>Feature sequence001 103 1314 gene locus_tag LOCUS_00010 103 1314 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_00010 1330 2877 gene locus_tag LOCUS_00020 1330 2877 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_00020 3644 2889 gene locus_tag LOCUS_00030 3644 2889 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_00030 3888 4718 gene locus_tag LOCUS_00040 3888 4718 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_00040 4720 5670 gene locus_tag LOCUS_00050 4720 5670 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_00050 5667 7154 gene locus_tag LOCUS_00060 gene glpK 5667 7154 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080610.1 protein_id gnl|my_center|LOCUS_00060 7177 8610 gene locus_tag LOCUS_00070 7177 8610 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_00070 8630 9646 gene locus_tag LOCUS_00080 8630 9646 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_00080 9684 12773 gene locus_tag LOCUS_00090 9684 12773 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769257.1 protein_id gnl|my_center|LOCUS_00090 12814 14337 gene locus_tag LOCUS_00100 12814 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14341 15897 gene locus_tag LOCUS_00110 14341 15897 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803715.1 protein_id gnl|my_center|LOCUS_00110 15907 17502 gene locus_tag LOCUS_00120 15907 17502 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803715.1 protein_id gnl|my_center|LOCUS_00120 17525 18700 gene locus_tag LOCUS_00130 17525 18700 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346611.1 protein_id gnl|my_center|LOCUS_00130 18705 20240 gene locus_tag LOCUS_00140 18705 20240 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803715.1 protein_id gnl|my_center|LOCUS_00140 20347 21504 gene locus_tag LOCUS_00150 20347 21504 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_00150 21525 23903 gene locus_tag LOCUS_00160 21525 23903 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_00160 24038 25327 gene locus_tag LOCUS_00170 24038 25327 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_00170 25331 26317 gene locus_tag LOCUS_00180 25331 26317 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_00180 26329 27483 gene locus_tag LOCUS_00190 gene galK 26329 27483 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_00190 27992 27480 gene locus_tag LOCUS_00200 27992 27480 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_00200 28019 28489 gene locus_tag LOCUS_00210 28019 28489 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_00210 30506 28476 gene locus_tag LOCUS_00220 30506 28476 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_00220 31957 30503 gene locus_tag LOCUS_00230 31957 30503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 32979 31954 gene locus_tag LOCUS_00240 32979 31954 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293828.1 protein_id gnl|my_center|LOCUS_00240 33767 32979 gene locus_tag LOCUS_00250 33767 32979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34053 34898 gene locus_tag LOCUS_00260 34053 34898 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_00260 36115 34877 gene locus_tag LOCUS_00270 36115 34877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 36227 37165 gene locus_tag LOCUS_00280 36227 37165 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_00280 37246 37172 gene locus_tag LOCUS_t00010 37246 37172 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 37311 38243 gene locus_tag LOCUS_00290 gene trxB 37311 38243 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_00290 38273 39091 gene locus_tag LOCUS_00300 gene bamD 38273 39091 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763159.1 protein_id gnl|my_center|LOCUS_00300 39093 39419 gene locus_tag LOCUS_00310 39093 39419 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_00310 39422 41089 gene locus_tag LOCUS_00320 gene recN 39422 41089 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_00320 41094 41885 gene locus_tag LOCUS_00330 gene nagB 41094 41885 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_00330 43253 41886 gene locus_tag LOCUS_00340 43253 41886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 44200 43250 gene locus_tag LOCUS_00350 44200 43250 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_00350 44818 44210 gene locus_tag LOCUS_00360 44818 44210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45568 44849 gene locus_tag LOCUS_00370 45568 44849 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964190.1 protein_id gnl|my_center|LOCUS_00370 45619 46428 gene locus_tag LOCUS_00380 45619 46428 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_00380 46421 47143 gene locus_tag LOCUS_00390 46421 47143 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771680.1 protein_id gnl|my_center|LOCUS_00390 47154 49694 gene locus_tag LOCUS_00400 47154 49694 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_00400 49705 50217 gene locus_tag LOCUS_00410 49705 50217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50255 50815 gene locus_tag LOCUS_00420 50255 50815 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784365.1 protein_id gnl|my_center|LOCUS_00420 50827 51642 gene locus_tag LOCUS_00430 gene murI 50827 51642 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404950.1 protein_id gnl|my_center|LOCUS_00430 52397 51537 gene locus_tag LOCUS_00440 gene coaW 52397 51537 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862728.1 protein_id gnl|my_center|LOCUS_00440 53737 52400 gene locus_tag LOCUS_00450 gene gdhA 53737 52400 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_00450 54803 53787 gene locus_tag LOCUS_00460 54803 53787 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_00460 56644 54800 gene locus_tag LOCUS_00470 56644 54800 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_00470 58657 56741 gene locus_tag LOCUS_00480 58657 56741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 61287 58639 gene locus_tag LOCUS_00490 61287 58639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 58669 58768 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65116 61298 gene locus_tag LOCUS_00500 gene rpoB 65116 61298 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_00500 65599 65222 gene locus_tag LOCUS_00510 gene rplL 65599 65222 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_00510 66158 65637 gene locus_tag LOCUS_00520 gene rplJ 66158 65637 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_00520 66874 66173 gene locus_tag LOCUS_00530 gene rplA 66874 66173 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_00530 67335 66889 gene locus_tag LOCUS_00540 gene rplK 67335 66889 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_00540 67897 67349 gene locus_tag LOCUS_00550 gene nusG 67897 67349 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_00550 68104 67910 gene locus_tag LOCUS_00560 gene secE 68104 67910 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_00560 68258 68187 gene locus_tag LOCUS_t00020 68258 68187 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 <69068 68325 gene locus_tag LOCUS_00570 <69068 68325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762026.1:elongation factor Tu >Feature sequence002 <1 1024 gene locus_tag LOCUS_00580 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964449.1:permease-like cell division protein FtsX 1032 1307 gene locus_tag LOCUS_00590 1032 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 1294 2100 gene locus_tag LOCUS_00600 1294 2100 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_00600 2097 2870 gene locus_tag LOCUS_00610 2097 2870 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_00610 3440 2763 gene locus_tag LOCUS_00620 3440 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 3850 3437 gene locus_tag LOCUS_00630 3850 3437 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203080.1 protein_id gnl|my_center|LOCUS_00630 5043 3862 gene locus_tag LOCUS_00640 5043 3862 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_00640 7124 5046 gene locus_tag LOCUS_00650 7124 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 8055 7099 gene locus_tag LOCUS_00660 8055 7099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086100.1 protein_id gnl|my_center|LOCUS_00660 8097 9182 gene locus_tag LOCUS_00670 8097 9182 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_00670 9371 9796 gene locus_tag LOCUS_00680 gene rplP 9371 9796 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_00680 9807 10010 gene locus_tag LOCUS_00690 9807 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 10018 10272 gene locus_tag LOCUS_00700 gene rpsQ 10018 10272 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_00700 10275 10643 gene locus_tag LOCUS_00710 gene rplN 10275 10643 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_00710 10654 10977 gene locus_tag LOCUS_00720 gene rplX 10654 10977 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_00720 10977 11582 gene locus_tag LOCUS_00730 gene rplE 10977 11582 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 protein_id gnl|my_center|LOCUS_00730 11583 11852 gene locus_tag LOCUS_00740 gene rpsN 11583 11852 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_00740 11891 12337 gene locus_tag LOCUS_00750 gene rpsH 11891 12337 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 protein_id gnl|my_center|LOCUS_00750 12351 12911 gene locus_tag LOCUS_00760 gene rplF 12351 12911 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_00760 12926 13288 gene locus_tag LOCUS_00770 gene rplR 12926 13288 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_00770 13296 13814 gene locus_tag LOCUS_00780 gene rpsE 13296 13814 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_00780 13827 14009 gene locus_tag LOCUS_00790 gene rpmD 13827 14009 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_00790 14023 14472 gene locus_tag LOCUS_00800 gene rplO 14023 14472 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_00800 14492 15811 gene locus_tag LOCUS_00810 gene secY 14492 15811 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_00810 15839 16609 gene locus_tag LOCUS_00820 gene map 15839 16609 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_00820 16637 16855 gene locus_tag LOCUS_00830 gene infA 16637 16855 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_00830 17025 17402 gene locus_tag LOCUS_00840 gene rpsM 17025 17402 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_00840 17414 17806 gene locus_tag LOCUS_00850 gene rpsK 17414 17806 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_00850 17833 18438 gene locus_tag LOCUS_00860 gene rpsD 17833 18438 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_00860 18691 18790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18803 19705 gene locus_tag LOCUS_00870 18803 19705 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_00870 19683 20249 gene locus_tag LOCUS_00880 19683 20249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 20326 21456 gene locus_tag LOCUS_00890 gene tgt 20326 21456 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_00890 21456 22571 gene locus_tag LOCUS_00900 21456 22571 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_00900 22594 23550 gene locus_tag LOCUS_00910 22594 23550 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_00910 23552 24502 gene locus_tag LOCUS_00920 23552 24502 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_00920 25897 24506 gene locus_tag LOCUS_00930 25897 24506 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_00930 26005 26943 gene locus_tag LOCUS_00940 26005 26943 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_00940 26996 27253 gene locus_tag LOCUS_00950 26996 27253 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_00950 27341 29698 gene locus_tag LOCUS_00960 27341 29698 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_00960 29703 30593 gene locus_tag LOCUS_00970 29703 30593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 31236 30556 gene locus_tag LOCUS_00980 31236 30556 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_00980 32170 31238 gene locus_tag LOCUS_00990 gene fmt 32170 31238 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_00990 33638 32181 gene locus_tag LOCUS_01000 33638 32181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 36267 33652 gene locus_tag LOCUS_01010 gene alaS 36267 33652 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_01010 36351 37316 gene locus_tag LOCUS_01020 36351 37316 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_01020 37326 38282 gene locus_tag LOCUS_01030 37326 38282 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_01030 38289 38609 gene locus_tag LOCUS_01040 38289 38609 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_01040 38606 39406 gene locus_tag LOCUS_01050 38606 39406 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_01050 39421 40224 gene locus_tag LOCUS_01060 39421 40224 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_01060 40214 41413 gene locus_tag LOCUS_01070 40214 41413 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_01070 41428 42930 gene locus_tag LOCUS_01080 gene dnaB 41428 42930 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_01080 42908 43762 gene locus_tag LOCUS_01090 42908 43762 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_01090 43765 44190 gene locus_tag LOCUS_01100 43765 44190 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765125.1 protein_id gnl|my_center|LOCUS_01100 44153 44998 gene locus_tag LOCUS_01110 44153 44998 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_01110 44991 46334 gene locus_tag LOCUS_01120 gene rsxC 44991 46334 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_01120 46336 47379 gene locus_tag LOCUS_01130 46336 47379 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_01130 47372 47959 gene locus_tag LOCUS_01140 47372 47959 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_01140 47956 48537 gene locus_tag LOCUS_01150 47956 48537 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_01150 48542 49141 gene locus_tag LOCUS_01160 gene rsxA 48542 49141 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_01160 49159 49389 gene locus_tag LOCUS_01170 49159 