>Feature sequence01 3336 4451 gene locus_tag LOCUS_00010 3336 4451 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_00010 4551 5234 gene locus_tag LOCUS_00020 gene ctrA 4551 5234 CDS product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920871.1 protein_id gnl|my_center|LOCUS_00020 6947 5235 gene locus_tag LOCUS_00030 6947 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8556 6988 gene locus_tag LOCUS_00040 8556 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 9143 8727 gene locus_tag LOCUS_00050 9143 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 10620 9166 gene locus_tag LOCUS_00060 gene pyk 10620 9166 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858708.1 protein_id gnl|my_center|LOCUS_00060 12727 10649 gene locus_tag LOCUS_00070 12727 10649 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852419.1 protein_id gnl|my_center|LOCUS_00070 13333 12836 gene locus_tag LOCUS_00080 13333 12836 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932995.1 protein_id gnl|my_center|LOCUS_00080 13471 14295 gene locus_tag LOCUS_00090 13471 14295 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 protein_id gnl|my_center|LOCUS_00090 14408 17035 gene locus_tag LOCUS_00100 14408 17035 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864150.1 protein_id gnl|my_center|LOCUS_00100 17037 18683 gene locus_tag LOCUS_00110 gene sulP 17037 18683 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_00110 19881 18667 gene locus_tag LOCUS_00120 19881 18667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 21295 19892 gene locus_tag LOCUS_00130 21295 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_00130 22028 21309 gene locus_tag LOCUS_00140 gene flgH 22028 21309 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864738.1 protein_id gnl|my_center|LOCUS_00140 22108 22551 gene locus_tag LOCUS_00150 22108 22551 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858625.1 protein_id gnl|my_center|LOCUS_00150 23368 22577 gene locus_tag LOCUS_00160 gene trpC 23368 22577 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854779.1 protein_id gnl|my_center|LOCUS_00160 24662 23370 gene locus_tag LOCUS_00170 24662 23370 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855132.1 protein_id gnl|my_center|LOCUS_00170 25035 24655 gene locus_tag LOCUS_00180 25035 24655 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864630.1 protein_id gnl|my_center|LOCUS_00180 25718 25023 gene locus_tag LOCUS_00190 25718 25023 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864161.1 protein_id gnl|my_center|LOCUS_00190 25769 26485 gene locus_tag LOCUS_00200 gene kdsB 25769 26485 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852502.1 protein_id gnl|my_center|LOCUS_00200 26663 27940 gene locus_tag LOCUS_00210 26663 27940 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_00210 28178 29371 gene locus_tag LOCUS_00220 28178 29371 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_00220 29463 29969 gene locus_tag LOCUS_00230 29463 29969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30005 30970 gene locus_tag LOCUS_00240 30005 30970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30960 31664 gene locus_tag LOCUS_00250 30960 31664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31690 31899 gene locus_tag LOCUS_00260 31690 31899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31943 33463 gene locus_tag LOCUS_00270 31943 33463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33476 34756 gene locus_tag LOCUS_00280 33476 34756 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210051.1 protein_id gnl|my_center|LOCUS_00280 34781 35527 gene locus_tag LOCUS_00290 34781 35527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35566 36594 gene locus_tag LOCUS_00300 35566 36594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 37846 36557 gene locus_tag LOCUS_00310 37846 36557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38202 38002 gene locus_tag LOCUS_00320 38202 38002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38847 38572 gene locus_tag LOCUS_00330 gene rpsO 38847 38572 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852579.1 protein_id gnl|my_center|LOCUS_00330 38983 39384 gene locus_tag LOCUS_00340 38983 39384 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852609.1 protein_id gnl|my_center|LOCUS_00340 39389 41566 gene locus_tag LOCUS_00350 gene flhA 39389 41566 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262893.1 protein_id gnl|my_center|LOCUS_00350 41587 42666 gene locus_tag LOCUS_00360 41587 42666 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852576.1 protein_id gnl|my_center|LOCUS_00360 44091 42682 gene locus_tag LOCUS_00370 44091 42682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45190 44099 gene locus_tag LOCUS_00380 45190 44099 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857924.1 protein_id gnl|my_center|LOCUS_00380 46390 45191 gene locus_tag LOCUS_00390 gene tyrS 46390 45191 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_00390 48602 46449 gene locus_tag LOCUS_00400 48602 46449 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 protein_id gnl|my_center|LOCUS_00400 48825 48607 gene locus_tag LOCUS_00410 48825 48607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49649 48936 gene locus_tag LOCUS_00420 gene pyrH 49649 48936 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148056.1 protein_id gnl|my_center|LOCUS_00420 49787 50578 gene locus_tag LOCUS_00430 49787 50578 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933208.1 protein_id gnl|my_center|LOCUS_00430 50638 51381 gene locus_tag LOCUS_00440 gene modA 50638 51381 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857589.1 protein_id gnl|my_center|LOCUS_00440 51378 51782 gene locus_tag LOCUS_00450 51378 51782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51775 52455 gene locus_tag LOCUS_00460 gene modB 51775 52455 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_00460 54267 52468 gene locus_tag LOCUS_00470 54267 52468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55215 54271 gene locus_tag LOCUS_00480 55215 54271 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811615.1 protein_id gnl|my_center|LOCUS_00480 56779 55226 gene locus_tag LOCUS_00490 56779 55226 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811612.1 protein_id gnl|my_center|LOCUS_00490 59971 56918 gene locus_tag LOCUS_00500 gene hefC 59971 56918 CDS product efflux RND transporter permease subunit HefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278421.1 protein_id gnl|my_center|LOCUS_00500 60723 59977 gene locus_tag LOCUS_00510 gene hefB 60723 59977 CDS product efflux RND transporter periplasmic adaptor subunit HefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619658.1 protein_id gnl|my_center|LOCUS_00510 61946 60720 gene locus_tag LOCUS_00520 61946 60720 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266478.1 protein_id gnl|my_center|LOCUS_00520 62400 62026 gene locus_tag LOCUS_00530 62400 62026 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869815.1 protein_id gnl|my_center|LOCUS_00530 62814 62611 gene locus_tag LOCUS_00540 62814 62611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 64593 62881 gene locus_tag LOCUS_00550 64593 62881 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140819.1 protein_id gnl|my_center|LOCUS_00550 65358 64972 gene locus_tag LOCUS_00560 65358 64972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 66461 65355 gene locus_tag LOCUS_00570 gene dapE 66461 65355 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854067.1 protein_id gnl|my_center|LOCUS_00570 67650 66472 gene locus_tag LOCUS_00580 67650 66472 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_00580 68265 67654 gene locus_tag LOCUS_00590 68265 67654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 68693 68262 gene locus_tag LOCUS_00600 68693 68262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851686.1 protein_id gnl|my_center|LOCUS_00600 71953 68696 gene locus_tag LOCUS_00610 gene carB 71953 68696 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858661.1 protein_id gnl|my_center|LOCUS_00610 72796 72035 gene locus_tag LOCUS_00620 gene mreC 72796 72035 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864583.1 protein_id gnl|my_center|LOCUS_00620 73826 72789 gene locus_tag LOCUS_00630 73826 72789 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_00630 75080 73836 gene locus_tag LOCUS_00640 gene clpX 75080 73836 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_00640 75863 75081 gene locus_tag LOCUS_00650 gene lpxA 75863 75081 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851756.1 protein_id gnl|my_center|LOCUS_00650 76312 75863 gene locus_tag LOCUS_00660 gene fabZ 76312 75863 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 protein_id gnl|my_center|LOCUS_00660 77443 76361 gene locus_tag LOCUS_00670 77443 76361 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 protein_id gnl|my_center|LOCUS_00670 77993 77493 gene locus_tag LOCUS_00680 77993 77493 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001873572.1 protein_id gnl|my_center|LOCUS_00680 78056 79273 gene locus_tag LOCUS_00690 78056 79273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79273 79929 gene locus_tag LOCUS_00700 gene crdR 79273 79929 CDS product copper response regulator transcription factor CrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_00700 80130 82679 gene locus_tag LOCUS_00710 80130 82679 CDS product adenine/cytosine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895775.1 protein_id gnl|my_center|LOCUS_00710 82681 83865 gene locus_tag LOCUS_00720 82681 83865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664224.1 protein_id gnl|my_center|LOCUS_00720 84659 83898 gene locus_tag LOCUS_00730 84659 83898 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933543.1 protein_id gnl|my_center|LOCUS_00730 84855 86204 gene locus_tag LOCUS_00740 84855 86204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 86215 86529 gene locus_tag LOCUS_00750 86215 86529 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_00750 86529 88193 gene locus_tag LOCUS_00760 86529 88193 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_00760 88318 90132 gene locus_tag LOCUS_00770 88318 90132 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388392.1 protein_id gnl|my_center|LOCUS_00770 90135 90752 gene locus_tag LOCUS_00780 90135 90752 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388391.1 protein_id gnl|my_center|LOCUS_00780 90752 92707 gene locus_tag LOCUS_00790 gene acs 90752 92707 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851288.1 protein_id gnl|my_center|LOCUS_00790 92797 93480 gene locus_tag LOCUS_00800 gene pyrF 92797 93480 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_00800 93553 93642 gene locus_tag LOCUS_t00010 93553 93642 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 94824 93667 gene locus_tag LOCUS_00810 94824 93667 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178940705.1 protein_id gnl|my_center|LOCUS_00810 95061 94834 gene locus_tag LOCUS_00820 95061 94834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 97211 95073 gene locus_tag LOCUS_00830 97211 95073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 97445 97215 gene locus_tag LOCUS_00840 97445 97215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 97571 98314 gene locus_tag LOCUS_00850 97571 98314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 98512 98321 gene locus_tag LOCUS_00860 98512 98321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 98798 98559 gene locus_tag LOCUS_00870 98798 98559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 101395 99149 gene locus_tag LOCUS_00880 101395 99149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 102509 101397 gene locus_tag LOCUS_00890 102509 101397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 105893 102537 gene locus_tag LOCUS_00900 105893 102537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 106388 105903 gene locus_tag LOCUS_00910 106388 105903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 106827 106390 gene locus_tag LOCUS_00920 106827 106390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 107715 107068 gene locus_tag LOCUS_00930 107715 107068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 107842 108144 gene locus_tag LOCUS_00940 107842 108144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 108146 108367 gene locus_tag LOCUS_00950 108146 108367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 108364 108618 gene locus_tag LOCUS_00960 108364 108618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 108875 108615 gene locus_tag LOCUS_00970 108875 108615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 109451 108882 gene locus_tag LOCUS_00980 109451 108882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 109741 109926 gene locus_tag LOCUS_00990 109741 109926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 110358 110074 gene locus_tag LOCUS_01000 110358 110074 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948599.1 protein_id gnl|my_center|LOCUS_01000 110672 110361 gene locus_tag LOCUS_01010 110672 110361 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_01010 110904 111050 gene locus_tag LOCUS_01020 110904 111050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 111276 111518 gene locus_tag LOCUS_01030 111276 111518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 111875 114901 gene locus_tag LOCUS_01040 gene mutS 111875 114901 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118377.1 protein_id gnl|my_center|LOCUS_01040 116117 114909 gene locus_tag LOCUS_01050 116117 114909 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855462.1 protein_id gnl|my_center|LOCUS_01050 116958 116119 gene locus_tag LOCUS_01060 gene galU 116958 116119 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088639.1 protein_id gnl|my_center|LOCUS_01060 119121 116974 gene locus_tag LOCUS_01070 gene pglB 119121 116974 CDS product undecaprenyl-diphosphooligosaccharide--protein glycotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852780.1 protein_id gnl|my_center|LOCUS_01070 120188 119136 gene locus_tag LOCUS_01080 gene mqnE 120188 119136 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858079.1 protein_id gnl|my_center|LOCUS_01080 121390 120191 gene locus_tag LOCUS_01090 gene metK 121390 120191 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852836.1 protein_id gnl|my_center|LOCUS_01090 123036 121468 gene locus_tag LOCUS_01100 gene lsrK 123036 121468 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098852.1 protein_id gnl|my_center|LOCUS_01100 123224 123934 gene locus_tag LOCUS_01110 123224 123934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 124192 124437 gene locus_tag LOCUS_01120 124192 124437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 124437 124709 gene locus_tag LOCUS_01130 124437 124709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 125347 124877 gene locus_tag LOCUS_01140 125347 124877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 125478 125684 gene locus_tag LOCUS_01150 125478 125684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 126263 125976 gene locus_tag LOCUS_01160 126263 125976 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 protein_id gnl|my_center|LOCUS_01160 126358 128868 gene locus_tag LOCUS_01170 126358 128868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 129001 130815 gene locus_tag LOCUS_01180 gene glmS 129001 130815 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858421.1 protein_id gnl|my_center|LOCUS_01180 130893 132740 gene locus_tag LOCUS_01190 130893 132740 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880333.1 protein_id gnl|my_center|LOCUS_01190 134100 132988 gene locus_tag LOCUS_01200 134100 132988 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 protein_id gnl|my_center|LOCUS_01200 135575 134193 gene locus_tag LOCUS_01210 gene thiC 135575 134193 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_01210 135751 136872 gene locus_tag LOCUS_01220 135751 136872 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_01220 136869 137756 gene locus_tag LOCUS_01230 136869 137756 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_01230 137734 138924 gene locus_tag LOCUS_01240 137734 138924 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851486.1 protein_id gnl|my_center|LOCUS_01240 138932 139438 gene locus_tag LOCUS_01250 138932 139438 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851418.1 protein_id gnl|my_center|LOCUS_01250 140620 139490 gene locus_tag LOCUS_01260 140620 139490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 141540 141049 gene locus_tag LOCUS_01270 141540 141049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 142347 141550 gene locus_tag LOCUS_01280 142347 141550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 143451 142351 gene locus_tag LOCUS_01290 143451 142351 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763705.1 protein_id gnl|my_center|LOCUS_01290 144149 143451 gene locus_tag LOCUS_01300 144149 143451 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814882.1 protein_id gnl|my_center|LOCUS_01300 144293 144619 gene locus_tag LOCUS_01310 144293 144619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 144705 146600 gene locus_tag LOCUS_01320 144705 146600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 146979 146611 gene locus_tag LOCUS_01330 146979 146611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 147044 147442 gene locus_tag LOCUS_01340 147044 147442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 150521 147549 gene locus_tag LOCUS_01350 150521 147549 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_01350 151133 150648 gene locus_tag LOCUS_01360 151133 150648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 151976 151227 gene locus_tag LOCUS_01370 gene flaC 151976 151227 CDS product flagellin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858476.1 protein_id gnl|my_center|LOCUS_01370 152135 152845 gene locus_tag LOCUS_01380 152135 152845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072727.1 protein_id gnl|my_center|LOCUS_01380 153097 152888 gene locus_tag LOCUS_01390 153097 152888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 153764 153222 gene locus_tag LOCUS_01400 153764 153222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 153986 154204 gene locus_tag LOCUS_01410 153986 154204 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_01410 154644 154264 gene locus_tag LOCUS_01420 154644 154264 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021908.1 protein_id gnl|my_center|LOCUS_01420 154762 156258 gene locus_tag LOCUS_01430 154762 156258 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854402.1 protein_id gnl|my_center|LOCUS_01430 156278 156418 gene locus_tag LOCUS_01440 156278 156418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 156505 158109 gene locus_tag LOCUS_01450 156505 158109 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942070.1 protein_id gnl|my_center|LOCUS_01450 158096 158935 gene locus_tag LOCUS_01460 158096 158935 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 protein_id gnl|my_center|LOCUS_01460 158932 159276 gene locus_tag LOCUS_01470 158932 159276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 159399 160751 gene locus_tag LOCUS_01480 gene gdhA 159399 160751 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 protein_id gnl|my_center|LOCUS_01480 160874 161542 gene locus_tag LOCUS_01490 160874 161542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 161539 162546 gene locus_tag LOCUS_01500 161539 162546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 162763 165585 gene locus_tag LOCUS_01510 gene napA 162763 165585 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_01510 165641 166435 gene locus_tag LOCUS_01520 gene napG 165641 166435 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852504.1 protein_id gnl|my_center|LOCUS_01520 166432 167277 gene locus_tag LOCUS_01530 gene napH 166432 167277 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891886.1 protein_id gnl|my_center|LOCUS_01530 167261 167968 gene locus_tag LOCUS_01540 167261 167968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 167968 168450 gene locus_tag LOCUS_01550 167968 168450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 168450 169400 gene locus_tag LOCUS_01560 168450 169400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 169414 169857 gene locus_tag LOCUS_01570 169414 169857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 169902 170291 gene locus_tag LOCUS_01580 169902 170291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 170295 170591 gene locus_tag LOCUS_01590 170295 170591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 170596 171024 gene locus_tag LOCUS_01600 170596 171024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 172319 171039 gene locus_tag LOCUS_01610 gene pepP 172319 171039 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693180.1 protein_id gnl|my_center|LOCUS_01610 172912 172316 gene locus_tag LOCUS_01620 172912 172316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 173876 172914 gene locus_tag LOCUS_01630 173876 172914 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771786.1 protein_id gnl|my_center|LOCUS_01630 174657 173914 gene locus_tag LOCUS_01640 174657 173914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969503.1 protein_id gnl|my_center|LOCUS_01640 175772 174657 gene locus_tag LOCUS_01650 175772 174657 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 protein_id gnl|my_center|LOCUS_01650 176277 175783 gene locus_tag LOCUS_01660 gene cheW 176277 175783 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070768.1 protein_id gnl|my_center|LOCUS_01660 178673 176274 gene locus_tag LOCUS_01670 178673 176274 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_01670 179626 178685 gene locus_tag LOCUS_01680 179626 178685 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851778.1 protein_id gnl|my_center|LOCUS_01680 180367 179630 gene locus_tag LOCUS_01690 180367 179630 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858657.1 protein_id gnl|my_center|LOCUS_01690 181361 180357 gene locus_tag LOCUS_01700 gene argC 181361 180357 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870608.1 protein_id gnl|my_center|LOCUS_01700 181845 181348 gene locus_tag LOCUS_01710 gene greA 181845 181348 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031337.1 protein_id gnl|my_center|LOCUS_01710 182002 182523 gene locus_tag LOCUS_01720 182002 182523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 183720 182539 gene locus_tag LOCUS_01730 183720 182539 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022106.1 protein_id gnl|my_center|LOCUS_01730 185200 183713 gene locus_tag LOCUS_01740 185200 183713 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_01740 187317 185371 gene locus_tag LOCUS_01750 187317 185371 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262047.1 protein_id gnl|my_center|LOCUS_01750 187777 187307 gene locus_tag LOCUS_01760 187777 187307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 188928 187777 gene locus_tag LOCUS_01770 188928 187777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262049.1 protein_id gnl|my_center|LOCUS_01770 189835 188963 gene locus_tag LOCUS_01780 189835 188963 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_01780 190958 189933 gene locus_tag LOCUS_01790 190958 189933 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_01790 193291 190955 gene locus_tag LOCUS_01800 193291 190955 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819022.1 protein_id gnl|my_center|LOCUS_01800 193637 193383 gene locus_tag LOCUS_01810 193637 193383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 194001 193621 gene locus_tag LOCUS_01820 194001 193621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 194641 193994 gene locus_tag LOCUS_01830 194641 193994 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860322.1 protein_id gnl|my_center|LOCUS_01830 195443 194643 gene locus_tag LOCUS_01840 gene surE 195443 194643 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854555.1 protein_id gnl|my_center|LOCUS_01840 195548 196939 gene locus_tag LOCUS_01850 195548 196939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 197108 198463 gene locus_tag LOCUS_01860 gene rho 197108 198463 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004715.1 protein_id gnl|my_center|LOCUS_01860 198467 199210 gene locus_tag LOCUS_01870 gene murI 198467 199210 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851499.1 protein_id gnl|my_center|LOCUS_01870 199232 200221 gene locus_tag LOCUS_01880 199232 200221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 200221 200634 gene locus_tag LOCUS_01890 200221 200634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 200634 201689 gene locus_tag LOCUS_01900 200634 201689 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_01900 201682 203721 gene locus_tag LOCUS_01910 201682 203721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 203762 205522 gene locus_tag LOCUS_01920 203762 205522 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971176.1 protein_id gnl|my_center|LOCUS_01920 205551 207596 gene locus_tag LOCUS_01930 205551 207596 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074095.1 protein_id gnl|my_center|LOCUS_01930 208798 207632 gene locus_tag LOCUS_01940 208798 207632 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966754.1 protein_id gnl|my_center|LOCUS_01940 210776 208791 gene locus_tag LOCUS_01950 210776 208791 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 protein_id gnl|my_center|LOCUS_01950 211645 210773 gene locus_tag LOCUS_01960 211645 210773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 212511 211642 gene locus_tag LOCUS_01970 gene rhuM 212511 211642 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 protein_id gnl|my_center|LOCUS_01970 213660 212773 gene locus_tag LOCUS_01980 gene rhuM 213660 212773 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 protein_id gnl|my_center|LOCUS_01980 214569 213709 gene locus_tag LOCUS_01990 gene dinD 214569 213709 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_01990 214770 214606 gene locus_tag LOCUS_02000 214770 214606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 216157 214799 gene locus_tag LOCUS_02010 216157 214799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 216912 216160 gene locus_tag LOCUS_02020 216912 216160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 219575 216909 gene locus_tag LOCUS_02030 219575 216909 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244282.1 protein_id gnl|my_center|LOCUS_02030 219746 221128 gene locus_tag LOCUS_02040 219746 221128 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358083.1 protein_id gnl|my_center|LOCUS_02040 221115 222782 gene locus_tag LOCUS_02050 221115 222782 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980053.1 protein_id gnl|my_center|LOCUS_02050 222804 223586 gene locus_tag LOCUS_02060 222804 223586 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873837.1 protein_id gnl|my_center|LOCUS_02060 224021 223785 gene locus_tag LOCUS_02070 224021 223785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 224064 225770 gene locus_tag LOCUS_02080 224064 225770 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197484.1 protein_id gnl|my_center|LOCUS_02080 228406 225812 gene locus_tag LOCUS_02090 228406 225812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 229725 228442 gene locus_tag LOCUS_02100 229725 228442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 231248 229854 gene locus_tag LOCUS_02110 231248 229854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 231916 231242 gene locus_tag LOCUS_02120 231916 231242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860529.1 protein_id gnl|my_center|LOCUS_02120 232028 232486 gene locus_tag LOCUS_02130 232028 232486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 233292 232483 gene locus_tag LOCUS_02140 233292 232483 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 protein_id gnl|my_center|LOCUS_02140 233980 233309 gene locus_tag LOCUS_02150 gene ung 233980 233309 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_02150 236983 234008 gene locus_tag LOCUS_02160 236983 234008 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858240.1 protein_id gnl|my_center|LOCUS_02160 238127 236961 gene locus_tag LOCUS_02170 238127 236961 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798455.1 protein_id gnl|my_center|LOCUS_02170 239665 238124 gene locus_tag LOCUS_02180 239665 238124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 240198 239668 gene locus_tag LOCUS_02190 gene lptE 240198 239668 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202125.1 protein_id gnl|my_center|LOCUS_02190 242650 240200 gene locus_tag LOCUS_02200 gene leuS 242650 240200 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_02200 242998 242660 gene locus_tag LOCUS_02210 242998 242660 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383778.1 protein_id gnl|my_center|LOCUS_02210 244073 243102 gene locus_tag LOCUS_02220 gene secF 244073 243102 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_02220 245653 244076 gene locus_tag LOCUS_02230 gene secD 245653 244076 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_02230 245909 245643 gene locus_tag LOCUS_02240 gene yajC 245909 245643 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 protein_id gnl|my_center|LOCUS_02240 246013 247251 gene locus_tag LOCUS_02250 246013 247251 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237964.1 protein_id gnl|my_center|LOCUS_02250 247310 249421 gene locus_tag LOCUS_02260 247310 249421 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860421.1 protein_id gnl|my_center|LOCUS_02260 249411 249938 gene locus_tag LOCUS_02270 249411 249938 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851622.1 protein_id gnl|my_center|LOCUS_02270 249948 250559 gene locus_tag LOCUS_02280 249948 250559 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979664.1 protein_id gnl|my_center|LOCUS_02280 251368 250556 gene locus_tag LOCUS_02290 251368 250556 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965820.1 protein_id gnl|my_center|LOCUS_02290 251848 251654 gene locus_tag LOCUS_02300 251848 251654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 252288 251836 gene locus_tag LOCUS_02310 252288 251836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 253527 252349 gene locus_tag LOCUS_02320 gene argJ 253527 252349 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905565.1 protein_id gnl|my_center|LOCUS_02320 254656 253520 gene locus_tag LOCUS_02330 254656 253520 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461981.1 protein_id gnl|my_center|LOCUS_02330 254866 254678 gene locus_tag LOCUS_02340 gene rpmB 254866 254678 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_02340 255029 255826 gene locus_tag LOCUS_02350 255029 255826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 255823 257217 gene locus_tag LOCUS_02360 255823 257217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 257293 257934 gene locus_tag LOCUS_02370 gene rpe 257293 257934 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861474.1 protein_id gnl|my_center|LOCUS_02370 257979 258545 gene locus_tag LOCUS_02380 257979 258545 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_02380 258535 259332 gene locus_tag LOCUS_02390 258535 259332 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858535.1 protein_id gnl|my_center|LOCUS_02390 260269 259334 gene locus_tag LOCUS_02400 gene accA 260269 259334 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_02400 261502 260285 gene locus_tag LOCUS_02410 261502 260285 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 protein_id gnl|my_center|LOCUS_02410 261829 261602 gene locus_tag LOCUS_02420 gene acpP 261829 261602 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854831.1 protein_id gnl|my_center|LOCUS_02420 262151 263974 gene locus_tag LOCUS_02430 262151 263974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 265532 263994 gene locus_tag LOCUS_02440 265532 263994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 265796 265536 gene locus_tag LOCUS_02450 265796 265536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 267245 265941 gene locus_tag LOCUS_02460 267245 265941 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_02460 268219 267272 gene locus_tag LOCUS_02470 268219 267272 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943863.1 protein_id gnl|my_center|LOCUS_02470 269012 268311 gene locus_tag LOCUS_02480 gene fabG 269012 268311 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_02480 268380 268389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 270509 269034 gene locus_tag LOCUS_02490 gene gpmI 270509 269034 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057737.1 protein_id gnl|my_center|LOCUS_02490 270787 271644 gene locus_tag LOCUS_02500 gene mraY 270787 271644 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 protein_id gnl|my_center|LOCUS_02500 271644 272846 gene locus_tag LOCUS_02510 gene murD 271644 272846 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_02510 272843 273415 gene locus_tag LOCUS_02520 gene purN 272843 273415 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_02520 273461 273536 gene locus_tag LOCUS_t00020 273461 273536 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 273567 273642 gene locus_tag LOCUS_t00030 273567 273642 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 274267 273809 gene locus_tag LOCUS_02530 274267 273809 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932275.1 protein_id gnl|my_center|LOCUS_02530 276632 274290 gene locus_tag LOCUS_02540 276632 274290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 278536 276629 gene locus_tag LOCUS_02550 278536 276629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 280205 278529 gene locus_tag LOCUS_02560 280205 278529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 280576 280202 gene locus_tag LOCUS_02570 280576 280202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 281850 280828 gene locus_tag LOCUS_02580 281850 280828 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083922.1 protein_id gnl|my_center|LOCUS_02580 282336 281866 gene locus_tag LOCUS_02590 282336 281866 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389161.1 protein_id gnl|my_center|LOCUS_02590 283161 282337 gene locus_tag LOCUS_02600 283161 282337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 284529 283165 gene locus_tag LOCUS_02610 284529 283165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 285363 284539 gene locus_tag LOCUS_02620 285363 284539 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665509.1 protein_id gnl|my_center|LOCUS_02620 287434 285356 gene locus_tag LOCUS_02630 gene cheA 287434 285356 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081040.1 protein_id gnl|my_center|LOCUS_02630 287690 287427 gene locus_tag LOCUS_02640 287690 287427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 289334 287691 gene locus_tag LOCUS_02650 289334 287691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 289831 289337 gene locus_tag LOCUS_02660 289831 289337 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_02660 290220 289834 gene locus_tag LOCUS_02670 290220 289834 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072183.1 protein_id gnl|my_center|LOCUS_02670 291709 290300 gene locus_tag LOCUS_02680 291709 290300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 291824 293107 gene locus_tag LOCUS_02690 291824 293107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 293074 293766 gene locus_tag LOCUS_02700 gene dccR 293074 293766 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_02700 293869 294253 gene locus_tag LOCUS_tm00010 293869 294253 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 295195 294299 gene locus_tag LOCUS_02710 295195 294299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 296706 295618 gene locus_tag LOCUS_02720 296706 295618 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_02720 297622 296726 gene locus_tag LOCUS_02730 297622 296726 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963753.1 protein_id gnl|my_center|LOCUS_02730 298634 297600 gene locus_tag LOCUS_02740 gene gmd 298634 297600 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 protein_id gnl|my_center|LOCUS_02740 299953 298643 gene locus_tag LOCUS_02750 gene vpoC 299953 298643 CDS product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 protein_id gnl|my_center|LOCUS_02750 301241 299943 gene locus_tag LOCUS_02760 301241 299943 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266724.1 protein_id gnl|my_center|LOCUS_02760 303046 301250 gene locus_tag LOCUS_02770 303046 301250 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266723.1 protein_id gnl|my_center|LOCUS_02770 304472 303087 gene locus_tag LOCUS_02780 304472 303087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 305040 304588 gene locus_tag LOCUS_02790 305040 304588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 305107 305183 gene locus_tag LOCUS_t00040 305107 305183 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 305424 305188 gene locus_tag LOCUS_02800 305424 305188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 305456 306253 gene locus_tag LOCUS_02810 305456 306253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 307017 306271 gene locus_tag LOCUS_02820 307017 306271 