_11780 4699 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 8334 7051 gene locus_tag LOCUS_11790 8334 7051 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_11790 9238 8336 gene locus_tag LOCUS_11800 9238 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 10810 9248 gene locus_tag LOCUS_11810 10810 9248 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_11810 11421 10807 gene locus_tag LOCUS_11820 11421 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 12242 11436 gene locus_tag LOCUS_11830 gene panB 12242 11436 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966197.1 protein_id gnl|my_center|LOCUS_11830 12798 12244 gene locus_tag LOCUS_11840 12798 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 12993 13631 gene locus_tag LOCUS_11850 12993 13631 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_11850 13633 14589 gene locus_tag LOCUS_11860 gene trxB 13633 14589 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_11860 14589 15392 gene locus_tag LOCUS_11870 gene mutM 14589 15392 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_11870 16884 15544 gene locus_tag LOCUS_11880 16884 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 17254 17574 gene locus_tag LOCUS_11890 17254 17574 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811819.1 protein_id gnl|my_center|LOCUS_11890 17673 19748 gene locus_tag LOCUS_11900 17673 19748 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_11900 19909 21345 gene locus_tag LOCUS_11910 19909 21345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence036 1534 197 gene locus_tag LOCUS_11920 1534 197 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_11920 2642 1527 gene locus_tag LOCUS_11930 2642 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11930 5707 2741 gene locus_tag LOCUS_11940 5707 2741 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_11940 6040 7071 gene locus_tag LOCUS_11950 6040 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 7158 9122 gene locus_tag LOCUS_11960 7158 9122 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481540.1 protein_id gnl|my_center|LOCUS_11960 9248 10537 gene locus_tag LOCUS_11970 9248 10537 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946662.1 protein_id gnl|my_center|LOCUS_11970 10537 11145 gene locus_tag LOCUS_11980 10537 11145 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392254.1 protein_id gnl|my_center|LOCUS_11980 11142 12017 gene locus_tag LOCUS_11990 11142 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 12014 12832 gene locus_tag LOCUS_12000 gene amrB 12014 12832 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_12000 12860 13399 gene locus_tag LOCUS_12010 12860 13399 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_12010 13597 14247 gene locus_tag LOCUS_12020 13597 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 14244 14957 gene locus_tag LOCUS_12030 14244 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 14961 16334 gene locus_tag LOCUS_12040 14961 16334 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987111.1 protein_id gnl|my_center|LOCUS_12040 16995 16405 gene locus_tag LOCUS_12050 16995 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 18791 17112 gene locus_tag LOCUS_12060 gene ettA 18791 17112 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_12060 19316 18852 gene locus_tag LOCUS_12070 19316 18852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 19888 19313 gene locus_tag LOCUS_12080 19888 19313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 20551 19901 gene locus_tag LOCUS_12090 20551 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence037 980 639 gene locus_tag LOCUS_12100 980 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 865 1707 gene locus_tag LOCUS_12110 865 1707 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263229.1 protein_id gnl|my_center|LOCUS_12110 1717 2100 gene locus_tag LOCUS_12120 1717 2100 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 protein_id gnl|my_center|LOCUS_12120 2097 3002 gene locus_tag LOCUS_12130 2097 3002 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_12130 3034 4146 gene locus_tag LOCUS_12140 3034 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4143 4931 gene locus_tag LOCUS_12150 4143 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4932 6206 gene locus_tag LOCUS_12160 4932 6206 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545290.1 protein_id gnl|my_center|LOCUS_12160 6287 6766 gene locus_tag LOCUS_12170 gene ribE 6287 6766 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_12170 6750 7220 gene locus_tag LOCUS_12180 gene nusB 6750 7220 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_12180 7226 8113 gene locus_tag LOCUS_12190 7226 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 8123 9205 gene locus_tag LOCUS_12200 8123 9205 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267479.1 protein_id gnl|my_center|LOCUS_12200 9208 10617 gene locus_tag LOCUS_12210 9208 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 10669 11286 gene locus_tag LOCUS_12220 10669 11286 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_12220 11288 12040 gene locus_tag LOCUS_12230 11288 12040 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_12230 12037 12894 gene locus_tag LOCUS_12240 12037 12894 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220028.1 protein_id gnl|my_center|LOCUS_12240 12906 13349 gene locus_tag LOCUS_12250 12906 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 13374 13568 gene locus_tag LOCUS_12260 13374 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 14011 14110 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15306 14359 gene locus_tag LOCUS_12270 gene arcC 15306 14359 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_12270 16778 15393 gene locus_tag LOCUS_12280 16778 15393 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_12280 16994 17389 gene locus_tag LOCUS_12290 16994 17389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 17964 20000 gene locus_tag LOCUS_12300 17964 20000 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_12300 20066 20437 gene locus_tag LOCUS_12310 20066 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence038 1470 148 gene locus_tag LOCUS_12320 1470 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1882 6591 gene locus_tag LOCUS_12330 1882 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 6823 6653 gene locus_tag LOCUS_12340 6823 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 7290 6835 gene locus_tag LOCUS_12350 7290 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 8893 7661 gene locus_tag LOCUS_12360 8893 7661 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_12360 9086 9274 gene locus_tag LOCUS_12370 9086 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 10562 10661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10827 13718 gene locus_tag LOCUS_12380 10827 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 13778 16189 gene locus_tag LOCUS_12390 13778 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 16320 17498 gene locus_tag LOCUS_12400 16320 17498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 19200 17542 gene locus_tag LOCUS_12410 19200 17542 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928646.1 protein_id gnl|my_center|LOCUS_12410 20011 19448 gene locus_tag LOCUS_12420 20011 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence039 <1 1129 gene locus_tag LOCUS_12430 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002666962.1:ABC transporter ATP-binding protein 5307 1267 gene locus_tag LOCUS_12440 5307 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5693 5792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7996 5837 gene locus_tag LOCUS_12450 7996 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 11750 8232 gene locus_tag LOCUS_12460 gene nifJ 11750 8232 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_12460 12316 12241 gene locus_tag LOCUS_t00370 12316 12241 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12446 12372 gene locus_tag LOCUS_t00380 12446 12372 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12530 12456 gene locus_tag LOCUS_t00390 12530 12456 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12906 14624 gene locus_tag LOCUS_12470 12906 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 15027 14644 gene locus_tag LOCUS_12480 15027 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 15241 17886 gene locus_tag LOCUS_12490 15241 17886 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_12490 17937 18012 gene locus_tag LOCUS_t00400 17937 18012 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18514 18810 gene locus_tag LOCUS_12500 18514 18810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 19023 19796 gene locus_tag LOCUS_12510 19023 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence040 3650 219 gene locus_tag LOCUS_12520 3650 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7087 3806 gene locus_tag LOCUS_12530 7087 3806 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_12530 7527 8807 gene locus_tag LOCUS_12540 gene hisS 7527 8807 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_12540 8818 9189 gene locus_tag LOCUS_12550 8818 9189 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405207.1 protein_id gnl|my_center|LOCUS_12550 9194 9742 gene locus_tag LOCUS_12560 9194 9742 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 protein_id gnl|my_center|LOCUS_12560 9864 10610 gene locus_tag LOCUS_12570 gene gpmA 9864 10610 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198007.1 protein_id gnl|my_center|LOCUS_12570 11063 10770 gene locus_tag LOCUS_12580 11063 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 19459 11120 gene locus_tag LOCUS_12590 19459 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11156 11255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence041 926 30 gene locus_tag LOCUS_12600 926 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1390 911 gene locus_tag LOCUS_12610 1390 911 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838769.1 protein_id gnl|my_center|LOCUS_12610 4242 1387 gene locus_tag LOCUS_12620 4242 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6253 4460 gene locus_tag LOCUS_12630 6253 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6989 6204 gene locus_tag LOCUS_12640 gene rsmA 6989 6204 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 protein_id gnl|my_center|LOCUS_12640 7217 7041 gene locus_tag LOCUS_12650 7217 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 7779 7306 gene locus_tag LOCUS_12660 7779 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 8869 7763 gene locus_tag LOCUS_12670 gene nqrF 8869 7763 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_12670 9465 8878 gene locus_tag LOCUS_12680 gene nqrE 9465 8878 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303538.1 protein_id gnl|my_center|LOCUS_12680 10061 9465 gene locus_tag LOCUS_12690 10061 9465 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160493.1 protein_id gnl|my_center|LOCUS_12690 10720 10058 gene locus_tag LOCUS_12700 10720 10058 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_12700 11610 10717 gene locus_tag LOCUS_12710 11610 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 12642 11869 gene locus_tag LOCUS_12720 12642 11869 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_12720 15870 12643 gene locus_tag LOCUS_12730 15870 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_12730 16322 15870 gene locus_tag LOCUS_12740 gene umuD 16322 15870 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_12740 17559 16372 gene locus_tag LOCUS_12750 