49389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 50250 49396 gene locus_tag LOCUS_01180 50250 49396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 50304 52625 gene locus_tag LOCUS_01190 50304 52625 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765772.1 protein_id gnl|my_center|LOCUS_01190 52622 53143 gene locus_tag LOCUS_01200 52622 53143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 53805 53140 gene locus_tag LOCUS_01210 53805 53140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 53913 54278 gene locus_tag LOCUS_01220 gene dut 53913 54278 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_01220 54286 55581 gene locus_tag LOCUS_01230 54286 55581 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_01230 56569 55553 gene locus_tag LOCUS_01240 56569 55553 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_01240 56605 58443 gene locus_tag LOCUS_01250 56605 58443 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704972.1 protein_id gnl|my_center|LOCUS_01250 59861 58371 gene locus_tag LOCUS_01260 59861 58371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 60843 59863 gene locus_tag LOCUS_01270 60843 59863 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_01270 62357 60819 gene locus_tag LOCUS_01280 62357 60819 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_01280 62583 63341 gene locus_tag LOCUS_01290 62583 63341 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_01290 63371 64420 gene locus_tag LOCUS_01300 63371 64420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 64431 65885 gene locus_tag LOCUS_01310 64431 65885 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_01310 65976 66395 gene locus_tag LOCUS_01320 65976 66395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 66399 66665 gene locus_tag LOCUS_01330 gene rpsR 66399 66665 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_01330 66680 67132 gene locus_tag LOCUS_01340 gene rplI 66680 67132 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence003 3 1271 gene locus_tag LOCUS_01350 3 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 5729 1263 gene locus_tag LOCUS_01360 5729 1263 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_01360 5764 6849 gene locus_tag LOCUS_01370 gene tsaD 5764 6849 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787941.1 protein_id gnl|my_center|LOCUS_01370 7399 6869 gene locus_tag LOCUS_01380 7399 6869 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_01380 8821 7415 gene locus_tag LOCUS_01390 8821 7415 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_01390 10156 8831 gene locus_tag LOCUS_01400 10156 8831 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_01400 11523 10153 gene locus_tag LOCUS_01410 11523 10153 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_01410 11604 11762 gene locus_tag LOCUS_01420 11604 11762 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_01420 11867 13105 gene locus_tag LOCUS_01430 11867 13105 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_01430 14340 13102 gene locus_tag LOCUS_01440 14340 13102 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_01440 15372 14350 gene locus_tag LOCUS_01450 gene galE 15372 14350 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_01450 17269 15440 gene locus_tag LOCUS_01460 17269 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 18384 17158 gene locus_tag LOCUS_01470 18384 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 17281 17380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19781 18450 gene locus_tag LOCUS_01480 19781 18450 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_01480 19840 21117 gene locus_tag LOCUS_01490 19840 21117 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_01490 21140 21215 gene locus_tag LOCUS_t00030 21140 21215 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24285 21229 gene locus_tag LOCUS_01500 24285 21229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 24848 24390 gene locus_tag LOCUS_01510 24848 24390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 24949 25971 gene locus_tag LOCUS_01520 24949 25971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 25524 25623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25985 27394 gene locus_tag LOCUS_01530 gene uxaC 25985 27394 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_01530 27400 28839 gene locus_tag LOCUS_01540 27400 28839 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769494.1 protein_id gnl|my_center|LOCUS_01540 29506 28829 gene locus_tag LOCUS_01550 29506 28829 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_01550 30551 29517 gene locus_tag LOCUS_01560 30551 29517 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_01560 31298 30606 gene locus_tag LOCUS_01570 31298 30606 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789787.1 protein_id gnl|my_center|LOCUS_01570 31380 34307 gene locus_tag LOCUS_01580 31380 34307 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_01580 34564 35598 gene locus_tag LOCUS_01590 34564 35598 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769569.1 protein_id gnl|my_center|LOCUS_01590 35610 36407 gene locus_tag LOCUS_01600 35610 36407 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_01600 36414 37304 gene locus_tag LOCUS_01610 36414 37304 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457195.1 protein_id gnl|my_center|LOCUS_01610 39329 37296 gene locus_tag LOCUS_01620 39329 37296 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_01620 42078 39322 gene locus_tag LOCUS_01630 42078 39322 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_01630 43010 42075 gene locus_tag LOCUS_01640 43010 42075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 43441 43043 gene locus_tag LOCUS_tm00010 43441 43043 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 43991 43473 gene locus_tag LOCUS_01650 43991 43473 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_01650 43948 44172 gene locus_tag LOCUS_01660 43948 44172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 44182 45771 gene locus_tag LOCUS_01670 gene lnt 44182 45771 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_01670 47480 45729 gene locus_tag LOCUS_01680 47480 45729 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_01680 49194 47464 gene locus_tag LOCUS_01690 49194 47464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 49680 49204 gene locus_tag LOCUS_01700 gene coaD 49680 49204 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_01700 50406 49738 gene locus_tag LOCUS_01710 gene ung 50406 49738 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206598.1 protein_id gnl|my_center|LOCUS_01710 52857 50407 gene locus_tag LOCUS_01720 gene lon 52857 50407 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_01720 54291 52870 gene locus_tag LOCUS_01730 54291 52870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 55349 54288 gene locus_tag LOCUS_01740 gene mutY 55349 54288 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_01740 55484 55768 gene locus_tag LOCUS_01750 55484 55768 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_01750 55949 57505 gene locus_tag LOCUS_01760 55949 57505 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_01760 59244 57502 gene locus_tag LOCUS_01770 59244 57502 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_01770 59288 60154 gene locus_tag LOCUS_01780 59288 60154 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_01780 60189 60548 gene locus_tag LOCUS_01790 60189 60548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 62671 60563 gene locus_tag LOCUS_01800 gene recG 62671 60563 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109022.1 protein_id gnl|my_center|LOCUS_01800 62711 63103 gene locus_tag LOCUS_01810 62711 63103 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_01810 63096 64133 gene locus_tag LOCUS_01820 gene pdxA 63096 64133 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_01820 64123 64635 gene locus_tag LOCUS_01830 gene rnhA 64123 64635 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_01830 65617 64568 gene locus_tag LOCUS_01840 65617 64568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 >Feature sequence004 2173 2679 gene locus_tag LOCUS_01850 2173 2679 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796780.1 protein_id gnl|my_center|LOCUS_01850 2762 3079 gene locus_tag LOCUS_01860 2762 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 3042 5249 gene locus_tag LOCUS_01870 3042 5249 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_01870 5324 5548 gene locus_tag LOCUS_01880 5324 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 5536 5751 gene locus_tag LOCUS_01890 5536 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 5751 6473 gene locus_tag LOCUS_01900 5751 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 6482 7873 gene locus_tag LOCUS_01910 6482 7873 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_01910 7890 9122 gene locus_tag LOCUS_01920 7890 9122 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840043.1 protein_id gnl|my_center|LOCUS_01920 9115 9843 gene locus_tag LOCUS_01930 gene tsaB 9115 9843 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_01930 10975 9827 gene locus_tag LOCUS_01940 10975 9827 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763566.1 protein_id gnl|my_center|LOCUS_01940 11378 10983 gene locus_tag LOCUS_01950 11378 10983 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_01950 11853 11380 gene locus_tag LOCUS_01960 gene greA 11853 11380 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_01960 12258 11938 gene locus_tag LOCUS_01970 12258 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 13133 12255 gene locus_tag LOCUS_01980 13133 12255 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_01980 17335 13124 gene locus_tag LOCUS_01990 17335 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 18525 17332 gene locus_tag LOCUS_02000 18525 17332 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_02000 19825 18527 gene locus_tag LOCUS_02010 19825 18527 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_02010 21735 19822 gene locus_tag LOCUS_02020 21735 19822 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_02020 23756 21774 gene locus_tag LOCUS_02030 23756 21774 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_02030 24937 23759 gene locus_tag LOCUS_02040 24937 23759 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206454.1 protein_id gnl|my_center|LOCUS_02040 25181 24975 gene locus_tag LOCUS_02050 25181 24975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 26354 25188 gene locus_tag LOCUS_02060 gene xseA 26354 25188 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_02060 26353 27000 gene locus_tag LOCUS_02070 gene yihA 26353 27000 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_02070 27046 27996 gene locus_tag LOCUS_02080 27046 27996 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_02080 27996 28832 gene locus_tag LOCUS_02090 27996 28832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 28829 29044 gene locus_tag LOCUS_02100 28829 29044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 29013 30317 gene locus_tag LOCUS_02110 gene der 29013 30317 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_02110 30729 30319 gene locus_tag LOCUS_02120 30729 30319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 30782 31255 gene locus_tag LOCUS_02130 gene rlmH 30782 31255 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_02130 31252 34818 gene locus_tag LOCUS_02140 31252 34818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 35980 34811 gene locus_tag LOCUS_02150 35980 34811 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_02150 36009 36758 gene locus_tag LOCUS_02160 gene cmk 36009 36758 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_02160 36737 37618 gene locus_tag LOCUS_02170 36737 37618 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_02170 37618 39243 gene locus_tag LOCUS_02180 37618 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 40981 39245 gene locus_tag LOCUS_02190 40981 39245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 41886 41032 gene locus_tag LOCUS_02200 41886 41032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 42828 41932 gene locus_tag LOCUS_02210 42828 41932 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_02210 43594 42821 gene locus_tag LOCUS_02220 43594 42821 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_02220 43674 44669 gene locus_tag LOCUS_02230 43674 44669 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_02230 46548 44641 gene locus_tag LOCUS_02240 46548 44641 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_02240 47112 46603 gene locus_tag LOCUS_02250 gene purE 47112 46603 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_02250 47159 47695 gene locus_tag LOCUS_02260 gene hpt 47159 47695 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_02260 47696 48274 gene locus_tag LOCUS_02270 47696 48274 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_02270 48253 49248 gene locus_tag LOCUS_02280 gene obgE 48253 49248 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_02280 49224 49814 gene locus_tag LOCUS_02290 49224 49814 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_02290 49795 50781 gene locus_tag LOCUS_02300 49795 50781 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_02300 52806 50770 gene locus_tag LOCUS_02310 gene scpA 52806 50770 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_02310 54614 52803 gene locus_tag LOCUS_02320 gene mutA 54614 52803 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_02320 56612 54636 gene locus_tag LOCUS_02330 56612 54636 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_02330 56722 56913 gene locus_tag LOCUS_02340 gene rpsU 56722 56913 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_02340 57132 57231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57309 58031 gene locus_tag LOCUS_02350 gene xerC 57309 58031 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_02350 58077 58370 gene locus_tag LOCUS_02360 gene raiA 58077 58370 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021962.1 protein_id gnl|my_center|LOCUS_02360 59354 58374 gene locus_tag LOCUS_02370 59354 58374 