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_02820 307885 307028 gene locus_tag LOCUS_02830 307885 307028 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557801.1 protein_id gnl|my_center|LOCUS_02830 308646 307900 gene locus_tag LOCUS_02840 308646 307900 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_02840 309787 308627 gene locus_tag LOCUS_02850 309787 308627 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088747.1 protein_id gnl|my_center|LOCUS_02850 310680 309766 gene locus_tag LOCUS_02860 310680 309766 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088748.1 protein_id gnl|my_center|LOCUS_02860 311456 310677 gene locus_tag LOCUS_02870 311456 310677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 313060 311453 gene locus_tag LOCUS_02880 313060 311453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 314907 313060 gene locus_tag LOCUS_02890 gene asnB 314907 313060 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088751.1 protein_id gnl|my_center|LOCUS_02890 315679 314939 gene locus_tag LOCUS_02900 315679 314939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 316374 315682 gene locus_tag LOCUS_02910 316374 315682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 317690 316371 gene locus_tag LOCUS_02920 317690 316371 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_02920 318820 317726 gene locus_tag LOCUS_02930 318820 317726 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_02930 319956 318817 gene locus_tag LOCUS_02940 gene rfbB 319956 318817 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_02940 <320806 319960 gene locus_tag LOCUS_02950 <320806 319960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073074.1:glucose-1-phosphate thymidylyltransferase RfbA >Feature sequence02 310 1008 gene locus_tag LOCUS_02960 310 1008 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 protein_id gnl|my_center|LOCUS_02960 1001 1399 gene locus_tag LOCUS_02970 1001 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 2486 1470 gene locus_tag LOCUS_02980 2486 1470 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969580.1 protein_id gnl|my_center|LOCUS_02980 2899 2606 gene locus_tag LOCUS_02990 gene soxZ 2899 2606 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_02990 3414 2959 gene locus_tag LOCUS_03000 3414 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 4589 3456 gene locus_tag LOCUS_03010 4589 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5940 4600 gene locus_tag LOCUS_03020 gene soxC 5940 4600 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_03020 6203 6643 gene locus_tag LOCUS_03030 6203 6643 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228600.1 protein_id gnl|my_center|LOCUS_03030 7317 6631 gene locus_tag LOCUS_03040 7317 6631 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376795.1 protein_id gnl|my_center|LOCUS_03040 8114 7314 gene locus_tag LOCUS_03050 8114 7314 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680541.1 protein_id gnl|my_center|LOCUS_03050 8967 8203 gene locus_tag LOCUS_03060 8967 8203 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_03060 9827 8964 gene locus_tag LOCUS_03070 9827 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 9992 10324 gene locus_tag LOCUS_03080 gene secG 9992 10324 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851915.1 protein_id gnl|my_center|LOCUS_03080 10423 10980 gene locus_tag LOCUS_03090 gene frr 10423 10980 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864198.1 protein_id gnl|my_center|LOCUS_03090 11012 11620 gene locus_tag LOCUS_03100 gene pyrE 11012 11620 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 protein_id gnl|my_center|LOCUS_03100 11635 12732 gene locus_tag LOCUS_03110 11635 12732 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444586.1 protein_id gnl|my_center|LOCUS_03110 12734 14203 gene locus_tag LOCUS_03120 12734 14203 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223797.1 protein_id gnl|my_center|LOCUS_03120 14196 15302 gene locus_tag LOCUS_03130 14196 15302 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263351.1 protein_id gnl|my_center|LOCUS_03130 15295 16233 gene locus_tag LOCUS_03140 15295 16233 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_03140 16230 16892 gene locus_tag LOCUS_03150 16230 16892 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_03150 17025 16879 gene locus_tag LOCUS_03160 17025 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 17124 18110 gene locus_tag LOCUS_03170 gene mltB 17124 18110 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957654.1 protein_id gnl|my_center|LOCUS_03170 18557 18174 gene locus_tag LOCUS_03180 18557 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 19072 18761 gene locus_tag LOCUS_03190 19072 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 19619 19194 gene locus_tag LOCUS_03200 19619 19194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 20370 19678 gene locus_tag LOCUS_03210 20370 19678 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461351.1 protein_id gnl|my_center|LOCUS_03210 23054 20373 gene locus_tag LOCUS_03220 23054 20373 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_03220 23625 23035 gene locus_tag LOCUS_03230 23625 23035 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405322.1 protein_id gnl|my_center|LOCUS_03230 25657 23636 gene locus_tag LOCUS_03240 gene kdpB 25657 23636 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968197.1 protein_id gnl|my_center|LOCUS_03240 27364 25667 gene locus_tag LOCUS_03250 gene kdpA 27364 25667 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973323.1 protein_id gnl|my_center|LOCUS_03250 28436 27717 gene locus_tag LOCUS_03260 28436 27717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 29320 28484 gene locus_tag LOCUS_03270 29320 28484 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_03270 30585 29317 gene locus_tag LOCUS_03280 30585 29317 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 protein_id gnl|my_center|LOCUS_03280 31405 30575 gene locus_tag LOCUS_03290 31405 30575 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674103.1 protein_id gnl|my_center|LOCUS_03290 33029 31410 gene locus_tag LOCUS_03300 33029 31410 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_03300 33169 34797 gene locus_tag LOCUS_03310 33169 34797 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853102.1 protein_id gnl|my_center|LOCUS_03310 34811 36415 gene locus_tag LOCUS_03320 gene recJ 34811 36415 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 protein_id gnl|my_center|LOCUS_03320 36552 38060 gene locus_tag LOCUS_03330 36552 38060 CDS product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 protein_id gnl|my_center|LOCUS_03330 38381 39856 gene locus_tag LOCUS_03340 38381 39856 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_03340 40112 40435 gene locus_tag LOCUS_03350 40112 40435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 40609 41583 gene locus_tag LOCUS_03360 40609 41583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 41909 43768 gene locus_tag LOCUS_03370 41909 43768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 45062 43749 gene locus_tag LOCUS_03380 gene fliI 45062 43749 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851735.1 protein_id gnl|my_center|LOCUS_03380 45674 45090 gene locus_tag LOCUS_03390 gene folE 45674 45090 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 protein_id gnl|my_center|LOCUS_03390 45925 47178 gene locus_tag LOCUS_03400 45925 47178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 49119 47200 gene locus_tag LOCUS_03410 49119 47200 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864793.1 protein_id gnl|my_center|LOCUS_03410 49894 49094 gene locus_tag LOCUS_03420 gene rsmA 49894 49094 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_03420 50079 50837 gene locus_tag LOCUS_03430 gene hisF 50079 50837 CDS product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880108.1 protein_id gnl|my_center|LOCUS_03430 50834 51376 gene locus_tag LOCUS_03440 50834 51376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923009.1 protein_id gnl|my_center|LOCUS_03440 51373 52443 gene locus_tag LOCUS_03450 gene rlmN 51373 52443 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_03450 53871 52951 gene locus_tag LOCUS_03460 53871 52951 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_03460 53981 55282 gene locus_tag LOCUS_03470 gene purB 53981 55282 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865088.1 protein_id gnl|my_center|LOCUS_03470 55426 57792 gene locus_tag LOCUS_03480 55426 57792 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865087.1 protein_id gnl|my_center|LOCUS_03480 57783 58154 gene locus_tag LOCUS_03490 57783 58154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 58234 59619 gene locus_tag LOCUS_03500 gene htrA 58234 59619 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853235.1 protein_id gnl|my_center|LOCUS_03500 59631 60053 gene locus_tag LOCUS_03510 gene trxC 59631 60053 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 protein_id gnl|my_center|LOCUS_03510 60087 61364 gene locus_tag LOCUS_03520 60087 61364 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851494.1 protein_id gnl|my_center|LOCUS_03520 61888 63627 gene locus_tag LOCUS_03530 61888 63627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 63989 63672 gene locus_tag LOCUS_03540 63989 63672 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_03540 65011 64046 gene locus_tag LOCUS_03550 65011 64046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 65568 65089 gene locus_tag LOCUS_03560 gene ruvC 65568 65089 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 protein_id gnl|my_center|LOCUS_03560 65669 66979 gene locus_tag LOCUS_03570 gene dnaA 65669 66979 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 protein_id gnl|my_center|LOCUS_03570 67146 68213 gene locus_tag LOCUS_03580 gene dnaN 67146 68213 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_03580 68364 70673 gene locus_tag LOCUS_03590 gene gyrB 68364 70673 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858833.1 protein_id gnl|my_center|LOCUS_03590 70697 72094 gene locus_tag LOCUS_03600 70697 72094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 72104 72481 gene locus_tag LOCUS_03610 gene queF 72104 72481 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 protein_id gnl|my_center|LOCUS_03610 73714 72470 gene locus_tag LOCUS_03620 73714 72470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 73872 75674 gene locus_tag LOCUS_03630 gene typA 73872 75674 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_03630 76665 75739 gene locus_tag LOCUS_03640 76665 75739 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_03640 76815 77837 gene locus_tag LOCUS_03650 76815 77837 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453999.1 protein_id gnl|my_center|LOCUS_03650 77824 78564 gene locus_tag LOCUS_03660 77824 78564 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880005.1 protein_id gnl|my_center|LOCUS_03660 78557 79195 gene locus_tag LOCUS_03670 gene pcm 78557 79195 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084597.1 protein_id gnl|my_center|LOCUS_03670 79199 80275 gene locus_tag LOCUS_03680 79199 80275 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 protein_id gnl|my_center|LOCUS_03680 80334 81167 gene locus_tag LOCUS_03690 gene thyX 80334 81167 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853111.1 protein_id gnl|my_center|LOCUS_03690 81172 81387 gene locus_tag LOCUS_03700 81172 81387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 81402 81959 gene locus_tag LOCUS_03710 81402 81959 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_03710 81999 83162 gene locus_tag LOCUS_03720 81999 83162 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_03720 83177 84274 gene locus_tag LOCUS_03730 83177 84274 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_03730 84542 84330 gene locus_tag LOCUS_03740 gene rpsU 84542 84330 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117778.1 protein_id gnl|my_center|LOCUS_03740 84986 86638 gene locus_tag LOCUS_03750 gene dnaG 84986 86638 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601638.1 protein_id gnl|my_center|LOCUS_03750 87560 86628 gene locus_tag LOCUS_03760 87560 86628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 87659 88918 gene locus_tag LOCUS_03770 gene rhlE 87659 88918 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_03770 88964 89941 gene locus_tag LOCUS_03780 88964 89941 CDS product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851386.1 protein_id gnl|my_center|LOCUS_03780 89985 90410 gene locus_tag LOCUS_03790 89985 90410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 90494 91999 gene locus_tag LOCUS_03800 90494 91999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 92028 92693 gene locus_tag LOCUS_03810 92028 92693 CDS product flagellar basal body rod modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805290.1 protein_id gnl|my_center|LOCUS_03810 92705 94006 gene locus_tag LOCUS_03820 92705 94006 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_03820 94106 96835 gene locus_tag LOCUS_03830 94106 96835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 96879 98045 gene locus_tag LOCUS_03840 gene purT 96879 98045 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496844.1 protein_id gnl|my_center|LOCUS_03840 98042 98968 gene locus_tag LOCUS_03850 98042 98968 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_03850 99070 99378 gene locus_tag LOCUS_03860 99070 99378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 99384 101009 gene locus_tag LOCUS_03870 gene sdhA 99384 101009 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_03870 100999 101682 gene locus_tag LOCUS_03880 100999 101682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 101749 102246 gene locus_tag LOCUS_03890 101749 102246 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858699.1 protein_id gnl|my_center|LOCUS_03890 102259 102903 gene locus_tag LOCUS_03900 102259 102903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 102991 103078 gene locus_tag LOCUS_t00050 102991 103078 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 103178 103624 gene locus_tag LOCUS_03910 103178 103624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 104742 103627 gene locus_tag LOCUS_03920 104742 103627 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012661737.1 protein_id gnl|my_center|LOCUS_03920 106359 104854 gene locus_tag LOCUS_03930 106359 104854 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 protein_id gnl|my_center|LOCUS_03930 107834 106515 gene locus_tag LOCUS_03940 107834 106515 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858516.1 protein_id gnl|my_center|LOCUS_03940 108291 107803 gene locus_tag LOCUS_03950 108291 107803 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_03950 108460 109491 gene locus_tag LOCUS_03960 108460 109491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267283.1 protein_id gnl|my_center|LOCUS_03960 110293 109484 gene locus_tag LOCUS_03970 110293 109484 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_03970 111076 110324 gene locus_tag LOCUS_03980 111076 110324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 111417 111091 gene locus_tag LOCUS_03990 111417 111091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 111721 111410 gene locus_tag LOCUS_04000 111721 111410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 112464 111718 gene locus_tag LOCUS_04010 112464 111718 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881421.1 protein_id gnl|my_center|LOCUS_04010 113336 112461 gene locus_tag LOCUS_04020 113336 112461 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_04020 114675 113398 gene locus_tag LOCUS_04030 114675 113398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_04030 115202 117772 gene locus_tag LOCUS_04040 115202 117772 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169981.1 protein_id gnl|my_center|LOCUS_04040 120148 117767 gene locus_tag LOCUS_04050 gene ppsA 120148 117767 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269108.1 protein_id gnl|my_center|LOCUS_04050 120774 120232 gene locus_tag LOCUS_04060 120774 120232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 121215 120778 gene locus_tag LOCUS_04070 121215 120778 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_04070 121980 121216 gene locus_tag LOCUS_04080 121980 121216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 122331 124013 gene locus_tag LOCUS_04090 122331 124013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 124097 125485 gene locus_tag LOCUS_04100 gene gltX 124097 125485 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 protein_id gnl|my_center|LOCUS_04100 126929 125538 gene locus_tag LOCUS_04110 126929 125538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 127069 127602 gene locus_tag LOCUS_04120 127069 127602 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252036.1 protein_id gnl|my_center|LOCUS_04120 127613 129442 gene locus_tag LOCUS_04130 127613 129442 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_04130 131850 129454 gene locus_tag LOCUS_04140 131850 129454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 134070 131854 gene locus_tag LOCUS_04150 134070 131854 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_04150 135361 134072 gene locus_tag LOCUS_04160 135361 134072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 139380 135358 gene locus_tag LOCUS_04170 139380 135358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 140264 139473 gene locus_tag LOCUS_04180 140264 139473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 140432 142294 gene locus_tag LOCUS_04190 140432 142294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 142818 142291 gene locus_tag LOCUS_04200 142818 142291 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210404.1 protein_id gnl|my_center|LOCUS_04200 144176 142806 gene locus_tag LOCUS_04210 gene dbpA 144176 142806 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940864.1 protein_id gnl|my_center|LOCUS_04210 144367 144176 gene locus_tag LOCUS_04220 144367 144176 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021362.1 protein_id gnl|my_center|LOCUS_04220 144494 144703 gene locus_tag LOCUS_04230 144494 144703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 144693 144950 gene locus_tag LOCUS_04240 144693 144950 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061866.1 protein_id gnl|my_center|LOCUS_04240 145607 145014 gene locus_tag LOCUS_04250 145607 145014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 147145 145652 gene locus_tag LOCUS_04260 147145 145652 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_04260 147278 147484 gene locus_tag LOCUS_04270 147278 147484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 147738 147481 gene locus_tag LOCUS_04280 147738 147481 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 protein_id gnl|my_center|LOCUS_04280 149018 147735 gene locus_tag LOCUS_04290 149018 147735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 149155 149754 gene locus_tag LOCUS_04300 149155 149754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 149833 150438 gene locus_tag LOCUS_04310 gene arsR 149833 150438 CDS product acid response regulator transcription factor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573710.1 protein_id gnl|my_center|LOCUS_04310 150473 151708 gene locus_tag LOCUS_04320 150473 151708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 151738 152949 gene locus_tag LOCUS_04330 151738 152949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 152946 154148 gene locus_tag LOCUS_04340 152946 154148 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971885.1 protein_id gnl|my_center|LOCUS_04340 154145 154858 gene locus_tag LOCUS_04350 154145 154858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531071.1 protein_id gnl|my_center|LOCUS_04350 154855 156066 gene locus_tag LOCUS_04360 154855 156066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_04360 156597 156259 gene locus_tag LOCUS_04370 156597 156259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 156932 156678 gene locus_tag LOCUS_04380 156932 156678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 157294 156932 gene locus_tag LOCUS_04390 gene fliS 157294 156932 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776169.1 protein_id gnl|my_center|LOCUS_04390 157481 158872 gene locus_tag LOCUS_04400 157481 158872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 158938 159939 gene locus_tag LOCUS_04410 gene pseB 158938 159939 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858028.1 protein_id gnl|my_center|LOCUS_04410 159939 161066 gene locus_tag LOCUS_04420 gene pseC 159939 161066 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856503.1 protein_id gnl|my_center|LOCUS_04420 161066 161764 gene locus_tag LOCUS_04430 gene pseF 161066 161764 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_04430 161761 162675 gene locus_tag LOCUS_04440 gene pseG 161761 162675 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002830499.1 protein_id gnl|my_center|LOCUS_04440 162657 163769 gene locus_tag LOCUS_04450 162657 163769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 163819 164121 gene locus_tag LOCUS_04460 163819 164121 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_04460 164114 164494 gene locus_tag LOCUS_04470 164114 164494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 164491 165525 gene locus_tag LOCUS_04480 gene pseI 164491 165525 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_04480 165525 166541 gene locus_tag LOCUS_04490 165525 166541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 166538 167479 gene locus_tag LOCUS_04500 166538 167479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 167476 168774 gene locus_tag LOCUS_04510 167476 168774 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_04510 168771 169328 gene locus_tag LOCUS_04520 168771 169328 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102490.1 protein_id gnl|my_center|LOCUS_04520 169340 170302 gene locus_tag LOCUS_04530 169340 170302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 170299 171435 gene locus_tag LOCUS_04540 gene pseA 170299 171435 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_04540 171425 172054 gene locus_tag LOCUS_04550 gene hisH 171425 172054 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_04550 172048 172800 gene locus_tag LOCUS_04560 172048 172800 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858306.1 protein_id gnl|my_center|LOCUS_04560 172810 174807 gene locus_tag LOCUS_04570 172810 174807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 177384 174958 gene locus_tag LOCUS_04580 177384 174958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 180082 177656 gene locus_tag LOCUS_04590 180082 177656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 180303 182519 gene locus_tag LOCUS_04600 gene topA 180303 182519 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681408.1 protein_id gnl|my_center|LOCUS_04600 182527 183051 gene locus_tag LOCUS_04610 182527 183051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 183044 183886 gene locus_tag LOCUS_04620 183044 183886 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851400.1 protein_id gnl|my_center|LOCUS_04620 183896 185059 gene locus_tag LOCUS_04630 183896 185059 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542869.1 protein_id gnl|my_center|LOCUS_04630 185066 185509 gene locus_tag LOCUS_04640 185066 185509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 185506 185910 gene locus_tag LOCUS_04650 185506 185910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 186896 185943 gene locus_tag LOCUS_04660 186896 185943 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856867.1 protein_id gnl|my_center|LOCUS_04660 187024 187614 gene locus_tag LOCUS_04670 187024 187614 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477331.1 protein_id gnl|my_center|LOCUS_04670 187614 189419 gene locus_tag LOCUS_04680 gene asnB 187614 189419 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102035.1 protein_id gnl|my_center|LOCUS_04680 190076 189420 gene locus_tag LOCUS_04690 190076 189420 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851887.1 protein_id gnl|my_center|LOCUS_04690 190994 190110 gene locus_tag LOCUS_04700 190994 190110 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888311.1 protein_id gnl|my_center|LOCUS_04700 191617 190994 gene locus_tag LOCUS_04710 gene upp 191617 190994 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881419.1 protein_id gnl|my_center|LOCUS_04710 192822 191641 gene locus_tag LOCUS_04720 192822 191641 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_04720 194900 192819 gene locus_tag LOCUS_04730 gene pta 194900 192819 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_04730 195196 196434 gene locus_tag LOCUS_04740 195196 196434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 196808 199603 gene locus_tag LOCUS_04750 196808 199603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 200355 199609 gene locus_tag LOCUS_04760 200355 199609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 200472 200822 gene locus_tag LOCUS_04770 200472 200822 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_04770 200840 201298 gene locus_tag LOCUS_04780 200840 201298 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_04780 201417 204059 gene locus_tag LOCUS_04790 201417 204059 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087775.1 protein_id gnl|my_center|LOCUS_04790 204052 205335 gene locus_tag LOCUS_04800 204052 205335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 205332 208379 gene locus_tag LOCUS_04810 205332 208379 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 protein_id gnl|my_center|LOCUS_04810 208363 209022 gene locus_tag LOCUS_04820 208363 209022 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_04820 209032 209604 gene locus_tag LOCUS_04830 209032 209604 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_04830 209690 209881 gene locus_tag LOCUS_04840 209690 209881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 209898 210896 gene locus_tag LOCUS_04850 gene rhuM 209898 210896 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_04850 210897 211904 gene locus_tag LOCUS_04860 210897 211904 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_04860 211918 212142 gene locus_tag LOCUS_04870 211918 212142 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338670.1 protein_id gnl|my_center|LOCUS_04870 212146 212865 gene locus_tag LOCUS_04880 gene blaOXA 212146 212865 CDS product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246349.1 protein_id gnl|my_center|LOCUS_04880 213402 213208 gene locus_tag LOCUS_04890 213402 213208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 213664 214119 gene locus_tag LOCUS_04900 213664 214119 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926982.1 protein_id gnl|my_center|LOCUS_04900 214113 214640 gene locus_tag LOCUS_04910 214113 214640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence03 702 214 gene locus_tag LOCUS_04920 702 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1295 894 gene locus_tag LOCUS_04930 gene perR 1295 894 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 protein_id gnl|my_center|LOCUS_04930 1464 2483 gene locus_tag LOCUS_04940 1464 2483 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857587.1 protein_id gnl|my_center|LOCUS_04940 2585 3031 gene locus_tag LOCUS_04950 2585 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 4627 3023 gene locus_tag LOCUS_04960 4627 3023 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_04960 5224 4655 gene locus_tag LOCUS_04970 5224 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 6177 5218 gene locus_tag LOCUS_04980 6177 5218 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_04980 7263 6199 gene locus_tag LOCUS_04990 gene mtnA 7263 6199 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083782.1 protein_id gnl|my_center|LOCUS_04990 7347 7541 gene locus_tag LOCUS_05000 7347 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 8233 7538 gene locus_tag LOCUS_05010 8233 7538 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_05010 8522 8223 gene locus_tag LOCUS_05020 8522 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8680 8519 gene locus_tag LOCUS_05030 8680 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 9097 8681 gene locus_tag LOCUS_05040 9097 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 10105 9107 gene locus_tag LOCUS_05050 10105 9107 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_05050 10216 10824 gene locus_tag LOCUS_05060 10216 10824 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_05060 10815 11192 gene locus_tag LOCUS_05070 10815 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 12394 11189 gene locus_tag LOCUS_05080 12394 11189 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256133.1 protein_id gnl|my_center|LOCUS_05080 13283 12387 gene locus_tag LOCUS_05090 13283 12387 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880083.1 protein_id gnl|my_center|LOCUS_05090 13369 14187 gene locus_tag LOCUS_05100 13369 14187 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 protein_id gnl|my_center|LOCUS_05100 14187 15110 gene locus_tag LOCUS_05110 14187 15110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 15213 16025 gene locus_tag LOCUS_05120 15213 16025 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_05120 16026 17219 gene locus_tag LOCUS_05130 16026 17219 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891823.1 protein_id gnl|my_center|LOCUS_05130 17216 19024 gene locus_tag LOCUS_05140 17216 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 19108 19404 gene locus_tag LOCUS_05150 19108 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 19846 19448 gene locus_tag LOCUS_05160 19846 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 19954 20145 gene locus_tag LOCUS_05170 19954 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 20343 20669 gene locus_tag LOCUS_05180 20343 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 20708 21361 gene locus_tag LOCUS_05190 20708 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 21351 22775 gene locus_tag LOCUS_05200 gene norB 21351 22775 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_05200 22787 22951 gene locus_tag LOCUS_05210 22787 22951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 23013 24653 gene locus_tag LOCUS_05220 23013 24653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 24864 25169 gene locus_tag LOCUS_05230 24864 25169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 25169 26290 gene locus_tag LOCUS_05240 gene nirJ 25169 26290 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113242.1 protein_id gnl|my_center|LOCUS_05240 26293 27429 gene locus_tag LOCUS_05250 26293 27429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 27429 28169 gene locus_tag LOCUS_05260 gene cobA 27429 28169 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880082.1 protein_id gnl|my_center|LOCUS_05260 28162 29688 gene locus_tag LOCUS_05270 28162 29688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 29678 30367 gene locus_tag LOCUS_05280 29678 30367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_05280 31070 30369 gene locus_tag LOCUS_05290 31070 30369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 31670 31140 gene locus_tag LOCUS_05300 31670 31140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 32588 31680 gene locus_tag LOCUS_05310 32588 31680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 34126 32585 gene locus_tag LOCUS_05320 34126 32585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 34733 34110 gene locus_tag LOCUS_05330 34733 34110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_05330 35803 34730 gene locus_tag LOCUS_05340 35803 34730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_05340 36270 35800 gene locus_tag LOCUS_05350 36270 35800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074809182.1 protein_id gnl|my_center|LOCUS_05350 37058 36312 gene locus_tag LOCUS_05360 37058 36312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 37124 37714 gene locus_tag LOCUS_05370 37124 37714 CDS product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704661.1 protein_id gnl|my_center|LOCUS_05370 37774 38220 gene locus_tag LOCUS_05380 37774 38220 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379721.1 protein_id gnl|my_center|LOCUS_05380 38387 40126 gene locus_tag LOCUS_05390 38387 40126 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771665.1 protein_id gnl|my_center|LOCUS_05390 40804 40133 gene locus_tag LOCUS_05400 gene cgpA 40804 40133 CDS product glycoprotein CgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851387.1 protein_id gnl|my_center|LOCUS_05400 41127 40849 gene locus_tag LOCUS_05410 41127 40849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 42402 41137 gene locus_tag LOCUS_05420 gene eno 42402 41137 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955673.1 protein_id gnl|my_center|LOCUS_05420 43491 42451 gene locus_tag LOCUS_05430 gene recA 43491 42451 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851424.1 protein_id gnl|my_center|LOCUS_05430 43664 44533 gene locus_tag LOCUS_05440 43664 44533 CDS product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626212.1 protein_id gnl|my_center|LOCUS_05440 44533 44799 gene locus_tag LOCUS_05450 gene fliQ 44533 44799 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 protein_id gnl|my_center|LOCUS_05450 44856 45626 gene locus_tag LOCUS_05460 44856 45626 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858257.1 protein_id gnl|my_center|LOCUS_05460 46604 45630 gene locus_tag LOCUS_05470 46604 45630 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051995.1 protein_id gnl|my_center|LOCUS_05470 47836 46625 gene locus_tag LOCUS_05480 47836 46625 CDS product NifS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941691.1 protein_id gnl|my_center|LOCUS_05480 48001 48504 gene locus_tag LOCUS_05490 48001 48504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 49184 48501 gene locus_tag LOCUS_05500 49184 48501 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_05500 49295 50554 gene locus_tag LOCUS_05510 gene leuC 49295 50554 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_05510 50637 51620 gene locus_tag LOCUS_05520 gene cadF 50637 51620 CDS product fibronectin-binding outer membrane protein CadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851185.1 protein_id gnl|my_center|LOCUS_05520 51621 52202 gene locus_tag LOCUS_05530 51621 52202 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867312.1 protein_id gnl|my_center|LOCUS_05530 52349 52819 gene locus_tag LOCUS_05540 gene moaC 52349 52819 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851725.1 protein_id gnl|my_center|LOCUS_05540 52800 53069 gene locus_tag LOCUS_05550 52800 53069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 53084 54055 gene locus_tag LOCUS_05560 53084 54055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 55152 54079 gene locus_tag LOCUS_05570 gene aroC 55152 54079 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851463.1 protein_id gnl|my_center|LOCUS_05570 55832 55149 gene locus_tag LOCUS_05580 gene rnc 55832 55149 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_05580 56260 55829 gene locus_tag LOCUS_05590 gene rnhA 56260 55829 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108269329.1 protein_id gnl|my_center|LOCUS_05590 57281 56235 gene locus_tag LOCUS_05600 57281 56235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851401.1 protein_id gnl|my_center|LOCUS_05600 57748 57278 gene locus_tag LOCUS_05610 gene cheQ 57748 57278 CDS product cheVAW transcriptional regulator CheQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851877.1 protein_id gnl|my_center|LOCUS_05610 58856 57810 gene locus_tag LOCUS_05620 58856 57810 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196095.1 protein_id gnl|my_center|LOCUS_05620 62370 58909 gene locus_tag LOCUS_05630 62370 58909 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941340.1 protein_id gnl|my_center|LOCUS_05630 63505 62510 gene locus_tag LOCUS_05640 gene purM 63505 62510 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 protein_id gnl|my_center|LOCUS_05640 63738 63556 gene locus_tag LOCUS_05650 63738 63556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 63890 64435 gene locus_tag LOCUS_05660 63890 64435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 64435 65037 gene locus_tag LOCUS_05670 gene coaE 64435 65037 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 protein_id gnl|my_center|LOCUS_05670 65034 65807 gene locus_tag LOCUS_05680 gene dapF 65034 65807 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_05680 66918 65851 gene locus_tag LOCUS_05690 gene prfA 66918 65851 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851189.1 protein_id gnl|my_center|LOCUS_05690 67191 66931 gene locus_tag LOCUS_05700 gene rpsT 67191 66931 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_05700 67336 68676 gene locus_tag LOCUS_05710 gene glmM 67336 68676 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688400.1 protein_id gnl|my_center|LOCUS_05710 68669 69124 gene locus_tag LOCUS_05720 gene lspA 68669 69124 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921378.1 protein_id gnl|my_center|LOCUS_05720 69309 70610 gene locus_tag LOCUS_05730 gene tig 69309 70610 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047731.1 protein_id