17559 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 17856 18131 gene locus_tag LOCUS_12760 17856 18131 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence042 1047 223 gene locus_tag LOCUS_12770 1047 223 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_12770 2203 1040 gene locus_tag LOCUS_12780 2203 1040 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_12780 2717 2196 gene locus_tag LOCUS_12790 2717 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3559 2696 gene locus_tag LOCUS_12800 3559 2696 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_12800 3636 4403 gene locus_tag LOCUS_12810 3636 4403 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_12810 4458 5057 gene locus_tag LOCUS_12820 4458 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5047 6105 gene locus_tag LOCUS_12830 5047 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6143 6793 gene locus_tag LOCUS_12840 6143 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 7474 6881 gene locus_tag LOCUS_12850 7474 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 8244 7471 gene locus_tag LOCUS_12860 8244 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 9062 8247 gene locus_tag LOCUS_12870 9062 8247 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878253.1 protein_id gnl|my_center|LOCUS_12870 10740 9055 gene locus_tag LOCUS_12880 10740 9055 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878252.1 protein_id gnl|my_center|LOCUS_12880 13450 10730 gene locus_tag LOCUS_12890 13450 10730 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_12890 14445 13462 gene locus_tag LOCUS_12900 14445 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 15388 14456 gene locus_tag LOCUS_12910 15388 14456 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_12910 16794 15385 gene locus_tag LOCUS_12920 16794 15385 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_12920 17363 16791 gene locus_tag LOCUS_12930 17363 16791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 18562 17363 gene locus_tag LOCUS_12940 18562 17363 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence043 283 702 gene locus_tag LOCUS_12950 283 702 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759735.1 protein_id gnl|my_center|LOCUS_12950 752 1657 gene locus_tag LOCUS_12960 752 1657 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399477.1 protein_id gnl|my_center|LOCUS_12960 2597 1596 gene locus_tag LOCUS_12970 2597 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3383 2598 gene locus_tag LOCUS_12980 3383 2598 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_12980 4111 3383 gene locus_tag LOCUS_12990 4111 3383 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082707.1 protein_id gnl|my_center|LOCUS_12990 5183 4248 gene locus_tag LOCUS_13000 5183 4248 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385462.1 protein_id gnl|my_center|LOCUS_13000 6722 5244 gene locus_tag LOCUS_13010 6722 5244 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861171.1 protein_id gnl|my_center|LOCUS_13010 9772 6752 gene locus_tag LOCUS_13020 9772 6752 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838071.1 protein_id gnl|my_center|LOCUS_13020 10679 9780 gene locus_tag LOCUS_13030 10679 9780 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840178.1 protein_id gnl|my_center|LOCUS_13030 11959 10691 gene locus_tag LOCUS_13040 11959 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_13040 12626 12725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17965 12962 gene locus_tag LOCUS_13050 17965 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence044 1292 279 gene locus_tag LOCUS_13060 1292 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1564 1289 gene locus_tag LOCUS_13070 1564 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2156 1932 gene locus_tag LOCUS_13080 2156 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2121 2402 gene locus_tag LOCUS_13090 2121 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3193 2408 gene locus_tag LOCUS_13100 3193 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3593 3249 gene locus_tag LOCUS_13110 3593 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 9610 3878 gene locus_tag LOCUS_13120 9610 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 10577 9759 gene locus_tag LOCUS_13130 10577 9759 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_13130 10817 10578 gene locus_tag LOCUS_13140 10817 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 11160 10819 gene locus_tag LOCUS_13150 11160 10819 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_13150 12029 11157 gene locus_tag LOCUS_13160 12029 11157 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_13160 12877 12026 gene locus_tag LOCUS_13170 12877 12026 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_13170 13209 12877 gene locus_tag LOCUS_13180 13209 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 13683 13237 gene locus_tag LOCUS_13190 13683 13237 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358683.1 protein_id gnl|my_center|LOCUS_13190 14023 13808 gene locus_tag LOCUS_13200 14023 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 14627 17917 gene locus_tag LOCUS_13210 14627 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence045 235 2229 gene locus_tag LOCUS_13220 235 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2374 3333 gene locus_tag LOCUS_13230 2374 3333 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_13230 3323 4690 gene locus_tag LOCUS_13240 3323 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 4755 5858 gene locus_tag LOCUS_13250 4755 5858 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_13250 5869 6654 gene locus_tag LOCUS_13260 5869 6654 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_13260 6658 7464 gene locus_tag LOCUS_13270 gene lgt 6658 7464 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_13270 7461 8180 gene locus_tag LOCUS_13280 7461 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 8200 9498 gene locus_tag LOCUS_13290 gene purB 8200 9498 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_13290 9568 10008 gene locus_tag LOCUS_13300 9568 10008 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_13300 9987 10628 gene locus_tag LOCUS_13310 9987 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 11544 10612 gene locus_tag LOCUS_13320 11544 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 12602 11541 gene locus_tag LOCUS_13330 12602 11541 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875763.1 protein_id gnl|my_center|LOCUS_13330 12836 13264 gene locus_tag LOCUS_13340 gene rplM 12836 13264 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377605.1 protein_id gnl|my_center|LOCUS_13340 13280 13666 gene locus_tag LOCUS_13350 gene rpsI 13280 13666 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631594.1 protein_id gnl|my_center|LOCUS_13350 13857 14639 gene locus_tag LOCUS_13360 gene rpsB 13857 14639 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546300.1 protein_id gnl|my_center|LOCUS_13360 14716 15312 gene locus_tag LOCUS_13370 gene tsf 14716 15312 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_13370 15331 16059 gene locus_tag LOCUS_13380 gene pyrH 15331 16059 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 protein_id gnl|my_center|LOCUS_13380 16075 16629 gene locus_tag LOCUS_13390 gene frr 16075 16629 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_13390 17824 16877 gene locus_tag LOCUS_13400 17824 16877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence046 <1 906 gene locus_tag LOCUS_13410 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680159.1:formylglycine-generating enzyme family protein 2395 1214 gene locus_tag LOCUS_13420 gene ftsZ 2395 1214 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570127.1 protein_id gnl|my_center|LOCUS_13420 3679 2408 gene locus_tag LOCUS_13430 gene ftsA 3679 2408 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588463.1 protein_id gnl|my_center|LOCUS_13430 4431 3676 gene locus_tag LOCUS_13440 4431 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 5912 4500 gene locus_tag LOCUS_13450 gene murC 5912 4500 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_13450 6967 5924 gene locus_tag LOCUS_13460 gene murG 6967 5924 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130746.1 protein_id gnl|my_center|LOCUS_13460 8106 6964 gene locus_tag LOCUS_13470 gene ftsW 8106 6964 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965425.1 protein_id gnl|my_center|LOCUS_13470 9436 8093 gene locus_tag LOCUS_13480 gene murD 9436 8093 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 protein_id gnl|my_center|LOCUS_13480 10548 9445 gene locus_tag LOCUS_13490 gene mraY 10548 9445 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_13490 13343 10548 gene locus_tag LOCUS_13500 13343 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 15514 13340 gene locus_tag LOCUS_13510 15514 13340 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_13510 15883 15521 gene locus_tag LOCUS_13520 15883 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 16815 15880 gene locus_tag LOCUS_13530 gene rsmH 16815 15880 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_13530 17252 16812 gene locus_tag LOCUS_13540 17252 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence047 196 4476 gene locus_tag LOCUS_13550 196 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4473 7283 gene locus_tag LOCUS_13560 4473 7283 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392668.1 protein_id gnl|my_center|LOCUS_13560 7283 8212 gene locus_tag LOCUS_13570 gene murB 7283 8212 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_13570 8209 8985 gene locus_tag LOCUS_13580 8209 8985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057157.1 protein_id gnl|my_center|LOCUS_13580 9873 9100 gene locus_tag LOCUS_13590 9873 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 10960 9887 gene locus_tag LOCUS_13600 10960 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 11266 11365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11564 12955 gene locus_tag LOCUS_13610 gene gcvT 11564 12955 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_13610 12970 13737 gene locus_tag LOCUS_13620 12970 13737 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_13620 13727 15733 gene locus_tag LOCUS_13630 13727 15733 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861272.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence048 39 1061 gene locus_tag LOCUS_13640 39 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1058 1624 gene locus_tag LOCUS_13650 1058 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3270 1966 gene locus_tag LOCUS_13660 3270 1966 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_13660 3741 3274 gene locus_tag LOCUS_13670 3741 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 4996 3764 gene locus_tag LOCUS_13680 4996 3764 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862413.1 protein_id gnl|my_center|LOCUS_13680 5123 5620 gene locus_tag LOCUS_13690 5123 5620 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_13690 5661 6071 gene locus_tag LOCUS_13700 5661 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6064 6531 gene locus_tag LOCUS_13710 6064 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 6503 7063 gene locus_tag LOCUS_13720 6503 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8596 7151 gene locus_tag LOCUS_13730 8596 7151 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_13730 9326 8598 gene locus_tag LOCUS_13740 gene kdsB 9326 8598 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_13740 11198 9360 gene locus_tag LOCUS_13750 gene mnmG 11198 9360 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_13750 11814 11182 gene locus_tag LOCUS_13760 gene yihA 11814 11182 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 protein_id gnl|my_center|LOCUS_13760 12178 11807 gene locus_tag LOCUS_13770 gene queD 12178 11807 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_13770 13120 12188 gene locus_tag LOCUS_13780 13120 12188 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939854.1 protein_id gnl|my_center|LOCUS_13780 13539 13638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14263 13640 gene locus_tag LOCUS_13790 14263 13640 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583090.1 protein_id gnl|my_center|LOCUS_13790 15451 14264 gene locus_tag LOCUS_13800 gene nifS 15451 14264 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_13800 15860 15456 gene locus_tag LOCUS_13810 15860 15456 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868963.