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_02370 60931 59357 gene locus_tag LOCUS_02380 gene atpA 60931 59357 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence005 <1 1158 gene locus_tag LOCUS_02390 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784328.1:alkaline phosphatase 1268 2062 gene locus_tag LOCUS_02400 1268 2062 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_02400 2046 2804 gene locus_tag LOCUS_02410 2046 2804 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109112.1 protein_id gnl|my_center|LOCUS_02410 2846 4240 gene locus_tag LOCUS_02420 gene ahcY 2846 4240 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_02420 4246 5637 gene locus_tag LOCUS_02430 gene asnS 4246 5637 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_02430 5639 6253 gene locus_tag LOCUS_02440 gene udk 5639 6253 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_02440 6266 6979 gene locus_tag LOCUS_02450 6266 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7083 7182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7231 7512 gene locus_tag LOCUS_02460 7231 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 7502 8194 gene locus_tag LOCUS_02470 gene rsmI 7502 8194 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784666.1 protein_id gnl|my_center|LOCUS_02470 8181 8816 gene locus_tag LOCUS_02480 8181 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 8874 9803 gene locus_tag LOCUS_02490 8874 9803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_02490 9800 11143 gene locus_tag LOCUS_02500 9800 11143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_02500 11113 11895 gene locus_tag LOCUS_02510 11113 11895 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 protein_id gnl|my_center|LOCUS_02510 11892 12701 gene locus_tag LOCUS_02520 11892 12701 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763634.1 protein_id gnl|my_center|LOCUS_02520 12713 13285 gene locus_tag LOCUS_02530 12713 13285 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_02530 13272 14378 gene locus_tag LOCUS_02540 13272 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 15430 14387 gene locus_tag LOCUS_02550 gene holA 15430 14387 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_02550 15529 15891 gene locus_tag LOCUS_02560 15529 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 15902 17305 gene locus_tag LOCUS_02570 15902 17305 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_02570 17873 17286 gene locus_tag LOCUS_02580 gene folE 17873 17286 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_02580 18011 18724 gene locus_tag LOCUS_02590 18011 18724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_02590 18721 19275 gene locus_tag LOCUS_02600 18721 19275 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_02600 19306 19527 gene locus_tag LOCUS_02610 19306 19527 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_02610 19537 20889 gene locus_tag LOCUS_02620 gene trkA 19537 20889 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_02620 21344 20871 gene locus_tag LOCUS_02630 21344 20871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 21814 21341 gene locus_tag LOCUS_02640 21814 21341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 22723 25488 gene locus_tag LOCUS_02650 gene leuS 22723 25488 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_02650 25485 26390 gene locus_tag LOCUS_02660 25485 26390 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_02660 27686 26394 gene locus_tag LOCUS_02670 27686 26394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 28792 27683 gene locus_tag LOCUS_02680 gene gcvT 28792 27683 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_02680 29269 28796 gene locus_tag LOCUS_02690 29269 28796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 29468 30604 gene locus_tag LOCUS_02700 29468 30604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 32216 31383 gene locus_tag LOCUS_02710 32216 31383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 32644 32213 gene locus_tag LOCUS_02720 32644 32213 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_02720 33700 32648 gene locus_tag LOCUS_02730 33700 32648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 33751 34767 gene locus_tag LOCUS_02740 33751 34767 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_02740 34764 35768 gene locus_tag LOCUS_02750 34764 35768 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_02750 35746 37380 gene locus_tag LOCUS_02760 35746 37380 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_02760 40077 37474 gene locus_tag LOCUS_02770 40077 37474 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107599.1 protein_id gnl|my_center|LOCUS_02770 37507 37606 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40963 40067 gene locus_tag LOCUS_02780 gene prfB 40963 40067 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02780 41645 41166 gene locus_tag LOCUS_02790 41645 41166 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389336.1 protein_id gnl|my_center|LOCUS_02790 41964 41785 gene locus_tag LOCUS_02800 41964 41785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 42524 42060 gene locus_tag LOCUS_02810 gene recX 42524 42060 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228243.1 protein_id gnl|my_center|LOCUS_02810 43549 42524 gene locus_tag LOCUS_02820 gene rlmN 43549 42524 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840521.1 protein_id gnl|my_center|LOCUS_02820 43617 44660 gene locus_tag LOCUS_02830 gene recA 43617 44660 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_02830 45602 44661 gene locus_tag LOCUS_02840 gene aroC 45602 44661 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_02840 46891 45599 gene locus_tag LOCUS_02850 gene aroA 46891 45599 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_02850 47033 48022 gene locus_tag LOCUS_02860 gene trpS 47033 48022 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694505.1 protein_id gnl|my_center|LOCUS_02860 48022 49947 gene locus_tag LOCUS_02870 gene dnaG 48022 49947 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_02870 49969 51993 gene locus_tag LOCUS_02880 gene metG 49969 51993 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_02880 52016 53371 gene locus_tag LOCUS_02890 52016 53371 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_02890 54430 53375 gene locus_tag LOCUS_02900 gene ansB 54430 53375 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707533.1 protein_id gnl|my_center|LOCUS_02900 54486 55043 gene locus_tag LOCUS_02910 54486 55043 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_02910 55763 55029 gene locus_tag LOCUS_02920 55763 55029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_02920 56483 55764 gene locus_tag LOCUS_02930 56483 55764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681925.1 protein_id gnl|my_center|LOCUS_02930 56624 57814 gene locus_tag LOCUS_02940 56624 57814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence006 173 1627 gene locus_tag LOCUS_02950 173 1627 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_02950 1594 2898 gene locus_tag LOCUS_02960 1594 2898 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767086.1 protein_id gnl|my_center|LOCUS_02960 2898 4211 gene locus_tag LOCUS_02970 2898 4211 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_02970 4226 5473 gene locus_tag LOCUS_02980 4226 5473 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_02980 5485 6609 gene locus_tag LOCUS_02990 5485 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 6644 8059 gene locus_tag LOCUS_03000 6644 8059 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_03000 8072 8815 gene locus_tag LOCUS_03010 8072 8815 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_03010 8812 9993 gene locus_tag LOCUS_03020 8812 9993 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_03020 10717 9983 gene locus_tag LOCUS_03030 10717 9983 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203143.1 protein_id gnl|my_center|LOCUS_03030 11819 10725 gene locus_tag LOCUS_03040 11819 10725 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763948.1 protein_id gnl|my_center|LOCUS_03040 12477 11797 gene locus_tag LOCUS_03050 12477 11797 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_03050 12630 13436 gene locus_tag LOCUS_03060 12630 13436 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141814429.1 protein_id gnl|my_center|LOCUS_03060 14048 13437 gene locus_tag LOCUS_03070 14048 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 15124 14045 gene locus_tag LOCUS_03080 15124 14045 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_03080 16481 15174 gene locus_tag LOCUS_03090 16481 15174 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_03090 17350 16493 gene locus_tag LOCUS_03100 17350 16493 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_03100 17720 17340 gene locus_tag LOCUS_03110 17720 17340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 19017 17725 gene locus_tag LOCUS_03120 19017 17725 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_03120 20500 19034 gene locus_tag LOCUS_03130 20500 19034 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_03130 23966 20502 gene locus_tag LOCUS_03140 23966 20502 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_03140 24691 23948 gene locus_tag LOCUS_03150 24691 23948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 25041 24664 gene locus_tag LOCUS_03160 25041 24664 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_03160 25642 25028 gene locus_tag LOCUS_03170 25642 25028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 26002 25646 gene locus_tag LOCUS_03180 26002 25646 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393711.1 protein_id gnl|my_center|LOCUS_03180 26889 25996 gene locus_tag LOCUS_03190 26889 25996 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_03190 28094 26895 gene locus_tag LOCUS_03200 28094 26895 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_03200 28360 28103 gene locus_tag LOCUS_03210 28360 28103 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_03210 28979 28368 gene locus_tag LOCUS_03220 28979 28368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_03220 30124 28976 gene locus_tag LOCUS_03230 30124 28976 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_03230 30525 30097 gene locus_tag LOCUS_03240 30525 30097 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_03240 30955 30512 gene locus_tag LOCUS_03250 30955 30512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964368.1 protein_id gnl|my_center|LOCUS_03250 31854 30961 gene locus_tag LOCUS_03260 31854 30961 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_03260 32102 31854 gene locus_tag LOCUS_03270 32102 31854 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_03270 33339 32122 gene locus_tag LOCUS_03280 33339 32122 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_03280 34075 33347 gene locus_tag LOCUS_03290 gene fabG 34075 33347 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_03290 35609 34080 gene locus_tag LOCUS_03300 35609 34080 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_03300 37842 35656 gene locus_tag LOCUS_03310 37842 35656 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_03310 37841 38866 gene locus_tag LOCUS_03320 gene mgrA 37841 38866 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_03320 38878 39765 gene locus_tag LOCUS_03330 38878 39765 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_03330 40806 39760 gene locus_tag LOCUS_03340 40806 39760 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109241.1 protein_id gnl|my_center|LOCUS_03340 41620 40913 gene locus_tag LOCUS_03350 41620 40913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 41783 42301 gene locus_tag LOCUS_03360 41783 42301 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_03360 42282 43496 gene locus_tag LOCUS_03370 42282 43496 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202363.1 protein_id gnl|my_center|LOCUS_03370 43588 43779 gene locus_tag LOCUS_03380 43588 43779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 43843 44430 gene locus_tag LOCUS_03390 43843 44430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 44406 51719 gene locus_tag LOCUS_03400 44406 51719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 52912 51773 gene locus_tag LOCUS_03410 52912 51773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 53080 53577 gene locus_tag LOCUS_03420 53080 53577 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence007 <1 2298 gene locus_tag LOCUS_03430 <1 2298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303096.1:histidine kinase 2295 3059 gene locus_tag LOCUS_03440 2295 3059 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_03440 3518 3617 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3717 3628 gene locus_tag LOCUS_t00040 3717 3628 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4716 3760 gene locus_tag LOCUS_03450 gene floA 4716 3760 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_03450 5201 4731 gene locus_tag LOCUS_03460 5201 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 7189 5213 gene locus_tag LOCUS_03470 7189 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7290 10346 gene locus_tag LOCUS_03480 gene secDF 7290 10346 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_03480 10863 10354 gene locus_tag LOCUS_03490 10863 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 10919 12706 gene locus_tag LOCUS_03500 10919 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 12019 12118 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16299 12712 gene locus_tag LOCUS_03510 gene dnaE 16299 12712 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_03510 17829 16306 gene locus_tag LOCUS_03520 gene gpmI 17829 16306 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108817.1 protein_id gnl|my_center|LOCUS_03520 17888 19927 gene locus_tag LOCUS_03530 gene rnr 17888 19927 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_03530 19932 20519 gene locus_tag LOCUS_03540 19932 20519 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_03540 21566 20526 gene locus_tag LOCUS_03550 gene thiL 21566 20526 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_03550 21587 23053 gene