gnl|my_center|LOCUS_05730 70614 71204 gene locus_tag LOCUS_05740 gene clpP 70614 71204 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806309.1 protein_id gnl|my_center|LOCUS_05740 71223 72272 gene locus_tag LOCUS_05750 71223 72272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 72293 72820 gene locus_tag LOCUS_05760 gene def 72293 72820 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185845.1 protein_id gnl|my_center|LOCUS_05760 72905 74416 gene locus_tag LOCUS_05770 72905 74416 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611139.1 protein_id gnl|my_center|LOCUS_05770 75018 74446 gene locus_tag LOCUS_05780 75018 74446 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_05780 78611 75120 gene locus_tag LOCUS_05790 gene metH 78611 75120 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_05790 78778 80211 gene locus_tag LOCUS_05800 gene ccoG 78778 80211 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_05800 80651 80325 gene locus_tag LOCUS_05810 80651 80325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 81305 80943 gene locus_tag LOCUS_05820 81305 80943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 84259 81671 gene locus_tag LOCUS_05830 84259 81671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 85211 84528 gene locus_tag LOCUS_05840 85211 84528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 85325 86116 gene locus_tag LOCUS_05850 85325 86116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 86113 87189 gene locus_tag LOCUS_05860 86113 87189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 87200 89212 gene locus_tag LOCUS_05870 87200 89212 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_05870 89409 90632 gene locus_tag LOCUS_05880 89409 90632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 90815 91759 gene locus_tag LOCUS_05890 90815 91759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 91774 91944 gene locus_tag LOCUS_05900 91774 91944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 91934 92092 gene locus_tag LOCUS_05910 91934 92092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 93066 92101 gene locus_tag LOCUS_05920 93066 92101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 93257 93063 gene locus_tag LOCUS_05930 93257 93063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 93721 93254 gene locus_tag LOCUS_05940 93721 93254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 94183 95082 gene locus_tag LOCUS_05950 94183 95082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05950 95368 96786 gene locus_tag LOCUS_05960 95368 96786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 97252 97164 gene locus_tag LOCUS_t00060 97252 97164 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 97354 97281 gene locus_tag LOCUS_t00070 97354 97281 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 97465 97379 gene locus_tag LOCUS_t00080 97465 97379 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 97589 97515 gene locus_tag LOCUS_t00090 97589 97515 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 97731 99416 gene locus_tag LOCUS_05970 gene ilvD 97731 99416 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 protein_id gnl|my_center|LOCUS_05970 99521 101329 gene locus_tag LOCUS_05980 gene thrS 99521 101329 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 protein_id gnl|my_center|LOCUS_05980 101326 101841 gene locus_tag LOCUS_05990 gene infC 101326 101841 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 protein_id gnl|my_center|LOCUS_05990 103183 101927 gene locus_tag LOCUS_06000 103183 101927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_06000 103116 103355 gene locus_tag LOCUS_06010 103116 103355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 103352 103939 gene locus_tag LOCUS_06020 gene rdgB 103352 103939 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_06020 104864 104100 gene locus_tag LOCUS_06030 gene uppP 104864 104100 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881444.1 protein_id gnl|my_center|LOCUS_06030 104989 106104 gene locus_tag LOCUS_06040 104989 106104 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924085.1 protein_id gnl|my_center|LOCUS_06040 106101 106949 gene locus_tag LOCUS_06050 106101 106949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 106962 108212 gene locus_tag LOCUS_06060 106962 108212 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 protein_id gnl|my_center|LOCUS_06060 108223 108642 gene locus_tag LOCUS_06070 108223 108642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 108639 109148 gene locus_tag LOCUS_06080 108639 109148 CDS product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226637.1 protein_id gnl|my_center|LOCUS_06080 109225 109776 gene locus_tag LOCUS_06090 109225 109776 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851269.1 protein_id gnl|my_center|LOCUS_06090 109777 110910 gene locus_tag LOCUS_06100 gene carA 109777 110910 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851156.1 protein_id gnl|my_center|LOCUS_06100 111126 112619 gene locus_tag LOCUS_06110 gene ccoN 111126 112619 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_06110 112635 113327 gene locus_tag LOCUS_06120 gene ccoO 112635 113327 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 protein_id gnl|my_center|LOCUS_06120 113337 113537 gene locus_tag LOCUS_06130 113337 113537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 113549 114472 gene locus_tag LOCUS_06140 113549 114472 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851306.1 protein_id gnl|my_center|LOCUS_06140 114483 114692 gene locus_tag LOCUS_06150 114483 114692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 114802 115506 gene locus_tag LOCUS_06160 114802 115506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851454.1 protein_id gnl|my_center|LOCUS_06160 115493 115999 gene locus_tag LOCUS_06170 115493 115999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 116014 118362 gene locus_tag LOCUS_06180 116014 118362 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891938.1 protein_id gnl|my_center|LOCUS_06180 118459 119997 gene locus_tag LOCUS_06190 118459 119997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 120007 121905 gene locus_tag LOCUS_06200 120007 121905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963644.1 protein_id gnl|my_center|LOCUS_06200 121902 122870 gene locus_tag LOCUS_06210 121902 122870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963669.1 protein_id gnl|my_center|LOCUS_06210 122952 124046 gene locus_tag LOCUS_06220 122952 124046 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_06220 124061 124291 gene locus_tag LOCUS_06230 124061 124291 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_06230 124352 127066 gene locus_tag LOCUS_06240 124352 127066 CDS product RecB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864468.1 protein_id gnl|my_center|LOCUS_06240 127158 127679 gene locus_tag LOCUS_06250 127158 127679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 127806 128228 gene locus_tag LOCUS_06260 gene rplM 127806 128228 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 protein_id gnl|my_center|LOCUS_06260 128237 128626 gene locus_tag LOCUS_06270 gene rpsI 128237 128626 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227269.1 protein_id gnl|my_center|LOCUS_06270 128731 130227 gene locus_tag LOCUS_06280 128731 130227 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_06280 130229 130867 gene locus_tag LOCUS_06290 130229 130867 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851542.1 protein_id gnl|my_center|LOCUS_06290 130991 131548 gene locus_tag LOCUS_06300 130991 131548 CDS product pyruvate flavodoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486467.1 protein_id gnl|my_center|LOCUS_06300 131559 131954 gene locus_tag LOCUS_06310 131559 131954 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656174.1 protein_id gnl|my_center|LOCUS_06310 131954 133177 gene locus_tag LOCUS_06320 131954 133177 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129867.1 protein_id gnl|my_center|LOCUS_06320 133188 134144 gene locus_tag LOCUS_06330 133188 134144 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238135.1 protein_id gnl|my_center|LOCUS_06330 135079 134303 gene locus_tag LOCUS_06340 135079 134303 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853285.1 protein_id gnl|my_center|LOCUS_06340 135645 135079 gene locus_tag LOCUS_06350 135645 135079 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853263.1 protein_id gnl|my_center|LOCUS_06350 138469 135635 gene locus_tag LOCUS_06360 138469 135635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 138846 139352 gene locus_tag LOCUS_06370 gene luxS 138846 139352 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693682.1 protein_id gnl|my_center|LOCUS_06370 139354 139656 gene locus_tag LOCUS_06380 139354 139656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 139669 140163 gene locus_tag LOCUS_06390 139669 140163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 140711 140905 gene locus_tag LOCUS_06400 140711 140905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 141173 141442 gene locus_tag LOCUS_06410 141173 141442 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_06410 141429 141656 gene locus_tag LOCUS_06420 141429 141656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_06420 141720 142445 gene locus_tag LOCUS_06430 141720 142445 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881294.1 protein_id gnl|my_center|LOCUS_06430 144210 142435 gene locus_tag LOCUS_06440 gene recQ 144210 142435 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957598.1 protein_id gnl|my_center|LOCUS_06440 144830 144219 gene locus_tag LOCUS_06450 144830 144219 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 protein_id gnl|my_center|LOCUS_06450 145559 144840 gene locus_tag LOCUS_06460 145559 144840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 145609 147483 gene locus_tag LOCUS_06470 gene mnmG 145609 147483 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864546.1 protein_id gnl|my_center|LOCUS_06470 147486 148352 gene locus_tag LOCUS_06480 147486 148352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 148413 148937 gene locus_tag LOCUS_06490 gene petA 148413 148937 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852880.1 protein_id gnl|my_center|LOCUS_06490 148950 150164 gene locus_tag LOCUS_06500 148950 150164 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807891.1 protein_id gnl|my_center|LOCUS_06500 150175 151122 gene locus_tag LOCUS_06510 150175 151122 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657605.1 protein_id gnl|my_center|LOCUS_06510 151899 151435 gene locus_tag LOCUS_06520 151899 151435 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201774.1 protein_id gnl|my_center|LOCUS_06520 152203 153441 gene locus_tag LOCUS_06530 152203 153441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 153615 154247 gene locus_tag LOCUS_06540 153615 154247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 154398 155363 gene locus_tag LOCUS_06550 gene moaA 154398 155363 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868437.1 protein_id gnl|my_center|LOCUS_06550 155363 156121 gene locus_tag LOCUS_06560 155363 156121 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851883.1 protein_id gnl|my_center|LOCUS_06560 156121 156702 gene locus_tag LOCUS_06570 156121 156702 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 protein_id gnl|my_center|LOCUS_06570 157943 156723 gene locus_tag LOCUS_06580 157943 156723 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856962.1 protein_id gnl|my_center|LOCUS_06580 157981 158388 gene locus_tag LOCUS_06590 157981 158388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 158385 159056 gene locus_tag LOCUS_06600 158385 159056 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851903.1 protein_id gnl|my_center|LOCUS_06600 159210 159410 gene locus_tag LOCUS_06610 gene rpmE 159210 159410 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_06610 159423 160238 gene locus_tag LOCUS_06620 gene rsmI 159423 160238 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_06620 160279 160959 gene locus_tag LOCUS_06630 gene rlmB 160279 160959 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851944.1 protein_id gnl|my_center|LOCUS_06630 160956 161957 gene locus_tag LOCUS_06640 160956 161957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 161951 162805 gene locus_tag LOCUS_06650 161951 162805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792823.1 protein_id gnl|my_center|LOCUS_06650 162857 164077 gene locus_tag LOCUS_06660 162857 164077 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932911.1 protein_id gnl|my_center|LOCUS_06660 164079 165338 gene locus_tag LOCUS_06670 164079 165338 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851705.1 protein_id gnl|my_center|LOCUS_06670 165345 166073 gene locus_tag LOCUS_06680 165345 166073 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800040.1 protein_id gnl|my_center|LOCUS_06680 166171 168234 gene locus_tag LOCUS_06690 gene fdhF 166171 168234 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_06690 168235 168564 gene locus_tag LOCUS_06700 168235 168564 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211699.1 protein_id gnl|my_center|LOCUS_06700 169247 168561 gene locus_tag LOCUS_06710 169247 168561 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 protein_id gnl|my_center|LOCUS_06710 170152 169244 gene locus_tag LOCUS_06720 170152 169244 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_06720 170209 170529 gene locus_tag LOCUS_06730 170209 170529 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816569.1 protein_id gnl|my_center|LOCUS_06730 170691 170945 gene locus_tag LOCUS_06740 170691 170945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 171732 170983 gene locus_tag LOCUS_06750 171732 170983 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_06750 171834 172436 gene locus_tag LOCUS_06760 171834 172436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence04 413 2371 gene locus_tag LOCUS_06770 413 2371 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_06770 2700 2386 gene locus_tag LOCUS_06780 2700 2386 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 protein_id gnl|my_center|LOCUS_06780 3481 2693 gene locus_tag LOCUS_06790 gene amrB 3481 2693 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_06790 4071 3499 gene locus_tag LOCUS_06800 4071 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4956 4084 gene locus_tag LOCUS_06810 4956 4084 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684382.1 protein_id gnl|my_center|LOCUS_06810 7251 5014 gene locus_tag LOCUS_06820 7251 5014 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966138.1 protein_id gnl|my_center|LOCUS_06820 8527 7244 gene locus_tag LOCUS_06830 8527 7244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_06830 9053 8610 gene locus_tag LOCUS_06840 9053 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9810 9106 gene locus_tag LOCUS_06850 9810 9106 CDS product DpnI domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678771.1 protein_id gnl|my_center|LOCUS_06850 10966 10085 gene locus_tag LOCUS_06860 gene glyQ 10966 10085 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852069.1 protein_id gnl|my_center|LOCUS_06860 11074 11604 gene locus_tag LOCUS_06870 11074 11604 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146763.1 protein_id gnl|my_center|LOCUS_06870 12466 11609 gene locus_tag LOCUS_06880 12466 11609 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_06880 12954 12481 gene locus_tag LOCUS_06890 12954 12481 CDS product DUF3972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852251.1 protein_id gnl|my_center|LOCUS_06890 13474 12977 gene locus_tag LOCUS_06900 gene purE 13474 12977 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_06900 14799 13507 gene locus_tag LOCUS_06910 14799 13507 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077422.1 protein_id gnl|my_center|LOCUS_06910 15533 14799 gene locus_tag LOCUS_06920 15533 14799 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852254.1 protein_id gnl|my_center|LOCUS_06920 15626 16405 gene locus_tag LOCUS_06930 15626 16405 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_06930 16561 16881 gene locus_tag LOCUS_06940 gene trxA 16561 16881 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 protein_id gnl|my_center|LOCUS_06940 17072 18016 gene locus_tag LOCUS_06950 gene trxB 17072 18016 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851648.1 protein_id gnl|my_center|LOCUS_06950 18026 18796 gene locus_tag LOCUS_06960 gene dapB 18026 18796 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_06960 18866 20221 gene locus_tag LOCUS_06970 gene purF 18866 20221 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_06970 20218 21180 gene locus_tag LOCUS_06980 20218 21180 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_06980 21725 21177 gene locus_tag LOCUS_06990 21725 21177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 22234 21722 gene locus_tag LOCUS_07000 22234 21722 CDS product DUF2393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858737.1 protein_id gnl|my_center|LOCUS_07000 22917 22237 gene locus_tag LOCUS_07010 gene hisIE 22917 22237 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_07010 24044 22926 gene locus_tag LOCUS_07020 24044 22926 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_07020 25013 24093 gene locus_tag LOCUS_07030 gene ilvE 25013 24093 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 protein_id gnl|my_center|LOCUS_07030 26505 25195 gene locus_tag LOCUS_07040 26505 25195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 27694 26690 gene locus_tag LOCUS_07050 gene pstS 27694 26690 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881320.1 protein_id gnl|my_center|LOCUS_07050 28596 27769 gene locus_tag LOCUS_07060 gene ppk2 28596 27769 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_07060 28704 29564 gene locus_tag LOCUS_07070 gene pstC 28704 29564 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545177.1 protein_id gnl|my_center|LOCUS_07070 29561 30403 gene locus_tag LOCUS_07080 gene pstA 29561 30403 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546243.1 protein_id gnl|my_center|LOCUS_07080 30403 31188 gene locus_tag LOCUS_07090 gene pstB 30403 31188 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546432.1 protein_id gnl|my_center|LOCUS_07090 31222 31893 gene locus_tag LOCUS_07100 31222 31893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 31994 33424 gene locus_tag LOCUS_07110 gene glnA 31994 33424 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858636.1 protein_id gnl|my_center|LOCUS_07110 33620 35278 gene locus_tag LOCUS_07120 gene leuA 33620 35278 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_07120 35424 36404 gene locus_tag LOCUS_07130 35424 36404 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_07130 38401 36434 gene locus_tag LOCUS_07140 38401 36434 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858576.1 protein_id gnl|my_center|LOCUS_07140 39087 38398 gene locus_tag LOCUS_07150 39087 38398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 40181 39084 gene locus_tag LOCUS_07160 40181 39084 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491853.1 protein_id gnl|my_center|LOCUS_07160 41956 40178 gene locus_tag LOCUS_07170 41956 40178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 42572 42018 gene locus_tag LOCUS_07180 42572 42018 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_07180 43054 42572 gene locus_tag LOCUS_07190 43054 42572 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186668.1 protein_id gnl|my_center|LOCUS_07190 45603 43054 gene locus_tag LOCUS_07200 gene alaS 45603 43054 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858583.1 protein_id gnl|my_center|LOCUS_07200 47121 45706 gene locus_tag LOCUS_07210 47121 45706 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_07210 47202 47438 gene locus_tag LOCUS_07220 47202 47438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 47431 47835 gene locus_tag LOCUS_07230 47431 47835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 49794 47875 gene locus_tag LOCUS_07240 gene tkt 49794 47875 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_07240 50790 49936 gene locus_tag LOCUS_07250 50790 49936 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 protein_id gnl|my_center|LOCUS_07250 51783 50803 gene locus_tag LOCUS_07260 51783 50803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 52093 51785 gene locus_tag LOCUS_07270 52093 51785 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851172.1 protein_id gnl|my_center|LOCUS_07270 52461 52096 gene locus_tag LOCUS_07280 gene panD 52461 52096 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 protein_id gnl|my_center|LOCUS_07280 52840 52466 gene locus_tag LOCUS_07290 52840 52466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 54219 52909 gene locus_tag LOCUS_07300 54219 52909 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 protein_id gnl|my_center|LOCUS_07300 54799 54209 gene locus_tag LOCUS_07310 54799 54209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 55098 54823 gene locus_tag LOCUS_07320 55098 54823 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858971.1 protein_id gnl|my_center|LOCUS_07320 56412 55180 gene locus_tag LOCUS_07330 56412 55180 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067929.1 protein_id gnl|my_center|LOCUS_07330 56842 56492 gene locus_tag LOCUS_07340 gene rplQ 56842 56492 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_07340 57858 56866 gene locus_tag LOCUS_07350 57858 56866 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864547.1 protein_id gnl|my_center|LOCUS_07350 58506 57880 gene locus_tag LOCUS_07360 gene rpsD 58506 57880 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 protein_id gnl|my_center|LOCUS_07360 58910 58518 gene locus_tag LOCUS_07370 gene rpsK 58910 58518 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779544.1 protein_id gnl|my_center|LOCUS_07370 59283 58921 gene locus_tag LOCUS_07380 gene rpsM 59283 58921 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 protein_id gnl|my_center|LOCUS_07380 60031 59687 gene locus_tag LOCUS_07390 60031 59687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 60327 61175 gene locus_tag LOCUS_07400 60327 61175 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_07400 61178 61384 gene locus_tag LOCUS_07410 61178 61384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 61450 61752 gene locus_tag LOCUS_07420 61450 61752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 62003 61785 gene locus_tag LOCUS_07430 gene infA 62003 61785 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781436.1 protein_id gnl|my_center|LOCUS_07430 62778 62020 gene locus_tag LOCUS_07440 gene map 62778 62020 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858416.1 protein_id gnl|my_center|LOCUS_07440 64044 62782 gene locus_tag LOCUS_07450 gene secY 64044 62782 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864789.1 protein_id gnl|my_center|LOCUS_07450 64445 64047 gene locus_tag LOCUS_07460 gene rplO 64445 64047 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851292.1 protein_id gnl|my_center|LOCUS_07460 64889 64449 gene locus_tag LOCUS_07470 gene rpsE 64889 64449 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001860543.1 protein_id gnl|my_center|LOCUS_07470 65254 64898 gene locus_tag LOCUS_07480 gene rplR 65254 64898 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851411.1 protein_id gnl|my_center|LOCUS_07480 65804 65268 gene locus_tag LOCUS_07490 gene rplF 65804 65268 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_07490 66209 65814 gene locus_tag LOCUS_07500 gene rpsH 66209 65814 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851353.1 protein_id gnl|my_center|LOCUS_07500 66473 66288 gene locus_tag LOCUS_07510 66473 66288 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851478.1 protein_id gnl|my_center|LOCUS_07510 67018 66473 gene locus_tag LOCUS_07520 gene rplE 67018 66473 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851453.1 protein_id gnl|my_center|LOCUS_07520 67252 67022 gene locus_tag LOCUS_07530 67252 67022 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779437.1 protein_id gnl|my_center|LOCUS_07530 67620 67252 gene locus_tag LOCUS_07540 gene rplN 67620 67252 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_07540 67868 67620 gene locus_tag LOCUS_07550 gene rpsQ 67868 67620 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851549.1 protein_id gnl|my_center|LOCUS_07550 68063 67878 gene locus_tag LOCUS_07560 gene rpmC 68063 67878 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851566.1 protein_id gnl|my_center|LOCUS_07560 68475 68050 gene locus_tag LOCUS_07570 gene rplP 68475 68050 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779441.1 protein_id gnl|my_center|LOCUS_07570 69203 68478 gene locus_tag LOCUS_07580 gene rpsC 69203 68478 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851138.1 protein_id gnl|my_center|LOCUS_07580 69522 69205 gene locus_tag LOCUS_07590 69522 69205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 69800 69525 gene locus_tag LOCUS_07600 gene rpsS 69800 69525 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_07600 70644 69805 gene locus_tag LOCUS_07610 gene rplB 70644 69805 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 protein_id gnl|my_center|LOCUS_07610 70927 70646 gene locus_tag LOCUS_07620 70927 70646 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851441.1 protein_id gnl|my_center|LOCUS_07620 71541 70927 gene locus_tag LOCUS_07630 gene rplD 71541 70927 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 protein_id gnl|my_center|LOCUS_07630 72116 71541 gene locus_tag LOCUS_07640 gene rplC 72116 71541 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_07640 72438 72127 gene locus_tag LOCUS_07650 gene rpsJ 72438 72127 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_07650 72594 73658 gene locus_tag LOCUS_07660 72594 73658 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611585.1 protein_id gnl|my_center|LOCUS_07660 73768 75096 gene locus_tag LOCUS_07670 gene tlpD 73768 75096 CDS product chemotaxis chemoreceptor TlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467802.1 protein_id gnl|my_center|LOCUS_07670 75093 75467 gene locus_tag LOCUS_07680 75093 75467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 75470 77050 gene locus_tag LOCUS_07690 75470 77050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 77043 77612 gene locus_tag LOCUS_07700 77043 77612 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853153.1 protein_id gnl|my_center|LOCUS_07700 79108 77609 gene locus_tag LOCUS_07710 79108 77609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 80342 79131 gene locus_tag LOCUS_07720 80342 79131 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_07720 80776 80339 gene locus_tag LOCUS_07730 80776 80339 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 protein_id gnl|my_center|LOCUS_07730 81001 80780 gene locus_tag LOCUS_07740 81001 80780 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_07740 81105 81761 gene locus_tag LOCUS_07750 81105 81761 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210707.1 protein_id gnl|my_center|LOCUS_07750 82057 83034 gene locus_tag LOCUS_07760 82057 83034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 83273 83190 gene locus_tag LOCUS_t00100 83273 83190 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 83376 83300 gene locus_tag LOCUS_t00110 83376 83300 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 83468 83392 gene locus_tag LOCUS_t00120 83468 83392 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 83580 83504 gene locus_tag LOCUS_t00130 83580 83504 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 83680 83603 gene locus_tag LOCUS_t00140 83680 83603 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 83904 84182 gene locus_tag LOCUS_07770 83904 84182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 84253 88542 gene locus_tag LOCUS_07780 84253 88542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 88539 89453 gene locus_tag LOCUS_07790 88539 89453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 90247 89468 gene locus_tag LOCUS_07800 90247 89468 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881431.1 protein_id gnl|my_center|LOCUS_07800 91632 90268 gene locus_tag LOCUS_07810 91632 90268 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678947.1 protein_id gnl|my_center|LOCUS_07810 92369 91635 gene locus_tag LOCUS_07820 92369 91635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 92474 93436 gene locus_tag LOCUS_07830 92474 93436 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121932.1 protein_id gnl|my_center|LOCUS_07830 93433 94407 gene locus_tag LOCUS_07840 93433 94407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 94409 95611 gene locus_tag LOCUS_07850 94409 95611 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060246.1 protein_id gnl|my_center|LOCUS_07850 95668 95955 gene locus_tag LOCUS_07860 95668 95955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 95957 97933 gene locus_tag LOCUS_07870 95957 97933 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_07870 97933 99618 gene locus_tag LOCUS_07880 97933 99618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 100011 99652 gene locus_tag LOCUS_07890 gene rplT 100011 99652 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_07890 100308 100117 gene locus_tag LOCUS_07900 gene rpmI 100308 100117 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125542.1 protein_id gnl|my_center|LOCUS_07900 100376 100603 gene locus_tag LOCUS_07910 100376 100603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 100752 101666 gene locus_tag LOCUS_07920 100752 101666 CDS product DUF234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852402.1 protein_id gnl|my_center|LOCUS_07920 101647 103758 gene locus_tag LOCUS_07930 101647 103758 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_07930 103765 104316 gene locus_tag LOCUS_07940 103765 104316 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_07940 105065 104313 gene locus_tag LOCUS_07950 105065 104313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 105735 105232 gene locus_tag LOCUS_07960 gene tpx 105735 105232 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_07960 106831 105854 gene locus_tag LOCUS_07970 gene tsaD 106831 105854 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864246.1 protein_id gnl|my_center|LOCUS_07970 107712 106834 gene locus_tag LOCUS_07980 107712 106834 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106543.1 protein_id gnl|my_center|LOCUS_07980 107930 107712 gene locus_tag LOCUS_07990 107930 107712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 108621 107938 gene locus_tag LOCUS_08000 108621 107938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 109165 108614 gene locus_tag LOCUS_08010 109165 108614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 110342 109281 gene locus_tag LOCUS_08020 gene dxr 110342 109281 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260724.1 protein_id gnl|my_center|LOCUS_08020 111098 110343 gene locus_tag LOCUS_08030 111098 110343 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656886.1 protein_id gnl|my_center|LOCUS_08030 111449 111138 gene locus_tag LOCUS_08040 111449 111138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 112780 111452 gene locus_tag LOCUS_08050 112780 111452 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864240.1 protein_id gnl|my_center|LOCUS_08050 112954 114234 gene locus_tag LOCUS_08060 112954 114234 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265576.1 protein_id gnl|my_center|LOCUS_08060 114238 115860 gene locus_tag LOCUS_08070 114238 115860 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004342954.1 protein_id gnl|my_center|LOCUS_08070 117798 115906 gene locus_tag LOCUS_08080 117798 115906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 119855 117867 gene locus_tag LOCUS_08090 119855 117867 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207012.1 protein_id gnl|my_center|LOCUS_08090 120170 120763 gene locus_tag LOCUS_08100 120170 120763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 120760 122397 gene locus_tag LOCUS_08110 gene ctaD 120760 122397 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902450.1 protein_id gnl|my_center|LOCUS_08110 122413 123009 gene locus_tag LOCUS_08120 122413 123009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 125008 123014 gene locus_tag LOCUS_08130 125008 123014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 125236 126333 gene locus_tag LOCUS_08140 125236 126333 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858516.1 protein_id gnl|my_center|LOCUS_08140 126371 126529 gene locus_tag LOCUS_08150 126371 126529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 126474 127472 gene locus_tag LOCUS_08160 126474 127472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 127538 127858 gene locus_tag LOCUS_08170 127538 127858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 127905 129845 gene locus_tag LOCUS_08180 127905 129845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 129858 130664 gene locus_tag LOCUS_08190 gene btuF 129858 130664 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175631671.1 protein_id gnl|my_center|LOCUS_08190 130661 131386 gene locus_tag LOCUS_08200 130661 131386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901785.1 protein_id gnl|my_center|LOCUS_08200 131379 132338 gene locus_tag LOCUS_08210 131379 132338 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903477.1 protein_id gnl|my_center|LOCUS_08210 132338 133960 gene locus_tag LOCUS_08220 132338 133960 CDS product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816035.1 protein_id gnl|my_center|LOCUS_08220 133957 134382 gene locus_tag LOCUS_08230 133957 134382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 134424 134780 gene locus_tag LOCUS_08240 gene arsC 134424 134780 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 protein_id gnl|my_center|LOCUS_08240 138032 134793 gene locus_tag LOCUS_08250 138032 134793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 138332 138039 gene locus_tag LOCUS_08260 138332 138039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 139794 138373 gene locus_tag LOCUS_08270 139794 138373 CDS product EH signature domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055826.1 protein_id gnl|my_center|LOCUS_08270 140545 139787 gene locus_tag LOCUS_08280 140545 139787 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252511.1 protein_id gnl|my_center|LOCUS_08280 142473 140548 gene locus_tag LOCUS_08290 gene zorA 142473 140548 CDS product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_08290 142730 142482 gene locus_tag LOCUS_08300 142730 142482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 142904 143197 gene locus_tag LOCUS_08310 142904 143197 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_08310 143194 143538 gene locus_tag LOCUS_08320 143194 143538 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_08320 143648 144439 gene locus_tag LOCUS_08330 143648 144439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 144581 144426 gene locus_tag LOCUS_08340 144581 144426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 144918 145052 gene locus_tag LOCUS_08350 144918 145052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 145620 145330 gene locus_tag LOCUS_08360 145620 145330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 145842 146345 gene locus_tag LOCUS_08370 gene cobU 145842 146345 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546718.1 protein_id gnl|my_center|LOCUS_08370 146342 147067 gene locus_tag LOCUS_08380 gene cobS 146342 147067 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_08380 147076 147600 gene locus_tag LOCUS_08390 147076 147600 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158375.1 protein_id gnl|my_center|LOCUS_08390 147637 147960 gene locus_tag LOCUS_08400 147637 147960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 148012 148785 gene locus_tag LOCUS_08410 148012 148785 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_08410 148869 149237 gene locus_tag LOCUS_08420 148869 149237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 149286 149636 gene locus_tag LOCUS_08430 149286 149636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 149793 150719 gene locus_tag LOCUS_08440 149793 150719 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980223.1 protein_id gnl|my_center|LOCUS_08440 150760 151020 gene locus_tag LOCUS_08450 150760 151020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 151205 151044 gene locus_tag LOCUS_08460 151205 151044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 151394 151221 gene locus_tag LOCUS_08470 151394 151221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 152012 151806 gene locus_tag LOCUS_08480 152012 151806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 153763 152009 gene locus_tag LOCUS_08490 153763 152009 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_08490 154495 153815 gene locus_tag LOCUS_08500 154495 153815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence05 <1 1240 gene locus_tag LOCUS_08510 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933702.1:efflux RND transporter permease subunit note possible pseudo, frameshifted 1240 2922 gene locus_tag LOCUS_08520 1240 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08520 