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence049 2760 28 gene locus_tag LOCUS_13820 2760 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3515 2883 gene locus_tag LOCUS_13830 3515 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3632 3731 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5283 4687 gene locus_tag LOCUS_13840 5283 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6497 5280 gene locus_tag LOCUS_13850 gene rodA 6497 5280 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125884.1 protein_id gnl|my_center|LOCUS_13850 8367 6484 gene locus_tag LOCUS_13860 gene mrdA 8367 6484 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_13860 8854 8360 gene locus_tag LOCUS_13870 8854 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 9545 8859 gene locus_tag LOCUS_13880 9545 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392507.1 protein_id gnl|my_center|LOCUS_13880 10306 9542 gene locus_tag LOCUS_13890 gene mreC 10306 9542 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929773.1 protein_id gnl|my_center|LOCUS_13890 11432 10395 gene locus_tag LOCUS_13900 11432 10395 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_13900 16871 11760 gene locus_tag LOCUS_13910 16871 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence050 257 2926 gene locus_tag LOCUS_13920 257 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3134 3991 gene locus_tag LOCUS_13930 3134 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4012 5550 gene locus_tag LOCUS_13940 4012 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 5732 6367 gene locus_tag LOCUS_13950 5732 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 6546 9266 gene locus_tag LOCUS_13960 gene ppdK 6546 9266 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_13960 9359 9910 gene locus_tag LOCUS_13970 9359 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 9911 10519 gene locus_tag LOCUS_13980 gene rdgB 9911 10519 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_13980 10533 11885 gene locus_tag LOCUS_13990 10533 11885 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_13990 12185 13387 gene locus_tag LOCUS_14000 12185 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 14227 13514 gene locus_tag LOCUS_14010 14227 13514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 15412 14396 gene locus_tag LOCUS_14020 15412 14396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 15838 15488 gene locus_tag LOCUS_14030 15838 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 16238 16053 gene locus_tag LOCUS_14040 16238 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 17027 16263 gene locus_tag LOCUS_14050 17027 16263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence051 15 1484 gene locus_tag LOCUS_14060 15 1484 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_14060 3103 1706 gene locus_tag LOCUS_14070 gene creD 3103 1706 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_14070 4525 3227 gene locus_tag LOCUS_14080 4525 3227 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_14080 4972 6195 gene locus_tag LOCUS_14090 4972 6195 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842981.1 protein_id gnl|my_center|LOCUS_14090 6192 6671 gene locus_tag LOCUS_14100 gene coaD 6192 6671 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_14100 6674 8047 gene locus_tag LOCUS_14110 gene dnaB 6674 8047 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938258.1 protein_id gnl|my_center|LOCUS_14110 8048 8797 gene locus_tag LOCUS_14120 8048 8797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405213.1 protein_id gnl|my_center|LOCUS_14120 8797 9834 gene locus_tag LOCUS_14130 8797 9834 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146675.1 protein_id gnl|my_center|LOCUS_14130 11586 9910 gene locus_tag LOCUS_14140 11586 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 14856 11596 gene locus_tag LOCUS_14150 14856 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence052 2680 902 gene locus_tag LOCUS_14160 gene aspS 2680 902 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_14160 3750 2692 gene locus_tag LOCUS_14170 3750 2692 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721374.1 protein_id gnl|my_center|LOCUS_14170 4997 3747 gene locus_tag LOCUS_14180 4997 3747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_14180 5986 4994 gene locus_tag LOCUS_14190 gene recF 5986 4994 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391554.1 protein_id gnl|my_center|LOCUS_14190 7250 6081 gene locus_tag LOCUS_14200 gene dnaN 7250 6081 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003013639.1 protein_id gnl|my_center|LOCUS_14200 7608 7707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8893 8582 gene locus_tag LOCUS_14210 8893 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 9712 10965 gene locus_tag LOCUS_14220 9712 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11360 12901 gene locus_tag LOCUS_14230 11360 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence053 444 1031 gene locus_tag LOCUS_14240 444 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1028 1843 gene locus_tag LOCUS_14250 1028 1843 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_14250 1854 2171 gene locus_tag LOCUS_14260 1854 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2190 3839 gene locus_tag LOCUS_14270 gene hcp 2190 3839 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939296.1 protein_id gnl|my_center|LOCUS_14270 3961 4977 gene locus_tag LOCUS_14280 3961 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 5061 10130 gene locus_tag LOCUS_14290 5061 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 9953 10052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10181 10726 gene locus_tag LOCUS_14300 10181 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 11004 10762 gene locus_tag LOCUS_14310 11004 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 10885 11142 gene locus_tag LOCUS_14320 10885 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 11734 12420 gene locus_tag LOCUS_14330 gene cmk 11734 12420 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_14330 12414 13301 gene locus_tag LOCUS_14340 gene ispH 12414 13301 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence054 4026 2260 gene locus_tag LOCUS_14350 gene nuoF 4026 2260 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_14350 4493 4023 gene locus_tag LOCUS_14360 gene nuoE 4493 4023 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_14360 7318 4703 gene locus_tag LOCUS_14370 7318 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 10174 7469 gene locus_tag LOCUS_14380 10174 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 12991 10376 gene locus_tag LOCUS_14390 12991 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 <15099 13142 gene locus_tag LOCUS_14400 <15099 13142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence055 1164 22 gene locus_tag LOCUS_14410 1164 22 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_14410 1801 1184 gene locus_tag LOCUS_14420 gene rpsD 1801 1184 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_14420 2200 1811 gene locus_tag LOCUS_14430 gene rpsK 2200 1811 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101798.1 protein_id gnl|my_center|LOCUS_14430 2579 2211 gene locus_tag LOCUS_14440 gene rpsM 2579 2211 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_14440 2971 2753 gene locus_tag LOCUS_14450 gene infA 2971 2753 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829792.1 protein_id gnl|my_center|LOCUS_14450 3744 2986 gene locus_tag LOCUS_14460 gene map 3744 2986 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_14460 5058 3745 gene locus_tag LOCUS_14470 gene secY 5058 3745 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_14470 5515 5060 gene locus_tag LOCUS_14480 gene rplO 5515 5060 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_14480 5706 5518 gene locus_tag LOCUS_14490 gene rpmD 5706 5518 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946096.1 protein_id gnl|my_center|LOCUS_14490 6224 5703 gene locus_tag LOCUS_14500 gene rpsE 6224 5703 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_14500 6609 6238 gene locus_tag LOCUS_14510 gene rplR 6609 6238 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623881.1 protein_id gnl|my_center|LOCUS_14510 7194 6622 gene locus_tag LOCUS_14520 gene rplF 7194 6622 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_14520 7617 7204 gene locus_tag LOCUS_14530 gene rpsH 7617 7204 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_14530 7818 7633 gene locus_tag LOCUS_14540 7818 7633 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557082.1 protein_id gnl|my_center|LOCUS_14540 8373 7828 gene locus_tag LOCUS_14550 gene rplE 8373 7828 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 protein_id gnl|my_center|LOCUS_14550 8703 8386 gene locus_tag LOCUS_14560 gene rplX 8703 8386 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459102.1 protein_id gnl|my_center|LOCUS_14560 9080 8712 gene locus_tag LOCUS_14570 gene rplN 9080 8712 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495199.1 protein_id gnl|my_center|LOCUS_14570 9362 9093 gene locus_tag LOCUS_14580 9362 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 9549 9355 gene locus_tag LOCUS_14590 gene rpmC 9549 9355 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_14590 9965 9546 gene locus_tag LOCUS_14600 gene rplP 9965 9546 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_14600 10623 9976 gene locus_tag LOCUS_14610 gene rpsC 10623 9976 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003176422.1 protein_id gnl|my_center|LOCUS_14610 10972 10634 gene locus_tag LOCUS_14620 gene rplV 10972 10634 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391423.1 protein_id gnl|my_center|LOCUS_14620 11258 10983 gene locus_tag LOCUS_14630 gene rpsS 11258 10983 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_14630 12105 11275 gene locus_tag LOCUS_14640 gene rplB 12105 11275 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_14640 12401 12114 gene locus_tag LOCUS_14650 gene rplW 12401 12114 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_14650 13033 12398 gene locus_tag LOCUS_14660 gene rplD 13033 12398 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_14660 13676 13044 gene locus_tag LOCUS_14670 gene rplC 13676 13044 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_14670 14005 13679 gene locus_tag LOCUS_14680 gene rpsJ 14005 13679 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871791.1 protein_id gnl|my_center|LOCUS_14680 14180 13998 gene locus_tag LOCUS_14690 14180 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 14416 14252 