locus_tag LOCUS_03560 gene sufB 21587 23053 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_03560 23056 23715 gene locus_tag LOCUS_03570 gene pnuC 23056 23715 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621371.1 protein_id gnl|my_center|LOCUS_03570 23709 24455 gene locus_tag LOCUS_03580 gene sufC 23709 24455 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_03580 24452 25489 gene locus_tag LOCUS_03590 24452 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 25610 28153 gene locus_tag LOCUS_03600 25610 28153 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_03600 28164 28946 gene locus_tag LOCUS_03610 gene ispE 28164 28946 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107363.1 protein_id gnl|my_center|LOCUS_03610 28975 29616 gene locus_tag LOCUS_03620 28975 29616 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_03620 30529 29594 gene locus_tag LOCUS_03630 30529 29594 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_03630 31958 30537 gene locus_tag LOCUS_03640 31958 30537 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784474.1 protein_id gnl|my_center|LOCUS_03640 33234 31966 gene locus_tag LOCUS_03650 33234 31966 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_03650 33417 34712 gene locus_tag LOCUS_03660 gene tyrS 33417 34712 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_03660 34709 35068 gene locus_tag LOCUS_03670 gene rbfA 34709 35068 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_03670 35084 36328 gene locus_tag LOCUS_03680 35084 36328 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_03680 37110 36250 gene locus_tag LOCUS_03690 37110 36250 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_03690 39455 37107 gene locus_tag LOCUS_03700 39455 37107 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_03700 41240 39612 gene locus_tag LOCUS_03710 gene groL 41240 39612 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_03710 41590 41270 gene locus_tag LOCUS_03720 41590 41270 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_03720 42333 41638 gene locus_tag LOCUS_03730 gene pnuC 42333 41638 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837609.1 protein_id gnl|my_center|LOCUS_03730 45242 42339 gene locus_tag LOCUS_03740 45242 42339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_03740 45373 45302 gene locus_tag LOCUS_t00050 45373 45302 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 45451 45380 gene locus_tag LOCUS_t00060 45451 45380 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 45889 45476 gene locus_tag LOCUS_03750 45889 45476 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_03750 47681 45897 gene locus_tag LOCUS_03760 47681 45897 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence008 1154 30 gene locus_tag LOCUS_03770 gene dnaN 1154 30 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_03770 2795 1182 gene locus_tag LOCUS_03780 2795 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3602 2802 gene locus_tag LOCUS_03790 gene surE 3602 2802 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_03790 3617 4687 gene locus_tag LOCUS_03800 gene gapA 3617 4687 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224141.1 protein_id gnl|my_center|LOCUS_03800 4755 5768 gene locus_tag LOCUS_03810 4755 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5761 6522 gene locus_tag LOCUS_03820 5761 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 9424 6503 gene locus_tag LOCUS_03830 9424 6503 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_03830 9424 11094 gene locus_tag LOCUS_03840 9424 11094 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_03840 11101 12402 gene locus_tag LOCUS_03850 11101 12402 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_03850 13651 12380 gene locus_tag LOCUS_03860 13651 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 14316 13648 gene locus_tag LOCUS_03870 14316 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 16168 14282 gene locus_tag LOCUS_03880 16168 14282 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108779.1 protein_id gnl|my_center|LOCUS_03880 18325 16172 gene locus_tag LOCUS_03890 18325 16172 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_03890 19528 18332 gene locus_tag LOCUS_03900 19528 18332 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869039.1 protein_id gnl|my_center|LOCUS_03900 21606 19531 gene locus_tag LOCUS_03910 gene ligA 21606 19531 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_03910 23562 21634 gene locus_tag LOCUS_03920 23562 21634 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_03920 23656 25251 gene locus_tag LOCUS_03930 gene pckA 23656 25251 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217613.1 protein_id gnl|my_center|LOCUS_03930 26765 25524 gene locus_tag LOCUS_03940 gene pfp 26765 25524 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_03940 27474 26812 gene locus_tag LOCUS_03950 27474 26812 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_03950 28026 27478 gene locus_tag LOCUS_03960 28026 27478 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_03960 28071 30890 gene locus_tag LOCUS_03970 28071 30890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 32154 30892 gene locus_tag LOCUS_03980 32154 30892 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250375.1 protein_id gnl|my_center|LOCUS_03980 32449 32135 gene locus_tag LOCUS_03990 32449 32135 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_03990 32516 35314 gene locus_tag LOCUS_04000 32516 35314 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_04000 35059 35158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35391 38402 gene locus_tag LOCUS_04010 35391 38402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 38399 38815 gene locus_tag LOCUS_04020 38399 38815 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_04020 38833 39039 gene locus_tag LOCUS_04030 38833 39039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 39045 39869 gene locus_tag LOCUS_04040 gene tatC 39045 39869 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_04040 39850 41430 gene locus_tag LOCUS_04050 39850 41430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 41427 43385 gene locus_tag LOCUS_04060 41427 43385 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799194.1 protein_id gnl|my_center|LOCUS_04060 43378 44115 gene locus_tag LOCUS_04070 gene rlmB 43378 44115 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence009 344 763 gene locus_tag LOCUS_04080 344 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1242 772 gene locus_tag LOCUS_04090 1242 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 1634 1239 gene locus_tag LOCUS_04100 1634 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 2136 1621 gene locus_tag LOCUS_04110 2136 1621 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_04110 2314 2129 gene locus_tag LOCUS_04120 2314 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2795 2316 gene locus_tag LOCUS_04130 2795 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2895 4199 gene locus_tag LOCUS_04140 gene purD 2895 4199 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_04140 4201 5151 gene locus_tag LOCUS_04150 4201 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6519 5089 gene locus_tag LOCUS_04160 6519 5089 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793956.1 protein_id gnl|my_center|LOCUS_04160 7310 6519 gene locus_tag LOCUS_04170 gene ccsA 7310 6519 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787665.1 protein_id gnl|my_center|LOCUS_04170 8188 7307 gene locus_tag LOCUS_04180 8188 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 8258 9400 gene locus_tag LOCUS_04190 8258 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 9646 9575 gene locus_tag LOCUS_t00070 9646 9575 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10711 9665 gene locus_tag LOCUS_04200 10711 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 11912 10692 gene locus_tag LOCUS_04210 11912 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 12010 12109 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14667 12484 gene locus_tag LOCUS_04220 14667 12484 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764507.1 protein_id gnl|my_center|LOCUS_04220 14817 16013 gene locus_tag LOCUS_04230 14817 16013 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_04230 16070 16438 gene locus_tag LOCUS_04240 16070 16438 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_04240 16963 16619 gene locus_tag LOCUS_04250 16963 16619 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_04250 17051 17995 gene locus_tag LOCUS_04260 gene nusB 17051 17995 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_04260 18028 18357 gene locus_tag LOCUS_04270 gene yajC 18028 18357 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_04270 18384 19328 gene locus_tag LOCUS_04280 18384 19328 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 protein_id gnl|my_center|LOCUS_04280 19333 19944 gene locus_tag LOCUS_04290 gene coaE 19333 19944 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_04290 19934 20521 gene locus_tag LOCUS_04300 19934 20521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 20536 21858 gene locus_tag LOCUS_04310 gene rimO 20536 21858 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_04310 21861 22622 gene locus_tag LOCUS_04320 gene fabG 21861 22622 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_04320 22644 23591 gene locus_tag LOCUS_04330 22644 23591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 23588 23770 gene locus_tag LOCUS_04340 23588 23770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 23791 26745 gene locus_tag LOCUS_04350 23791 26745 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_04350 28525 30195 gene locus_tag LOCUS_04360 28525 30195 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_04360 30247 31005 gene locus_tag LOCUS_04370 30247 31005 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_04370 31089 33341 gene locus_tag LOCUS_04380 31089 33341 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_04380 33329 33928 gene locus_tag LOCUS_04390 gene pnuC 33329 33928 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_04390 33952 35238 gene locus_tag LOCUS_04400 33952 35238 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_04400 35235 36050 gene locus_tag LOCUS_04410 35235 36050 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_04410 36125 36958 gene locus_tag LOCUS_04420 36125 36958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 37081 38001 gene locus_tag LOCUS_04430 37081 38001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence010 <1 1028 gene locus_tag LOCUS_04440 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963885.1:tRNA 2-thiouridine(34) synthase MnmA 2595 1009 gene locus_tag LOCUS_04450 2595 1009 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_04450 2739 3752 gene locus_tag LOCUS_04460 2739 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3783 5036 gene locus_tag LOCUS_04470 3783 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 5829 5014 gene locus_tag LOCUS_04480 5829 5014 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_04480 7741 5810 gene locus_tag LOCUS_04490 gene rpsA 7741 5810 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_04490 7939 9168 gene locus_tag LOCUS_04500 7939 9168 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_04500 9173 10960 gene locus_tag LOCUS_04510 9173 10960 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_04510 11816 10965 gene locus_tag LOCUS_04520 11816 10965 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_04520 14208 11821 gene locus_tag LOCUS_04530 14208 11821 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_04530 15161 14205 gene locus_tag LOCUS_04540 gene corA 15161 14205 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_04540 16912 15404 gene locus_tag LOCUS_04550 16912 15404 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_04550 17545 16928 gene locus_tag LOCUS_04560 gene recR 17545 16928 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787270.1 protein_id gnl|my_center|LOCUS_04560 18362 17538 gene locus_tag LOCUS_04570 gene murQ 18362 17538 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760452.1 protein_id gnl|my_center|LOCUS_04570 19210 18359 gene locus_tag LOCUS_04580 19210 18359 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_04580 19293 21353 gene locus_tag LOCUS_04590 19293 21353 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_04590 21576 21797 gene locus_tag LOCUS_04600 21576 21797 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_04600 21811 22893 gene locus_tag LOCUS_04610 21811 22893 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_04610 22906 23667 gene locus_tag LOCUS_04620 22906 23667 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_04620 23670 24215 gene locus_tag LOCUS_04630 23670 24215 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_04630 24270 24563 gene locus_tag LOCUS_04640 24270 24563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_04640 24573 24863 gene locus_tag LOCUS_04650 24573 24863 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_04650 25112 26662 gene locus_tag LOCUS_04660 gene rny 25112 26662 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760083.1 protein_id gnl|my_center|LOCUS_04660 28082 26646 gene locus_tag LOCUS_04670 28082 26646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 29453 28089 gene locus_tag LOCUS_04680 29453 28089 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_04680 30709 29465 gene locus_tag LOCUS_04690 gene clpX 30709 29465 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_04690 31386 30709 gene locus_tag LOCUS_04700 gene clpP 31386 30709 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_04700 32685 31390 gene locus_tag LOCUS_04710 gene tig 32685 31390 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_04710 32790 33548 gene locus_tag LOCUS_04720 gene tpiA 32790 33548 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_04720 33552 34433 gene locus_tag LOCUS_04730 gene prmA 33552 34433 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence011 1342 2 gene locus_tag LOCUS_04740 1342 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2577 