4574 2985 gene locus_tag LOCUS_08530 gene serA 4574 2985 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 protein_id gnl|my_center|LOCUS_08530 5059 4574 gene locus_tag LOCUS_08540 5059 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6717 5065 gene locus_tag LOCUS_08550 6717 5065 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852520.1 protein_id gnl|my_center|LOCUS_08550 7652 6819 gene locus_tag LOCUS_08560 7652 6819 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_08560 8935 7655 gene locus_tag LOCUS_08570 gene aroA 8935 7655 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852577.1 protein_id gnl|my_center|LOCUS_08570 11271 8932 gene locus_tag LOCUS_08580 gene pheT 11271 8932 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915726.1 protein_id gnl|my_center|LOCUS_08580 12260 11268 gene locus_tag LOCUS_08590 gene pheS 12260 11268 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 protein_id gnl|my_center|LOCUS_08590 12384 12740 gene locus_tag LOCUS_08600 12384 12740 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852408.1 protein_id gnl|my_center|LOCUS_08600 13216 12752 gene locus_tag LOCUS_08610 13216 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 14598 13219 gene locus_tag LOCUS_08620 gene argH 14598 13219 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891895.1 protein_id gnl|my_center|LOCUS_08620 15205 14870 gene locus_tag LOCUS_08630 15205 14870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 17112 15298 gene locus_tag LOCUS_08640 17112 15298 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204347.1 protein_id gnl|my_center|LOCUS_08640 18056 17115 gene locus_tag LOCUS_08650 gene hemC 18056 17115 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856753.1 protein_id gnl|my_center|LOCUS_08650 18887 18057 gene locus_tag LOCUS_08660 18887 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 19269 18841 gene locus_tag LOCUS_08670 19269 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 20573 19269 gene locus_tag LOCUS_08680 20573 19269 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971520.1 protein_id gnl|my_center|LOCUS_08680 21872 20574 gene locus_tag LOCUS_08690 gene hemA 21872 20574 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878972.1 protein_id gnl|my_center|LOCUS_08690 22759 21872 gene locus_tag LOCUS_08700 22759 21872 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_08700 23186 22773 gene locus_tag LOCUS_08710 23186 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 23468 23187 gene locus_tag LOCUS_08720 23468 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 23568 24716 gene locus_tag LOCUS_08730 23568 24716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 25459 24782 gene locus_tag LOCUS_08740 25459 24782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 27371 25449 gene locus_tag LOCUS_08750 27371 25449 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_08750 27556 29478 gene locus_tag LOCUS_08760 27556 29478 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105914.1 protein_id gnl|my_center|LOCUS_08760 29488 30162 gene locus_tag LOCUS_08770 29488 30162 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_08770 30155 31552 gene locus_tag LOCUS_08780 30155 31552 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_08780 32550 31699 gene locus_tag LOCUS_08790 gene argB 32550 31699 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_08790 33346 32534 gene locus_tag LOCUS_08800 33346 32534 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833936.1 protein_id gnl|my_center|LOCUS_08800 34583 33462 gene locus_tag LOCUS_08810 gene pseC 34583 33462 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_08810 35401 34595 gene locus_tag LOCUS_08820 35401 34595 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932247.1 protein_id gnl|my_center|LOCUS_08820 35490 36083 gene locus_tag LOCUS_08830 35490 36083 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404680.1 protein_id gnl|my_center|LOCUS_08830 36583 36092 gene locus_tag LOCUS_08840 36583 36092 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868197.1 protein_id gnl|my_center|LOCUS_08840 37437 36580 gene locus_tag LOCUS_08850 gene cmoB 37437 36580 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_08850 37554 38447 gene locus_tag LOCUS_08860 37554 38447 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853697.1 protein_id gnl|my_center|LOCUS_08860 38469 38669 gene locus_tag LOCUS_08870 38469 38669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 39011 38646 gene locus_tag LOCUS_08880 gene acpS 39011 38646 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857939.1 protein_id gnl|my_center|LOCUS_08880 39593 39012 gene locus_tag LOCUS_08890 gene fliL 39593 39012 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797017.1 protein_id gnl|my_center|LOCUS_08890 39919 39662 gene locus_tag LOCUS_08900 39919 39662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 41347 40001 gene locus_tag LOCUS_08910 gene radA 41347 40001 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858434.1 protein_id gnl|my_center|LOCUS_08910 42331 41453 gene locus_tag LOCUS_08920 gene ftsY 42331 41453 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864556.1 protein_id gnl|my_center|LOCUS_08920 42892 42332 gene locus_tag LOCUS_08930 42892 42332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 42956 43528 gene locus_tag LOCUS_08940 42956 43528 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875342.1 protein_id gnl|my_center|LOCUS_08940 43530 45098 gene locus_tag LOCUS_08950 gene rny 43530 45098 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 protein_id gnl|my_center|LOCUS_08950 45450 45160 gene locus_tag LOCUS_08960 45450 45160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 45604 45978 gene locus_tag LOCUS_08970 45604 45978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 46895 46005 gene locus_tag LOCUS_08980 46895 46005 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 protein_id gnl|my_center|LOCUS_08980 47592 46888 gene locus_tag LOCUS_08990 47592 46888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 49154 47589 gene locus_tag LOCUS_09000 49154 47589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 50579 49155 gene locus_tag LOCUS_09010 gene gatB 50579 49155 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 protein_id gnl|my_center|LOCUS_09010 50699 51871 gene locus_tag LOCUS_09020 50699 51871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 51885 52280 gene locus_tag LOCUS_09030 51885 52280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 52267 53571 gene locus_tag LOCUS_09040 52267 53571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 53982 53572 gene locus_tag LOCUS_09050 53982 53572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 54253 53990 gene locus_tag LOCUS_09060 54253 53990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 54940 54266 gene locus_tag LOCUS_09070 54940 54266 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858390.1 protein_id gnl|my_center|LOCUS_09070 55971 55018 gene locus_tag LOCUS_09080 gene truD 55971 55018 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052415.1 protein_id gnl|my_center|LOCUS_09080 56879 56058 gene locus_tag LOCUS_09090 56879 56058 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852206.1 protein_id gnl|my_center|LOCUS_09090 56823 57071 gene locus_tag LOCUS_09100 56823 57071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 57249 56992 gene locus_tag LOCUS_09110 57249 56992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 57899 57450 gene locus_tag LOCUS_09120 57899 57450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 58179 58496 gene locus_tag LOCUS_09130 58179 58496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 58489 58842 gene locus_tag LOCUS_09140 58489 58842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 59491 58913 gene locus_tag LOCUS_09150 59491 58913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 60414 59572 gene locus_tag LOCUS_09160 60414 59572 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_09160 61216 60506 gene locus_tag LOCUS_09170 61216 60506 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852328.1 protein_id gnl|my_center|LOCUS_09170 63161 61200 gene locus_tag LOCUS_09180 gene ligA 63161 61200 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852062.1 protein_id gnl|my_center|LOCUS_09180 63300 64247 gene locus_tag LOCUS_09190 63300 64247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 64330 65313 gene locus_tag LOCUS_09200 64330 65313 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 protein_id gnl|my_center|LOCUS_09200 65317 66099 gene locus_tag LOCUS_09210 65317 66099 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_09210 66087 66824 gene locus_tag LOCUS_09220 66087 66824 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_09220 66824 68074 gene locus_tag LOCUS_09230 66824 68074 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_09230 70657 68084 gene locus_tag LOCUS_09240 70657 68084 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_09240 72527 70650 gene locus_tag LOCUS_09250 72527 70650 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201781412.1 protein_id gnl|my_center|LOCUS_09250 72684 72881 gene locus_tag LOCUS_09260 72684 72881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 72961 73521 gene locus_tag LOCUS_09270 72961 73521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 75690 73525 gene locus_tag LOCUS_09280 75690 73525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 75835 77097 gene locus_tag LOCUS_09290 gene vpoC 75835 77097 CDS product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 protein_id gnl|my_center|LOCUS_09290 77094 78239 gene locus_tag LOCUS_09300 77094 78239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 78236 79381 gene locus_tag LOCUS_09310 78236 79381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_09310 79383 80093 gene locus_tag LOCUS_09320 79383 80093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_09320 80165 80470 gene locus_tag LOCUS_09330 80165 80470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 80495 81157 gene locus_tag LOCUS_09340 gene dccR 80495 81157 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_09340 81144 82292 gene locus_tag LOCUS_09350 gene dccS 81144 82292 CDS product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 protein_id gnl|my_center|LOCUS_09350 82286 82612 gene locus_tag LOCUS_09360 82286 82612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 84321 82606 gene locus_tag LOCUS_09370 84321 82606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 85833 84334 gene locus_tag LOCUS_09380 85833 84334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 89433 85855 gene locus_tag LOCUS_09390 89433 85855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 90583 89435 gene locus_tag LOCUS_09400 90583 89435 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_09400 91714 90584 gene locus_tag LOCUS_09410 91714 90584 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_09410 93093 91777 gene locus_tag LOCUS_09420 93093 91777 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_09420 93362 93090 gene locus_tag LOCUS_09430 93362 93090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 94207 93359 gene locus_tag LOCUS_09440 94207 93359 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263160.1 protein_id gnl|my_center|LOCUS_09440 95452 94220 gene locus_tag LOCUS_09450 95452 94220 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858477.1 protein_id gnl|my_center|LOCUS_09450 95544 95912 gene locus_tag LOCUS_09460 95544 95912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 96172 96882 gene locus_tag LOCUS_09470 96172 96882 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_09470 98156 96909 gene locus_tag LOCUS_09480 gene mshG 98156 96909 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_09480 99889 98156 gene locus_tag LOCUS_09490 99889 98156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 100443 99898 gene locus_tag LOCUS_09500 100443 99898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 101363 100440 gene locus_tag LOCUS_09510 101363 100440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 102168 101356 gene locus_tag LOCUS_09520 102168 101356 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851464.1 protein_id gnl|my_center|LOCUS_09520 103751 102165 gene locus_tag LOCUS_09530 gene mshL 103751 102165 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_09530 104171 103761 gene locus_tag LOCUS_09540 104171 103761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 104854 104213 gene locus_tag LOCUS_09550 104854 104213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 106404 104851 gene locus_tag LOCUS_09560 106404 104851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 107726 106416 gene locus_tag LOCUS_09570 107726 106416 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940453.1 protein_id gnl|my_center|LOCUS_09570 108701 107733 gene locus_tag LOCUS_09580 gene csd6 108701 107733 CDS product cell shape-determining L,D-carboxypeptidase Csd6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757130.1 protein_id gnl|my_center|LOCUS_09580 109576 108776 gene locus_tag LOCUS_09590 gene era 109576 108776 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852114.1 protein_id gnl|my_center|LOCUS_09590 111027 109699 gene locus_tag LOCUS_09600 gene hslU 111027 109699 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 protein_id gnl|my_center|LOCUS_09600 111569 111024 gene locus_tag LOCUS_09610 gene hslV 111569 111024 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence06 612 528 gene locus_tag LOCUS_t00150 612 528 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 973 659 gene locus_tag LOCUS_09620 973 659 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853292.1 protein_id gnl|my_center|LOCUS_09620 3335 1170 gene locus_tag LOCUS_09630 3335 1170 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853182.1 protein_id gnl|my_center|LOCUS_09630 3987 3325 gene locus_tag LOCUS_09640 3987 3325 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090667.1 protein_id gnl|my_center|LOCUS_09640 6169 3989 gene locus_tag LOCUS_09650 6169 3989 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 protein_id gnl|my_center|LOCUS_09650 6611 6162 gene locus_tag LOCUS_09660 6611 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 7888 6608 gene locus_tag LOCUS_09670 gene purD 7888 6608 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853212.1 protein_id gnl|my_center|LOCUS_09670 8865 8203 gene locus_tag LOCUS_09680 8865 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 10406 8856 gene locus_tag LOCUS_09690 gene guaA 10406 8856 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853189.1 protein_id gnl|my_center|LOCUS_09690 11881 10499 gene locus_tag LOCUS_09700 gene nhaD 11881 10499 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_09700 13325 11874 gene locus_tag LOCUS_09710 gene nadB 13325 11874 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_09710 13565 13918 gene locus_tag LOCUS_09720 13565 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 13915 15717 gene locus_tag LOCUS_09730 gene uvrC 13915 15717 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774319.1 protein_id gnl|my_center|LOCUS_09730 15841 16275 gene locus_tag LOCUS_09740 15841 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 16262 17857 gene locus_tag LOCUS_09750 16262 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 17860 21030 gene locus_tag LOCUS_09760 17860 21030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 21041 21415 gene locus_tag LOCUS_09770 21041 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 23838 21427 gene locus_tag LOCUS_09780 gene lon 23838 21427 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868636.1 protein_id gnl|my_center|LOCUS_09780 24580 23825 gene locus_tag LOCUS_09790 24580 23825 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237316.1 protein_id gnl|my_center|LOCUS_09790 24705 25085 gene locus_tag LOCUS_09800 gene fliW 24705 25085 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862609.1 protein_id gnl|my_center|LOCUS_09800 25299 30005 gene locus_tag LOCUS_09810 25299 30005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 29999 30625 gene locus_tag LOCUS_09820 29999 30625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 30625 31506 gene locus_tag LOCUS_09830 30625 31506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 31482 31991 gene locus_tag LOCUS_09840 31482 31991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 32119 32661 gene locus_tag LOCUS_09850 gene raiA 32119 32661 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016408.1 protein_id gnl|my_center|LOCUS_09850 34554 32746 gene locus_tag LOCUS_09860 gene recG 34554 32746 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158370.1 protein_id gnl|my_center|LOCUS_09860 35864 34626 gene locus_tag LOCUS_09870 35864 34626 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858609.1 protein_id gnl|my_center|LOCUS_09870 36959 35910 gene locus_tag LOCUS_09880 36959 35910 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_09880 37059 38957 gene locus_tag LOCUS_09890 37059 38957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 40923 38935 gene locus_tag LOCUS_09900 40923 38935 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215916.1 protein_id gnl|my_center|LOCUS_09900 41615 40920 gene locus_tag LOCUS_09910 41615 40920 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_09910 41963 46993 gene locus_tag LOCUS_09920 41963 46993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 47440 47042 gene locus_tag LOCUS_09930 gene nusB 47440 47042 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_09930 47904 47440 gene locus_tag LOCUS_09940 gene ribE 47904 47440 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 protein_id gnl|my_center|LOCUS_09940 48697 47906 gene locus_tag LOCUS_09950 gene kdsA 48697 47906 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858652.1 protein_id gnl|my_center|LOCUS_09950 49763 48759 gene locus_tag LOCUS_09960 49763 48759 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 protein_id gnl|my_center|LOCUS_09960 49708 50721 gene locus_tag LOCUS_09970 49708 50721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 50740 51540 gene locus_tag LOCUS_09980 50740 51540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 51602 52354 gene locus_tag LOCUS_09990 51602 52354 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853334.1 protein_id gnl|my_center|LOCUS_09990 52359 52733 gene locus_tag LOCUS_10000 52359 52733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 53176 52730 gene locus_tag LOCUS_10010 53176 52730 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 protein_id gnl|my_center|LOCUS_10010 53270 53851 gene locus_tag LOCUS_10020 53270 53851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 53891 54571 gene locus_tag LOCUS_10030 53891 54571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 54633 56123 gene locus_tag LOCUS_10040 gene der 54633 56123 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858744.1 protein_id gnl|my_center|LOCUS_10040 56590 56147 gene locus_tag LOCUS_10050 gene hemJ 56590 56147 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506456.1 protein_id gnl|my_center|LOCUS_10050 56921 56592 gene locus_tag LOCUS_10060 56921 56592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 57049 58014 gene locus_tag LOCUS_10070 gene trpS 57049 58014 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_10070 58972 58052 gene locus_tag LOCUS_10080 gene argF 58972 58052 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858026.1 protein_id gnl|my_center|LOCUS_10080 60045 59074 gene locus_tag LOCUS_10090 gene hemB 60045 59074 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 protein_id gnl|my_center|LOCUS_10090 60118 60681 gene locus_tag LOCUS_10100 gene ribA 60118 60681 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_10100 60698 61279 gene locus_tag LOCUS_10110 gene rsmG 60698 61279 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068828.1 protein_id gnl|my_center|LOCUS_10110 61276 61497 gene locus_tag LOCUS_10120 61276 61497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 61494 61886 gene locus_tag LOCUS_10130 61494 61886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 61957 63915 gene locus_tag LOCUS_10140 61957 63915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 64947 63928 gene locus_tag LOCUS_10150 64947 63928 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852617.1 protein_id gnl|my_center|LOCUS_10150 64963 65958 gene locus_tag LOCUS_10160 64963 65958 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_10160 66144 68111 gene locus_tag LOCUS_10170 66144 68111 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_10170 68207 69268 gene locus_tag LOCUS_10180 gene ispG 68207 69268 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852250.1 protein_id gnl|my_center|LOCUS_10180 69318 70544 gene locus_tag LOCUS_10190 69318 70544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 70670 70954 gene locus_tag LOCUS_10200 70670 70954 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870896.1 protein_id gnl|my_center|LOCUS_10200 70947 71378 gene locus_tag LOCUS_10210 70947 71378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 71378 72829 gene locus_tag LOCUS_10220 71378 72829 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858532.1 protein_id gnl|my_center|LOCUS_10220 72835 74097 gene locus_tag LOCUS_10230 72835 74097 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611625.1 protein_id gnl|my_center|LOCUS_10230 74877 74044 gene locus_tag LOCUS_10240 74877 74044 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_10240 76269 74884 gene locus_tag LOCUS_10250 76269 74884 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852810.1 protein_id gnl|my_center|LOCUS_10250 77025 76273 gene locus_tag LOCUS_10260 77025 76273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 77195 78403 gene locus_tag LOCUS_10270 77195 78403 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 protein_id gnl|my_center|LOCUS_10270 78372 78941 gene locus_tag LOCUS_10280 78372 78941 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119978.1 protein_id gnl|my_center|LOCUS_10280 80772 78925 gene locus_tag LOCUS_10290 80772 78925 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852169.1 protein_id gnl|my_center|LOCUS_10290 81228 80791 gene locus_tag LOCUS_10300 81228 80791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 81713 81333 gene locus_tag LOCUS_10310 81713 81333 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167122675.1 protein_id gnl|my_center|LOCUS_10310 81877 82308 gene locus_tag LOCUS_10320 gene flgB 81877 82308 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347783.1 protein_id gnl|my_center|LOCUS_10320 82318 82812 gene locus_tag LOCUS_10330 gene flgC 82318 82812 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480097.1 protein_id gnl|my_center|LOCUS_10330 82825 83127 gene locus_tag LOCUS_10340 gene fliE 82825 83127 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147918.1 protein_id gnl|my_center|LOCUS_10340 83329 85062 gene locus_tag LOCUS_10350 83329 85062 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370329.1 protein_id gnl|my_center|LOCUS_10350 85860 85039 gene locus_tag LOCUS_10360 gene panC 85860 85039 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264323.1 protein_id gnl|my_center|LOCUS_10360 85913 87010 gene locus_tag LOCUS_10370 gene prfB 85913 87010 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851475.1 protein_id gnl|my_center|LOCUS_10370 87040 87753 gene locus_tag LOCUS_10380 87040 87753 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853863.1 protein_id gnl|my_center|LOCUS_10380 90256 88166 gene locus_tag LOCUS_10390 gene fusA 90256 88166 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779472.1 protein_id gnl|my_center|LOCUS_10390 90736 90269 gene locus_tag LOCUS_10400 gene rpsG 90736 90269 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779471.1 protein_id gnl|my_center|LOCUS_10400 91222 90842 gene locus_tag LOCUS_10410 gene rpsL 91222 90842 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142321.1 protein_id gnl|my_center|LOCUS_10410 95950 91439 gene locus_tag LOCUS_10420 gene rpoC 95950 91439 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858508.1 protein_id gnl|my_center|LOCUS_10420 100088 95943 gene locus_tag LOCUS_10430 gene rpoB 100088 95943 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891860.1 protein_id gnl|my_center|LOCUS_10430 100685 100317 gene locus_tag LOCUS_10440 gene rplL 100685 100317 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858569.1 protein_id gnl|my_center|LOCUS_10440 101223 100744 gene locus_tag LOCUS_10450 gene rplJ 101223 100744 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858610.1 protein_id gnl|my_center|LOCUS_10450 102051 101359 gene locus_tag LOCUS_10460 gene rplA 102051 101359 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854928.1 protein_id gnl|my_center|LOCUS_10460 102548 102123 gene locus_tag LOCUS_10470 gene rplK 102548 102123 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779452.1 protein_id gnl|my_center|LOCUS_10470 103111 102569 gene locus_tag LOCUS_10480 gene nusG 103111 102569 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851098.1 protein_id gnl|my_center|LOCUS_10480 103300 103121 gene locus_tag LOCUS_10490 103300 103121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 103437 103361 gene locus_tag LOCUS_t00160 103437 103361 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 103644 103492 gene locus_tag LOCUS_10500 gene rpmG 103644 103492 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_10500 104889 103690 gene locus_tag LOCUS_10510 gene tuf 104889 103690 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040579.1 protein_id gnl|my_center|LOCUS_10510 105052 104978 gene locus_tag LOCUS_t00170 105052 104978 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 105289 105213 gene locus_tag LOCUS_t00180 105289 105213 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 105388 105304 gene locus_tag LOCUS_t00190 105388 105304 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 105523 105447 gene locus_tag LOCUS_t00200 105523 105447 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 105662 106390 gene locus_tag LOCUS_10520 105662 106390 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence07 728 1252 gene locus_tag LOCUS_10530 728 1252 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904001.1 protein_id gnl|my_center|LOCUS_10530 1245 1667 gene locus_tag LOCUS_10540 1245 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1664 2956 gene locus_tag LOCUS_10550 gene hisD 1664 2956 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_10550 3218 3856 gene locus_tag LOCUS_10560 3218 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3856 4755 gene locus_tag LOCUS_10570 3856 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 4768 8160 gene locus_tag LOCUS_10580 4768 8160 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_10580 8701 8204 gene locus_tag LOCUS_10590 8701 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 8778 9278 gene locus_tag LOCUS_10600 8778 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 10963 9314 gene locus_tag LOCUS_10610 10963 9314 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_10610 11585 11049 gene locus_tag LOCUS_10620 11585 11049 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722402.1 protein_id gnl|my_center|LOCUS_10620 12022 11738 gene locus_tag LOCUS_10630 12022 11738 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_10630 12352 12119 gene locus_tag LOCUS_10640 12352 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 12596 12357 gene locus_tag LOCUS_10650 12596 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 14469 12811 gene locus_tag LOCUS_10660 14469 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 15115 14459 gene locus_tag LOCUS_10670 15115 14459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 15228 16301 gene locus_tag LOCUS_10680 gene fbaA 15228 16301 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_10680 16680 16333 gene locus_tag LOCUS_10690 16680 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 16760 17467 gene locus_tag LOCUS_10700 gene cmoA 16760 17467 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_10700 17760 17503 gene locus_tag LOCUS_10710 17760 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 18433 17792 gene locus_tag LOCUS_10720 gene nth 18433 17792 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852225.1 protein_id gnl|my_center|LOCUS_10720 18530 19363 gene locus_tag LOCUS_10730 gene peb4 18530 19363 CDS product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 protein_id gnl|my_center|LOCUS_10730 19364 20245 gene locus_tag LOCUS_10740 19364 20245 CDS product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450949.1 protein_id gnl|my_center|LOCUS_10740 20330 22906 gene locus_tag LOCUS_10750 20330 22906 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858618.1 protein_id gnl|my_center|LOCUS_10750 22909 23283 gene locus_tag LOCUS_10760 22909 23283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 23354 23488 gene locus_tag LOCUS_10770 gene rpmH 23354 23488 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776864.1 protein_id gnl|my_center|LOCUS_10770 23569 23826 gene locus_tag LOCUS_10780 23569 23826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 24152 25768 gene locus_tag LOCUS_10790 gene yidC 24152 25768 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853384.1 protein_id gnl|my_center|LOCUS_10790 25761 26678 gene locus_tag LOCUS_10800 25761 26678 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 protein_id gnl|my_center|LOCUS_10800 26684 28024 gene locus_tag LOCUS_10810 gene mnmE 26684 28024 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853397.1 protein_id gnl|my_center|LOCUS_10810 28024 28416 gene locus_tag LOCUS_10820 gene ruvX 28024 28416 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599146.1 protein_id gnl|my_center|LOCUS_10820 28532 29230 gene locus_tag LOCUS_10830 28532 29230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 30066 29419 gene locus_tag LOCUS_10840 30066 29419 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880976.1 protein_id gnl|my_center|LOCUS_10840 31361 30063 gene locus_tag LOCUS_10850 31361 30063 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864101.1 protein_id gnl|my_center|LOCUS_10850 32091 31402 gene locus_tag LOCUS_10860 gene kdpE 32091 31402 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025470747.1 protein_id gnl|my_center|LOCUS_10860 33122 32088 gene locus_tag LOCUS_10870 33122 32088 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070474.1 protein_id gnl|my_center|LOCUS_10870 33799 33302 gene locus_tag LOCUS_10880 33799 33302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 33893 35125 gene locus_tag LOCUS_10890 33893 35125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 35126 36226 gene locus_tag LOCUS_10900 35126 36226 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967657.1 protein_id gnl|my_center|LOCUS_10900 36228 39323 gene locus_tag LOCUS_10910 36228 39323 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_10910 39978 39355 gene locus_tag LOCUS_10920 39978 39355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 40085 41107 gene locus_tag LOCUS_10930 gene ilvC 40085 41107 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_10930 42066 41326 gene locus_tag LOCUS_10940 gene trpA 42066 41326 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_10940 42467 42063 gene locus_tag LOCUS_10950 42467 42063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 42547 43338 gene locus_tag LOCUS_10960 gene panB 42547 43338 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062669.1 protein_id gnl|my_center|LOCUS_10960 43347 44360 gene locus_tag LOCUS_10970 gene ruvB 43347 44360 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856258.1 protein_id gnl|my_center|LOCUS_10970 44357 45394 gene locus_tag LOCUS_10980 44357 45394 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 protein_id gnl|my_center|LOCUS_10980 46290 45400 gene locus_tag LOCUS_10990 46290 45400 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221211.1 protein_id gnl|my_center|LOCUS_10990 46425 47330 gene locus_tag LOCUS_11000 46425 47330 CDS product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 protein_id gnl|my_center|LOCUS_11000 47327 47938 gene locus_tag LOCUS_11010 gene hisH 47327 47938 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_11010 48048 48758 gene locus_tag LOCUS_11020 gene hisA 48048 48758 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_11020 48841 49215 gene locus_tag LOCUS_11030 48841 49215 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 protein_id gnl|my_center|LOCUS_11030 49215 50048 gene locus_tag LOCUS_11040 49215 50048 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852657.1 protein_id gnl|my_center|LOCUS_11040 50051 52042 gene locus_tag LOCUS_11050 gene ftsH 50051 52042 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852796.1 protein_id gnl|my_center|LOCUS_11050 52032 52688 gene locus_tag LOCUS_11060 52032 52688 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_11060 55161 52825 gene locus_tag LOCUS_11070 gene pflB 55161 52825 CDS product motility protein PflB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858651.1 protein_id gnl|my_center|LOCUS_11070 56459 55212 gene locus_tag LOCUS_11080 gene serS 56459 55212 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567145.1 protein_id gnl|my_center|LOCUS_11080 57370 56474 gene locus_tag LOCUS_11090 57370 56474 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545211.1 protein_id gnl|my_center|LOCUS_11090 57425 58048 gene locus_tag LOCUS_11100 gene serB 57425 58048 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_11100 58048 58377 gene locus_tag LOCUS_11110 58048 58377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 60126 58381 gene locus_tag LOCUS_11120 60126 58381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 60523 60260 gene locus_tag LOCUS_11130 gene rpsR 60523 60260 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 protein_id gnl|my_center|LOCUS_11130 61080 60550 gene locus_tag LOCUS_11140 61080 60550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 61543 61127 gene locus_tag LOCUS_11150 gene rpsF 61543 61127 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865739.1 protein_id gnl|my_center|LOCUS_11150 61799 62887 gene locus_tag LOCUS_11160 61799 62887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 62890 63666 gene locus_tag LOCUS_11170 62890 63666 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874287.1 protein_id gnl|my_center|LOCUS_11170 64687 63659 gene locus_tag LOCUS_11180 gene queA 64687 63659 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_11180 65504 64689 gene locus_tag LOCUS_11190 gene tatC 65504 64689 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852171.1 protein_id gnl|my_center|LOCUS_11190 65916 65497 gene locus_tag LOCUS_11200 gene tatB 65916 65497 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467616.1 protein_id gnl|my_center|LOCUS_11200 66925 65969 gene locus_tag LOCUS_11210 gene hemW 66925 65969 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852262.1 protein_id gnl|my_center|LOCUS_11210 68148 67027 gene locus_tag LOCUS_11220 68148 67027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 68658 68158 gene locus_tag LOCUS_11230 gene cetB 68658 68158 CDS product bipartate energy taxis response protein CetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002777340.1 protein_id gnl|my_center|LOCUS_11230 68681 69151 gene locus_tag LOCUS_11240 68681 69151 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_11240 69152 70363 gene locus_tag LOCUS_11250 69152 70363 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891865.1 protein_id gnl|my_center|LOCUS_11250 70368 70916 gene locus_tag LOCUS_11260 70368 70916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 70903 71529 gene locus_tag LOCUS_11270 70903 71529 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 protein_id gnl|my_center|LOCUS_11270 71519 72661 gene locus_tag LOCUS_11280 gene folP 71519 72661 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858587.1 protein_id gnl|my_center|LOCUS_11280 72673 74001 gene locus_tag LOCUS_11290 72673 74001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 76124 74004 gene locus_tag LOCUS_11300 76124 74004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence08 1214 174 gene locus_tag LOCUS_11310 gene mnmA 1214 174 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851977.1 protein_id gnl|my_center|LOCUS_11310 1987 1217 gene locus_tag LOCUS_11320 1987 1217 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881230.1 protein_id gnl|my_center|LOCUS_11320 2860 2000 gene locus_tag LOCUS_11330 gene fliY 2860 2000 CDS product flagellar motor switch protein FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150629.1 protein_id gnl|my_center|LOCUS_11330 3955 2864 gene locus_tag LOCUS_11340 gene fliM 3955 2864 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851710.1 protein_id gnl|my_center|LOCUS_11340 4640 3957 gene locus_tag LOCUS_11350 4640 3957 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602430.1 protein_id gnl|my_center|LOCUS_11350 4969 4637 gene locus_tag LOCUS_11360 4969 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 5867 4992 gene locus_tag LOCUS_11370 gene flhG 5867 4992 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_11370 