gene locus_tag LOCUS_14700 14416 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence056 1736 1960 gene locus_tag LOCUS_14710 1736 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2118 2927 gene locus_tag LOCUS_14720 2118 2927 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972729.1 protein_id gnl|my_center|LOCUS_14720 3811 3164 gene locus_tag LOCUS_14730 3811 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 5898 3712 gene locus_tag LOCUS_14740 5898 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6245 6344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6441 8297 gene locus_tag LOCUS_14750 6441 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 8486 9496 gene locus_tag LOCUS_14760 8486 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 10058 9609 gene locus_tag LOCUS_14770 gene purE 10058 9609 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_14770 10724 10062 gene locus_tag LOCUS_14780 10724 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 10821 11321 gene locus_tag LOCUS_14790 10821 11321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 11401 12117 gene locus_tag LOCUS_14800 11401 12117 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_14800 12114 13190 gene locus_tag LOCUS_14810 gene ychF 12114 13190 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence057 1074 2141 gene locus_tag LOCUS_14820 1074 2141 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_14820 2380 2165 gene locus_tag LOCUS_14830 2380 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4415 2445 gene locus_tag LOCUS_14840 4415 2445 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_14840 7560 4555 gene locus_tag LOCUS_14850 7560 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 9958 7553 gene locus_tag LOCUS_14860 9958 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 10272 10565 gene locus_tag LOCUS_14870 10272 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 13069 10814 gene locus_tag LOCUS_14880 13069 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence058 2131 959 gene locus_tag LOCUS_14890 2131 959 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_14890 3816 2131 gene locus_tag LOCUS_14900 3816 2131 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_14900 4055 3813 gene locus_tag LOCUS_14910 4055 3813 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012311059.1 protein_id gnl|my_center|LOCUS_14910 6052 4052 gene locus_tag LOCUS_14920 6052 4052 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582935.1 protein_id gnl|my_center|LOCUS_14920 7956 6064 gene locus_tag LOCUS_14930 gene nuoF 7956 6064 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_14930 8449 7949 gene locus_tag LOCUS_14940 gene nuoE 8449 7949 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_14940 9175 8537 gene locus_tag LOCUS_14950 9175 8537 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_14950 9671 10450 gene locus_tag LOCUS_14960 9671 10450 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080893.1 protein_id gnl|my_center|LOCUS_14960 10443 11090 gene locus_tag LOCUS_14970 10443 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 11091 12371 gene locus_tag LOCUS_14980 gene thiC 11091 12371 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870539.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence059 236 454 gene locus_tag LOCUS_14990 236 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 821 1108 gene locus_tag LOCUS_15000 821 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1236 1598 gene locus_tag LOCUS_15010 1236 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1605 4724 gene locus_tag LOCUS_15020 gene ileS 1605 4724 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_15020 4995 6782 gene locus_tag LOCUS_15030 4995 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 7197 8369 gene locus_tag LOCUS_15040 7197 8369 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_15040 8639 8409 gene locus_tag LOCUS_15050 8639 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 8702 8801 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9499 8876 gene locus_tag LOCUS_15060 9499 8876 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903837.1 protein_id gnl|my_center|LOCUS_15060 9668 11833 gene locus_tag LOCUS_15070 gene recQ 9668 11833 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_15070 12203 12358 gene locus_tag LOCUS_15080 12203 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence060 229 1452 gene locus_tag LOCUS_15090 229 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1474 2307 gene locus_tag LOCUS_15100 1474 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3895 2834 gene locus_tag LOCUS_15110 3895 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678794.1 protein_id gnl|my_center|LOCUS_15110 4646 4101 gene locus_tag LOCUS_15120 4646 4101 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181848.1 protein_id gnl|my_center|LOCUS_15120 5627 5022 gene locus_tag LOCUS_15130 5627 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6934 5624 gene locus_tag LOCUS_15140 6934 5624 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_15140 7470 9422 gene locus_tag LOCUS_15150 7470 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 10749 9511 gene locus_tag LOCUS_15160 10749 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 <12742 10746 gene locus_tag LOCUS_15170 <12742 10746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928901.1:TonB-dependent receptor 10935 11034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence061 <1 2118 gene locus_tag LOCUS_15180 <1 2118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099383.1:DNA polymerase I 2148 2247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3056 2307 gene locus_tag LOCUS_15190 3056 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4074 3337 gene locus_tag LOCUS_15200 4074 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 4252 4629 gene locus_tag LOCUS_15210 4252 4629 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_15210 4650 5246 gene locus_tag LOCUS_15220 4650 5246 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_15220 5263 5403 gene locus_tag LOCUS_15230 5263 5403 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_15230 5477 5929 gene locus_tag LOCUS_15240 5477 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 5926 6621 gene locus_tag LOCUS_15250 gene tsaB 5926 6621 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_15250 7494 6592 gene locus_tag LOCUS_15260 7494 6592 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582840.1 protein_id gnl|my_center|LOCUS_15260 8982 7501 gene locus_tag LOCUS_15270 8982 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 9634 8990 gene locus_tag LOCUS_15280 9634 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence062 451 3339 gene locus_tag LOCUS_15290 451 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3352 3981 gene locus_tag LOCUS_15300 3352 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3999 5180 gene locus_tag LOCUS_15310 3999 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 5193 5795 gene locus_tag LOCUS_15320 5193 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 5918 8677 gene locus_tag LOCUS_15330 5918 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8687 9307 gene locus_tag LOCUS_15340 8687 9307 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760805.1 protein_id gnl|my_center|LOCUS_15340 10360 9416 gene locus_tag LOCUS_15350 10360 9416 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence063 1357 332 gene locus_tag LOCUS_15360 1357 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1972 1373 gene locus_tag LOCUS_15370 gene lpcA 1972 1373 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 protein_id gnl|my_center|LOCUS_15370 3055 1976 gene locus_tag LOCUS_15380 gene add 3055 1976 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_15380 3661 3221 gene locus_tag LOCUS_15390 gene tsaE 3661 3221 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_15390 4216 3815 gene locus_tag LOCUS_15400 4216 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 5029 4226 gene locus_tag LOCUS_15410 5029 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 5037 5136 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6988 5948 gene locus_tag LOCUS_15420 6988 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 8220 7006 gene locus_tag LOCUS_15430 8220 7006 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_15430 8598 8410 gene locus_tag LOCUS_15440 8598 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 10469 8817 gene locus_tag LOCUS_15450 10469 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 12270 10471 gene locus_tag LOCUS_15460 gene lepA 12270 10471 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280999.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence064 1831 497 gene locus_tag LOCUS_15470 1831 497 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_15470 4265 1824 gene locus_tag LOCUS_15480 4265 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 6221 4272 gene locus_tag LOCUS_15490 6221 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 6728 6327 gene locus_tag LOCUS_15500 gene mce 6728 6327 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_15500 7281 6733 gene locus_tag LOCUS_15510 7281 6733 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_15510 8117 7278 gene locus_tag LOCUS_15520 8117 7278 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_15520 9366 8119 gene locus_tag LOCUS_15530 9366 8119 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_15530 9665 9366 gene locus_tag LOCUS_15540 9665 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 10916 9699 gene locus_tag LOCUS_15550 10916 9699 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_15550 11227 10937 gene locus_tag LOCUS_15560 11227 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence065 1256 129 gene locus_tag LOCUS_15570 1256 129 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789543.1 protein_id gnl|my_center|LOCUS_15570 1976 1260 gene locus_tag LOCUS_15580 1976 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2822 1980 gene locus_tag LOCUS_15590 2822 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4383 2833 gene locus_tag LOCUS_15600 4383 2833 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_15600 4705 5526 gene locus_tag LOCUS_15610 gene nadC 4705 5526 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_15610 5529 6254 gene locus_tag LOCUS_15620 5529 6254 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_15620 6504 7391 gene locus_tag LOCUS_15630 6504 7391 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930648.1 protein_id gnl|my_center|LOCUS_15630 7800 7399 gene locus_tag LOCUS_15640 7800 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 7880 10387 gene locus_tag LOCUS_15650 7880 10387 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838538.