1354 gene locus_tag LOCUS_04750 2577 1354 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_04750 5878 2681 gene locus_tag LOCUS_04760 gene mfd 5878 2681 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766199.1 protein_id gnl|my_center|LOCUS_04760 7091 5865 gene locus_tag LOCUS_04770 7091 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 8117 7104 gene locus_tag LOCUS_04780 gene ruvB 8117 7104 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_04780 8683 8306 gene locus_tag LOCUS_04790 8683 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 10934 8673 gene locus_tag LOCUS_04800 gene xdhB 10934 8673 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_04800 12336 10927 gene locus_tag LOCUS_04810 gene xdhA 12336 10927 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186232.1 protein_id gnl|my_center|LOCUS_04810 14542 12341 gene locus_tag LOCUS_04820 14542 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 15050 14553 gene locus_tag LOCUS_04830 15050 14553 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765910.1 protein_id gnl|my_center|LOCUS_04830 16242 15052 gene locus_tag LOCUS_04840 16242 15052 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_04840 16314 18257 gene locus_tag LOCUS_04850 16314 18257 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_04850 18259 19011 gene locus_tag LOCUS_04860 18259 19011 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_04860 19558 18941 gene locus_tag LOCUS_04870 19558 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 19652 20362 gene locus_tag LOCUS_04880 19652 20362 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_04880 21047 20355 gene locus_tag LOCUS_04890 21047 20355 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_04890 22322 21165 gene locus_tag LOCUS_04900 gene hflX 22322 21165 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_04900 23078 22386 gene locus_tag LOCUS_04910 23078 22386 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_04910 23172 23098 gene locus_tag LOCUS_t00080 23172 23098 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23247 23687 gene locus_tag LOCUS_04920 gene ybeY 23247 23687 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_04920 23677 25554 gene locus_tag LOCUS_04930 gene mnmG 23677 25554 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_04930 25731 28061 gene locus_tag LOCUS_04940 25731 28061 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_04940 28775 28065 gene locus_tag LOCUS_04950 28775 28065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 <29406 28756 gene locus_tag LOCUS_04960 <29406 28756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963830.1:AMP-dependent synthetase/ligase >Feature sequence012 566 177 gene locus_tag LOCUS_04970 566 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 692 1234 gene locus_tag LOCUS_04980 692 1234 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_04980 1246 1713 gene locus_tag LOCUS_04990 1246 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4199 1710 gene locus_tag LOCUS_05000 4199 1710 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_05000 5393 4218 gene locus_tag LOCUS_05010 5393 4218 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_05010 6128 5421 gene locus_tag LOCUS_05020 6128 5421 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_05020 6518 6135 gene locus_tag LOCUS_05030 6518 6135 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791034.1 protein_id gnl|my_center|LOCUS_05030 7111 6530 gene locus_tag LOCUS_05040 7111 6530 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_05040 7802 7116 gene locus_tag LOCUS_05050 7802 7116 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_05050 9515 7806 gene locus_tag LOCUS_05060 gene mutL 9515 7806 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_05060 9841 9512 gene locus_tag LOCUS_05070 9841 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 10981 9854 gene locus_tag LOCUS_05080 10981 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 11565 10978 gene locus_tag LOCUS_05090 gene purN 11565 10978 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_05090 11604 12116 gene locus_tag LOCUS_05100 gene ispF 11604 12116 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_05100 12173 12247 gene locus_tag LOCUS_t00090 12173 12247 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12326 13021 gene locus_tag LOCUS_05110 12326 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 13268 12972 gene locus_tag LOCUS_05120 13268 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 13267 13632 gene locus_tag LOCUS_05130 13267 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 13577 13762 gene locus_tag LOCUS_05140 13577 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13804 14211 gene locus_tag LOCUS_05150 13804 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 14224 14661 gene locus_tag LOCUS_05160 14224 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 15298 14711 gene locus_tag LOCUS_05170 15298 14711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 15421 15957 gene locus_tag LOCUS_05180 15421 15957 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_05180 16018 16578 gene locus_tag LOCUS_05190 16018 16578 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583840.1 protein_id gnl|my_center|LOCUS_05190 17879 16584 gene locus_tag LOCUS_05200 17879 16584 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_05200 18004 18594 gene locus_tag LOCUS_05210 18004 18594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 18762 19766 gene locus_tag LOCUS_05220 18762 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 19773 20474 gene locus_tag LOCUS_05230 19773 20474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_05230 20487 21695 gene locus_tag LOCUS_05240 20487 21695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 21692 22984 gene locus_tag LOCUS_05250 21692 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 22997 23773 gene locus_tag LOCUS_05260 22997 23773 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_05260 24088 23774 gene locus_tag LOCUS_05270 24088 23774 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_05270 24197 24757 gene locus_tag LOCUS_05280 24197 24757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 24838 25941 gene locus_tag LOCUS_05290 24838 25941 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence013 <1 563 gene locus_tag LOCUS_05300 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107406.1:DUF4301 family protein 889 1038 gene locus_tag LOCUS_05310 889 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 2145 1111 gene locus_tag LOCUS_05320 2145 1111 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639944.1 protein_id gnl|my_center|LOCUS_05320 2231 3388 gene locus_tag LOCUS_05330 gene lysA 2231 3388 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_05330 3394 4011 gene locus_tag LOCUS_05340 3394 4011 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_05340 4021 5355 gene locus_tag LOCUS_05350 gene ffh 4021 5355 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_05350 5355 6233 gene locus_tag LOCUS_05360 gene folD 5355 6233 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_05360 6241 7188 gene locus_tag LOCUS_05370 6241 7188 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_05370 7188 8687 gene locus_tag LOCUS_05380 7188 8687 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_05380 9418 8684 gene locus_tag LOCUS_05390 gene trmD 9418 8684 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_05390 9459 11228 gene locus_tag LOCUS_05400 9459 11228 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_05400 11221 13095 gene locus_tag LOCUS_05410 gene yidC 11221 13095 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_05410 13883 13092 gene locus_tag LOCUS_05420 gene dapF 13883 13092 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_05420 13952 15400 gene locus_tag LOCUS_05430 13952 15400 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_05430 15478 16338 gene locus_tag LOCUS_05440 15478 16338 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_05440 16342 17682 gene locus_tag LOCUS_05450 16342 17682 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836461.1 protein_id gnl|my_center|LOCUS_05450 17679 19457 gene locus_tag LOCUS_05460 gene argS 17679 19457 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_05460 19514 19879 gene locus_tag LOCUS_05470 19514 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 19791 21608 gene locus_tag LOCUS_05480 19791 21608 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_05480 21601 23754 gene locus_tag LOCUS_05490 21601 23754 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_05490 24659 23730 gene locus_tag LOCUS_05500 24659 23730 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_05500 26006 24663 gene locus_tag LOCUS_05510 26006 24663 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_05510 26754 26008 gene locus_tag LOCUS_05520 26754 26008 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence014 220 1479 gene locus_tag LOCUS_05530 220 1479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_05530 2235 1483 gene locus_tag LOCUS_05540 2235 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2667 2254 gene locus_tag LOCUS_05550 2667 2254 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_05550 3345 2677 gene locus_tag LOCUS_05560 3345 2677 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_05560 4126 3347 gene locus_tag LOCUS_05570 gene truA 4126 3347 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_05570 4189 5181 gene locus_tag LOCUS_05580 4189 5181 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_05580 5182 6072 gene locus_tag LOCUS_05590 5182 6072 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_05590 6075 7088 gene locus_tag LOCUS_05600 6075 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 7098 8087 gene locus_tag LOCUS_05610 7098 8087 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_05610 8094 9812 gene locus_tag LOCUS_05620 8094 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 9813 11636 gene locus_tag LOCUS_05630 9813 11636 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_05630 11646 12410 gene locus_tag LOCUS_05640 11646 12410 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_05640 12432 13073 gene locus_tag LOCUS_05650 12432 13073 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_05650 13063 15324 gene locus_tag LOCUS_05660 13063 15324 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109202.1 protein_id gnl|my_center|LOCUS_05660 15321 15914 gene locus_tag LOCUS_05670 15321 15914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 16727 15906 gene locus_tag LOCUS_05680 16727 15906 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929723.1 protein_id gnl|my_center|LOCUS_05680 18148 16817 gene locus_tag LOCUS_05690 18148 16817 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_05690 18575 18168 gene locus_tag LOCUS_05700 18575 18168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 19210 18578 gene locus_tag LOCUS_05710 gene pyrE 19210 18578 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962823.1 protein_id gnl|my_center|LOCUS_05710 19297 19923 gene locus_tag LOCUS_05720 19297 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 20142 19843 gene locus_tag LOCUS_05730 20142 19843 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176701.1 protein_id gnl|my_center|LOCUS_05730 21446 20199 gene locus_tag LOCUS_05740 gene nqrF 21446 20199 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_05740 22073 21456 gene locus_tag LOCUS_05750 gene nqrE 22073 21456 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 protein_id gnl|my_center|LOCUS_05750 22693 22061 gene locus_tag LOCUS_05760 22693 22061 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_05760 23297 22686 gene locus_tag LOCUS_05770 23297 22686 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_05770 24408 23290 gene locus_tag LOCUS_05780 24408 23290 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_05780 25772 24405 gene locus_tag LOCUS_05790 25772 24405 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence015 198 1367 gene locus_tag LOCUS_05800 198 1367 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793803.1 protein_id gnl|my_center|LOCUS_05800 2306 2734 gene locus_tag LOCUS_05810 2306 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 2949 8309 gene locus_tag LOCUS_05820 2949 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 8770 9546 gene locus_tag LOCUS_05830 8770 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 9530 10087 gene locus_tag LOCUS_05840 9530 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 10226 10645 gene locus_tag LOCUS_05850 10226 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 10852 11931 gene locus_tag LOCUS_05860 10852 11931 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_05860 11935 14220 gene locus_tag LOCUS_05870 11935 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 14213 15127 gene locus_tag LOCUS_05880 14213 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 15140 16690 gene locus_tag LOCUS_05890 15140 16690 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_05890 16683 17156 gene locus_tag LOCUS_05900 16683 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 17149 18261 gene locus_tag LOCUS_05910 17149 18261 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691244.1 protein_id gnl|my_center|LOCUS_05910 18310 21534 gene locus_tag LOCUS_05920 18310 21534 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_05920 21654 22835 gene locus_tag LOCUS_05930 21654 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 23109 23870 gene locus_tag LOCUS_05940 23109 23870 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 protein_id gnl|my_center|LOCUS_05940 23863 24765 gene locus_tag LOCUS_05950 23863 24765 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence016 3876 784 gene locus_tag LOCUS_05960 3876 784 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_05960 5729 4077 gene locus_tag LOCUS_05970 5729 4077 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108757.1 protein_id gnl|my_center|LOCUS_05970 7140 5740 gene locus_tag LOCUS_05980 7140 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 