7135 5864 gene locus_tag LOCUS_11380 gene flhF 7135 5864 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612466.1 protein_id gnl|my_center|LOCUS_11380 7524 7132 gene locus_tag LOCUS_11390 gene folK 7524 7132 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851803.1 protein_id gnl|my_center|LOCUS_11390 8105 7626 gene locus_tag LOCUS_11400 gene aroQ 8105 7626 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_11400 8194 9411 gene locus_tag LOCUS_11410 8194 9411 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_11410 9415 10284 gene locus_tag LOCUS_11420 gene sppA 9415 10284 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851869.1 protein_id gnl|my_center|LOCUS_11420 10753 10289 gene locus_tag LOCUS_11430 10753 10289 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 protein_id gnl|my_center|LOCUS_11430 11174 10758 gene locus_tag LOCUS_11440 11174 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 11832 11233 gene locus_tag LOCUS_11450 11832 11233 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687047.1 protein_id gnl|my_center|LOCUS_11450 13091 11841 gene locus_tag LOCUS_11460 gene xseA 13091 11841 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382848.1 protein_id gnl|my_center|LOCUS_11460 14588 13521 gene locus_tag LOCUS_11470 14588 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 14940 14635 gene locus_tag LOCUS_11480 14940 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 15904 15185 gene locus_tag LOCUS_11490 gene ubiE 15904 15185 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858648.1 protein_id gnl|my_center|LOCUS_11490 16918 15908 gene locus_tag LOCUS_11500 gene ribD 16918 15908 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891948.1 protein_id gnl|my_center|LOCUS_11500 17361 16912 gene locus_tag LOCUS_11510 gene rimP 17361 16912 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 protein_id gnl|my_center|LOCUS_11510 17719 17369 gene locus_tag LOCUS_11520 gene rbfA 17719 17369 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778650.1 protein_id gnl|my_center|LOCUS_11520 20334 17716 gene locus_tag LOCUS_11530 gene infB 20334 17716 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864659.1 protein_id gnl|my_center|LOCUS_11530 21506 20625 gene locus_tag LOCUS_11540 gene thrB 21506 20625 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261726.1 protein_id gnl|my_center|LOCUS_11540 21975 21514 gene locus_tag LOCUS_11550 21975 21514 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851789.1 protein_id gnl|my_center|LOCUS_11550 22852 21968 gene locus_tag LOCUS_11560 gene lpxC 22852 21968 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859351.1 protein_id gnl|my_center|LOCUS_11560 24226 22856 gene locus_tag LOCUS_11570 24226 22856 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 protein_id gnl|my_center|LOCUS_11570 25166 24228 gene locus_tag LOCUS_11580 25166 24228 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_11580 26246 25194 gene locus_tag LOCUS_11590 gene flhB 26246 25194 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_11590 27108 26293 gene locus_tag LOCUS_11600 gene nadC 27108 26293 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405980.1 protein_id gnl|my_center|LOCUS_11600 28103 27105 gene locus_tag LOCUS_11610 gene nadA 28103 27105 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141770.1 protein_id gnl|my_center|LOCUS_11610 28209 28823 gene locus_tag LOCUS_11620 gene plsY 28209 28823 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 protein_id gnl|my_center|LOCUS_11620 28820 29149 gene locus_tag LOCUS_11630 28820 29149 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850887.1 protein_id gnl|my_center|LOCUS_11630 29251 29925 gene locus_tag LOCUS_11640 gene hsrA 29251 29925 CDS product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 protein_id gnl|my_center|LOCUS_11640 30054 31358 gene locus_tag LOCUS_11650 30054 31358 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_11650 31461 31712 gene locus_tag LOCUS_11660 31461 31712 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055463.1 protein_id gnl|my_center|LOCUS_11660 31723 33198 gene locus_tag LOCUS_11670 31723 33198 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074267.1 protein_id gnl|my_center|LOCUS_11670 33271 33645 gene locus_tag LOCUS_11680 33271 33645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 33642 35126 gene locus_tag LOCUS_11690 33642 35126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 35135 35929 gene locus_tag LOCUS_11700 35135 35929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 35916 36356 gene locus_tag LOCUS_11710 35916 36356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 36400 36999 gene locus_tag LOCUS_11720 36400 36999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 37004 37492 gene locus_tag LOCUS_11730 37004 37492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 37525 39087 gene locus_tag LOCUS_11740 37525 39087 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899360.1 protein_id gnl|my_center|LOCUS_11740 39077 40126 gene locus_tag LOCUS_11750 39077 40126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 40126 40779 gene locus_tag LOCUS_11760 40126 40779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 43037 40776 gene locus_tag LOCUS_11770 gene bamA 43037 40776 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_11770 43435 44457 gene locus_tag LOCUS_11780 43435 44457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 44454 45485 gene locus_tag LOCUS_11790 44454 45485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 45687 45938 gene locus_tag LOCUS_11800 45687 45938 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250181.1 protein_id gnl|my_center|LOCUS_11800 45928 46230 gene locus_tag LOCUS_11810 45928 46230 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221356.1 protein_id gnl|my_center|LOCUS_11810 46340 47170 gene locus_tag LOCUS_11820 46340 47170 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611641.1 protein_id gnl|my_center|LOCUS_11820 48582 47167 gene locus_tag LOCUS_11830 48582 47167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 50403 48607 gene locus_tag LOCUS_11840 50403 48607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 51329 50400 gene locus_tag LOCUS_11850 51329 50400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 51723 51322 gene locus_tag LOCUS_11860 51723 51322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 52554 51724 gene locus_tag LOCUS_11870 52554 51724 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_11870 53518 52571 gene locus_tag LOCUS_11880 53518 52571 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_11880 54597 53587 gene locus_tag LOCUS_11890 54597 53587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 55608 54604 gene locus_tag LOCUS_11900 55608 54604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 56407 55649 gene locus_tag LOCUS_11910 gene traT 56407 55649 CDS product conjugal transfer complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032641144.1 protein_id gnl|my_center|LOCUS_11910 57547 56450 gene locus_tag LOCUS_11920 57547 56450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 58952 57528 gene locus_tag LOCUS_11930 58952 57528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 59770 58949 gene locus_tag LOCUS_11940 59770 58949 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_11940 60692 59922 gene locus_tag LOCUS_11950 60692 59922 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_11950 61289 60795 gene locus_tag LOCUS_11960 61289 60795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 61415 61490 gene locus_tag LOCUS_t00210 61415 61490 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 61514 61588 gene locus_tag LOCUS_t00220 61514 61588 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 61665 64304 gene locus_tag LOCUS_11970 61665 64304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 64336 66330 gene locus_tag LOCUS_11980 64336 66330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 67250 66327 gene locus_tag LOCUS_11990 gene czcD 67250 66327 CDS product CDF family cation-efflux transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852858.1 protein_id gnl|my_center|LOCUS_11990 68014 67286 gene locus_tag LOCUS_12000 68014 67286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 69233 68058 gene locus_tag LOCUS_12010 69233 68058 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_12010 69760 69422 gene locus_tag LOCUS_12020 gene glnB 69760 69422 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_12020 71070 69817 gene locus_tag LOCUS_12030 71070 69817 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545822.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence09 1327 224 gene locus_tag LOCUS_12040 1327 224 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989662.1 protein_id gnl|my_center|LOCUS_12040 1544 1335 gene locus_tag LOCUS_12050 1544 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2139 1537 gene locus_tag LOCUS_12060 2139 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3478 2141 gene locus_tag LOCUS_12070 3478 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4749 3604 gene locus_tag LOCUS_12080 4749 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5833 4682 gene locus_tag LOCUS_12090 5833 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6209 5838 gene locus_tag LOCUS_12100 6209 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 7968 6220 gene locus_tag LOCUS_12110 7968 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 8463 8083 gene locus_tag LOCUS_12120 8463 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 8779 8597 gene locus_tag LOCUS_12130 8779 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 9017 8850 gene locus_tag LOCUS_12140 9017 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 9489 9100 gene locus_tag LOCUS_12150 9489 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 10095 9745 gene locus_tag LOCUS_12160 10095 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 10211 10411 gene locus_tag LOCUS_12170 10211 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 10416 11222 gene locus_tag LOCUS_12180 10416 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 11945 12154 gene locus_tag LOCUS_12190 11945 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 12266 12811 gene locus_tag LOCUS_12200 12266 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 12902 12976 gene locus_tag LOCUS_t00230 12902 12976 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13061 14359 gene locus_tag LOCUS_12210 gene gltX 13061 14359 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_12210 14356 14640 gene locus_tag LOCUS_12220 14356 14640 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 protein_id gnl|my_center|LOCUS_12220 15135 14653 gene locus_tag LOCUS_12230 15135 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 15232 15735 gene locus_tag LOCUS_12240 gene mobB 15232 15735 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 protein_id gnl|my_center|LOCUS_12240 15740 16582 gene locus_tag LOCUS_12250 15740 16582 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_12250 16566 16757 gene locus_tag LOCUS_12260 16566 16757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797008.1 protein_id gnl|my_center|LOCUS_12260 16771 18702 gene locus_tag LOCUS_12270 gene metG 16771 18702 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852639.1 protein_id gnl|my_center|LOCUS_12270 18699 19697 gene locus_tag LOCUS_12280 18699 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 19746 21026 gene locus_tag LOCUS_12290 19746 21026 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009982187.1 protein_id gnl|my_center|LOCUS_12290 21624 20962 gene locus_tag LOCUS_12300 21624 20962 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_12300 22252 21611 gene locus_tag LOCUS_12310 gene queC 22252 21611 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779268.1 protein_id gnl|my_center|LOCUS_12310 22369 22545 gene locus_tag LOCUS_12320 22369 22545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 22623 23042 gene locus_tag LOCUS_12330 gene ybeY 22623 23042 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851664.1 protein_id gnl|my_center|LOCUS_12330 24865 23078 gene locus_tag LOCUS_12340 gene mrdA 24865 23078 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 protein_id gnl|my_center|LOCUS_12340 25314 24862 gene locus_tag LOCUS_12350 25314 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 25742 25281 gene locus_tag LOCUS_12360 25742 25281 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583314.1 protein_id gnl|my_center|LOCUS_12360 26349 25732 gene locus_tag LOCUS_12370 gene yihA 26349 25732 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852258.1 protein_id gnl|my_center|LOCUS_12370 26825 26346 gene locus_tag LOCUS_12380 26825 26346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 27178 26822 gene locus_tag LOCUS_12390 27178 26822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 27840 27346 gene locus_tag LOCUS_12400 27840 27346 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858506.1 protein_id gnl|my_center|LOCUS_12400 28409 27837 gene locus_tag LOCUS_12410 gene hisB 28409 27837 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528350.1 protein_id gnl|my_center|LOCUS_12410 29213 28413 gene locus_tag LOCUS_12420 29213 28413 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852227.1 protein_id gnl|my_center|LOCUS_12420 30433 29213 gene locus_tag LOCUS_12430 30433 29213 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044457.1 protein_id gnl|my_center|LOCUS_12430 31287 30511 gene locus_tag LOCUS_12440 31287 30511 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858473.1 protein_id gnl|my_center|LOCUS_12440 32835 31300 gene locus_tag LOCUS_12450 32835 31300 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871805.1 protein_id gnl|my_center|LOCUS_12450 32990 33196 gene locus_tag LOCUS_12460 32990 33196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 34055 33201 gene locus_tag LOCUS_12470 34055 33201 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 protein_id gnl|my_center|LOCUS_12470 34187 34795 gene locus_tag LOCUS_12480 gene wrbA 34187 34795 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_12480 34971 36725 gene locus_tag LOCUS_12490 gene aspS 34971 36725 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871806.1 protein_id gnl|my_center|LOCUS_12490 36736 37305 gene locus_tag LOCUS_12500 36736 37305 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 protein_id gnl|my_center|LOCUS_12500 37742 37338 gene locus_tag LOCUS_12510 37742 37338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 38482 37835 gene locus_tag LOCUS_12520 gene adk 38482 37835 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706319.1 protein_id gnl|my_center|LOCUS_12520 38603 39847 gene locus_tag LOCUS_12530 38603 39847 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_12530 40148 39861 gene locus_tag LOCUS_12540 40148 39861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 40207 40941 gene locus_tag LOCUS_12550 40207 40941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 41432 40929 gene locus_tag LOCUS_12560 41432 40929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 41510 42706 gene locus_tag LOCUS_12570 41510 42706 CDS product 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851311.1 protein_id gnl|my_center|LOCUS_12570 42837 43142 gene locus_tag LOCUS_12580 42837 43142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 44293 43178 gene locus_tag LOCUS_12590 44293 43178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 45719 44403 gene locus_tag LOCUS_12600 45719 44403 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080877.1 protein_id gnl|my_center|LOCUS_12600 46390 45731 gene locus_tag LOCUS_12610 46390 45731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 46431 46610 gene locus_tag LOCUS_12620 46431 46610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 46756 46607 gene locus_tag LOCUS_12630 46756 46607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 47223 46753 gene locus_tag LOCUS_12640 47223 46753 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_12640 48068 47232 gene locus_tag LOCUS_12650 gene purU 48068 47232 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705222.1 protein_id gnl|my_center|LOCUS_12650 48415 48065 gene locus_tag LOCUS_12660 48415 48065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 48654 48406 gene locus_tag LOCUS_12670 48654 48406 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891888.1 protein_id gnl|my_center|LOCUS_12670 49718 48651 gene locus_tag LOCUS_12680 gene leuB 49718 48651 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_12680 50221 49718 gene locus_tag LOCUS_12690 gene leuD 50221 49718 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_12690 51142 50354 gene locus_tag LOCUS_12700 gene flgG 51142 50354 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852142.1 protein_id gnl|my_center|LOCUS_12700 51976 51155 gene locus_tag LOCUS_12710 51976 51155 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858501.1 protein_id gnl|my_center|LOCUS_12710 52110 53981 gene locus_tag LOCUS_12720 gene rpoD 52110 53981 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 protein_id gnl|my_center|LOCUS_12720 53991 54677 gene locus_tag LOCUS_12730 53991 54677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 55191 54679 gene locus_tag LOCUS_12740 55191 54679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 55498 55166 gene locus_tag LOCUS_12750 55498 55166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 56783 55491 gene locus_tag LOCUS_12760 gene hemL 56783 55491 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421462.1 protein_id gnl|my_center|LOCUS_12760 56969 57769 gene locus_tag LOCUS_12770 56969 57769 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114818.1 protein_id gnl|my_center|LOCUS_12770 58715 57777 gene locus_tag LOCUS_12780 58715 57777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 59055 58705 gene locus_tag LOCUS_12790 59055 58705 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235932.1 protein_id gnl|my_center|LOCUS_12790 59237 60094 gene locus_tag LOCUS_12800 gene folD 59237 60094 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881240.1 protein_id gnl|my_center|LOCUS_12800 60095 60904 gene locus_tag LOCUS_12810 gene lepB 60095 60904 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_12810 60891 61268 gene locus_tag LOCUS_12820 60891 61268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence10 997 23 gene locus_tag LOCUS_12830 gene waaF 997 23 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875425.1 protein_id gnl|my_center|LOCUS_12830 2183 1005 gene locus_tag LOCUS_12840 2183 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2362 3183 gene locus_tag LOCUS_12850 2362 3183 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 protein_id gnl|my_center|LOCUS_12850 4242 3190 gene locus_tag LOCUS_12860 4242 3190 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 protein_id gnl|my_center|LOCUS_12860 4310 4846 gene locus_tag LOCUS_12870 4310 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5588 4839 gene locus_tag LOCUS_12880 5588 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 6312 5578 gene locus_tag LOCUS_12890 6312 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108792.1 protein_id gnl|my_center|LOCUS_12890 7510 6302 gene locus_tag LOCUS_12900 7510 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 8601 7519 gene locus_tag LOCUS_12910 8601 7519 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546788.1 protein_id gnl|my_center|LOCUS_12910 9012 8662 gene locus_tag LOCUS_12920 9012 8662 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851707.1 protein_id gnl|my_center|LOCUS_12920 9985 8981 gene locus_tag LOCUS_12930 gene waaC 9985 8981 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684682.1 protein_id gnl|my_center|LOCUS_12930 10085 11794 gene locus_tag LOCUS_12940 10085 11794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858782.1 protein_id gnl|my_center|LOCUS_12940 11865 13232 gene locus_tag LOCUS_12950 gene hemN 11865 13232 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 protein_id gnl|my_center|LOCUS_12950 13232 14518 gene locus_tag LOCUS_12960 13232 14518 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 protein_id gnl|my_center|LOCUS_12960 14518 15336 gene locus_tag LOCUS_12970 gene lgt 14518 15336 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854600.1 protein_id gnl|my_center|LOCUS_12970 15842 15339 gene locus_tag LOCUS_12980 15842 15339 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_12980 16034 16636 gene locus_tag LOCUS_12990 16034 16636 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853249.1 protein_id gnl|my_center|LOCUS_12990 16658 17953 gene locus_tag LOCUS_13000 16658 17953 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063821.1 protein_id gnl|my_center|LOCUS_13000 17960 18667 gene locus_tag LOCUS_13010 gene truC 17960 18667 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 protein_id gnl|my_center|LOCUS_13010 18709 19152 gene locus_tag LOCUS_13020 18709 19152 CDS product CopD family copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338876.1 protein_id gnl|my_center|LOCUS_13020 20310 19171 gene locus_tag LOCUS_13030 20310 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 20450 21016 gene locus_tag LOCUS_13040 20450 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927105.1 protein_id gnl|my_center|LOCUS_13040 21554 21045 gene locus_tag LOCUS_13050 gene tpx 21554 21045 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_13050 21663 21893 gene locus_tag LOCUS_13060 21663 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 22285 21887 gene locus_tag LOCUS_13070 gene exbD 22285 21887 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836350.1 protein_id gnl|my_center|LOCUS_13070 22737 22288 gene locus_tag LOCUS_13080 gene exbB 22737 22288 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661840.1 protein_id gnl|my_center|LOCUS_13080 23567 22737 gene locus_tag LOCUS_13090 23567 22737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 24210 23557 gene locus_tag LOCUS_13100 gene dccR 24210 23557 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_13100 25210 24203 gene locus_tag LOCUS_13110 gene pyrC 25210 24203 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852008.1 protein_id gnl|my_center|LOCUS_13110 26582 25224 gene locus_tag LOCUS_13120 26582 25224 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355104.1 protein_id gnl|my_center|LOCUS_13120 26830 27243 gene locus_tag LOCUS_13130 26830 27243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 28770 27319 gene locus_tag LOCUS_13140 gene accC 28770 27319 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880952.1 protein_id gnl|my_center|LOCUS_13140 29031 28804 gene locus_tag LOCUS_13150 29031 28804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 29021 29911 gene locus_tag LOCUS_13160 29021 29911 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 protein_id gnl|my_center|LOCUS_13160 30062 32620 gene locus_tag LOCUS_13170 gene pepN 30062 32620 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443934.1 protein_id gnl|my_center|LOCUS_13170 32787 34256 gene locus_tag LOCUS_13180 32787 34256 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_13180 34284 34448 gene locus_tag LOCUS_13190 34284 34448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 34527 35339 gene locus_tag LOCUS_13200 34527 35339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 35352 38006 gene locus_tag LOCUS_13210 35352 38006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 38764 38003 gene locus_tag LOCUS_13220 38764 38003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 39857 38907 gene locus_tag LOCUS_13230 39857 38907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 40285 41103 gene locus_tag LOCUS_13240 40285 41103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 41226 42623 gene locus_tag LOCUS_13250 41226 42623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 42620 43108 gene locus_tag LOCUS_13260 42620 43108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 43095 43598 gene locus_tag LOCUS_13270 43095 43598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 43577 45049 gene locus_tag LOCUS_13280 gene mshL 43577 45049 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_13280 45046 46062 gene locus_tag LOCUS_13290 45046 46062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 46064 47182 gene locus_tag LOCUS_13300 46064 47182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 47192 48862 gene locus_tag LOCUS_13310 47192 48862 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546442.1 protein_id gnl|my_center|LOCUS_13310 48862 50067 gene locus_tag LOCUS_13320 48862 50067 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545964.1 protein_id gnl|my_center|LOCUS_13320 50155 50733 gene locus_tag LOCUS_13330 50155 50733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 51770 51282 gene locus_tag LOCUS_13340 51770 51282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 51918 51760 gene locus_tag LOCUS_13350 51918 51760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 53744 52026 gene locus_tag LOCUS_13360 53744 52026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 54088 54006 gene locus_tag LOCUS_t00240 54088 54006 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 54239 54640 gene locus_tag LOCUS_13370 54239 54640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 54637 54915 gene locus_tag LOCUS_13380 54637 54915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 54993 56117 gene locus_tag LOCUS_13390 54993 56117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 56114 56437 gene locus_tag LOCUS_13400 56114 56437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 56534 57664 gene locus_tag LOCUS_13410 56534 57664 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence11 704 189 gene locus_tag LOCUS_13420 704 189 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_13420 1771 776 gene locus_tag LOCUS_13430 1771 776 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_13430 3114 1768 gene locus_tag LOCUS_13440 3114 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3178 4518 gene locus_tag LOCUS_13450 gene nhaA 3178 4518 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_13450 4545 5648 gene locus_tag LOCUS_13460 4545 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5664 6011 gene locus_tag LOCUS_13470 5664 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 6173 6493 gene locus_tag LOCUS_13480 6173 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6490 7686 gene locus_tag LOCUS_13490 6490 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7683 8753 gene locus_tag LOCUS_13500 7683 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 8753 11824 gene locus_tag LOCUS_13510 8753 11824 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_13510 12914 11859 gene locus_tag LOCUS_13520 12914 11859 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_13520 13626 12940 gene locus_tag LOCUS_13530 13626 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 14433 14146 gene locus_tag LOCUS_13540 14433 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 15650 14517 gene locus_tag LOCUS_13550 15650 14517 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430586.1 protein_id gnl|my_center|LOCUS_13550 16308 15643 gene locus_tag LOCUS_13560 16308 15643 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356718.1 protein_id gnl|my_center|LOCUS_13560 16357 17109 gene locus_tag LOCUS_13570 gene exoX 16357 17109 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816172.1 protein_id gnl|my_center|LOCUS_13570 18487 17096 gene locus_tag LOCUS_13580 18487 17096 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_13580 19121 18477 gene locus_tag LOCUS_13590 19121 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 19163 19843 gene locus_tag LOCUS_13600 19163 19843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042721.1 protein_id gnl|my_center|LOCUS_13600 21411 19840 gene locus_tag LOCUS_13610 gene argS 21411 19840 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891916.1 protein_id gnl|my_center|LOCUS_13610 21690 21439 gene locus_tag LOCUS_13620 21690 21439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 22401 21781 gene locus_tag LOCUS_13630 gene gmk 22401 21781 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860253.1 protein_id gnl|my_center|LOCUS_13630 23957 22401 gene locus_tag LOCUS_13640 23957 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852900.1 protein_id gnl|my_center|LOCUS_13640 24771 24007 gene locus_tag LOCUS_13650 gene fliR 24771 24007 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852712.1 protein_id gnl|my_center|LOCUS_13650 25429 24785 gene locus_tag LOCUS_13660 25429 24785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588225.1 protein_id gnl|my_center|LOCUS_13660 26095 25490 gene locus_tag LOCUS_13670 26095 25490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 27382 26186 gene locus_tag LOCUS_13680 27382 26186 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938462.1 protein_id gnl|my_center|LOCUS_13680 28560 27508 gene locus_tag LOCUS_13690 gene tsf 28560 27508 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864836.1 protein_id gnl|my_center|LOCUS_13690 29339 28563 gene locus_tag LOCUS_13700 gene rpsB 29339 28563 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002892710.1 protein_id gnl|my_center|LOCUS_13700 29984 29517 gene locus_tag LOCUS_13710 gene bcp 29984 29517 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_13710 30583 30002 gene locus_tag LOCUS_13720 gene cybH 30583 30002 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853164.1 protein_id gnl|my_center|LOCUS_13720 31076 30609 gene locus_tag LOCUS_13730 31076 30609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 31681 31076 gene locus_tag LOCUS_13740 31681 31076 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_13740 32696 31674 gene locus_tag LOCUS_13750 gene murG 32696 31674 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_13750 33881 32718 gene locus_tag LOCUS_13760 33881 32718 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611797.1 protein_id gnl|my_center|LOCUS_13760 34406 33888 gene locus_tag LOCUS_13770 34406 33888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 34924 34403 gene locus_tag LOCUS_13780 34924 34403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 35781 34921 gene locus_tag LOCUS_13790 35781 34921 CDS product 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851905.1 protein_id gnl|my_center|LOCUS_13790 36942 35848 gene locus_tag LOCUS_13800 36942 35848 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_13800 37751 37071 gene locus_tag LOCUS_13810 gene arsR 37751 37071 CDS product acid response regulator transcription factor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573710.1 protein_id gnl|my_center|LOCUS_13810 38249 37770 gene locus_tag LOCUS_13820 38249 37770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 38716 38264 gene locus_tag LOCUS_13830 38716 38264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 40047 38824 gene locus_tag LOCUS_13840 40047 38824 CDS product sialate:H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900427.1 protein_id gnl|my_center|LOCUS_13840 41414 40047 gene locus_tag LOCUS_13850 41414 40047 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732612.1 protein_id gnl|my_center|LOCUS_13850 41630 42520 gene locus_tag LOCUS_13860 gene miaA 41630 42520 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080343057.1 protein_id gnl|my_center|LOCUS_13860 42917 42531 gene locus_tag LOCUS_13870 42917 42531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 43200 42910 gene locus_tag LOCUS_13880 43200 42910 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_13880 44290 43268 gene locus_tag LOCUS_13890 44290 43268 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_13890 45412 44357 gene locus_tag LOCUS_13900 45412 44357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 46137 45463 gene locus_tag LOCUS_13910 46137 45463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 47146 46496 gene locus_tag LOCUS_13920 47146 46496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 47637 47167 gene locus_tag LOCUS_13930 47637 47167 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_13930 48924 47662 gene locus_tag LOCUS_13940 gene arsB 48924 47662 CDS product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455949.1 protein_id gnl|my_center|LOCUS_13940 49229 48921 gene locus_tag LOCUS_13950 49229 48921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 51698 49338 gene locus_tag LOCUS_13960 51698 49338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 53233 51725 gene locus_tag LOCUS_13970 gene nuoN 53233 51725 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904307.1 protein_id gnl|my_center|LOCUS_13970 54786 53233 gene locus_tag LOCUS_13980 54786 53233 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 protein_id gnl|my_center|LOCUS_13980 <55893 54790 gene locus_tag LOCUS_13990 <55893 54790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001200192.1:NADH-quinone oxidoreductase subunit L >Feature sequence12 938 201 gene locus_tag LOCUS_14000 938 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2169 952 gene locus_tag LOCUS_14010 2169 952 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 protein_id gnl|my_center|LOCUS_14010 2580 2248 gene locus_tag LOCUS_14020 2580 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3576 2758 gene locus_tag LOCUS_14030 3576 2758 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694515.1 protein_id gnl|my_center|LOCUS_14030 4042 3824 gene locus_tag LOCUS_14040 4042 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4782 4051 gene locus_tag LOCUS_14050 4782 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 6764 4797 gene locus_tag LOCUS_14060 6764 4797 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 protein_id gnl|my_center|LOCUS_14060 8791 6782 gene locus_tag LOCUS_14070 8791 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 9453 8803 gene locus_tag LOCUS_14080 9453 8803 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024409.1 protein_id gnl|my_center|LOCUS_14080 10723 9515 gene locus_tag LOCUS_14090 10723 9515 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583929.1 protein_id gnl|my_center|LOCUS_14090 11450 10737 gene locus_tag LOCUS_14100 11450 10737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 11860 11447 gene locus_tag LOCUS_14110 gene exbD 11860 11447 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836350.1 protein_id gnl|my_center|LOCUS_14110 12297 11857 gene locus_tag LOCUS_14120 12297 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 13280 12300 gene locus_tag LOCUS_14130 13280 12300 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047958.1 protein_id gnl|my_center|LOCUS_14130 14097 13330 gene locus_tag LOCUS_14140 14097 13330 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927097.1 protein_id gnl|my_center|LOCUS_14140 14915 14094 gene locus_tag LOCUS_14150 gene modD 14915 14094 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814376.1 protein_id gnl|my_center|LOCUS_14150 15709 14930 gene locus_tag LOCUS_14160 15709 14930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_14160 16731 15700 gene locus_tag LOCUS_14170 16731 15700 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024407.1 protein_id gnl|my_center|LOCUS_14170 18977 16734 gene locus_tag LOCUS_14180 18977 16734 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933207.1 protein_id gnl|my_center|LOCUS_14180 19992 18970 gene locus_tag LOCUS_14190 19992 18970 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065059.1 protein_id gnl|my_center|LOCUS_14190 21145 20372 gene locus_tag LOCUS_14200 21145 20372 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_14200 21556 21480 gene locus_tag LOCUS_t00250 21556 21480 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22010 21732 gene locus_tag LOCUS_14210 22010 21732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 22936 22007 gene locus_tag LOCUS_14220 gene rsmH 22936 22007 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155571.1 protein_id gnl|my_center|LOCUS_14220 23372 23073 gene locus_tag LOCUS_14230 23372 23073 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101428.1 protein_id gnl|my_center|LOCUS_14230 24496 23390 gene locus_tag LOCUS_14240 24496 23390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 24975 24631 gene locus_tag LOCUS_14250 24975 24631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 26284 25052 gene locus_tag LOCUS_14260 26284 25052 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_14260 26431 26580 gene locus_tag LOCUS_14270 26431 26580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 27007 26654 gene locus_tag LOCUS_14280 27007 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 27166 27924 gene locus_tag LOCUS_14290 gene proC 27166 27924 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228245.1 protein_id gnl|my_center|LOCUS_14290 28388 27933 gene locus_tag LOCUS_14300 28388 27933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 29035 28397 gene locus_tag LOCUS_14310 29035 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 30566 29094 gene locus_tag LOCUS_14320 gene thrC 30566 29094 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852451.1 protein_id gnl|my_center|LOCUS_14320 31848 30616 gene locus_tag LOCUS_14330 31848 30616 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 protein_id gnl|my_center|LOCUS_14330 32657 31845 gene locus_tag LOCUS_14340 32657 31845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 33315 32644 gene locus_tag LOCUS_14350 33315 32644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 protein_id gnl|my_center|LOCUS_14350 34261 33308 gene locus_tag LOCUS_14360 34261 33308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14360 34480 34289 gene locus_tag LOCUS_14370 34480 34289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 35880 34492 gene locus_tag LOCUS_14380 35880 34492 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108527784.1 protein_id gnl|my_center|LOCUS_14380 36799 35828 gene locus_tag LOCUS_14390 36799 35828 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174316.1 protein_id gnl|my_center|LOCUS_14390 36849 37961 gene locus_tag LOCUS_14400 36849 37961 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 protein_id gnl|my_center|LOCUS_14400 38270 38194 gene locus_tag LOCUS_t00260 38270 38194 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 38367 38292 gene locus_tag LOCUS_t00270 38367 38292 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 38475 38400 gene locus_tag LOCUS_t00280 38475 38400 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 38578 38503 gene locus_tag LOCUS_t00290 38578 38503 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 38674 38598 gene locus_tag LOCUS_t00300 38674 38598 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 38764 38689 gene locus_tag LOCUS_t00310 38764 38689 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 39927 38839 gene locus_tag LOCUS_14410 39927 38839 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853490.1 protein_id gnl|my_center|LOCUS_14410 40052 42811 gene locus_tag LOCUS_14420 gene ileS 40052 42811 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907389.1 protein_id gnl|my_center|LOCUS_14420 42918 43307 gene locus_tag LOCUS_14430 42918 43307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 43676 44317 gene locus_tag LOCUS_14440 43676 44317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 44318 45505 gene locus_tag LOCUS_14450 44318 45505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 45571 45972 gene locus_tag LOCUS_14460 45571 45972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 46092 46364 gene locus_tag LOCUS_14470 46092 46364 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_14470 46361 46729 gene locus_tag LOCUS_14480 46361 46729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 47173 47682 gene locus_tag LOCUS_14490 47173 47682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 48255 49598 gene locus_tag LOCUS_14500 gene gatA 48255 49598 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631468.1 protein_id gnl|my_center|LOCUS_14500 49936 49670 gene locus_tag LOCUS_14510 49936 49670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 50060 50908 gene locus_tag LOCUS_14520 50060 50908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 51074 51358 gene locus_tag LOCUS_14530 51074 51358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 51375 52079 gene locus_tag LOCUS_14540 51375 52079 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_14540 52215 53660 gene locus_tag LOCUS_14550 gene guaB 52215 53660 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852968.