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence066 1489 392 gene locus_tag LOCUS_15660 1489 392 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 protein_id gnl|my_center|LOCUS_15660 1756 3867 gene locus_tag LOCUS_15670 1756 3867 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_15670 4135 5469 gene locus_tag LOCUS_15680 gene gcvPA 4135 5469 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_15680 5462 6916 gene locus_tag LOCUS_15690 gene gcvPB 5462 6916 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933777.1 protein_id gnl|my_center|LOCUS_15690 6926 7567 gene locus_tag LOCUS_15700 6926 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 7570 8610 gene locus_tag LOCUS_15710 gene lpxD 7570 8610 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922341.1 protein_id gnl|my_center|LOCUS_15710 8603 10000 gene locus_tag LOCUS_15720 8603 10000 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_15720 9997 10767 gene locus_tag LOCUS_15730 gene lpxA 9997 10767 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence067 3059 888 gene locus_tag LOCUS_15740 3059 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4917 3184 gene locus_tag LOCUS_15750 4917 3184 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477345.1 protein_id gnl|my_center|LOCUS_15750 5290 4928 gene locus_tag LOCUS_15760 5290 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5613 5891 gene locus_tag LOCUS_15770 5613 5891 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_15770 5905 6534 gene locus_tag LOCUS_15780 5905 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7367 6573 gene locus_tag LOCUS_15790 7367 6573 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_15790 8240 7368 gene locus_tag LOCUS_15800 8240 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 9881 8241 gene locus_tag LOCUS_15810 gene yidC 9881 8241 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_15810 10441 10127 gene locus_tag LOCUS_15820 10441 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10579 10445 gene locus_tag LOCUS_15830 gene rpmH 10579 10445 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence068 951 2144 gene locus_tag LOCUS_15840 gene kbl 951 2144 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_15840 2148 2978 gene locus_tag LOCUS_15850 gene rsmI 2148 2978 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_15850 2975 3610 gene locus_tag LOCUS_15860 2975 3610 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174997.1 protein_id gnl|my_center|LOCUS_15860 4958 3636 gene locus_tag LOCUS_15870 4958 3636 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_15870 5897 4965 gene locus_tag LOCUS_15880 5897 4965 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_15880 6472 5894 gene locus_tag LOCUS_15890 6472 5894 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_15890 7891 6488 gene locus_tag LOCUS_15900 gene ahcY 7891 6488 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932403.1 protein_id gnl|my_center|LOCUS_15900 9780 7966 gene locus_tag LOCUS_15910 9780 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 8668 8767 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10234 9965 gene locus_tag LOCUS_15920 gene rpsO 10234 9965 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence069 1360 305 gene locus_tag LOCUS_15930 gene wecB 1360 305 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_15930 2645 1362 gene locus_tag LOCUS_15940 2645 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 3226 2642 gene locus_tag LOCUS_15950 3226 2642 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_15950 3826 3230 gene locus_tag LOCUS_15960 gene recR 3826 3230 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_15960 4152 3829 gene locus_tag LOCUS_15970 4152 3829 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_15970 4258 4357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5573 4716 gene locus_tag LOCUS_15980 5573 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 6619 5570 gene locus_tag LOCUS_15990 gene hydE 6619 5570 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_15990 <10686 7136 gene locus_tag LOCUS_16000 <10686 7136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616152.1:agmatine deiminase family protein >Feature sequence070 109 738 gene locus_tag LOCUS_16010 109 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1809 718 gene locus_tag LOCUS_16020 1809 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2895 1813 gene locus_tag LOCUS_16030 gene csm5 2895 1813 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546605.1 protein_id gnl|my_center|LOCUS_16030 3914 2901 gene locus_tag LOCUS_16040 3914 2901 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_16040 4605 3925 gene locus_tag LOCUS_16050 gene csm3 4605 3925 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_16050 5028 4618 gene locus_tag LOCUS_16060 5028 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 7507 5021 gene locus_tag LOCUS_16070 gene cas10 7507 5021 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_16070 8541 7648 gene locus_tag LOCUS_16080 8541 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 10017 9046 gene locus_tag LOCUS_16090 10017 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence071 535 314 gene locus_tag LOCUS_16100 535 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 651 2027 gene locus_tag LOCUS_16110 651 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1876 1975 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3485 2205 gene locus_tag LOCUS_16120 3485 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3495 3594 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4283 3900 gene locus_tag LOCUS_16130 4283 3900 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869552.1 protein_id gnl|my_center|LOCUS_16130 4472 6868 gene locus_tag LOCUS_16140 4472 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 6849 7442 gene locus_tag LOCUS_16150 gene gmhB 6849 7442 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_16150 7439 8242 gene locus_tag LOCUS_16160 7439 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 8235 9020 gene locus_tag LOCUS_16170 8235 9020 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870123.1 protein_id gnl|my_center|LOCUS_16170 9065 10123 gene locus_tag LOCUS_16180 gene dinB 9065 10123 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140172.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence072 680 294 gene locus_tag LOCUS_16190 680 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1752 688 gene locus_tag LOCUS_16200 gene arsB 1752 688 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_16200 2115 1765 gene locus_tag LOCUS_16210 2115 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3035 2142 gene locus_tag LOCUS_16220 3035 2142 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107120.1 protein_id gnl|my_center|LOCUS_16220 3301 3032 gene locus_tag LOCUS_16230 gene arsR 3301 3032 CDS product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120603.1 protein_id gnl|my_center|LOCUS_16230 3889 3737 gene locus_tag LOCUS_16240 3889 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 4165 3929 gene locus_tag LOCUS_16250 4165 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 4760 4233 gene locus_tag LOCUS_16260 4760 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 5179 4769 gene locus_tag LOCUS_16270 5179 4769 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_16270 5418 5185 gene locus_tag LOCUS_16280 5418 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6142 5435 gene locus_tag LOCUS_16290 6142 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 7446 6139 gene locus_tag LOCUS_16300 7446 6139 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_16300 7747 7466 gene locus_tag LOCUS_16310 7747 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 8394 8050 gene locus_tag LOCUS_16320 8394 8050 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_16320 8738 8475 gene locus_tag LOCUS_16330 8738 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 8827 9273 gene locus_tag LOCUS_16340 8827 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence073 2415 1111 gene locus_tag LOCUS_16350 gene rseP 2415 1111 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262429.1 protein_id gnl|my_center|LOCUS_16350 3156 2419 gene locus_tag LOCUS_16360 3156 2419 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_16360 4709 3153 gene locus_tag LOCUS_16370 4709 3153 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_16370 5210 6886 gene locus_tag LOCUS_16380 5210 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 7034 7822 gene locus_tag LOCUS_16390 7034 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence074 3218 981 gene locus_tag LOCUS_16400 3218 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4539 3220 gene locus_tag LOCUS_16410 4539 3220 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_16410 5270 4536 gene locus_tag LOCUS_16420 5270 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 7179 5434 gene locus_tag LOCUS_16430 7179 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 7982 7188 gene locus_tag LOCUS_16440 7982 7188 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141396.1 protein_id gnl|my_center|LOCUS_16440 8718 7975 gene locus_tag LOCUS_16450 8718 7975 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466723.1 protein_id gnl|my_center|LOCUS_16450 <9793 8708 gene locus_tag LOCUS_16460 <9793 8708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886623.1:peptide chain release factor 2 >Feature sequence075 2 556 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaacccttgatttgatggattgatggatagagac 1325 738 gene locus_tag LOCUS_16470 gene cas4 1325 738 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_16470 1620 1330 gene locus_tag LOCUS_16480 1620 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2675 1620 gene locus_tag LOCUS_16490 gene cas1 2675 1620 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_16490 5066 2679 gene locus_tag LOCUS_16500 5066 2679 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_16500 5836 5066 gene locus_tag LOCUS_16510 5836 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 6721 5849 gene locus_tag LOCUS_16520 gene cas7b 6721 5849 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_16520 8750 6714 gene locus_tag LOCUS_16530 8750 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 9421 8747 gene locus_tag LOCUS_16540 9421 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence076 89 872 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatcccctcaaacgggtcgtgtttatttcaat 1532 1245 gene locus_tag LOCUS_16550 gene cas2 1532 1245 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263664.1 protein_id gnl|my_center|LOCUS_16550 2527 1523 gene locus_tag LOCUS_16560 gene cas1 2527 1523 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_16560 5262 2563 gene locus_tag LOCUS_16570 5262 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3640 3739 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5415 6251 gene locus_tag LOCUS_16580 5415 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 6235 7125 gene locus_tag LOCUS_16590 6235 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 7222 8673 gene locus_tag LOCUS_16600 7222 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence077 884 153 gene locus_tag LOCUS_16610 884 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1716 871 gene locus_tag LOCUS_16620 1716 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2164 2649 gene locus_tag LOCUS_16630 2164 2649 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939670.1 protein_id gnl|my_center|LOCUS_16630 2711 3193 gene locus_tag LOCUS_16640 2711 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3248 3892 gene locus_tag LOCUS_16650 3248 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 4232 5512 gene locus_tag LOCUS_16660 4232 5512 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294071.1 protein_id gnl|my_center|LOCUS_16660 5505 6419 gene locus_tag LOCUS_16670 5505 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 6588 8687 gene locus_tag LOCUS_16680 6588 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 8878 9111 gene locus_tag LOCUS_16690 8878 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence078 5656 200 gene locus_tag LOCUS_16700 5656 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 7139 5718 gene locus_tag LOCUS_16710 gene glnA 7139 5718 