8318 7128 gene locus_tag LOCUS_05990 8318 7128 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 protein_id gnl|my_center|LOCUS_05990 9830 8382 gene locus_tag LOCUS_06000 9830 8382 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_06000 10201 10872 gene locus_tag LOCUS_06010 10201 10872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_06010 10884 12140 gene locus_tag LOCUS_06020 10884 12140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_06020 12143 13399 gene locus_tag LOCUS_06030 12143 13399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_06030 13422 14522 gene locus_tag LOCUS_06040 13422 14522 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_06040 14523 15881 gene locus_tag LOCUS_06050 14523 15881 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_06050 16183 15887 gene locus_tag LOCUS_06060 16183 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_06060 19281 16180 gene locus_tag LOCUS_06070 19281 16180 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_06070 20304 19288 gene locus_tag LOCUS_06080 20304 19288 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_06080 21645 20308 gene locus_tag LOCUS_06090 21645 20308 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_06090 21835 22758 gene locus_tag LOCUS_06100 21835 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 22755 23474 gene locus_tag LOCUS_06110 22755 23474 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_06110 24318 23431 gene locus_tag LOCUS_06120 24318 23431 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence017 <1 2256 gene locus_tag LOCUS_06130 <1 2256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082478.1:beta-glucosidase 3571 2192 gene locus_tag LOCUS_06140 gene gltA 3571 2192 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_06140 4421 3564 gene locus_tag LOCUS_06150 4421 3564 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_06150 7027 4481 gene locus_tag LOCUS_06160 7027 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 8085 7075 gene locus_tag LOCUS_06170 8085 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9685 8093 gene locus_tag LOCUS_06180 9685 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8190 8289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9946 9743 gene locus_tag LOCUS_06190 9946 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10221 11975 gene locus_tag LOCUS_06200 gene sppA 10221 11975 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_06200 13239 11890 gene locus_tag LOCUS_06210 gene tilS 13239 11890 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_06210 14311 13247 gene locus_tag LOCUS_06220 14311 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 15032 14322 gene locus_tag LOCUS_06230 15032 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 16515 15043 gene locus_tag LOCUS_06240 gene proS 16515 15043 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_06240 16656 17981 gene locus_tag LOCUS_06250 16656 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 18019 19536 gene locus_tag LOCUS_06260 18019 19536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 20115 19510 gene locus_tag LOCUS_06270 20115 19510 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_06270 20917 20117 gene locus_tag LOCUS_06280 gene lpxA 20917 20117 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_06280 21826 20924 gene locus_tag LOCUS_06290 21826 20924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 22813 21827 gene locus_tag LOCUS_06300 gene lpxD 22813 21827 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_06300 22987 24231 gene locus_tag LOCUS_06310 gene nusA 22987 24231 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence018 1160 399 gene locus_tag LOCUS_06320 1160 399 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681110.1 protein_id gnl|my_center|LOCUS_06320 2103 1141 gene locus_tag LOCUS_06330 2103 1141 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_06330 2262 2507 gene locus_tag LOCUS_06340 2262 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2509 4704 gene locus_tag LOCUS_06350 2509 4704 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545775.1 protein_id gnl|my_center|LOCUS_06350 5202 4687 gene locus_tag LOCUS_06360 5202 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 5631 5215 gene locus_tag LOCUS_06370 5631 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 5755 6312 gene locus_tag LOCUS_06380 5755 6312 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_06380 6392 6826 gene locus_tag LOCUS_06390 6392 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 6925 7506 gene locus_tag LOCUS_06400 6925 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 7511 8029 gene locus_tag LOCUS_06410 7511 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 9660 8035 gene locus_tag LOCUS_06420 9660 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 10273 9644 gene locus_tag LOCUS_06430 10273 9644 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_06430 11618 10257 gene locus_tag LOCUS_06440 11618 10257 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766607.1 protein_id gnl|my_center|LOCUS_06440 12966 11611 gene locus_tag LOCUS_06450 12966 11611 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766054.1 protein_id gnl|my_center|LOCUS_06450 14270 12963 gene locus_tag LOCUS_06460 14270 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 13680 13779 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14722 14267 gene locus_tag LOCUS_06470 gene ruvX 14722 14267 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_06470 14744 15604 gene locus_tag LOCUS_06480 14744 15604 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_06480 15606 16769 gene locus_tag LOCUS_06490 15606 16769 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_06490 16774 18102 gene locus_tag LOCUS_06500 gene rseP 16774 18102 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_06500 18121 19119 gene locus_tag LOCUS_06510 18121 19119 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_06510 19156 19228 gene locus_tag LOCUS_t00100 19156 19228 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 19247 19501 gene locus_tag LOCUS_06520 gene rpsT 19247 19501 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_06520 19532 20257 gene locus_tag LOCUS_06530 gene radC 19532 20257 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_06530 20297 20950 gene locus_tag LOCUS_06540 gene upp 20297 20950 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_06540 22592 20952 gene locus_tag LOCUS_06550 22592 20952 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_06550 24006 22594 gene locus_tag LOCUS_06560 gene rpoN 24006 22594 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence019 471 1523 gene locus_tag LOCUS_06570 471 1523 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_06570 2107 1520 gene locus_tag LOCUS_06580 2107 1520 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_06580 2152 5943 gene locus_tag LOCUS_06590 2152 5943 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_06590 5945 7945 gene locus_tag LOCUS_06600 5945 7945 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_06600 8498 7899 gene locus_tag LOCUS_06610 8498 7899 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_06610 8500 9072 gene locus_tag LOCUS_06620 8500 9072 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_06620 9920 9048 gene locus_tag LOCUS_06630 gene metF 9920 9048 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757857.1 protein_id gnl|my_center|LOCUS_06630 13399 9917 gene locus_tag LOCUS_06640 gene metH 13399 9917 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729624.1 protein_id gnl|my_center|LOCUS_06640 13724 13446 gene locus_tag LOCUS_06650 13724 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 14923 13745 gene locus_tag LOCUS_06660 14923 13745 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_06660 16156 14945 gene locus_tag LOCUS_06670 16156 14945 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_06670 16215 17141 gene locus_tag LOCUS_06680 16215 17141 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_06680 17664 17134 gene locus_tag LOCUS_06690 17664 17134 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820897.1 protein_id gnl|my_center|LOCUS_06690 18841 17651 gene locus_tag LOCUS_06700 18841 17651 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_06700 18904 20373 gene locus_tag LOCUS_06710 gene guaB 18904 20373 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_06710 20373 21251 gene locus_tag LOCUS_06720 20373 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 21241 22605 gene locus_tag LOCUS_06730 21241 22605 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence020 637 188 gene locus_tag LOCUS_06740 gene mraZ 637 188 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_06740 715 2043 gene locus_tag LOCUS_06750 715 2043 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_06750 2794 2030 gene locus_tag LOCUS_06760 gene lptB 2794 2030 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_06760 4696 2807 gene locus_tag LOCUS_06770 4696 2807 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090974988.1 protein_id gnl|my_center|LOCUS_06770 4737 6017 gene locus_tag LOCUS_06780 4737 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5330 5429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6017 6685 gene locus_tag LOCUS_06790 6017 6685 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_06790 8027 6639 gene locus_tag LOCUS_06800 8027 6639 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_06800 8601 8035 gene locus_tag LOCUS_06810 gene efp 8601 8035 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_06810 8668 9786 gene locus_tag LOCUS_06820 8668 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_06820 11348 9783 gene locus_tag LOCUS_06830 11348 9783 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_06830 12795 11341 gene locus_tag LOCUS_06840 12795 11341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_06840 14294 12807 gene locus_tag LOCUS_06850 14294 12807 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922030.1 protein_id gnl|my_center|LOCUS_06850 14435 14508 gene locus_tag LOCUS_t00110 14435 14508 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 14570 14669 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14858 16138 gene locus_tag LOCUS_06860 gene eno 14858 16138 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933619.1 protein_id gnl|my_center|LOCUS_06860 16233 17042 gene locus_tag LOCUS_06870 16233 17042 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_06870 17105 18469 gene locus_tag LOCUS_06880 17105 18469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 19468 18461 gene locus_tag LOCUS_06890 19468 18461 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_06890 21870 19465 gene locus_tag LOCUS_06900 gene thrA 21870 19465 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_06900 22835 21837 gene locus_tag LOCUS_06910 gene metX 22835 21837 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_06910 <23890 22832 gene locus_tag LOCUS_06920 <23890 22832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932291.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase >Feature sequence021 2263 1904 gene locus_tag LOCUS_06930 2263 1904 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 protein_id gnl|my_center|LOCUS_06930 3081 2269 gene locus_tag LOCUS_06940 3081 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3914 3084 gene locus_tag LOCUS_06950 3914 3084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_06950 4043 4750 gene locus_tag LOCUS_06960 4043 4750 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_06960 4747 5388 gene locus_tag LOCUS_06970 gene nth 4747 5388 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_06970 5385 6317 gene locus_tag LOCUS_06980 gene xerD 5385 6317 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_06980 6372 9341 gene locus_tag LOCUS_06990 6372 9341 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108497.1 protein_id gnl|my_center|LOCUS_06990 9338 10975 gene locus_tag LOCUS_07000 9338 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 11031 13016 gene locus_tag LOCUS_07010 gene gyrB 11031 13016 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_07010 13019 14272 gene locus_tag LOCUS_07020 13019 14272 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_07020 14275 15102 gene locus_tag LOCUS_07030 14275 15102 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_07030 16352 15108 gene locus_tag LOCUS_07040 16352 15108 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_07040 16798 16349 gene locus_tag LOCUS_07050 16798 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 18456 16978 gene locus_tag LOCUS_07060 gene cls 18456 16978 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_07060 19205 18453 gene locus_tag LOCUS_07070 gene ubiE 19205 18453 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704116.1 protein_id gnl|my_center|LOCUS_07070 19686 19171 gene locus_tag LOCUS_07080 19686 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 19748 19832 gene locus_tag LOCUS_t00120 19748 19832 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21270 20179 gene locus_tag LOCUS_07090 21270 20179 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_07090 21972 21274 gene locus_tag LOCUS_07100 21972 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence022 945 295 gene locus_tag LOCUS_07110 945 295 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_07110 1376 1047 gene locus_tag LOCUS_07120 1376 1047 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_07120 1468 2718 gene locus_tag LOCUS_07130 1468 2718 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957913.1 protein_id gnl|my_center|LOCUS_07130 4813 2708 gene locus_tag LOCUS_07140 4813 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_07140 6292 4916 gene locus_tag LOCUS_07150 6292 4916 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675966.1 protein_id gnl|my_center|LOCUS_07150 6990 6289 gene locus_tag LOCUS_07160 6990 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 8269 6974 gene locus_tag LOCUS_07170 8269 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 9522 8269 gene locus_tag LOCUS_07180 