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence13 871 200 gene locus_tag LOCUS_14560 871 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2836 1022 gene locus_tag LOCUS_14570 2836 1022 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_14570 4180 2846 gene locus_tag LOCUS_14580 4180 2846 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_14580 5461 4268 gene locus_tag LOCUS_14590 5461 4268 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_14590 6027 5458 gene locus_tag LOCUS_14600 6027 5458 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_14600 6416 6216 gene locus_tag LOCUS_14610 6416 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6638 6420 gene locus_tag LOCUS_14620 6638 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 6907 7071 gene locus_tag LOCUS_14630 6907 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 7523 7266 gene locus_tag LOCUS_14640 7523 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 8060 7923 gene locus_tag LOCUS_14650 8060 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 8271 8020 gene locus_tag LOCUS_14660 8271 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 11777 8655 gene locus_tag LOCUS_14670 11777 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 12812 12378 gene locus_tag LOCUS_14680 12812 12378 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653660.1 protein_id gnl|my_center|LOCUS_14680 13008 12802 gene locus_tag LOCUS_14690 13008 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 13668 13381 gene locus_tag LOCUS_14700 13668 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 13925 13674 gene locus_tag LOCUS_14710 13925 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 14477 14193 gene locus_tag LOCUS_14720 14477 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 14673 14467 gene locus_tag LOCUS_14730 14673 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 15744 14773 gene locus_tag LOCUS_14740 15744 14773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 16477 15959 gene locus_tag LOCUS_14750 16477 15959 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304752.1 protein_id gnl|my_center|LOCUS_14750 17843 16710 gene locus_tag LOCUS_14760 17843 16710 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083207.1 protein_id gnl|my_center|LOCUS_14760 19295 18093 gene locus_tag LOCUS_14770 19295 18093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 21167 19560 gene locus_tag LOCUS_14780 21167 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 22987 21251 gene locus_tag LOCUS_14790 22987 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 24200 23061 gene locus_tag LOCUS_14800 24200 23061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 27567 24205 gene locus_tag LOCUS_14810 27567 24205 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880674.1 protein_id gnl|my_center|LOCUS_14810 29153 27564 gene locus_tag LOCUS_14820 29153 27564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 30366 29140 gene locus_tag LOCUS_14830 30366 29140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930671.1 protein_id gnl|my_center|LOCUS_14830 31744 30590 gene locus_tag LOCUS_14840 31744 30590 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_14840 32633 31860 gene locus_tag LOCUS_14850 32633 31860 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_14850 34028 32634 gene locus_tag LOCUS_14860 34028 32634 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_14860 34159 35085 gene locus_tag LOCUS_14870 34159 35085 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853293.1 protein_id gnl|my_center|LOCUS_14870 35100 36890 gene locus_tag LOCUS_14880 gene lepA 35100 36890 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002837927.1 protein_id gnl|my_center|LOCUS_14880 36905 37480 gene locus_tag LOCUS_14890 36905 37480 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 protein_id gnl|my_center|LOCUS_14890 37530 39392 gene locus_tag LOCUS_14900 37530 39392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 39393 39824 gene locus_tag LOCUS_14910 39393 39824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 39818 41719 gene locus_tag LOCUS_14920 39818 41719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 43746 41734 gene locus_tag LOCUS_14930 43746 41734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 43931 44476 gene locus_tag LOCUS_14940 gene grpE 43931 44476 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780052.1 protein_id gnl|my_center|LOCUS_14940 44713 46593 gene locus_tag LOCUS_14950 gene dnaK 44713 46593 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826316.1 protein_id gnl|my_center|LOCUS_14950 46715 47689 gene locus_tag LOCUS_14960 46715 47689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 47923 49668 gene locus_tag LOCUS_14970 47923 49668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 49694 52093 gene locus_tag LOCUS_14980 49694 52093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 52090 53343 gene locus_tag LOCUS_14990 gene urtA 52090 53343 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889579.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence14 97 1107 gene locus_tag LOCUS_15000 97 1107 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312415.1 protein_id gnl|my_center|LOCUS_15000 1109 3811 gene locus_tag LOCUS_15010 gene rbbA 1109 3811 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_15010 3811 4932 gene locus_tag LOCUS_15020 3811 4932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974060.1 protein_id gnl|my_center|LOCUS_15020 5010 5372 gene locus_tag LOCUS_15030 5010 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15030 5384 5998 gene locus_tag LOCUS_15040 5384 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5995 7278 gene locus_tag LOCUS_15050 5995 7278 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023204.1 protein_id gnl|my_center|LOCUS_15050 7880 7281 gene locus_tag LOCUS_15060 7880 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 9011 7911 gene locus_tag LOCUS_15070 gene ychF 9011 7911 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 protein_id gnl|my_center|LOCUS_15070 9904 9095 gene locus_tag LOCUS_15080 9904 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 10236 9904 gene locus_tag LOCUS_15090 10236 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 11241 10273 gene locus_tag LOCUS_15100 11241 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 11938 11315 gene locus_tag LOCUS_15110 11938 11315 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464355.1 protein_id gnl|my_center|LOCUS_15110 12577 12038 gene locus_tag LOCUS_15120 12577 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 12920 12624 gene locus_tag LOCUS_15130 12920 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 13261 13001 gene locus_tag LOCUS_15140 13261 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 13820 13332 gene locus_tag LOCUS_15150 13820 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 14597 13836 gene locus_tag LOCUS_15160 gene zupT 14597 13836 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851840.1 protein_id gnl|my_center|LOCUS_15160 14796 15671 gene locus_tag LOCUS_15170 14796 15671 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 protein_id gnl|my_center|LOCUS_15170 15740 16267 gene locus_tag LOCUS_15180 15740 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 16264 16470 gene locus_tag LOCUS_15190 16264 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 16693 16460 gene locus_tag LOCUS_15200 16693 16460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 16936 17346 gene locus_tag LOCUS_15210 16936 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 17401 18429 gene locus_tag LOCUS_15220 17401 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 18798 18478 gene locus_tag LOCUS_15230 18798 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 19493 18795 gene locus_tag LOCUS_15240 19493 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 20185 19928 gene locus_tag LOCUS_15250 20185 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 20366 20587 gene locus_tag LOCUS_15260 20366 20587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 20588 20869 gene locus_tag LOCUS_15270 20588 20869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 21023 22021 gene locus_tag LOCUS_15280 gene gap 21023 22021 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780453.1 protein_id gnl|my_center|LOCUS_15280 22063 23706 gene locus_tag LOCUS_15290 gene glgP 22063 23706 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_15290 23720 24562 gene locus_tag LOCUS_15300 gene pfkA 23720 24562 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082880.1 protein_id gnl|my_center|LOCUS_15300 24767 27259 gene locus_tag LOCUS_15310 24767 27259 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880431.1 protein_id gnl|my_center|LOCUS_15310 27256 29292 gene locus_tag LOCUS_15320 27256 29292 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943867.1 protein_id gnl|my_center|LOCUS_15320 29364 32087 gene locus_tag LOCUS_15330 29364 32087 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244282.1 protein_id gnl|my_center|LOCUS_15330 32084 32470 gene locus_tag LOCUS_15340 32084 32470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 32567 33553 gene locus_tag LOCUS_15350 32567 33553 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_15350 33570 33719 gene locus_tag LOCUS_15360 33570 33719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 33716 35749 gene locus_tag LOCUS_15370 33716 35749 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_15370 35742 36761 gene locus_tag LOCUS_15380 gene galT 35742 36761 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_15380 36764 38161 gene locus_tag LOCUS_15390 36764 38161 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880433.1 protein_id gnl|my_center|LOCUS_15390 38158 38991 gene locus_tag LOCUS_15400 38158 38991 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_15400 38984 40465 gene locus_tag LOCUS_15410 38984 40465 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_15410 40476 42389 gene locus_tag LOCUS_15420 gene glgB 40476 42389 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_15420 42574 44136 gene locus_tag LOCUS_15430 42574 44136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 44150 45067 gene locus_tag LOCUS_15440 44150 45067 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_15440 45064 45765 gene locus_tag LOCUS_15450 45064 45765 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963400.1 protein_id gnl|my_center|LOCUS_15450 45762 46895 gene locus_tag LOCUS_15460 gene rffA 45762 46895 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612049.1 protein_id gnl|my_center|LOCUS_15460 46898 47260 gene locus_tag LOCUS_15470 46898 47260 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393953.1 protein_id gnl|my_center|LOCUS_15470 48107 47265 gene locus_tag LOCUS_15480 gene motB 48107 47265 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085308.1 protein_id gnl|my_center|LOCUS_15480 48385 48107 gene locus_tag LOCUS_15490 48385 48107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15490 48882 48520 gene locus_tag LOCUS_15500 48882 48520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15500 51383 49110 gene locus_tag LOCUS_15510 gene metE 51383 49110 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_15510 <52694 51785 gene locus_tag LOCUS_15520 <52694 51785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853317.1:leucyl aminopeptidase >Feature sequence15 <1 1136 gene locus_tag LOCUS_15530 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001145994.1:DDE transposase 1499 1119 gene locus_tag LOCUS_15540 1499 1119 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_15540 1656 4232 gene locus_tag LOCUS_15550 1656 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5157 4240 gene locus_tag LOCUS_15560 5157 4240 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073874.1 protein_id gnl|my_center|LOCUS_15560 5313 6359 gene locus_tag LOCUS_15570 5313 6359 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_15570 6361 9357 gene locus_tag LOCUS_15580 6361 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 9354 10757 gene locus_tag LOCUS_15590 gene cls 9354 10757 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016286.1 protein_id gnl|my_center|LOCUS_15590 10759 11490 gene locus_tag LOCUS_15600 10759 11490 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022781.1 protein_id gnl|my_center|LOCUS_15600 12116 11487 gene locus_tag LOCUS_15610 12116 11487 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694521.1 protein_id gnl|my_center|LOCUS_15610 13364 12162 gene locus_tag LOCUS_15620 13364 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 13475 14374 gene locus_tag LOCUS_15630 13475 14374 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 protein_id gnl|my_center|LOCUS_15630 14384 14821 gene locus_tag LOCUS_15640 14384 14821 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947613.1 protein_id gnl|my_center|LOCUS_15640 14849 15238 gene locus_tag LOCUS_15650 14849 15238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 16474 15227 gene locus_tag LOCUS_15660 16474 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 17148 16519 gene locus_tag LOCUS_15670 17148 16519 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853160.1 protein_id gnl|my_center|LOCUS_15670 18107 17157 gene locus_tag LOCUS_15680 gene hemH 18107 17157 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364269.1 protein_id gnl|my_center|LOCUS_15680 18811 18110 gene locus_tag LOCUS_15690 18811 18110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 21947 18822 gene locus_tag LOCUS_15700 gene ccsA 21947 18822 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_15700 22299 22012 gene locus_tag LOCUS_15710 22299 22012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 23337 22354 gene locus_tag LOCUS_15720 gene flgS 23337 22354 CDS product acid survival sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748581.1 protein_id gnl|my_center|LOCUS_15720 24863 23337 gene locus_tag LOCUS_15730 24863 23337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 29221 24866 gene locus_tag LOCUS_15740 29221 24866 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119947.1 protein_id gnl|my_center|LOCUS_15740 30588 29329 gene locus_tag LOCUS_15750 30588 29329 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267127.1 protein_id gnl|my_center|LOCUS_15750 32210 30642 gene locus_tag LOCUS_15760 32210 30642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 33233 32688 gene locus_tag LOCUS_15770 33233 32688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 35226 33460 gene locus_tag LOCUS_15780 gene dsbD 35226 33460 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_15780 35363 37294 gene locus_tag LOCUS_15790 35363 37294 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_15790 37308 38090 gene locus_tag LOCUS_15800 37308 38090 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_15800 38087 38998 gene locus_tag LOCUS_15810 gene pdxA 38087 38998 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853162.1 protein_id gnl|my_center|LOCUS_15810 39629 38991 gene locus_tag LOCUS_15820 39629 38991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 40316 39675 gene locus_tag LOCUS_15830 40316 39675 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_15830 40634 41500 gene locus_tag LOCUS_15840 40634 41500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 42390 41503 gene locus_tag LOCUS_15850 42390 41503 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_15850 42547 45282 gene locus_tag LOCUS_15860 42547 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 45272 46390 gene locus_tag LOCUS_15870 45272 46390 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_15870 47081 46392 gene locus_tag LOCUS_15880 47081 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 47707 47081 gene locus_tag LOCUS_15890 gene hisG 47707 47081 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_15890 48318 47701 gene locus_tag LOCUS_15900 48318 47701 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864777.1 protein_id gnl|my_center|LOCUS_15900 48638 48318 gene locus_tag LOCUS_15910 48638 48318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 48780 49748 gene locus_tag LOCUS_15920 48780 49748 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 protein_id gnl|my_center|LOCUS_15920 49830 51197 gene locus_tag LOCUS_15930 49830 51197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 51197 51985 gene locus_tag LOCUS_15940 51197 51985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence16 117 347 gene locus_tag LOCUS_15950 117 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 358 771 gene locus_tag LOCUS_15960 358 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 786 1451 gene locus_tag LOCUS_15970 786 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1438 3921 gene locus_tag LOCUS_15980 1438 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 4017 4205 gene locus_tag LOCUS_15990 4017 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 8925 4561 gene locus_tag LOCUS_16000 8925 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 9919 8939 gene locus_tag LOCUS_16010 9919 8939 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_16010 11502 9916 gene locus_tag LOCUS_16020 11502 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 11939 11574 gene locus_tag LOCUS_16030 11939 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 12355 12014 gene locus_tag LOCUS_16040 12355 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 12636 12560 gene locus_tag LOCUS_t00320 12636 12560 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12735 12661 gene locus_tag LOCUS_t00330 12735 12661 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12833 12757 gene locus_tag LOCUS_t00340 12833 12757 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12991 14019 gene locus_tag LOCUS_16050 12991 14019 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601458.1 protein_id gnl|my_center|LOCUS_16050 14054 14773 gene locus_tag LOCUS_16060 14054 14773 CDS product DUF695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016290.1 protein_id gnl|my_center|LOCUS_16060 14780 16597 gene locus_tag LOCUS_16070 14780 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 16600 17784 gene locus_tag LOCUS_16080 16600 17784 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852026.1 protein_id gnl|my_center|LOCUS_16080 17788 18936 gene locus_tag LOCUS_16090 gene nspC 17788 18936 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858431.1 protein_id gnl|my_center|LOCUS_16090 18948 19502 gene locus_tag LOCUS_16100 18948 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 21148 19556 gene locus_tag LOCUS_16110 21148 19556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 21832 21212 gene locus_tag LOCUS_16120 gene recO 21832 21212 CDS product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 protein_id gnl|my_center|LOCUS_16120 22010 26449 gene locus_tag LOCUS_16130 gene gltB 22010 26449 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461215.1 protein_id gnl|my_center|LOCUS_16130 26452 27837 gene locus_tag LOCUS_16140 26452 27837 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461217.1 protein_id gnl|my_center|LOCUS_16140 27973 28818 gene locus_tag LOCUS_16150 gene accD 27973 28818 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 protein_id gnl|my_center|LOCUS_16150 28818 29381 gene locus_tag LOCUS_16160 gene thiE 28818 29381 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_16160 29378 29836 gene locus_tag LOCUS_16170 29378 29836 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869860.1 protein_id gnl|my_center|LOCUS_16170 29846 30196 gene locus_tag LOCUS_16180 gene dksA 29846 30196 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_16180 30207 31223 gene locus_tag LOCUS_16190 30207 31223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 31236 32189 gene locus_tag LOCUS_16200 31236 32189 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851926.1 protein_id gnl|my_center|LOCUS_16200 32183 33319 gene locus_tag LOCUS_16210 32183 33319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 34212 33316 gene locus_tag LOCUS_16220 34212 33316 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889661.1 protein_id gnl|my_center|LOCUS_16220 34547 34209 gene locus_tag LOCUS_16230 34547 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 34970 34548 gene locus_tag LOCUS_16240 34970 34548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 35069 35800 gene locus_tag LOCUS_16250 35069 35800 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858695.1 protein_id gnl|my_center|LOCUS_16250 35817 38648 gene locus_tag LOCUS_16260 gene uvrA 35817 38648 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858721.1 protein_id gnl|my_center|LOCUS_16260 38661 39692 gene locus_tag LOCUS_16270 gene selD 38661 39692 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211671.1 protein_id gnl|my_center|LOCUS_16270 39693 40772 gene locus_tag LOCUS_16280 gene mnmH 39693 40772 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103288.1 protein_id gnl|my_center|LOCUS_16280 41952 40765 gene locus_tag LOCUS_16290 41952 40765 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_16290 42998 41937 gene locus_tag LOCUS_16300 gene lpxB 42998 41937 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142178.1 protein_id gnl|my_center|LOCUS_16300 43189 42995 gene locus_tag LOCUS_16310 43189 42995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 43632 43387 gene locus_tag LOCUS_16320 43632 43387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence17 579 1916 gene locus_tag LOCUS_16330 579 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2081 2566 gene locus_tag LOCUS_16340 2081 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5707 2693 gene locus_tag LOCUS_16350 5707 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 6873 5776 gene locus_tag LOCUS_16360 6873 5776 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858516.1 protein_id gnl|my_center|LOCUS_16360 7170 7421 gene locus_tag LOCUS_16370 7170 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 8203 7424 gene locus_tag LOCUS_16380 8203 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 9141 8200 gene locus_tag LOCUS_16390 9141 8200 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_16390 9707 9153 gene locus_tag LOCUS_16400 9707 9153 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_16400 9854 10000 gene locus_tag LOCUS_16410 9854 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 10030 10224 gene locus_tag LOCUS_16420 10030 10224 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933349.1 protein_id gnl|my_center|LOCUS_16420 10343 11668 gene locus_tag LOCUS_16430 10343 11668 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 protein_id gnl|my_center|LOCUS_16430 11726 11971 gene locus_tag LOCUS_16440 11726 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 11965 12300 gene locus_tag LOCUS_16450 gene mazF 11965 12300 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240418.1 protein_id gnl|my_center|LOCUS_16450 12449 12739 gene locus_tag LOCUS_16460 12449 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 12912 13406 gene locus_tag LOCUS_16470 12912 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 14926 13700 gene locus_tag LOCUS_16480 14926 13700 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_16480 15245 15060 gene locus_tag LOCUS_16490 15245 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 16476 15298 gene locus_tag LOCUS_16500 16476 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 17149 16463 gene locus_tag LOCUS_16510 gene dccR 17149 16463 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_16510 19390 17168 gene locus_tag LOCUS_16520 19390 17168 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 protein_id gnl|my_center|LOCUS_16520 19710 19381 gene locus_tag LOCUS_16530 19710 19381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 21023 19710 gene locus_tag LOCUS_16540 gene murC 21023 19710 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894779.1 protein_id gnl|my_center|LOCUS_16540 21529 21020 gene locus_tag LOCUS_16550 21529 21020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 22662 21517 gene locus_tag LOCUS_16560 22662 21517 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142409.1 protein_id gnl|my_center|LOCUS_16560 23251 22727 gene locus_tag LOCUS_16570 23251 22727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 23933 23262 gene locus_tag LOCUS_16580 23933 23262 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260915.1 protein_id gnl|my_center|LOCUS_16580 24727 23930 gene locus_tag LOCUS_16590 24727 23930 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853489.1 protein_id gnl|my_center|LOCUS_16590 25025 24777 gene locus_tag LOCUS_16600 25025 24777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 26124 25018 gene locus_tag LOCUS_16610 26124 25018 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_16610 27090 26173 gene locus_tag LOCUS_16620 27090 26173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 30197 27078 gene locus_tag LOCUS_16630 30197 27078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 31027 30197 gene locus_tag LOCUS_16640 31027 30197 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262176.1 protein_id gnl|my_center|LOCUS_16640 33472 31046 gene locus_tag LOCUS_16650 33472 31046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 34294 33473 gene locus_tag LOCUS_16660 34294 33473 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_16660 37815 34291 gene locus_tag LOCUS_16670 37815 34291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 38153 37815 gene locus_tag LOCUS_16680 38153 37815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence18 258 1328 gene locus_tag LOCUS_16690 258 1328 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858697.1 protein_id gnl|my_center|LOCUS_16690 1397 2608 gene locus_tag LOCUS_16700 gene lysA 1397 2608 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858733.1 protein_id gnl|my_center|LOCUS_16700 2610 3386 gene locus_tag LOCUS_16710 2610 3386 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858702.1 protein_id gnl|my_center|LOCUS_16710 3383 4477 gene locus_tag LOCUS_16720 gene pheA 3383 4477 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_16720 4464 5558 gene locus_tag LOCUS_16730 gene hisC 4464 5558 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 protein_id gnl|my_center|LOCUS_16730 5577 7292 gene locus_tag LOCUS_16740 gene fliF 5577 7292 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364750.1 protein_id gnl|my_center|LOCUS_16740 7308 8336 gene locus_tag LOCUS_16750 gene fliG 7308 8336 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_16750 8338 9126 gene locus_tag LOCUS_16760 gene fliH 8338 9126 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858748.1 protein_id gnl|my_center|LOCUS_16760 9136 10968 gene locus_tag LOCUS_16770 gene dxs 9136 10968 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858717.1 protein_id gnl|my_center|LOCUS_16770 10949 12064 gene locus_tag LOCUS_16780 10949 12064 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_16780 13308 12061 gene locus_tag LOCUS_16790 13308 12061 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_16790 13356 14615 gene locus_tag LOCUS_16800 gene pif1 13356 14615 CDS product ATP-dependent DNA helicase Pif1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853306.1 protein_id gnl|my_center|LOCUS_16800 15282 14686 gene locus_tag LOCUS_16810 15282 14686 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_16810 15492 16667 gene locus_tag LOCUS_16820 gene metK 15492 16667 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655178.1 protein_id gnl|my_center|LOCUS_16820 16819 17103 gene locus_tag LOCUS_16830 16819 17103 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_16830 17249 17662 gene locus_tag LOCUS_16840 gene ndk 17249 17662 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_16840 17711 18097 gene locus_tag LOCUS_16850 17711 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 18222 18371 gene locus_tag LOCUS_16860 gene rpmF 18222 18371 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858674.1 protein_id gnl|my_center|LOCUS_16860 18375 19373 gene locus_tag LOCUS_16870 gene plsX 18375 19373 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 protein_id gnl|my_center|LOCUS_16870 19373 20374 gene locus_tag LOCUS_16880 19373 20374 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_16880 20786 20421 gene locus_tag LOCUS_16890 20786 20421 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_16890 22559 20904 gene locus_tag LOCUS_16900 22559 20904 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 protein_id gnl|my_center|LOCUS_16900 22831 23028 gene locus_tag LOCUS_16910 22831 23028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 23034 23417 gene locus_tag LOCUS_16920 23034 23417 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 protein_id gnl|my_center|LOCUS_16920 23977 23420 gene locus_tag LOCUS_16930 gene pssA 23977 23420 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181527.1 protein_id gnl|my_center|LOCUS_16930 24134 25357 gene locus_tag LOCUS_16940 24134 25357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 25417 25656 gene locus_tag LOCUS_16950 25417 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 25653 27791 gene locus_tag LOCUS_16960 gene feoB 25653 27791 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_16960 27855 28517 gene locus_tag LOCUS_16970 27855 28517 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853196.1 protein_id gnl|my_center|LOCUS_16970 28536 29810 gene locus_tag LOCUS_16980 28536 29810 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_16980 29834 31255 gene locus_tag LOCUS_16990 gene mltF 29834 31255 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080546580.1 protein_id gnl|my_center|LOCUS_16990 31625 31290 gene locus_tag LOCUS_17000 gene rsfS 31625 31290 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858238.1 protein_id gnl|my_center|LOCUS_17000 32158 31610 gene locus_tag LOCUS_17010 gene nadD 32158 31610 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780449.1 protein_id gnl|my_center|LOCUS_17010 32225 33223 gene locus_tag LOCUS_17020 gene gap 32225 33223 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780453.1 protein_id gnl|my_center|LOCUS_17020 33232 34431 gene locus_tag LOCUS_17030 33232 34431 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891932.1 protein_id gnl|my_center|LOCUS_17030 34435 35142 gene locus_tag LOCUS_17040 34435 35142 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160988.1 protein_id gnl|my_center|LOCUS_17040 35161 35985 gene locus_tag LOCUS_17050 gene fabI 35161 35985 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780456.1 protein_id gnl|my_center|LOCUS_17050 36071 36733 gene locus_tag LOCUS_17060 36071 36733 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence19 <1 574 gene locus_tag LOCUS_17070 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941312.1:carbon-nitrogen hydrolase 584 1276 gene locus_tag LOCUS_17080 gene pfs 584 1276 CDS product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859787.1 protein_id gnl|my_center|LOCUS_17080 1293 2024 gene locus_tag LOCUS_17090 1293 2024 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 protein_id gnl|my_center|LOCUS_17090 2123 3379 gene locus_tag LOCUS_17100 2123 3379 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884428.1 protein_id gnl|my_center|LOCUS_17100 3361 4191 gene locus_tag LOCUS_17110 3361 4191 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176078.1 protein_id gnl|my_center|LOCUS_17110 4193 4675 gene locus_tag LOCUS_17120 4193 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4754 5845 gene locus_tag LOCUS_17130 4754 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 5838 6149 gene locus_tag LOCUS_17140 5838 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 6139 7314 gene locus_tag LOCUS_17150 6139 7314 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_17150 7314 7982 gene locus_tag LOCUS_17160 7314 7982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870305.1 protein_id gnl|my_center|LOCUS_17160 7982 8929 gene locus_tag LOCUS_17170 7982 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_17170 8940 9371 gene locus_tag LOCUS_17180 8940 9371 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458975.1 protein_id gnl|my_center|LOCUS_17180 9368 9997 gene locus_tag LOCUS_17190 9368 9997 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254634.1 protein_id gnl|my_center|LOCUS_17190 10557 10033 gene locus_tag LOCUS_17200 10557 10033 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963244.1 protein_id gnl|my_center|LOCUS_17200 11065 10568 gene locus_tag LOCUS_17210 11065 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 11904 11077 gene locus_tag LOCUS_17220 11904 11077 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808202.1 protein_id gnl|my_center|LOCUS_17220 12378 11914 gene locus_tag LOCUS_17230 12378 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 13003 12365 gene locus_tag LOCUS_17240 13003 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 13912 13007 gene locus_tag LOCUS_17250 gene napH 13912 13007 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925622.1 protein_id gnl|my_center|LOCUS_17250 14450 13944 gene locus_tag LOCUS_17260 14450 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 15090 14452 gene locus_tag LOCUS_17270 15090 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 15840 15100 gene locus_tag LOCUS_17280 gene napG 15840 15100 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_17280 17060 15843 gene locus_tag LOCUS_17290 17060 15843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 17865 17083 gene locus_tag LOCUS_17300 17865 17083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 20640 18040 gene locus_tag LOCUS_17310 20640 18040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 21703 20747 gene locus_tag LOCUS_17320 21703 20747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 22375 21707 gene locus_tag LOCUS_17330 22375 21707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 22807 22379 gene locus_tag LOCUS_17340 