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_16710 7831 7187 gene locus_tag LOCUS_16720 7831 7187 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_16720 9030 7828 gene locus_tag LOCUS_16730 gene tyrS 9030 7828 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence079 1259 1358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2699 1443 gene locus_tag LOCUS_16740 2699 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4282 2927 gene locus_tag LOCUS_16750 4282 2927 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_16750 4591 4690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5507 4965 gene locus_tag LOCUS_16760 5507 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 5959 5519 gene locus_tag LOCUS_16770 5959 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 7318 5975 gene locus_tag LOCUS_16780 7318 5975 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_16780 7840 8973 gene locus_tag LOCUS_16790 7840 8973 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence080 <1 973 gene locus_tag LOCUS_16800 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037269.1:endonuclease 2929 1358 gene locus_tag LOCUS_16810 2929 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4200 2926 gene locus_tag LOCUS_16820 4200 2926 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048114.1 protein_id gnl|my_center|LOCUS_16820 4243 4342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5538 4522 gene locus_tag LOCUS_16830 gene ruvB 5538 4522 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_16830 6000 5542 gene locus_tag LOCUS_16840 6000 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6735 6019 gene locus_tag LOCUS_16850 6735 6019 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_16850 7490 6738 gene locus_tag LOCUS_16860 7490 6738 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048115.1 protein_id gnl|my_center|LOCUS_16860 7578 8468 gene locus_tag LOCUS_16870 gene xerC 7578 8468 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_16870 8579 8503 gene locus_tag LOCUS_t00410 8579 8503 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8669 8593 gene locus_tag LOCUS_t00420 8669 8593 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 3871 2492 gene locus_tag LOCUS_16880 3871 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 4370 4579 gene locus_tag LOCUS_16890 4370 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 5324 5632 gene locus_tag LOCUS_16900 5324 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16900 8257 5846 gene locus_tag LOCUS_16910 8257 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence082 506 2371 gene locus_tag LOCUS_16920 506 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2372 3484 gene locus_tag LOCUS_16930 2372 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3488 4042 gene locus_tag LOCUS_16940 3488 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4039 5481 gene locus_tag LOCUS_16950 4039 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 5491 6822 gene locus_tag LOCUS_16960 5491 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 6822 7634 gene locus_tag LOCUS_16970 gene zupT 6822 7634 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_16970 8245 7823 gene locus_tag LOCUS_16980 8245 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 8654 8226 gene locus_tag LOCUS_16990 8654 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence083 1131 151 gene locus_tag LOCUS_17000 gene secF 1131 151 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_17000 2737 1142 gene locus_tag LOCUS_17010 gene secD 2737 1142 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939106.1 protein_id gnl|my_center|LOCUS_17010 3141 2839 gene locus_tag LOCUS_17020 3141 2839 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791533.1 protein_id gnl|my_center|LOCUS_17020 6352 3098 gene locus_tag LOCUS_17030 6352 3098 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_17030 7296 6352 gene locus_tag LOCUS_17040 gene ftsY 7296 6352 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443981.1 protein_id gnl|my_center|LOCUS_17040 7449 8054 gene locus_tag LOCUS_17050 7449 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 8047 8652 gene locus_tag LOCUS_17060 8047 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence084 <1 641 gene locus_tag LOCUS_17070 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065262.1:CRISPR-associated endonuclease Cas6 638 2503 gene locus_tag LOCUS_17080 638 2503 CDS product TIGR02556 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082349.1 protein_id gnl|my_center|LOCUS_17080 2516 3385 gene locus_tag LOCUS_17090 gene cas7b 2516 3385 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_17090 3411 4127 gene locus_tag LOCUS_17100 gene cas5b 3411 4127 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_17100 5722 6426 gene locus_tag LOCUS_17110 5722 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6429 7490 gene locus_tag LOCUS_17120 gene cas1 6429 7490 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_17120 7484 7774 gene locus_tag LOCUS_17130 7484 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 7897 8367 gene locus_tag LOCUS_17140 7897 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence085 <1 8262 gene locus_tag LOCUS_17150 <1 8262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245629.1:bacillopeptidase F >Feature sequence086 <1 820 gene locus_tag LOCUS_17160 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022565.1:phosphatase PAP2 family protein 981 1481 gene locus_tag LOCUS_17170 981 1481 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_17170 1995 2837 gene locus_tag LOCUS_17180 1995 2837 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 protein_id gnl|my_center|LOCUS_17180 2853 3554 gene locus_tag LOCUS_17190 2853 3554 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_17190 3558 3971 gene locus_tag LOCUS_17200 3558 3971 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_17200 4552 4016 gene locus_tag LOCUS_17210 4552 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 4772 6025 gene locus_tag LOCUS_17220 4772 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6022 7350 gene locus_tag LOCUS_17230 6022 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 7996 7352 gene locus_tag LOCUS_17240 7996 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence087 5146 5658 gene locus_tag LOCUS_17250 5146 5658 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_17250 5665 7443 gene locus_tag LOCUS_17260 5665 7443 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_17260 7436 8218 gene locus_tag LOCUS_17270 7436 8218 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence088 165 2141 gene locus_tag LOCUS_17280 165 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2339 4804 gene locus_tag LOCUS_17290 2339 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4819 5997 gene locus_tag LOCUS_17300 4819 5997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_17300 5994 6881 gene locus_tag LOCUS_17310 5994 6881 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813258.1 protein_id gnl|my_center|LOCUS_17310 6878 7678 gene locus_tag LOCUS_17320 6878 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence089 70 2130 gene locus_tag LOCUS_17330 70 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2141 2857 gene locus_tag LOCUS_17340 2141 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2854 3369 gene locus_tag LOCUS_17350 2854 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3587 4348 gene locus_tag LOCUS_17360 3587 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4682 5464 gene locus_tag LOCUS_17370 4682 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 5461 6531 gene locus_tag LOCUS_17380 5461 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 7606 7139 gene locus_tag LOCUS_17390 gene tnpA 7606 7139 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence090 3433 1022 gene locus_tag LOCUS_17400 3433 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4954 3488 gene locus_tag LOCUS_17410 4954 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 6436 4964 gene locus_tag LOCUS_17420 6436 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence091 922 425 gene locus_tag LOCUS_17430 922 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17430 1380 919 gene locus_tag LOCUS_17440 1380 919 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975049.1 protein_id gnl|my_center|LOCUS_17440 2276 1377 gene locus_tag LOCUS_17450 2276 1377 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869168.1 protein_id gnl|my_center|LOCUS_17450 3115 2303 gene locus_tag LOCUS_17460 3115 2303 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_17460 4535 3126 gene locus_tag LOCUS_17470 4535 3126 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_17470 6040 4532 gene locus_tag LOCUS_17480 gene fdrA 6040 4532 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_17480 6798 6037 gene locus_tag LOCUS_17490 6798 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence092 161 1729 gene locus_tag LOCUS_17500 161 1729 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_17500 1796 2908 gene locus_tag LOCUS_17510 1796 2908 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857221.1 protein_id gnl|my_center|LOCUS_17510 3088 4887 gene locus_tag LOCUS_17520 3088 4887 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_17520 4942 5331 gene locus_tag LOCUS_17530 4942 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5513 5947 gene locus_tag LOCUS_17540 5513 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6046 6900 gene locus_tag LOCUS_17550 6046 6900 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861549.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence093 337 1500 gene locus_tag LOCUS_17560 337 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 4140 1579 gene locus_tag LOCUS_17570 gene clpB 4140 1579 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence094 821 5149 gene locus_tag LOCUS_17580 821 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 6462 5455 gene locus_tag LOCUS_17590 6462 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 6580 6443 gene locus_tag LOCUS_17600 6580 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence095 1717 524 gene locus_tag LOCUS_17610 1717 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2192 1707 gene locus_tag LOCUS_17620 2192 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2836 2192 gene locus_tag LOCUS_17630 2836 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 4946 2823 gene locus_tag LOCUS_17640 4946 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2894 2993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6480 4933 gene locus_tag LOCUS_17650 6480 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence096 407 30 gene locus_tag LOCUS_17660 407 30 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_17660 3817 455 gene locus_tag LOCUS_17670 gene ileS 3817 455 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_17670 3990 4592 gene locus_tag LOCUS_17680 3990 4592 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_17680 4829 4608 gene locus_tag LOCUS_17690 4829 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 6053 5118 gene locus_tag LOCUS_17700 6053 5118 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_17700 <6745 6050 gene locus_tag LOCUS_17710 <6745 6050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790532.1:MraY family glycosyltransferase >Feature sequence097 2482 1367 gene locus_tag LOCUS_17720 2482 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 4581 2479 gene locus_tag LOCUS_17730 4581 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 5339 4839 gene locus_tag LOCUS_17740 5339 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 6532 5336 gene locus_tag LOCUS_17750 6532 5336 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675897.