9522 8269 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_07180 11185 9563 gene locus_tag LOCUS_07190 11185 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 11243 11818 gene locus_tag LOCUS_07200 11243 11818 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775732.1 protein_id gnl|my_center|LOCUS_07200 11821 12942 gene locus_tag LOCUS_07210 11821 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13921 12959 gene locus_tag LOCUS_07220 13921 12959 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_07220 14015 14782 gene locus_tag LOCUS_07230 14015 14782 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_07230 14772 15338 gene locus_tag LOCUS_07240 gene gmk 14772 15338 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_07240 15340 15897 gene locus_tag LOCUS_07250 gene nadD 15340 15897 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_07250 15910 17388 gene locus_tag LOCUS_07260 15910 17388 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_07260 18142 17372 gene locus_tag LOCUS_07270 18142 17372 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_07270 18187 20115 gene locus_tag LOCUS_07280 gene dnaK 18187 20115 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_07280 20117 20728 gene locus_tag LOCUS_07290 20117 20728 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_07290 20737 21903 gene locus_tag LOCUS_07300 gene dnaJ 20737 21903 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence023 1139 273 gene locus_tag LOCUS_07310 gene prmC 1139 273 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_07310 2127 1120 gene locus_tag LOCUS_07320 2127 1120 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_07320 4484 2130 gene locus_tag LOCUS_07330 4484 2130 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_07330 4578 6872 gene locus_tag LOCUS_07340 gene topA 4578 6872 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_07340 6865 7860 gene locus_tag LOCUS_07350 6865 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 7887 8351 gene locus_tag LOCUS_07360 7887 8351 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_07360 8336 9889 gene locus_tag LOCUS_07370 gene purH 8336 9889 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_07370 10198 10297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10326 11144 gene locus_tag LOCUS_07380 10326 11144 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_07380 11160 11996 gene locus_tag LOCUS_07390 11160 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 11993 12505 gene locus_tag LOCUS_07400 gene mreD 11993 12505 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_07400 12511 14352 gene locus_tag LOCUS_07410 gene mrdA 12511 14352 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_07410 14349 15776 gene locus_tag LOCUS_07420 gene rodA 14349 15776 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_07420 15798 18638 gene locus_tag LOCUS_07430 gene gcvP 15798 18638 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_07430 19317 18859 gene locus_tag LOCUS_07440 gene smpB 19317 18859 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_07440 20209 19334 gene locus_tag LOCUS_07450 gene lgt 20209 19334 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_07450 21127 20228 gene locus_tag LOCUS_07460 21127 20228 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_07460 21172 22437 gene locus_tag LOCUS_07470 21172 22437 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763375.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence024 2080 1160 gene locus_tag LOCUS_07480 2080 1160 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_07480 3161 2088 gene locus_tag LOCUS_07490 gene serC 3161 2088 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_07490 3698 3228 gene locus_tag LOCUS_07500 gene pyrI 3698 3228 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_07500 4605 3703 gene locus_tag LOCUS_07510 gene pyrB 4605 3703 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_07510 5218 4625 gene locus_tag LOCUS_07520 5218 4625 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_07520 5267 6301 gene locus_tag LOCUS_07530 5267 6301 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_07530 6301 7158 gene locus_tag LOCUS_07540 gene miaA 6301 7158 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_07540 7468 7112 gene locus_tag LOCUS_07550 7468 7112 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_07550 8151 7477 gene locus_tag LOCUS_07560 8151 7477 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_07560 9276 8242 gene locus_tag LOCUS_07570 9276 8242 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_07570 10244 9273 gene locus_tag LOCUS_07580 10244 9273 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_07580 10300 12486 gene locus_tag LOCUS_07590 gene recQ 10300 12486 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_07590 12506 14776 gene locus_tag LOCUS_07600 12506 14776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14778 15008 gene locus_tag LOCUS_07610 14778 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 15008 16840 gene locus_tag LOCUS_07620 15008 16840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_07620 16858 18528 gene locus_tag LOCUS_07630 16858 18528 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_07630 18521 18931 gene locus_tag LOCUS_07640 18521 18931 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_07640 18936 20612 gene locus_tag LOCUS_07650 18936 20612 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_07650 21422 20547 gene locus_tag LOCUS_07660 gene era 21422 20547 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_07660 <22238 21430 gene locus_tag LOCUS_07670 <22238 21430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791757.1:pseudouridine synthase >Feature sequence025 <1 884 gene locus_tag LOCUS_07680 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202946.1:excinuclease ABC subunit UvrB 881 2998 gene locus_tag LOCUS_07690 881 2998 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_07690 3003 5804 gene locus_tag LOCUS_07700 gene uvrA 3003 5804 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_07700 5828 6601 gene locus_tag LOCUS_07710 5828 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 7518 6592 gene locus_tag LOCUS_07720 7518 6592 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_07720 7644 9644 gene locus_tag LOCUS_07730 7644 9644 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202518.1 protein_id gnl|my_center|LOCUS_07730 10558 9680 gene locus_tag LOCUS_07740 10558 9680 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_07740 11322 10558 gene locus_tag LOCUS_07750 11322 10558 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764605.1 protein_id gnl|my_center|LOCUS_07750 12831 11341 gene locus_tag LOCUS_07760 12831 11341 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_07760 13277 12894 gene locus_tag LOCUS_07770 13277 12894 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_07770 13342 14223 gene locus_tag LOCUS_07780 13342 14223 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_07780 14213 15100 gene locus_tag LOCUS_07790 14213 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 15235 15162 gene locus_tag LOCUS_t00130 15235 15162 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15284 16528 gene locus_tag LOCUS_07800 15284 16528 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_07800 17492 16512 gene locus_tag LOCUS_07810 17492 16512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 20032 17492 gene locus_tag LOCUS_07820 20032 17492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 20918 20061 gene locus_tag LOCUS_07830 20918 20061 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107815.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence026 <1 1556 gene locus_tag LOCUS_07840 <1 1556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545854.1:glycosyltransferase family 39 protein 3824 1569 gene locus_tag LOCUS_07850 3824 1569 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_07850 3984 5726 gene locus_tag LOCUS_07860 3984 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 5728 7017 gene locus_tag LOCUS_07870 5728 7017 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_07870 7026 8255 gene locus_tag LOCUS_07880 7026 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 8258 9658 gene locus_tag LOCUS_07890 8258 9658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_07890 9651 10856 gene locus_tag LOCUS_07900 9651 10856 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_07900 12882 10828 gene locus_tag LOCUS_07910 12882 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 14081 12864 gene locus_tag LOCUS_07920 14081 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_07920 16160 14085 gene locus_tag LOCUS_07930 16160 14085 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421613.1 protein_id gnl|my_center|LOCUS_07930 17568 16171 gene locus_tag LOCUS_07940 17568 16171 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_07940 19019 17580 gene locus_tag LOCUS_07950 19019 17580 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_07950 19780 19016 gene locus_tag LOCUS_07960 19780 19016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 20615 19764 gene locus_tag LOCUS_07970 20615 19764 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555854.1 protein_id gnl|my_center|LOCUS_07970 <21473 20602 gene locus_tag LOCUS_07980 <21473 20602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769934.1:NADH:flavin oxidoreductase >Feature sequence027 632 21 gene locus_tag LOCUS_07990 632 21 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_07990 833 2449 gene locus_tag LOCUS_08000 833 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2527 3171 gene locus_tag LOCUS_08010 2527 3171 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_08010 3178 3822 gene locus_tag LOCUS_08020 3178 3822 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_08020 3828 6662 gene locus_tag LOCUS_08030 gene uvrA 3828 6662 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_08030 6670 8286 gene locus_tag LOCUS_08040 6670 8286 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_08040 9433 8261 gene locus_tag LOCUS_08050 9433 8261 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105427.1 protein_id gnl|my_center|LOCUS_08050 11158 9437 gene locus_tag LOCUS_08060 11158 9437 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_08060 11221 11787 gene locus_tag LOCUS_08070 11221 11787 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_08070 11784 12251 gene locus_tag LOCUS_08080 11784 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 12244 13458 gene locus_tag LOCUS_08090 12244 13458 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202363.1 protein_id gnl|my_center|LOCUS_08090 14203 13448 gene locus_tag LOCUS_08100 14203 13448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_08100 14949 14203 gene locus_tag LOCUS_08110 14949 14203 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_08110 16010 14946 gene locus_tag LOCUS_08120 16010 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 16122 17306 gene locus_tag LOCUS_08130 16122 17306 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_08130 18924 17263 gene locus_tag LOCUS_08140 18924 17263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 19996 18917 gene locus_tag LOCUS_08150 19996 18917 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_08150 20985 19993 gene locus_tag LOCUS_08160 20985 19993 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence028 1089 271 gene locus_tag LOCUS_08170 1089 271 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_08170 1138 1566 gene locus_tag LOCUS_08180 1138 1566 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_08180 2232 1555 gene locus_tag LOCUS_08190 2232 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2348 2764 gene locus_tag LOCUS_08200 2348 2764 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_08200 2767 3642 gene locus_tag LOCUS_08210 gene amrS 2767 3642 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870318.1 protein_id gnl|my_center|LOCUS_08210 5060 3639 gene locus_tag LOCUS_08220 gene amrB 5060 3639 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_08220 5592 5062 gene locus_tag LOCUS_08230 5592 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 6406 5606 gene locus_tag LOCUS_08240 6406 5606 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_08240 6945 6442 gene locus_tag LOCUS_08250 gene tpx 6945 6442 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 protein_id gnl|my_center|LOCUS_08250 8058 6982 gene locus_tag LOCUS_08260 8058 6982 CDS product 7-dehydrocholesterol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958044.1 protein_id gnl|my_center|LOCUS_08260 8840 8061 gene locus_tag LOCUS_08270 8840 8061 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 protein_id gnl|my_center|LOCUS_08270 10154 8865 gene locus_tag LOCUS_08280 gene hemW 10154 8865 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249433.1 protein_id gnl|my_center|LOCUS_08280 12919 10151 gene locus_tag LOCUS_08290 12919 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 14137 12926 gene locus_tag LOCUS_08300 14137 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 15115 14150 gene locus_tag LOCUS_08310 15115 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 15809 15135 gene locus_tag LOCUS_08320 15809 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 16544 15816 gene locus_tag LOCUS_08330 16544 15816 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829499.1 protein_id gnl|my_center|LOCUS_08330 17352 16555 gene locus_tag LOCUS_08340 17352 16555 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566220.1 protein_id gnl|my_center|LOCUS_08340 17927 17349 gene locus_tag LOCUS_08350 17927 17349 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_08350 18350 17937 gene locus_tag LOCUS_08360 18350 17937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 18434 18961 gene locus_tag LOCUS_08370 18434 18961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence029 593 1672 gene locus_tag LOCUS_08380 593 1672 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_08380 1678 2739 gene locus_tag LOCUS_08390 gene meaB 1678 2739 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_08390 