22807 22379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 24015 22897 gene locus_tag LOCUS_17350 gene ftsZ 24015 22897 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 protein_id gnl|my_center|LOCUS_17350 25385 24027 gene locus_tag LOCUS_17360 gene ftsA 25385 24027 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_17360 26853 25387 gene locus_tag LOCUS_17370 26853 25387 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574070.1 protein_id gnl|my_center|LOCUS_17370 27023 27376 gene locus_tag LOCUS_17380 27023 27376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 27383 28681 gene locus_tag LOCUS_17390 27383 28681 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106128.1 protein_id gnl|my_center|LOCUS_17390 29268 28678 gene locus_tag LOCUS_17400 29268 28678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 29676 29320 gene locus_tag LOCUS_17410 29676 29320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 29769 30245 gene locus_tag LOCUS_17420 29769 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 30248 30601 gene locus_tag LOCUS_17430 30248 30601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 31729 30605 gene locus_tag LOCUS_17440 gene dnaJ 31729 30605 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853203.1 protein_id gnl|my_center|LOCUS_17440 31887 32909 gene locus_tag LOCUS_17450 31887 32909 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_17450 32906 33475 gene locus_tag LOCUS_17460 gene recR 32906 33475 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099619.1 protein_id gnl|my_center|LOCUS_17460 33478 34260 gene locus_tag LOCUS_17470 33478 34260 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 protein_id gnl|my_center|LOCUS_17470 34263 34865 gene locus_tag LOCUS_17480 34263 34865 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence20 1167 922 gene locus_tag LOCUS_17490 1167 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1312 1617 gene locus_tag LOCUS_17500 1312 1617 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 protein_id gnl|my_center|LOCUS_17500 1655 1963 gene locus_tag LOCUS_17510 1655 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2635 2132 gene locus_tag LOCUS_17520 2635 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4634 2742 gene locus_tag LOCUS_17530 gene htpG 4634 2742 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 protein_id gnl|my_center|LOCUS_17530 4803 5132 gene locus_tag LOCUS_17540 4803 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6505 5108 gene locus_tag LOCUS_17550 6505 5108 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_17550 6610 8547 gene locus_tag LOCUS_17560 6610 8547 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 protein_id gnl|my_center|LOCUS_17560 10032 8683 gene locus_tag LOCUS_17570 10032 8683 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766790.1 protein_id gnl|my_center|LOCUS_17570 10675 10184 gene locus_tag LOCUS_17580 10675 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 10896 11807 gene locus_tag LOCUS_17590 10896 11807 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880121.1 protein_id gnl|my_center|LOCUS_17590 11807 12457 gene locus_tag LOCUS_17600 11807 12457 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858643.1 protein_id gnl|my_center|LOCUS_17600 12457 12933 gene locus_tag LOCUS_17610 12457 12933 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_17610 12945 14459 gene locus_tag LOCUS_17620 gene lysS 12945 14459 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858694.1 protein_id gnl|my_center|LOCUS_17620 14536 15783 gene locus_tag LOCUS_17630 14536 15783 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_17630 15796 16338 gene locus_tag LOCUS_17640 15796 16338 CDS product DUF1882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138087.1 protein_id gnl|my_center|LOCUS_17640 16436 17146 gene locus_tag LOCUS_17650 16436 17146 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864776.1 protein_id gnl|my_center|LOCUS_17650 17197 18600 gene locus_tag LOCUS_17660 gene trpE 17197 18600 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_17660 18601 19392 gene locus_tag LOCUS_17670 18601 19392 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 protein_id gnl|my_center|LOCUS_17670 21600 19372 gene locus_tag LOCUS_17680 gene hypF 21600 19372 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_17680 21944 21603 gene locus_tag LOCUS_17690 gene hypA 21944 21603 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880634.1 protein_id gnl|my_center|LOCUS_17690 22936 21944 gene locus_tag LOCUS_17700 gene hypE 22936 21944 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072154.1 protein_id gnl|my_center|LOCUS_17700 24014 22929 gene locus_tag LOCUS_17710 24014 22929 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766357.1 protein_id gnl|my_center|LOCUS_17710 25074 24046 gene locus_tag LOCUS_17720 25074 24046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 27035 25071 gene locus_tag LOCUS_17730 27035 25071 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014220075.1 protein_id gnl|my_center|LOCUS_17730 27465 27100 gene locus_tag LOCUS_17740 27465 27100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 27772 27458 gene locus_tag LOCUS_17750 27772 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 28496 27816 gene locus_tag LOCUS_17760 28496 27816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 28991 28500 gene locus_tag LOCUS_17770 gene sixA 28991 28500 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_17770 30014 28995 gene locus_tag LOCUS_17780 30014 28995 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_17780 30124 30597 gene locus_tag LOCUS_17790 gene hoxE 30124 30597 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943357.1 protein_id gnl|my_center|LOCUS_17790 30594 32213 gene locus_tag LOCUS_17800 30594 32213 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_17800 32206 32922 gene locus_tag LOCUS_17810 gene hoxU 32206 32922 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_17810 33549 33277 gene locus_tag LOCUS_17820 33549 33277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 33773 33546 gene locus_tag LOCUS_17830 33773 33546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence21 2511 2050 gene locus_tag LOCUS_17840 2511 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 4506 2593 gene locus_tag LOCUS_17850 4506 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 7291 4736 gene locus_tag LOCUS_17860 7291 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 8558 7479 gene locus_tag LOCUS_17870 8558 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 8798 9055 gene locus_tag LOCUS_17880 8798 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 9079 10488 gene locus_tag LOCUS_17890 gene omp50 9079 10488 CDS product outer membrane tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891915.1 protein_id gnl|my_center|LOCUS_17890 10511 12409 gene locus_tag LOCUS_17900 10511 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 12442 14082 gene locus_tag LOCUS_17910 12442 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 14307 16001 gene locus_tag LOCUS_17920 14307 16001 CDS product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070885.1 protein_id gnl|my_center|LOCUS_17920 16032 17225 gene locus_tag LOCUS_17930 16032 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 17228 19390 gene locus_tag LOCUS_17940 17228 19390 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 protein_id gnl|my_center|LOCUS_17940 19402 20859 gene locus_tag LOCUS_17950 19402 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 20856 21167 gene locus_tag LOCUS_17960 20856 21167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 21276 22655 gene locus_tag LOCUS_17970 21276 22655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 22652 23950 gene locus_tag LOCUS_17980 22652 23950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 23940 24755 gene locus_tag LOCUS_17990 23940 24755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 24757 26853 gene locus_tag LOCUS_18000 24757 26853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 26925 28094 gene locus_tag LOCUS_18010 26925 28094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 28107 28784 gene locus_tag LOCUS_18020 gene dccR 28107 28784 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_18020 28946 29464 gene locus_tag LOCUS_18030 28946 29464 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_18030 29467 31020 gene locus_tag LOCUS_18040 29467 31020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 32414 31209 gene locus_tag LOCUS_18050 32414 31209 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence22 <1 676 gene locus_tag LOCUS_18060 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080204.1:thiamine pyrophosphate-dependent enzyme 968 1096 gene locus_tag LOCUS_18070 968 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1105 1812 gene locus_tag LOCUS_18080 1105 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1900 4011 gene locus_tag LOCUS_18090 1900 4011 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385039.1 protein_id gnl|my_center|LOCUS_18090 4086 4577 gene locus_tag LOCUS_18100 gene ftnA 4086 4577 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467599.1 protein_id gnl|my_center|LOCUS_18100 4809 4615 gene locus_tag LOCUS_18110 4809 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5154 4813 gene locus_tag LOCUS_18120 5154 4813 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855637.1 protein_id gnl|my_center|LOCUS_18120 5328 5164 gene locus_tag LOCUS_18130 5328 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 6799 5489 gene locus_tag LOCUS_18140 gene glmU 6799 5489 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862579.1 protein_id gnl|my_center|LOCUS_18140 7000 7740 gene locus_tag LOCUS_18150 gene fliP 7000 7740 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_18150 7756 8880 gene locus_tag LOCUS_18160 gene trmA 7756 8880 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113457.1 protein_id gnl|my_center|LOCUS_18160 8877 9113 gene locus_tag LOCUS_18170 8877 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 9110 10516 gene locus_tag LOCUS_18180 9110 10516 CDS product COG3400 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857878.1 protein_id gnl|my_center|LOCUS_18180 10951 12465 gene locus_tag LOCUS_18190 10951 12465 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880708.1 protein_id gnl|my_center|LOCUS_18190 12617 13666 gene locus_tag LOCUS_18200 gene aroB 12617 13666 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156090.1 protein_id gnl|my_center|LOCUS_18200 13666 15312 gene locus_tag LOCUS_18210 13666 15312 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218141.1 protein_id gnl|my_center|LOCUS_18210 15313 16560 gene locus_tag LOCUS_18220 gene mtaB 15313 16560 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_18220 16547 18196 gene locus_tag LOCUS_18230 16547 18196 CDS product ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852990.1 protein_id gnl|my_center|LOCUS_18230 18183 18707 gene locus_tag LOCUS_18240 18183 18707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 18718 19248 gene locus_tag LOCUS_18250 gene mog 18718 19248 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_18250 19868 19278 gene locus_tag LOCUS_18260 19868 19278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 20454 20140 gene locus_tag LOCUS_18270 20454 20140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 21080 20859 gene locus_tag LOCUS_18280 gene relE3 21080 20859 CDS product type II toxin-antitoxin system toxin RelE3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870615.1 protein_id gnl|my_center|LOCUS_18280 21332 21132 gene locus_tag LOCUS_18290 21332 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 21890 21426 gene locus_tag LOCUS_18300 21890 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 22264 21965 gene locus_tag LOCUS_18310 22264 21965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 22509 22267 gene locus_tag LOCUS_18320 22509 22267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 22997 22677 gene locus_tag LOCUS_18330 22997 22677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 23963 23076 gene locus_tag LOCUS_18340 23963 23076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 24305 24051 gene locus_tag LOCUS_18350 24305 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 24605 25567 gene locus_tag LOCUS_18360 24605 25567 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_18360 26495 25614 gene locus_tag LOCUS_18370 26495 25614 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933695.1 protein_id gnl|my_center|LOCUS_18370 27484 26507 gene locus_tag LOCUS_18380 27484 26507 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_18380 29206 27494 gene locus_tag LOCUS_18390 gene sdhA 29206 27494 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727811.1 protein_id gnl|my_center|LOCUS_18390 30592 29393 gene locus_tag LOCUS_18400 30592 29393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 30681 31499 gene locus_tag LOCUS_18410 30681 31499 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130232873.1 protein_id gnl|my_center|LOCUS_18410 31512 32588 gene locus_tag LOCUS_18420 gene truD 31512 32588 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052415.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence23 861 85 gene locus_tag LOCUS_18430 861 85 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688976.1 protein_id gnl|my_center|LOCUS_18430 998 2191 gene locus_tag LOCUS_18440 998 2191 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_18440 2726 2175 gene locus_tag LOCUS_18450 2726 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2884 4980 gene locus_tag LOCUS_18460 2884 4980 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_18460 4997 5149 gene locus_tag LOCUS_18470 gene nrdD 4997 5149 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389030.1 protein_id gnl|my_center|LOCUS_18470 5112 5813 gene locus_tag LOCUS_18480 5112 5813 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_18480 5859 7562 gene locus_tag LOCUS_18490 5859 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 8226 7549 gene locus_tag LOCUS_18500 8226 7549 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_18500 9427 8216 gene locus_tag LOCUS_18510 9427 8216 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 protein_id gnl|my_center|LOCUS_18510 12154 9434 gene locus_tag LOCUS_18520 gene polA 12154 9434 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858644.1 protein_id gnl|my_center|LOCUS_18520 12963 12151 gene locus_tag LOCUS_18530 12963 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 13726 13013 gene locus_tag LOCUS_18540 13726 13013 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851528.1 protein_id gnl|my_center|LOCUS_18540 14208 13738 gene locus_tag LOCUS_18550 14208 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 14777 14298 gene locus_tag LOCUS_18560 14777 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 15601 14774 gene locus_tag LOCUS_18570 gene xerD 15601 14774 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_18570 16598 15603 gene locus_tag LOCUS_18580 16598 15603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 17190 16603 gene locus_tag LOCUS_18590 17190 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 17320 17610 gene locus_tag LOCUS_18600 gene gatC 17320 17610 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165207.1 protein_id gnl|my_center|LOCUS_18600 17615 18694 gene locus_tag LOCUS_18610 17615 18694 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_18610 18745 21060 gene locus_tag LOCUS_18620 gene opgB 18745 21060 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704310.1 protein_id gnl|my_center|LOCUS_18620 21572 21315 gene locus_tag LOCUS_18630 21572 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 22593 21658 gene locus_tag LOCUS_18640 22593 21658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 23189 23004 gene locus_tag LOCUS_18650 23189 23004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 24349 23354 gene locus_tag LOCUS_18660 24349 23354 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256047.1 protein_id gnl|my_center|LOCUS_18660 25541 24339 gene locus_tag LOCUS_18670 25541 24339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 26682 25498 gene locus_tag LOCUS_18680 26682 25498 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459301.1 protein_id gnl|my_center|LOCUS_18680 28412 26679 gene locus_tag LOCUS_18690 28412 26679 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877176.1 protein_id gnl|my_center|LOCUS_18690 29202 28405 gene locus_tag LOCUS_18700 29202 28405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 29336 30283 gene locus_tag LOCUS_18710 gene cheV1 29336 30283 CDS product chemotaxis protein CheV1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785454.1 protein_id gnl|my_center|LOCUS_18710 31657 30323 gene locus_tag LOCUS_18720 31657 30323 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_18720 <32502 31662 gene locus_tag LOCUS_18730 <32502 31662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858311.1:biotin attachment protein >Feature sequence24 6 1985 gene locus_tag LOCUS_18740 6 1985 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942370.1 protein_id gnl|my_center|LOCUS_18740 2290 2006 gene locus_tag LOCUS_18750 2290 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2532 2287 gene locus_tag LOCUS_18760 2532 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2894 3205 gene locus_tag LOCUS_18770 2894 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4634 3543 gene locus_tag LOCUS_18780 4634 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 5760 4585 gene locus_tag LOCUS_18790 5760 4585 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883155.1 protein_id gnl|my_center|LOCUS_18790 6224 6415 gene locus_tag LOCUS_18800 6224 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 6613 6831 gene locus_tag LOCUS_18810 6613 6831 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558414.1 protein_id gnl|my_center|LOCUS_18810 7005 7280 gene locus_tag LOCUS_18820 7005 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 8402 7296 gene locus_tag LOCUS_18830 8402 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 8522 9790 gene locus_tag LOCUS_18840 gene coaBC 8522 9790 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009984.1 protein_id gnl|my_center|LOCUS_18840 9879 10556 gene locus_tag LOCUS_18850 9879 10556 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_18850 10556 11371 gene locus_tag LOCUS_18860 10556 11371 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_18860 11371 12390 gene locus_tag LOCUS_18870 11371 12390 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852624.1 protein_id gnl|my_center|LOCUS_18870 12391 13101 gene locus_tag LOCUS_18880 gene truA 12391 13101 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852636.1 protein_id gnl|my_center|LOCUS_18880 13147 13881 gene locus_tag LOCUS_18890 13147 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 14158 15681 gene locus_tag LOCUS_18900 14158 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 16149 15718 gene locus_tag LOCUS_18910 16149 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 18343 16322 gene locus_tag LOCUS_18920 gene glyS 18343 16322 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858294.1 protein_id gnl|my_center|LOCUS_18920 18512 18898 gene locus_tag LOCUS_18930 18512 18898 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870246.1 protein_id gnl|my_center|LOCUS_18930 21105 18940 gene locus_tag LOCUS_18940 21105 18940 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 protein_id gnl|my_center|LOCUS_18940 21378 22025 gene locus_tag LOCUS_18950 gene dccR 21378 22025 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_18950 22012 23157 gene locus_tag LOCUS_18960 gene crdS 22012 23157 CDS product copper-sensing histidine kinase CrdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951935.1 protein_id gnl|my_center|LOCUS_18960 23702 23154 gene locus_tag LOCUS_18970 23702 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 24141 23713 gene locus_tag LOCUS_18980 24141 23713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 26152 24221 gene locus_tag LOCUS_18990 26152 24221 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_18990 27817 26240 gene locus_tag LOCUS_19000 27817 26240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 28180 28058 gene locus_tag LOCUS_19010 28180 28058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 29306 28242 gene locus_tag LOCUS_19020 29306 28242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 29651 29400 gene locus_tag LOCUS_19030 29651 29400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 29829 29641 gene locus_tag LOCUS_19040 29829 29641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 30156 30758 gene locus_tag LOCUS_19050 gene udg 30156 30758 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence25 2023 1499 gene locus_tag LOCUS_19060 gene greA 2023 1499 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031337.1 protein_id gnl|my_center|LOCUS_19060 2360 2034 gene locus_tag LOCUS_19070 2360 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2483 3280 gene locus_tag LOCUS_19080 gene cheP 2483 3280 CDS product cheVAW transcriptional regulator CheP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851703.1 protein_id gnl|my_center|LOCUS_19080 3289 5235 gene locus_tag LOCUS_19090 3289 5235 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 protein_id gnl|my_center|LOCUS_19090 5238 6200 gene locus_tag LOCUS_19100 5238 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 6363 6581 gene locus_tag LOCUS_19110 6363 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 6880 6635 gene locus_tag LOCUS_19120 6880 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 7529 7287 gene locus_tag LOCUS_19130 7529 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 10526 7701 gene locus_tag LOCUS_19140 10526 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 10985 11209 gene locus_tag LOCUS_19150 10985 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 11206 11469 gene locus_tag LOCUS_19160 gene yoeB 11206 11469 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_19160 11727 11482 gene locus_tag LOCUS_19170 11727 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 12963 11824 gene locus_tag LOCUS_19180 12963 11824 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095144.1 protein_id gnl|my_center|LOCUS_19180 13208 13029 gene locus_tag LOCUS_19190 13208 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 13926 13438 gene locus_tag LOCUS_19200 13926 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 14189 14114 gene locus_tag LOCUS_t00350 14189 14114 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14470 14394 gene locus_tag LOCUS_t00360 14470 14394 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14754 14536 gene locus_tag LOCUS_19210 14754 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 14991 14764 gene locus_tag LOCUS_19220 14991 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 15333 15085 gene locus_tag LOCUS_19230 15333 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 15543 15983 gene locus_tag LOCUS_19240 15543 15983 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334532.1 protein_id gnl|my_center|LOCUS_19240 15992 16924 gene locus_tag LOCUS_19250 gene rimK 15992 16924 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_19250 16936 17967 gene locus_tag LOCUS_19260 16936 17967 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 protein_id gnl|my_center|LOCUS_19260 17964 19403 gene locus_tag LOCUS_19270 17964 19403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 19413 20198 gene locus_tag LOCUS_19280 gene corA 19413 20198 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 protein_id gnl|my_center|LOCUS_19280 20399 20268 gene locus_tag LOCUS_19290 20399 20268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 20568 21446 gene locus_tag LOCUS_19300 20568 21446 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_19300 21466 22002 gene locus_tag LOCUS_19310 21466 22002 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 protein_id gnl|my_center|LOCUS_19310 22129 24558 gene locus_tag LOCUS_19320 22129 24558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 25197 24628 gene locus_tag LOCUS_19330 25197 24628 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528397.1 protein_id gnl|my_center|LOCUS_19330 25417 27390 gene locus_tag LOCUS_19340 gene uvrB 25417 27390 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855027.1 protein_id gnl|my_center|LOCUS_19340 27443 28006 gene locus_tag LOCUS_19350 27443 28006 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856055.1 protein_id gnl|my_center|LOCUS_19350 29600 28014 gene locus_tag LOCUS_19360 gene pckA 29600 28014 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 protein_id gnl|my_center|LOCUS_19360 29764 29839 gene locus_tag LOCUS_t00370 29764 29839 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <30450 29810 gene locus_tag LOCUS_19370 <30450 29810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005693280.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence26 674 264 gene locus_tag LOCUS_19380 674 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1450 674 gene locus_tag LOCUS_19390 1450 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1946 1692 gene locus_tag LOCUS_19400 1946 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2113 2583 gene locus_tag LOCUS_19410 2113 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2589 3020 gene locus_tag LOCUS_19420 2589 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3049 3543 gene locus_tag LOCUS_19430 3049 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4642 3446 gene locus_tag LOCUS_19440 4642 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 5574 5230 gene locus_tag LOCUS_19450 5574 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 6799 5717 gene locus_tag LOCUS_19460 6799 5717 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939045.1 protein_id gnl|my_center|LOCUS_19460 7049 7402 gene locus_tag LOCUS_19470 7049 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 8780 7419 gene locus_tag LOCUS_19480 gene mgtE 8780 7419 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_19480 9233 8796 gene locus_tag LOCUS_19490 gene rimI 9233 8796 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208657.1 protein_id gnl|my_center|LOCUS_19490 10210 9230 gene locus_tag LOCUS_19500 10210 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 10488 10562 gene locus_tag LOCUS_t00380 10488 10562 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11191 10700 gene locus_tag LOCUS_19510 11191 10700 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 protein_id gnl|my_center|LOCUS_19510 12650 11205 gene locus_tag LOCUS_19520 12650 11205 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191311.1 protein_id gnl|my_center|LOCUS_19520 13387 12650 gene locus_tag LOCUS_19530 13387 12650 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852645.1 protein_id gnl|my_center|LOCUS_19530 14424 13387 gene locus_tag LOCUS_19540 14424 13387 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852516.1 protein_id gnl|my_center|LOCUS_19540 15006 14440 gene locus_tag LOCUS_19550 gene ruvA 15006 14440 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635172.1 protein_id gnl|my_center|LOCUS_19550 16907 15003 gene locus_tag LOCUS_19560 16907 15003 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852626.1 protein_id gnl|my_center|LOCUS_19560 17164 16958 gene locus_tag LOCUS_19570 17164 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 17413 17204 gene locus_tag LOCUS_19580 17413 17204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 17427 18416 gene locus_tag LOCUS_19590 17427 18416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 18403 19803 gene locus_tag LOCUS_19600 gene cysS 18403 19803 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471359.1 protein_id gnl|my_center|LOCUS_19600 20999 19800 gene locus_tag LOCUS_19610 20999 19800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 21086 21811 gene locus_tag LOCUS_19620 21086 21811 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19620 22597 22040 gene locus_tag LOCUS_19630 22597 22040 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852508.1 protein_id gnl|my_center|LOCUS_19630 22740 23798 gene locus_tag LOCUS_19640 22740 23798 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_19640 23795 25093 gene locus_tag LOCUS_19650 23795 25093 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 protein_id gnl|my_center|LOCUS_19650 25378 25734 gene locus_tag LOCUS_19660 25378 25734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941371.1 protein_id gnl|my_center|LOCUS_19660 25880 26773 gene locus_tag LOCUS_19670 gene dapA 25880 26773 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852574.1 protein_id gnl|my_center|LOCUS_19670 26774 27541 gene locus_tag LOCUS_19680 26774 27541 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891889.1 protein_id gnl|my_center|LOCUS_19680 27609 28511 gene locus_tag LOCUS_19690 27609 28511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 28574 29107 gene locus_tag LOCUS_19700 28574 29107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 29816 29145 gene locus_tag LOCUS_19710 29816 29145 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852254.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence27 993 658 gene locus_tag LOCUS_19720 993 658 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096894.1 protein_id gnl|my_center|LOCUS_19720 2048 1176 gene locus_tag LOCUS_19730 gene sucD 2048 1176 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002872006.1 protein_id gnl|my_center|LOCUS_19730 3236 2061 gene locus_tag LOCUS_19740 gene sucC 3236 2061 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858590.1 protein_id gnl|my_center|LOCUS_19740 4696 3305 gene locus_tag LOCUS_19750 gene fumC 4696 3305 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160526.1 protein_id gnl|my_center|LOCUS_19750 5660 4701 gene locus_tag LOCUS_19760 gene mdh 5660 4701 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_19760 8054 5859 gene locus_tag LOCUS_19770 8054 5859 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_19770 9138 8194 gene locus_tag LOCUS_19780 gene mltG 9138 8194 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859067.1 protein_id gnl|my_center|LOCUS_19780 9068 12226 gene locus_tag LOCUS_19790 9068 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 13440 12238 gene locus_tag LOCUS_19800 13440 12238 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 protein_id gnl|my_center|LOCUS_19800 16013 13437 gene locus_tag LOCUS_19810 gene secA 16013 13437 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858134.1 protein_id gnl|my_center|LOCUS_19810 16187 16702 gene locus_tag LOCUS_19820 16187 16702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 19068 16699 gene locus_tag LOCUS_19830 19068 16699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 21734 19185 gene locus_tag LOCUS_19840 gene acnB 21734 19185 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932230.1 protein_id gnl|my_center|LOCUS_19840 22248 21847 gene locus_tag LOCUS_19850 22248 21847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 24458 22248 gene locus_tag LOCUS_19860 24458 22248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 27061 24587 gene locus_tag LOCUS_19870 gene flgL 27061 24587 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852538.1 protein_id gnl|my_center|LOCUS_19870 27188 27271 gene locus_tag LOCUS_t00390 27188 27271 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27764 28644 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttgaaccgacacatgtgatgtatttaaac >Feature sequence28 <1 4667 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttgaaccgacacatgtgatgtatttaaac 5130 4819 gene locus_tag LOCUS_19880 gene cas2 5130 4819 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_19880 6131 5127 gene locus_tag LOCUS_19890 gene cas1b 6131 5127 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_19890 6628 6140 gene locus_tag LOCUS_19900 gene cas4 6628 6140 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023578.1 protein_id gnl|my_center|LOCUS_19900 7437 6625 gene locus_tag LOCUS_19910 7437 6625 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_19910 9856 7454 gene locus_tag LOCUS_19920 9856 7454 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_19920 14745 9853 gene locus_tag LOCUS_19930 14745 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 18319 14738 gene locus_tag LOCUS_19940 18319 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 19107 18343 gene locus_tag LOCUS_19950 19107 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 20004 19111 gene locus_tag LOCUS_19960 20004 19111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 20689 20006 gene locus_tag LOCUS_19970 20689 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 22143 20686 gene locus_tag LOCUS_19980 22143 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 23869 22145 gene locus_tag LOCUS_19990 23869 22145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 24582 23866 gene locus_tag LOCUS_20000 gene cas6 24582 23866 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986678.1 protein_id gnl|my_center|LOCUS_20000 24803 24588 gene locus_tag LOCUS_20010 24803 24588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 25397 24897 gene locus_tag LOCUS_20020 25397 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence29 1435 2844 gene locus_tag LOCUS_20030 1435 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 4010 2841 gene locus_tag LOCUS_20040 4010 2841 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967300.1 protein_id gnl|my_center|LOCUS_20040 4759 4058 gene locus_tag LOCUS_20050 gene cysE 4759 4058 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852612.1 protein_id gnl|my_center|LOCUS_20050 6598 4769 gene locus_tag LOCUS_20060 gene speA 6598 4769 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891885.1 protein_id gnl|my_center|LOCUS_20060 8335 6608 gene locus_tag LOCUS_20070 8335 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 9547 8336 gene locus_tag LOCUS_20080 gene hisS 9547 8336 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 protein_id gnl|my_center|LOCUS_20080 10544 9969 gene locus_tag LOCUS_20090 10544 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 10848 10609 gene locus_tag LOCUS_20100 10848 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 11151 10879 gene locus_tag LOCUS_20110 11151 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 14390 11217 gene locus_tag LOCUS_20120 14390 11217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 14815 14405 gene locus_tag LOCUS_20130 14815 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 15554 14886 gene locus_tag LOCUS_20140 15554 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 18460 15554 gene locus_tag LOCUS_20150 18460 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 18621 19298 gene locus_tag LOCUS_20160 gene sodB 18621 19298 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 protein_id gnl|my_center|LOCUS_20160 19319 20221 gene locus_tag LOCUS_20170 19319 20221 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943923.1 protein_id gnl|my_center|LOCUS_20170 20769 20218 gene locus_tag LOCUS_20180 20769 20218 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_20180 21545 20835 gene locus_tag LOCUS_20190 21545 20835 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185849.1 protein_id gnl|my_center|LOCUS_20190 22308 21628 gene locus_tag LOCUS_20200 22308 21628 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 protein_id gnl|my_center|LOCUS_20200 23140 22319 gene locus_tag LOCUS_20210 23140 22319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 23937 23137 gene locus_tag LOCUS_20220 23937 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 24413 23922 gene locus_tag LOCUS_20230 gene coaD 24413 23922 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169234.1 protein_id gnl|my_center|LOCUS_20230 24940 24413 gene locus_tag LOCUS_20240 24940 24413 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852466.1 protein_id gnl|my_center|LOCUS_20240 25065 24937 gene locus_tag LOCUS_20250 25065 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence30 1415 1185 gene locus_tag LOCUS_20260 1415 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20260 4552 1736 gene locus_tag LOCUS_20270 4552 1736 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_20270 5832 4564 gene locus_tag LOCUS_20280 5832 4564 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852268.1 protein_id gnl|my_center|LOCUS_20280 6568 5846 gene locus_tag LOCUS_20290 gene lptB 6568 5846 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353241.1 protein_id gnl|my_center|LOCUS_20290 6969 6556 gene locus_tag LOCUS_20300 gene tsaE 6969 6556 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202493.1 protein_id gnl|my_center|LOCUS_20300 7952 6966 gene locus_tag LOCUS_20310 gene trpD 7952 6966 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328329.1 protein_id gnl|my_center|LOCUS_20310 8197 7949 gene locus_tag LOCUS_20320 8197 7949 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 protein_id gnl|my_center|LOCUS_20320 8638 8333 gene locus_tag LOCUS_20330 8638 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 8949 8638 gene locus_tag LOCUS_20340 8949 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 9212 8964 gene locus_tag LOCUS_20350 9212 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 9544 9218 gene locus_tag LOCUS_20360 9544 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 9734 9534 gene locus_tag LOCUS_20370 9734 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 12164 9843 gene locus_tag LOCUS_20380 12164 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 15842 12225 gene locus_tag LOCUS_20390 gene dnaE 15842 12225 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_20390 18496 15947 gene locus_tag LOCUS_20400 18496 15947 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 protein_id gnl|my_center|LOCUS_20400 19231 18665 gene locus_tag LOCUS_20410 gene efp 19231 18665 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974265.1 protein_id gnl|my_center|LOCUS_20410 19331 20449 gene locus_tag LOCUS_20420 gene tgt 19331 20449 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853029.1 protein_id gnl|my_center|LOCUS_20420 20729 20493 gene locus_tag LOCUS_20430 20729 20493 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855201.1 protein_id gnl|my_center|LOCUS_20430 21982 20768 gene locus_tag LOCUS_20440 21982 20768 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864549.