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence098 1575 55 gene locus_tag LOCUS_17760 1575 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5680 1871 gene locus_tag LOCUS_17770 5680 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 6150 6410 gene locus_tag LOCUS_17780 6150 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence099 5705 336 gene locus_tag LOCUS_17790 5705 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence100 1993 1151 gene locus_tag LOCUS_17800 gene cas1 1993 1151 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_17800 6149 2067 gene locus_tag LOCUS_17810 gene cas9 6149 2067 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963637.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence101 881 645 gene locus_tag LOCUS_17820 881 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1360 1635 gene locus_tag LOCUS_17830 1360 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1776 3491 gene locus_tag LOCUS_17840 1776 3491 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074344.1 protein_id gnl|my_center|LOCUS_17840 4437 3478 gene locus_tag LOCUS_17850 4437 3478 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074343.1 protein_id gnl|my_center|LOCUS_17850 4827 4597 gene locus_tag LOCUS_17860 4827 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 5454 4999 gene locus_tag LOCUS_17870 5454 4999 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_17870 6227 6152 gene locus_tag LOCUS_t00430 6227 6152 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence102 3105 673 gene locus_tag LOCUS_17880 3105 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3802 5283 gene locus_tag LOCUS_17890 3802 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5292 6143 gene locus_tag LOCUS_17900 5292 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence103 3805 3272 gene locus_tag LOCUS_17910 3805 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 5355 4534 gene locus_tag LOCUS_17920 5355 4534 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065510.1 protein_id gnl|my_center|LOCUS_17920 5730 5939 gene locus_tag LOCUS_17930 5730 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence104 5 1563 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcagcttgacaccaaacagctattagattttat 1926 1606 gene locus_tag LOCUS_17940 gene cas2 1926 1606 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_17940 2833 1919 gene locus_tag LOCUS_17950 gene cas1 2833 1919 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_17950 5987 2808 gene locus_tag LOCUS_17960 gene cas9 5987 2808 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence105 665 1003 gene locus_tag LOCUS_17970 665 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1367 990 gene locus_tag LOCUS_17980 1367 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1610 2209 gene locus_tag LOCUS_17990 1610 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2260 3420 gene locus_tag LOCUS_18000 2260 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4318 5064 gene locus_tag LOCUS_18010 4318 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5758 5396 gene locus_tag LOCUS_18020 5758 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence106 238 1431 gene locus_tag LOCUS_18030 gene pgsB 238 1431 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_18030 1424 1879 gene locus_tag LOCUS_18040 gene pgsC 1424 1879 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_18040 1881 2999 gene locus_tag LOCUS_18050 1881 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3019 3840 gene locus_tag LOCUS_18060 3019 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3850 4980 gene locus_tag LOCUS_18070 3850 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4997 5311 gene locus_tag LOCUS_18080 4997 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence107 2079 868 gene locus_tag LOCUS_18090 2079 868 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838690.1 protein_id gnl|my_center|LOCUS_18090 2954 2076 gene locus_tag LOCUS_18100 2954 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3418 2957 gene locus_tag LOCUS_18110 3418 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4858 3593 gene locus_tag LOCUS_18120 4858 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 5429 4860 gene locus_tag LOCUS_18130 5429 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5851 5435 gene locus_tag LOCUS_18140 5851 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence108 2376 616 gene locus_tag LOCUS_18150 2376 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 5339 3138 gene locus_tag LOCUS_18160 5339 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence109 665 228 gene locus_tag LOCUS_18170 665 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1714 728 gene locus_tag LOCUS_18180 gene dprA 1714 728 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082954.1 protein_id gnl|my_center|LOCUS_18180 2845 1832 gene locus_tag LOCUS_18190 gene obgE 2845 1832 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_18190 4348 2867 gene locus_tag LOCUS_18200 4348 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5217 4348 gene locus_tag LOCUS_18210 5217 4348 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence110 2353 1013 gene locus_tag LOCUS_18220 2353 1013 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_18220 2885 2370 gene locus_tag LOCUS_18230 2885 2370 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_18230 3957 2941 gene locus_tag LOCUS_18240 3957 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 4066 4165 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5097 5010 gene locus_tag LOCUS_t00440 5097 5010 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence111 463 1614 gene locus_tag LOCUS_18250 gene alr 463 1614 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982425.1 protein_id gnl|my_center|LOCUS_18250 2866 1754 gene locus_tag LOCUS_18260 2866 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4989 2863 gene locus_tag LOCUS_18270 4989 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence112 2619 904 gene locus_tag LOCUS_18280 2619 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 4673 2622 gene locus_tag LOCUS_18290 4673 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5141 4701 gene locus_tag LOCUS_18300 5141 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence113 1202 2497 gene locus_tag LOCUS_18310 1202 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2372 2471 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2637 4853 gene locus_tag LOCUS_18320 2637 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence114 24 1202 gene locus_tag LOCUS_18330 24 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1184 2872 gene locus_tag LOCUS_18340 1184 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence115 1023 112 gene locus_tag LOCUS_18350 1023 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1885 1049 gene locus_tag LOCUS_18360 1885 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 4133 3489 gene locus_tag LOCUS_18370 4133 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4853 4155 gene locus_tag LOCUS_18380 4853 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence116 1212 2165 gene locus_tag LOCUS_18390 1212 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3836 2211 gene locus_tag LOCUS_18400 3836 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence117 <1 1296 gene locus_tag LOCUS_18410 <1 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000189425.1:sodium-extruding oxaloacetate decarboxylase subunit alpha 1306 1842 gene locus_tag LOCUS_18420 gene pyrR 1306 1842 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431186.1 protein_id gnl|my_center|LOCUS_18420 1820 2617 gene locus_tag LOCUS_18430 gene pyrF 1820 2617 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence118 1477 929 gene locus_tag LOCUS_18440 1477 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3675 2062 gene locus_tag LOCUS_18450 3675 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4454 3672 gene locus_tag LOCUS_18460 4454 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence119 245 2329 gene locus_tag LOCUS_18470 245 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2326 3666 gene locus_tag LOCUS_18480 2326 3666 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence120 <1 1923 gene locus_tag LOCUS_18490 <1 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065524.1:DUF2341 domain-containing protein 1934 2902 gene locus_tag LOCUS_18500 1934 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2913 4790 gene locus_tag LOCUS_18510 2913 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence121 224 703 gene locus_tag LOCUS_18520 224 703 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_18520 705 1235 gene locus_tag LOCUS_18530 705 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1235 2161 gene locus_tag LOCUS_18540 1235 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2232 2807 gene locus_tag LOCUS_18550 2232 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2807 3400 gene locus_tag LOCUS_18560 2807 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3397 4113 gene locus_tag LOCUS_18570 3397 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4497 4120 gene locus_tag LOCUS_18580 4497 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence122 <1 3346 gene locus_tag LOCUS_18590 <1 3346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860274.1:right-handed parallel beta-helix repeat-containing protein 3358 4461 gene locus_tag LOCUS_18600 3358 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence123 705 2837 gene locus_tag LOCUS_18610 705 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2837 4837 gene locus_tag LOCUS_18620 2837 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence124 1447 422 gene locus_tag LOCUS_18630 1447 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3627 1441 gene locus_tag LOCUS_18640 3627 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 <4761 4037 gene locus_tag LOCUS_18650 <4761 4037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680159.1:formylglycine-generating enzyme family protein >Feature sequence125 4623 838 gene locus_tag LOCUS_18660 4623 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence126 1388 2941 gene locus_tag LOCUS_18670 1388 2941 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938762.1 protein_id gnl|my_center|LOCUS_18670 2945 4438 gene locus_tag LOCUS_18680 gene lysS 2945 4438 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence127 156 359 gene locus_tag LOCUS_18690 156 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3588 655 gene locus_tag LOCUS_18700 3588 655 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_18700 4440 3598 gene locus_tag LOCUS_18710 4440 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence128 <1 2287 gene locus_tag LOCUS_18720 <1 2287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870228.1:helicase-related protein 2280 3737 gene locus_tag LOCUS_18730 2280 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence129 2688 2518 gene locus_tag LOCUS_18740 2688 2518 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387504.1 protein_id gnl|my_center|LOCUS_18740 4102 2828 gene locus_tag LOCUS_18750 4102 2828 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence130 663 812 gene locus_tag LOCUS_18760 663 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence131 2860 1604 gene locus_tag LOCUS_18770 2860 1604 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291923.1 protein_id gnl|my_center|LOCUS_18770 3602 3207 gene locus_tag LOCUS_18780 3602 3207 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723377.1 protein_id gnl|my_center|LOCUS_18780 3879 3595 gene locus_tag LOCUS_18790 3879 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810433.