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence31 529 1074 gene locus_tag LOCUS_20450 529 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1065 1880 gene locus_tag LOCUS_20460 gene minD 1065 1880 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019069.1 protein_id gnl|my_center|LOCUS_20460 1877 2113 gene locus_tag LOCUS_20470 gene minE 1877 2113 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552653.1 protein_id gnl|my_center|LOCUS_20470 4633 2150 gene locus_tag LOCUS_20480 4633 2150 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_20480 5200 4844 gene locus_tag LOCUS_20490 5200 4844 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_20490 5260 6183 gene locus_tag LOCUS_20500 gene cysK 5260 6183 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_20500 6176 6778 gene locus_tag LOCUS_20510 6176 6778 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_20510 6768 7229 gene locus_tag LOCUS_20520 6768 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 8164 7262 gene locus_tag LOCUS_20530 8164 7262 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_20530 8358 10340 gene locus_tag LOCUS_20540 8358 10340 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_20540 10337 11158 gene locus_tag LOCUS_20550 gene truB 10337 11158 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 protein_id gnl|my_center|LOCUS_20550 11152 11382 gene locus_tag LOCUS_20560 11152 11382 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906447.1 protein_id gnl|my_center|LOCUS_20560 11394 12179 gene locus_tag LOCUS_20570 11394 12179 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 protein_id gnl|my_center|LOCUS_20570 12180 12317 gene locus_tag LOCUS_20580 12180 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 12348 13340 gene locus_tag LOCUS_20590 12348 13340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 13539 14378 gene locus_tag LOCUS_20600 gene dinD 13539 14378 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350563.1 protein_id gnl|my_center|LOCUS_20600 14417 14869 gene locus_tag LOCUS_20610 gene smpB 14417 14869 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_20610 14898 15467 gene locus_tag LOCUS_20620 14898 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 15476 16198 gene locus_tag LOCUS_20630 15476 16198 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_20630 16235 16948 gene locus_tag LOCUS_20640 16235 16948 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_20640 16951 18117 gene locus_tag LOCUS_20650 gene waaA 16951 18117 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852277.1 protein_id gnl|my_center|LOCUS_20650 18253 18987 gene locus_tag LOCUS_20660 18253 18987 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409617.1 protein_id gnl|my_center|LOCUS_20660 18993 19235 gene locus_tag LOCUS_20670 18993 19235 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 protein_id gnl|my_center|LOCUS_20670 19235 19687 gene locus_tag LOCUS_20680 19235 19687 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 protein_id gnl|my_center|LOCUS_20680 19762 21108 gene locus_tag LOCUS_20690 gene ffh 19762 21108 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852163.1 protein_id gnl|my_center|LOCUS_20690 21228 21458 gene locus_tag LOCUS_20700 gene rpsP 21228 21458 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852274.1 protein_id gnl|my_center|LOCUS_20700 21460 21699 gene locus_tag LOCUS_20710 21460 21699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 21680 22219 gene locus_tag LOCUS_20720 gene rimM 21680 22219 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852323.1 protein_id gnl|my_center|LOCUS_20720 22219 22923 gene locus_tag LOCUS_20730 gene trmD 22219 22923 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868040.1 protein_id gnl|my_center|LOCUS_20730 22913 23272 gene locus_tag LOCUS_20740 gene rplS 22913 23272 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852307.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence32 1257 520 gene locus_tag LOCUS_20750 1257 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1767 1264 gene locus_tag LOCUS_20760 1767 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2407 1805 gene locus_tag LOCUS_20770 2407 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 3242 2451 gene locus_tag LOCUS_20780 3242 2451 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_20780 3410 3243 gene locus_tag LOCUS_20790 3410 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3515 3766 gene locus_tag LOCUS_20800 3515 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3821 5134 gene locus_tag LOCUS_20810 gene rimO 3821 5134 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 protein_id gnl|my_center|LOCUS_20810 5127 6128 gene locus_tag LOCUS_20820 gene tilS 5127 6128 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612475.1 protein_id gnl|my_center|LOCUS_20820 6225 8417 gene locus_tag LOCUS_20830 gene pqqU 6225 8417 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_20830 8504 8947 gene locus_tag LOCUS_20840 gene exbB 8504 8947 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881140.1 protein_id gnl|my_center|LOCUS_20840 8937 9317 gene locus_tag LOCUS_20850 8937 9317 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881197.1 protein_id gnl|my_center|LOCUS_20850 9335 9994 gene locus_tag LOCUS_20860 9335 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 10013 12766 gene locus_tag LOCUS_20870 10013 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 12753 13733 gene locus_tag LOCUS_20880 12753 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 13726 14991 gene locus_tag LOCUS_20890 13726 14991 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869008.1 protein_id gnl|my_center|LOCUS_20890 14991 15797 gene locus_tag LOCUS_20900 gene hadI 14991 15797 CDS product 2-hydroxyisocaproyl-CoA dehydratase activator HadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888223.1 protein_id gnl|my_center|LOCUS_20900 15867 16565 gene locus_tag LOCUS_20910 15867 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 17107 16571 gene locus_tag LOCUS_20920 17107 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 17624 17097 gene locus_tag LOCUS_20930 17624 17097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 18621 17614 gene locus_tag LOCUS_20940 18621 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911905.1 protein_id gnl|my_center|LOCUS_20940 19457 18618 gene locus_tag LOCUS_20950 gene xerD 19457 18618 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583825.1 protein_id gnl|my_center|LOCUS_20950 20070 19435 gene locus_tag LOCUS_20960 20070 19435 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_20960 21364 20063 gene locus_tag LOCUS_20970 gene miaB 21364 20063 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 protein_id gnl|my_center|LOCUS_20970 21619 21374 gene locus_tag LOCUS_20980 21619 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 21794 22936 gene locus_tag LOCUS_20990 gene nusA 21794 22936 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 protein_id gnl|my_center|LOCUS_20990 23331 22972 gene locus_tag LOCUS_21000 23331 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence33 1340 336 gene locus_tag LOCUS_21010 1340 336 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_21010 3286 1337 gene locus_tag LOCUS_21020 3286 1337 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483790.1 protein_id gnl|my_center|LOCUS_21020 4378 3290 gene locus_tag LOCUS_21030 4378 3290 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_21030 5694 4381 gene locus_tag LOCUS_21040 5694 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 6612 5740 gene locus_tag LOCUS_21050 6612 5740 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_21050 6818 7627 gene locus_tag LOCUS_21060 gene hypB 6818 7627 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072157.1 protein_id gnl|my_center|LOCUS_21060 7627 7902 gene locus_tag LOCUS_21070 7627 7902 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335443.1 protein_id gnl|my_center|LOCUS_21070 7902 9047 gene locus_tag LOCUS_21080 gene hypD 7902 9047 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 protein_id gnl|my_center|LOCUS_21080 9110 11047 gene locus_tag LOCUS_21090 9110 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963644.1 protein_id gnl|my_center|LOCUS_21090 11028 11951 gene locus_tag LOCUS_21100 11028 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963669.1 protein_id gnl|my_center|LOCUS_21100 11948 12277 gene locus_tag LOCUS_21110 11948 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 12411 13964 gene locus_tag LOCUS_21120 12411 13964 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933539.1 protein_id gnl|my_center|LOCUS_21120 13961 15196 gene locus_tag LOCUS_21130 13961 15196 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145225398.1 protein_id gnl|my_center|LOCUS_21130 15198 16439 gene locus_tag LOCUS_21140 15198 16439 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217540.1 protein_id gnl|my_center|LOCUS_21140 16423 19527 gene locus_tag LOCUS_21150 16423 19527 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141537.1 protein_id gnl|my_center|LOCUS_21150 19694 19978 gene locus_tag LOCUS_21160 19694 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 19971 20390 gene locus_tag LOCUS_21170 19971 20390 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545111.1 protein_id gnl|my_center|LOCUS_21170 20494 22053 gene locus_tag LOCUS_21180 20494 22053 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880726.1 protein_id gnl|my_center|LOCUS_21180 22217 22525 gene locus_tag LOCUS_21190 gene rplU 22217 22525 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119318.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence34 149 2809 gene locus_tag LOCUS_21200 149 2809 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087385.1 protein_id gnl|my_center|LOCUS_21200 3130 2876 gene locus_tag LOCUS_21210 3130 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3351 5309 gene locus_tag LOCUS_21220 3351 5309 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 protein_id gnl|my_center|LOCUS_21220 5316 7910 gene locus_tag LOCUS_21230 5316 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 8358 7936 gene locus_tag LOCUS_21240 8358 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 9782 8358 gene locus_tag LOCUS_21250 9782 8358 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_21250 10330 9779 gene locus_tag LOCUS_21260 10330 9779 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_21260 13286 10380 gene locus_tag LOCUS_21270 13286 10380 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057320.1 protein_id gnl|my_center|LOCUS_21270 15198 13288 gene locus_tag LOCUS_21280 15198 13288 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_21280 15355 15543 gene locus_tag LOCUS_21290 15355 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 15686 17062 gene locus_tag LOCUS_21300 15686 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 17141 18130 gene locus_tag LOCUS_21310 17141 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 18142 18402 gene locus_tag LOCUS_21320 18142 18402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 <19231 18707 gene locus_tag LOCUS_21330 <19231 18707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994756.1:KilA-N domain-containing protein >Feature sequence35 <1 800 gene locus_tag LOCUS_21340 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880611.1:OmpP1/FadL family transporter 809 2545 gene locus_tag LOCUS_21350 809 2545 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858720.1 protein_id gnl|my_center|LOCUS_21350 2559 2990 gene locus_tag LOCUS_21360 2559 2990 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_21360 3007 3309 gene locus_tag LOCUS_21370 3007 3309 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323760.1 protein_id gnl|my_center|LOCUS_21370 3422 3601 gene locus_tag LOCUS_21380 3422 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 3605 5320 gene locus_tag LOCUS_21390 3605 5320 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_21390 5537 5965 gene locus_tag LOCUS_21400 5537 5965 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183543.1 protein_id gnl|my_center|LOCUS_21400 5947 6456 gene locus_tag LOCUS_21410 5947 6456 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851253.1 protein_id gnl|my_center|LOCUS_21410 6456 7262 gene locus_tag LOCUS_21420 6456 7262 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864416.1 protein_id gnl|my_center|LOCUS_21420 7271 8509 gene locus_tag LOCUS_21430 gene nuoD 7271 8509 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864417.1 protein_id gnl|my_center|LOCUS_21430 8509 8730 gene locus_tag LOCUS_21440 8509 8730 CDS product NADH-ubiquinone oxidoreductase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824979.1 protein_id gnl|my_center|LOCUS_21440 8745 10778 gene locus_tag LOCUS_21450 8745 10778 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941178.1 protein_id gnl|my_center|LOCUS_21450 10782 13040 gene locus_tag LOCUS_21460 10782 13040 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632151.1 protein_id gnl|my_center|LOCUS_21460 13033 15519 gene locus_tag LOCUS_21470 13033 15519 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 protein_id gnl|my_center|LOCUS_21470 15523 16509 gene locus_tag LOCUS_21480 gene nuoH 15523 16509 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277308.1 protein_id gnl|my_center|LOCUS_21480 16519 17154 gene locus_tag LOCUS_21490 gene nuoI 16519 17154 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851456.1 protein_id gnl|my_center|LOCUS_21490 17166 17744 gene locus_tag LOCUS_21500 17166 17744 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464208.1 protein_id gnl|my_center|LOCUS_21500 17741 18049 gene locus_tag LOCUS_21510 gene nuoK 17741 18049 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence36 131 388 gene locus_tag LOCUS_21520 gene rpmA 131 388 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_21520 543 1649 gene locus_tag LOCUS_21530 gene obgE 543 1649 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851611.1 protein_id gnl|my_center|LOCUS_21530 1654 2427 gene locus_tag LOCUS_21540 gene proB 1654 2427 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851769.1 protein_id gnl|my_center|LOCUS_21540 2417 3352 gene locus_tag LOCUS_21550 gene fmt 2417 3352 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851657.1 protein_id gnl|my_center|LOCUS_21550 3333 3968 gene locus_tag LOCUS_21560 3333 3968 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 protein_id gnl|my_center|LOCUS_21560 3965 4750 gene locus_tag LOCUS_21570 3965 4750 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_21570 4762 5586 gene locus_tag LOCUS_21580 4762 5586 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034353519.1 protein_id gnl|my_center|LOCUS_21580 5713 6135 gene locus_tag LOCUS_21590 5713 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 6145 6663 gene locus_tag LOCUS_21600 6145 6663 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 protein_id gnl|my_center|LOCUS_21600 6665 7198 gene locus_tag LOCUS_21610 6665 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 7220 8737 gene locus_tag LOCUS_21620 gene atpA 7220 8737 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_21620 8748 9635 gene locus_tag LOCUS_21630 gene atpG 8748 9635 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 protein_id gnl|my_center|LOCUS_21630 9647 11041 gene locus_tag LOCUS_21640 gene atpD 9647 11041 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 protein_id gnl|my_center|LOCUS_21640 11058 11450 gene locus_tag LOCUS_21650 gene atpC 11058 11450 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851752.1 protein_id gnl|my_center|LOCUS_21650 11454 12020 gene locus_tag LOCUS_21660 11454 12020 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887310.1 protein_id gnl|my_center|LOCUS_21660 12022 12414 gene locus_tag LOCUS_21670 12022 12414 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105106.1 protein_id gnl|my_center|LOCUS_21670 12407 13177 gene locus_tag LOCUS_21680 12407 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 13180 14427 gene locus_tag LOCUS_21690 gene tolB 13180 14427 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_21690 14491 15015 gene locus_tag LOCUS_21700 gene pal 14491 15015 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851617.1 protein_id gnl|my_center|LOCUS_21700 15019 15942 gene locus_tag LOCUS_21710 15019 15942 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851738.1 protein_id gnl|my_center|LOCUS_21710 15974 16522 gene locus_tag LOCUS_21720 15974 16522 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851661.1 protein_id gnl|my_center|LOCUS_21720 16488 17261 gene locus_tag LOCUS_21730 16488 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 17272 18210 gene locus_tag LOCUS_21740 gene fabD 17272 18210 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence37 1283 843 gene locus_tag LOCUS_21750 1283 843 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_21750 1426 2742 gene locus_tag LOCUS_21760 1426 2742 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856815.1 protein_id gnl|my_center|LOCUS_21760 2747 3460 gene locus_tag LOCUS_21770 2747 3460 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858572.1 protein_id gnl|my_center|LOCUS_21770 3464 3706 gene locus_tag LOCUS_21780 gene purS 3464 3706 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858611.1 protein_id gnl|my_center|LOCUS_21780 3703 4377 gene locus_tag LOCUS_21790 gene purQ 3703 4377 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858528.1 protein_id gnl|my_center|LOCUS_21790 4374 5510 gene locus_tag LOCUS_21800 4374 5510 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858517.1 protein_id gnl|my_center|LOCUS_21800 5488 6186 gene locus_tag LOCUS_21810 5488 6186 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858620.1 protein_id gnl|my_center|LOCUS_21810 6149 6544 gene locus_tag LOCUS_21820 gene crcB 6149 6544 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858490.1 protein_id gnl|my_center|LOCUS_21820 7103 6534 gene locus_tag LOCUS_21830 7103 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 7799 7107 gene locus_tag LOCUS_21840 gene dut 7799 7107 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_21840 8447 8022 gene locus_tag LOCUS_21850 8447 8022 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209282.1 protein_id gnl|my_center|LOCUS_21850 8673 8431 gene locus_tag LOCUS_21860 8673 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 9915 8716 gene locus_tag LOCUS_21870 9915 8716 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_21870 10976 9912 gene locus_tag LOCUS_21880 10976 9912 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994644.1 protein_id gnl|my_center|LOCUS_21880 11092 11814 gene locus_tag LOCUS_21890 11092 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994642.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21890 11855 12082 gene locus_tag LOCUS_21900 11855 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 14293 12182 gene locus_tag LOCUS_21910 gene ovoA 14293 12182 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_21910 14323 15054 gene locus_tag LOCUS_21920 gene pgeF 14323 15054 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986855.1 protein_id gnl|my_center|LOCUS_21920 16725 15097 gene locus_tag LOCUS_21930 gene groL 16725 15097 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858047.1 protein_id gnl|my_center|LOCUS_21930 17124 16861 gene locus_tag LOCUS_21940 gene groES 17124 16861 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 protein_id gnl|my_center|LOCUS_21940 17347 17423 gene locus_tag LOCUS_t00400 17347 17423 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17434 17508 gene locus_tag LOCUS_t00410 17434 17508 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence38 272 499 gene locus_tag LOCUS_21950 272 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 524 676 gene locus_tag LOCUS_21960 524 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1114 2055 gene locus_tag LOCUS_21970 1114 2055 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 protein_id gnl|my_center|LOCUS_21970 2075 3352 gene locus_tag LOCUS_21980 2075 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 6013 3347 gene locus_tag LOCUS_21990 6013 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 8005 7931 gene locus_tag LOCUS_t00420 8005 7931 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8996 8064 gene locus_tag LOCUS_22000 8996 8064 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853222.1 protein_id gnl|my_center|LOCUS_22000 10028 8997 gene locus_tag LOCUS_22010 gene hemE 10028 8997 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 protein_id gnl|my_center|LOCUS_22010 10567 10049 gene locus_tag LOCUS_22020 10567 10049 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_22020 11604 10570 gene locus_tag LOCUS_22030 11604 10570 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 protein_id gnl|my_center|LOCUS_22030 12772 11621 gene locus_tag LOCUS_22040 gene flgR 12772 11621 CDS product fla regulon two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853038.1 protein_id gnl|my_center|LOCUS_22040 13217 12807 gene locus_tag LOCUS_22050 13217 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 13717 13166 gene locus_tag LOCUS_22060 gene flgP 13717 13166 CDS product flagellar assembly lipoprotein FlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852972.1 protein_id gnl|my_center|LOCUS_22060 15393 13762 gene locus_tag LOCUS_22070 15393 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22070 >Feature sequence39 697 80 gene locus_tag LOCUS_22080 697 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22080 1595 750 gene locus_tag LOCUS_22090 gene nfo 1595 750 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097964.1 protein_id gnl|my_center|LOCUS_22090 2058 1588 gene locus_tag LOCUS_22100 2058 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2239 3168 gene locus_tag LOCUS_22110 2239 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4088 3264 gene locus_tag LOCUS_22120 4088 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 4505 4308 gene locus_tag LOCUS_22130 4505 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 4749 4489 gene locus_tag LOCUS_22140 4749 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 4845 6116 gene locus_tag LOCUS_22150 4845 6116 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208841.1 protein_id gnl|my_center|LOCUS_22150 6129 7079 gene locus_tag LOCUS_22160 6129 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 7113 8540 gene locus_tag LOCUS_22170 7113 8540 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_22170 9350 8541 gene locus_tag LOCUS_22180 9350 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 9897 9427 gene locus_tag LOCUS_22190 9897 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 10787 9939 gene locus_tag LOCUS_22200 gene aguB 10787 9939 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464341.1 protein_id gnl|my_center|LOCUS_22200 11875 10799 gene locus_tag LOCUS_22210 11875 10799 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_22210 13047 12019 gene locus_tag LOCUS_22220 13047 12019 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121988.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence40 364 1239 gene locus_tag LOCUS_22230 364 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2168 1494 gene locus_tag LOCUS_22240 2168 1494 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888213.1 protein_id gnl|my_center|LOCUS_22240 3224 2172 gene locus_tag LOCUS_22250 gene rseP 3224 2172 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_22250 3776 3225 gene locus_tag LOCUS_22260 gene pgsA 3776 3225 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_22260 3888 5057 gene locus_tag LOCUS_22270 3888 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 6309 5029 gene locus_tag LOCUS_22280 6309 5029 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_22280 6385 7173 gene locus_tag LOCUS_22290 6385 7173 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937487.1 protein_id gnl|my_center|LOCUS_22290 7170 7442 gene locus_tag LOCUS_22300 7170 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 7453 8568 gene locus_tag LOCUS_22310 gene ald 7453 8568 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219742.1 protein_id gnl|my_center|LOCUS_22310 8571 9182 gene locus_tag LOCUS_22320 8571 9182 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776334.1 protein_id gnl|my_center|LOCUS_22320 9363 10388 gene locus_tag LOCUS_22330 gene amrS 9363 10388 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_22330 10403 11086 gene locus_tag LOCUS_22340 10403 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 11167 11613 gene locus_tag LOCUS_22350 11167 11613 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_22350 11625 12050 gene locus_tag LOCUS_22360 11625 12050 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_22360 12350 12123 gene locus_tag LOCUS_22370 12350 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 13659 12610 gene locus_tag LOCUS_22380 13659 12610 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210874.1 protein_id gnl|my_center|LOCUS_22380 14287 13667 gene locus_tag LOCUS_22390 14287 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 15120 14287 gene locus_tag LOCUS_22400 15120 14287 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037038.1 protein_id gnl|my_center|LOCUS_22400 15262 15098 gene locus_tag LOCUS_22410 15262 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence41 1446 277 gene locus_tag LOCUS_22420 1446 277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_22420 1570 1995 gene locus_tag LOCUS_22430 1570 1995 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_22430 2008 3210 gene locus_tag LOCUS_22440 gene ilvA 2008 3210 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_22440 3211 5361 gene locus_tag LOCUS_22450 3211 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 5404 7101 gene locus_tag LOCUS_22460 5404 7101 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852093.1 protein_id gnl|my_center|LOCUS_22460 7101 7577 gene locus_tag LOCUS_22470 gene ilvN 7101 7577 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852211.1 protein_id gnl|my_center|LOCUS_22470 7610 8560 gene locus_tag LOCUS_22480 gene lpxD 7610 8560 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852180.1 protein_id gnl|my_center|LOCUS_22480 8699 8902 gene locus_tag LOCUS_22490 8699 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 8921 10618 gene locus_tag LOCUS_22500 8921 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 10615 13236 gene locus_tag LOCUS_22510 10615 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 13802 13233 gene locus_tag LOCUS_22520 13802 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 14100 13795 gene locus_tag LOCUS_22530 14100 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence42 1073 3 gene locus_tag LOCUS_22540 1073 3 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_22540 2252 1083 gene locus_tag LOCUS_22550 gene ugd 2252 1083 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704814.1 protein_id gnl|my_center|LOCUS_22550 3149 2352 gene locus_tag LOCUS_22560 3149 2352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_22560 5036 3156 gene locus_tag LOCUS_22570 gene flgK 5036 3156 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851396.1 protein_id gnl|my_center|LOCUS_22570 5466 5038 gene locus_tag LOCUS_22580 5466 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 5705 5496 gene locus_tag LOCUS_22590 5705 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 6078 5776 gene locus_tag LOCUS_22600 6078 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609401.1 protein_id gnl|my_center|LOCUS_22600 7124 6078 gene locus_tag LOCUS_22610 7124 6078 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858049.1 protein_id gnl|my_center|LOCUS_22610 7760 7170 gene locus_tag LOCUS_22620 7760 7170 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 protein_id gnl|my_center|LOCUS_22620 8118 7750 gene locus_tag LOCUS_22630 8118 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 8847 8161 gene locus_tag LOCUS_22640 8847 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 9307 8879 gene locus_tag LOCUS_22650 9307 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 9393 10667 gene locus_tag LOCUS_22660 gene murA 9393 10667 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857102.1 protein_id gnl|my_center|LOCUS_22660 11048 10671 gene locus_tag LOCUS_22670 gene hspR 11048 10671 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_22670 11941 11063 gene locus_tag LOCUS_22680 11941 11063 CDS product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853234.1 protein_id gnl|my_center|LOCUS_22680 12893 12012 gene locus_tag LOCUS_22690 gene htpX 12893 12012 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence43 902 210 gene locus_tag LOCUS_22700 gene aat 902 210 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_22700 3076 899 gene locus_tag LOCUS_22710 gene clpA 3076 899 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_22710 3375 3076 gene locus_tag LOCUS_22720 gene clpS 3375 3076 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946553.1 protein_id gnl|my_center|LOCUS_22720 3454 4080 gene locus_tag LOCUS_22730 gene bioD 3454 4080 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897490.1 protein_id gnl|my_center|LOCUS_22730 4102 4977 gene locus_tag LOCUS_22740 4102 4977 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852714.1 protein_id gnl|my_center|LOCUS_22740 4967 5905 gene locus_tag LOCUS_22750 4967 5905 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_22750 5922 7319 gene locus_tag LOCUS_22760 5922 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 7376 8356 gene locus_tag LOCUS_22770 7376 8356 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851728.1 protein_id gnl|my_center|LOCUS_22770 8353 9549 gene locus_tag LOCUS_22780 8353 9549 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_22780 9616 10152 gene locus_tag LOCUS_22790 9616 10152 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002791314.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence44 155 1417 gene locus_tag LOCUS_22800 155 1417 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_22800 1443 2276 gene locus_tag LOCUS_22810 1443 2276 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_22810 2790 2317 gene locus_tag LOCUS_22820 2790 2317 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814552.1 protein_id gnl|my_center|LOCUS_22820 4372 2948 gene locus_tag LOCUS_22830 gene rfaE1 4372 2948 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_22830 5394 4369 gene locus_tag LOCUS_22840 gene rfaD 5394 4369 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858041.1 protein_id gnl|my_center|LOCUS_22840 5523 5807 gene locus_tag LOCUS_22850 5523 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 6078 5863 gene locus_tag LOCUS_22860 gene ccoS 6078 5863 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090949.1 protein_id gnl|my_center|LOCUS_22860 8429 6081 gene locus_tag LOCUS_22870 8429 6081 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891913.1 protein_id gnl|my_center|LOCUS_22870 8961 8476 gene locus_tag LOCUS_22880 8961 8476 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_22880 9469 8945 gene locus_tag LOCUS_22890 gene gmhB 9469 8945 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853963.1 protein_id gnl|my_center|LOCUS_22890 10063 9476 gene locus_tag LOCUS_22900 gene gmhA2 10063 9476 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence45 680 1354 gene locus_tag LOCUS_22910 680 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1421 1870 gene locus_tag LOCUS_22920 1421 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1884 2432 gene locus_tag LOCUS_22930 1884 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2852 2568 gene locus_tag LOCUS_22940 2852 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3234 2944 gene locus_tag LOCUS_22950 3234 2944 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_22950 4881 3346 gene locus_tag LOCUS_22960 gene purH 4881 3346 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853339.1 protein_id gnl|my_center|LOCUS_22960 4869 5285 gene locus_tag LOCUS_22970 4869 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 7147 5282 gene locus_tag LOCUS_22980 7147 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 <8276 7392 gene locus_tag LOCUS_22990 <8276 7392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858406.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence46 932 666 gene locus_tag LOCUS_23000 932 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2683 929 gene locus_tag LOCUS_23010 2683 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2897 2685 gene locus_tag LOCUS_23020 2897 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 3178 2894 gene locus_tag LOCUS_23030 3178 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3780 3175 gene locus_tag LOCUS_23040 3780 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 4034 3783 gene locus_tag LOCUS_23050 4034 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 5602 4031 gene locus_tag LOCUS_23060 5602 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 5925 5602 gene locus_tag LOCUS_23070 5925 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 6843 6076 gene locus_tag LOCUS_23080 6843 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence47 3268 926 gene locus_tag LOCUS_23090 3268 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4777 3281 gene locus_tag LOCUS_23100 4777 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence48 2651 168 gene locus_tag LOCUS_23110 2651 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2896 4014 gene locus_tag LOCUS_23120 2896 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence49 373 1668 gene locus_tag LOCUS_23130 373 1668 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_23130 2342 1746 gene locus_tag LOCUS_23140 gene fliL 2342 1746 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797017.1 protein_id gnl|my_center|LOCUS_23140 3449 2430 gene locus_tag LOCUS_23150 3449 2430 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012661737.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence50 254 135 gene locus_tag LOCUS_23160 254 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 581 796 gene locus_tag LOCUS_23170 581 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1011 793 gene locus_tag LOCUS_23180 1011 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2222 1014 gene locus_tag LOCUS_23190 2222 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence51 2084 1284 gene locus_tag LOCUS_23200 2084 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3235 2072 gene locus_tag LOCUS_23210 3235 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence52 3115 1079 gene locus_tag LOCUS_23220 3115 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence53 <1 710 gene locus_tag LOCUS_23230 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858560.1:2-oxoglutarate synthase subunit alpha 710 1567 gene locus_tag LOCUS_23240 710 1567 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_23240 1577 2131 gene locus_tag LOCUS_23250 1577 2131 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_23250 2839 2222 gene locus_tag LOCUS_23260 2839 2222 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085042.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence54 2547 475 gene locus_tag LOCUS_23270 gene cheA 2547 475 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350517.1 protein_id gnl|my_center|LOCUS_23270 2925 2557 gene locus_tag LOCUS_23280 2925 2557 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence55 1417 869 gene locus_tag LOCUS_23290 gene apt 1417 869 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853297.1 protein_id gnl|my_center|LOCUS_23290 1761 1429 gene locus_tag LOCUS_23300 1761 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495094.1 protein_id gnl|my_center|LOCUS_23300 2246 1812 gene locus_tag LOCUS_23310 gene rpiB 2246 1812 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence56 306 1268 gene locus_tag LOCUS_23320 306 1268 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_23320 1272 1658 gene locus_tag LOCUS_23330 1272 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_23330