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence132 >Feature sequence133 550 1101 gene locus_tag LOCUS_18800 550 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1283 2398 gene locus_tag LOCUS_18810 1283 2398 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710628.1 protein_id gnl|my_center|LOCUS_18810 2614 3402 gene locus_tag LOCUS_18820 2614 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18820 >Feature sequence134 254 2386 gene locus_tag LOCUS_18830 254 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2383 3501 gene locus_tag LOCUS_18840 2383 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence135 124 558 gene locus_tag LOCUS_18850 124 558 CDS product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963419.1 protein_id gnl|my_center|LOCUS_18850 739 2106 gene locus_tag LOCUS_18860 739 2106 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_18860 2303 2782 gene locus_tag LOCUS_18870 2303 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2850 3857 gene locus_tag LOCUS_18880 gene wecB 2850 3857 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence136 3703 1946 gene locus_tag LOCUS_18890 3703 1946 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence137 494 1081 gene locus_tag LOCUS_18900 494 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1212 2096 gene locus_tag LOCUS_18910 1212 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2093 2434 gene locus_tag LOCUS_18920 2093 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2440 3090 gene locus_tag LOCUS_18930 2440 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence138 2613 814 gene locus_tag LOCUS_18940 2613 814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence139 <1 2111 gene locus_tag LOCUS_18950 <1 2111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164979579.1:AAA domain-containing protein >Feature sequence140 2504 1767 gene locus_tag LOCUS_18960 2504 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3105 2530 gene locus_tag LOCUS_18970 3105 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence141 >Feature sequence142 >Feature sequence143 3056 801 gene locus_tag LOCUS_18980 3056 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence144 322 110 gene locus_tag LOCUS_18990 322 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 677 3505 gene locus_tag LOCUS_19000 677 3505 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence145 <1 636 gene locus_tag LOCUS_19010 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680712.1:carbon-nitrogen hydrolase family protein 661 1107 gene locus_tag LOCUS_19020 661 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2339 1176 gene locus_tag LOCUS_19030 2339 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1180 1279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3091 2357 gene locus_tag LOCUS_19040 3091 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence146 >Feature sequence147 440 252 gene locus_tag LOCUS_19050 440 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 516 2771 gene locus_tag LOCUS_19060 516 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence148 230 574 gene locus_tag LOCUS_19070 230 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3239 576 gene locus_tag LOCUS_19080 3239 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence149 522 692 gene locus_tag LOCUS_19090 522 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 706 2307 gene locus_tag LOCUS_19100 706 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence150 1139 231 gene locus_tag LOCUS_19110 1139 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1606 1349 gene locus_tag LOCUS_19120 1606 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3178 1907 gene locus_tag LOCUS_19130 3178 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence151 <3391 542 gene locus_tag LOCUS_19140 <3391 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963937.1:T9SS type A sorting domain-containing protein >Feature sequence152 2937 1945 gene locus_tag LOCUS_19150 2937 1945 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933236.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence153 3072 1897 gene locus_tag LOCUS_19160 3072 1897 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence154 2068 2 gene locus_tag LOCUS_19170 2068 2 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_19170 3171 2068 gene locus_tag LOCUS_19180 3171 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence155 1255 65 gene locus_tag LOCUS_19190 1255 65 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_19190 1701 1252 gene locus_tag LOCUS_19200 1701 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 <3245 1698 gene locus_tag LOCUS_19210 <3245 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869170.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence156 266 111 gene locus_tag LOCUS_19220 266 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1972 332 gene locus_tag LOCUS_19230 1972 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2437 2117 gene locus_tag LOCUS_19240 gene trxA 2437 2117 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_19240 2719 2444 gene locus_tag LOCUS_19250 2719 2444 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence157 2496 7 gene locus_tag LOCUS_19260 gene mrfA 2496 7 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_19260 3089 2496 gene locus_tag LOCUS_19270 3089 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence158 227 937 gene locus_tag LOCUS_19280 227 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 938 1456 gene locus_tag LOCUS_19290 938 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1449 1847 gene locus_tag LOCUS_19300 1449 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1850 2227 gene locus_tag LOCUS_19310 1850 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2420 2875 gene locus_tag LOCUS_19320 2420 2875 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202837.1 protein_id gnl|my_center|LOCUS_19320 2908 3189 gene locus_tag LOCUS_19330 2908 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence159 1679 828 gene locus_tag LOCUS_19340 1679 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 3024 1681 gene locus_tag LOCUS_19350 3024 1681 CDS product SH3 domain-containing C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853331.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence160 19 1443 gene locus_tag LOCUS_19360 19 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1308 1407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1506 2828 gene locus_tag LOCUS_19370 1506 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence161 162 1712 gene locus_tag LOCUS_19380 162 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence162 118 1806 gene locus_tag LOCUS_19390 118 1806 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_19390 1799 2749 gene locus_tag LOCUS_19400 gene dusB 1799 2749 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence163 299 988 gene locus_tag LOCUS_19410 299 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1260 1048 gene locus_tag LOCUS_19420 1260 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2258 1566 gene locus_tag LOCUS_19430 gene aqpZ 2258 1566 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705214.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence164 1820 1437 gene locus_tag LOCUS_19440 1820 1437 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_19440 1945 2019 gene locus_tag LOCUS_t00450 1945 2019 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2726 2112 gene locus_tag LOCUS_19450 gene ahpC 2726 2112 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775969.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence165 141 782 gene locus_tag LOCUS_19460 141 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 804 1568 gene locus_tag LOCUS_19470 gene soj 804 1568 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_19470 1582 2424 gene locus_tag LOCUS_19480 1582 2424 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence166 >Feature sequence167 1228 737 gene locus_tag LOCUS_19490 1228 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1579 1232 gene locus_tag LOCUS_19500 1579 1232 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence168 1008 820 gene locus_tag LOCUS_19510 1008 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2574 1021 gene locus_tag LOCUS_19520 2574 1021 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence169 1315 143 gene locus_tag LOCUS_19530 1315 143 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727030.1 protein_id gnl|my_center|LOCUS_19530 2510 1380 gene locus_tag LOCUS_19540 2510 1380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_19540 2937 2614 gene locus_tag LOCUS_19550 2937 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence170 2408 402 gene locus_tag LOCUS_19560 2408 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence171 >Feature sequence172 735 22 gene locus_tag LOCUS_19570 735 22 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_19570 2852 732 gene locus_tag LOCUS_19580 2852 732 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence173 2296 1268 gene locus_tag LOCUS_19590 gene wlbA 2296 1268 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence174 1965 1528 gene locus_tag LOCUS_19600 1965 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence175 159 2858 gene locus_tag LOCUS_19610 159 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence176 >Feature sequence177 2113 2436 gene locus_tag LOCUS_19620 2113 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence178 1753 419 gene locus_tag LOCUS_19630 gene rlmD 1753 419 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_19630 2622 1753 gene locus_tag LOCUS_19640 gene htpX 2622 1753 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence179 2 169 gene locus_tag LOCUS_19650 2 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1512 232 gene locus_tag LOCUS_19660 1512 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2639 1509 gene locus_tag LOCUS_19670 2639 1509 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence180 88 471 gene locus_tag LOCUS_19680 88 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 468 1103 gene locus_tag LOCUS_19690 468 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence181 2662 86 gene locus_tag LOCUS_19700 2662 86 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence182 <1 1086 gene locus_tag LOCUS_19710 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808733.1:DEAD/DEAH box helicase family protein 1643 2398 gene locus_tag LOCUS_19720 1643 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence183 800 423 gene locus_tag LOCUS_19730 800 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1925 813 gene locus_tag LOCUS_19740 1925 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence184 741 2435 gene locus_tag LOCUS_19750 741 2435 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence185 750 157 gene locus_tag LOCUS_19760 750 157 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_19760 2029 818 gene locus_tag LOCUS_19770 gene thrC 2029 818 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence186 570 1781 gene locus_tag LOCUS_19780 gene thrC 570 1781 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_19780 1935 2441 gene locus_tag LOCUS_19790 1935 2441 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_19790