4596 2758 gene locus_tag LOCUS_08400 gene rho 4596 2758 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798804.1 protein_id gnl|my_center|LOCUS_08400 7236 4666 gene locus_tag LOCUS_08410 7236 4666 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_08410 7450 8538 gene locus_tag LOCUS_08420 7450 8538 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_08420 8545 9465 gene locus_tag LOCUS_08430 8545 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 9677 11092 gene locus_tag LOCUS_08440 gene dnaA 9677 11092 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_08440 11105 12553 gene locus_tag LOCUS_08450 11105 12553 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_08450 12556 13197 gene locus_tag LOCUS_08460 gene rpe 12556 13197 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802152.1 protein_id gnl|my_center|LOCUS_08460 13846 13190 gene locus_tag LOCUS_08470 13846 13190 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_08470 14689 13853 gene locus_tag LOCUS_08480 14689 13853 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_08480 16664 14673 gene locus_tag LOCUS_08490 gene ftsH 16664 14673 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_08490 17020 16679 gene locus_tag LOCUS_08500 gene rsfS 17020 16679 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_08500 17074 17733 gene locus_tag LOCUS_08510 17074 17733 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268654.1 protein_id gnl|my_center|LOCUS_08510 18425 17664 gene locus_tag LOCUS_08520 gene pyrF 18425 17664 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_08520 19497 18406 gene locus_tag LOCUS_08530 gene prfA 19497 18406 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_08530 20070 19594 gene locus_tag LOCUS_08540 gene nuoE 20070 19594 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence030 1451 426 gene locus_tag LOCUS_08550 1451 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2257 1457 gene locus_tag LOCUS_08560 2257 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2410 2336 gene locus_tag LOCUS_t00140 2410 2336 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2563 3156 gene locus_tag LOCUS_08570 gene ddpX 2563 3156 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391509.1 protein_id gnl|my_center|LOCUS_08570 3605 3153 gene locus_tag LOCUS_08580 3605 3153 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108716.1 protein_id gnl|my_center|LOCUS_08580 3764 3606 gene locus_tag LOCUS_08590 3764 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4650 3766 gene locus_tag LOCUS_08600 4650 3766 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_08600 6079 4832 gene locus_tag LOCUS_08610 6079 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 6124 8052 gene locus_tag LOCUS_08620 6124 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 8069 10543 gene locus_tag LOCUS_08630 8069 10543 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_08630 10543 11160 gene locus_tag LOCUS_08640 10543 11160 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 protein_id gnl|my_center|LOCUS_08640 11167 16233 gene locus_tag LOCUS_08650 11167 16233 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072066367.1 protein_id gnl|my_center|LOCUS_08650 16355 16630 gene locus_tag LOCUS_08660 gene rpsO 16355 16630 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_08660 16826 19060 gene locus_tag LOCUS_08670 gene pnp 16826 19060 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence031 1709 195 gene locus_tag LOCUS_08680 1709 195 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_08680 2752 1790 gene locus_tag LOCUS_08690 2752 1790 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791368.1 protein_id gnl|my_center|LOCUS_08690 3415 2822 gene locus_tag LOCUS_08700 3415 2822 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_08700 3791 3330 gene locus_tag LOCUS_08710 gene rpiB 3791 3330 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_08710 3846 4547 gene locus_tag LOCUS_08720 3846 4547 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181878.1 protein_id gnl|my_center|LOCUS_08720 4558 5934 gene locus_tag LOCUS_08730 4558 5934 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_08730 5945 6349 gene locus_tag LOCUS_08740 5945 6349 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_08740 6434 6868 gene locus_tag LOCUS_08750 6434 6868 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_08750 8066 6927 gene locus_tag LOCUS_08760 8066 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 8202 10043 gene locus_tag LOCUS_08770 8202 10043 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_08770 10405 10040 gene locus_tag LOCUS_08780 10405 10040 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784476.1 protein_id gnl|my_center|LOCUS_08780 12914 10413 gene locus_tag LOCUS_08790 12914 10413 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_08790 13113 14408 gene locus_tag LOCUS_08800 13113 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14451 15572 gene locus_tag LOCUS_08810 14451 15572 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_08810 15562 16335 gene locus_tag LOCUS_08820 gene zupT 15562 16335 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262376.1 protein_id gnl|my_center|LOCUS_08820 16356 17237 gene locus_tag LOCUS_08830 16356 17237 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_08830 19032 17200 gene locus_tag LOCUS_08840 19032 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 <19712 19039 gene locus_tag LOCUS_08850 <19712 19039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583023.1:permease >Feature sequence032 <1 2445 gene locus_tag LOCUS_08860 <1 2445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783920.1:translation initiation factor IF-2 3675 2446 gene locus_tag LOCUS_08870 3675 2446 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_08870 4340 3672 gene locus_tag LOCUS_08880 4340 3672 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_08880 4282 5187 gene locus_tag LOCUS_08890 gene folP 4282 5187 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_08890 5203 6546 gene locus_tag LOCUS_08900 gene purB 5203 6546 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_08900 6558 7796 gene locus_tag LOCUS_08910 6558 7796 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_08910 7793 8491 gene locus_tag LOCUS_08920 7793 8491 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_08920 8783 8445 gene locus_tag LOCUS_08930 8783 8445 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_08930 8843 9742 gene locus_tag LOCUS_08940 8843 9742 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_08940 9758 10654 gene locus_tag LOCUS_08950 9758 10654 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203662.1 protein_id gnl|my_center|LOCUS_08950 10620 11525 gene locus_tag LOCUS_08960 10620 11525 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_08960 11886 11515 gene locus_tag LOCUS_08970 11886 11515 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_08970 12466 11891 gene locus_tag LOCUS_08980 gene pth 12466 11891 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_08980 13094 12480 gene locus_tag LOCUS_08990 13094 12480 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_08990 14450 13215 gene locus_tag LOCUS_09000 14450 13215 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202581.1 protein_id gnl|my_center|LOCUS_09000 14473 14667 gene locus_tag LOCUS_09010 14473 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 14679 15023 gene locus_tag LOCUS_09020 14679 15023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 15027 15290 gene locus_tag LOCUS_09030 15027 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 15298 17301 gene locus_tag LOCUS_09040 15298 17301 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_09040 18578 17286 gene locus_tag LOCUS_09050 18578 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 <19593 18628 gene locus_tag LOCUS_09060 <19593 18628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405561.1:SusD/RagB family nutrient-binding outer membrane lipoprotein >Feature sequence033 34 1722 gene locus_tag LOCUS_09070 34 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1730 2944 gene locus_tag LOCUS_09080 1730 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202177.1 protein_id gnl|my_center|LOCUS_09080 3035 6316 gene locus_tag LOCUS_09090 gene secA 3035 6316 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_09090 6336 7712 gene locus_tag LOCUS_09100 gene lpdA 6336 7712 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_09100 7720 8151 gene locus_tag LOCUS_09110 7720 8151 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080162.1 protein_id gnl|my_center|LOCUS_09110 9540 8158 gene locus_tag LOCUS_09120 gene rlmD 9540 8158 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_09120 10468 9497 gene locus_tag LOCUS_09130 10468 9497 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_09130 10992 10480 gene locus_tag LOCUS_09140 10992 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 11092 13026 gene locus_tag LOCUS_09150 gene thrS 11092 13026 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_09150 13167 13643 gene locus_tag LOCUS_09160 gene infC 13167 13643 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_09160 13955 14299 gene locus_tag LOCUS_09170 gene rplT 13955 14299 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_09170 14310 15644 gene locus_tag LOCUS_09180 14310 15644 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_09180 15754 15960 gene locus_tag LOCUS_09190 gene rpmB 15754 15960 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_09190 15972 16154 gene locus_tag LOCUS_09200 gene rpmG 15972 16154 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_09200 16171 16329 gene locus_tag LOCUS_09210 16171 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 16417 16516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16980 17900 gene locus_tag LOCUS_09220 gene ftsY 16980 17900 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence034 187 14 gene locus_tag LOCUS_09230 187 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 738 250 gene locus_tag LOCUS_09240 738 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1717 749 gene locus_tag LOCUS_09250 1717 749 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_09250 2753 1689 gene locus_tag LOCUS_09260 2753 1689 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_09260 2825 3037 gene locus_tag LOCUS_09270 2825 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 3174 3617 gene locus_tag LOCUS_09280 3174 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 5127 3598 gene locus_tag LOCUS_09290 gene guaA 5127 3598 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963998.1 protein_id gnl|my_center|LOCUS_09290 5220 5666 gene locus_tag LOCUS_09300 5220 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5870 5942 gene locus_tag LOCUS_t00150 5870 5942 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5967 6542 gene locus_tag LOCUS_09310 5967 6542 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_09310 6551 7750 gene locus_tag LOCUS_09320 gene hydF 6551 7750 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_09320 7761 8408 gene locus_tag LOCUS_09330 7761 8408 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267339.1 protein_id gnl|my_center|LOCUS_09330 9160 8351 gene locus_tag LOCUS_09340 gene mnmD 9160 8351 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_09340 9392 9141 gene locus_tag LOCUS_09350 9392 9141 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_09350 10862 9468 gene locus_tag LOCUS_09360 gene glmM 10862 9468 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_09360 11324 10866 gene locus_tag LOCUS_09370 11324 10866 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_09370 13181 11355 gene locus_tag LOCUS_09380 13181 11355 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_09380 13780 13178 gene locus_tag LOCUS_09390 13780 13178 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_09390 15117 13792 gene locus_tag LOCUS_09400 15117 13792 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762991.1 protein_id gnl|my_center|LOCUS_09400 16891 15128 gene locus_tag LOCUS_09410 16891 15128 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788434.1 protein_id gnl|my_center|LOCUS_09410 17532 16894 gene locus_tag LOCUS_09420 17532 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 18136 17522 gene locus_tag LOCUS_09430 18136 17522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538528.1 protein_id gnl|my_center|LOCUS_09430 <19079 18162 gene locus_tag LOCUS_09440 <19079 18162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107939.1:sodium ion-translocating decarboxylase subunit beta >Feature sequence035 373 116 gene locus_tag LOCUS_09450 373 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1880 378 gene locus_tag LOCUS_09460 gene atpD 1880 378 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_09460 2049 3800 gene locus_tag LOCUS_09470 2049 3800 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_09470 3804 6476 gene locus_tag LOCUS_09480 3804 6476 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_09480 6488 6946 gene locus_tag LOCUS_09490 6488 6946 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_09490 8676 6943 gene locus_tag LOCUS_09500 gene recJ 8676 6943 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_09500 8758 10266 gene locus_tag LOCUS_09510 gene lysS 8758 10266 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_09510 10268 11053 gene locus_tag LOCUS_09520 10268 11053 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_09520 11059 11796 gene locus_tag LOCUS_09530 gene aroE 11059 11796 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831091.1 protein_id gnl|my_center|LOCUS_09530 11843 12304 gene locus_tag LOCUS_09540 11843 12304 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_09540 13717 12305 gene locus_tag LOCUS_09550 13717 12305 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_09550 15104 13710 gene locus_tag LOCUS_09560 15104 13710 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_09560 15204 16469 gene locus_tag LOCUS_09570 15204 16469 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_09570 16479 18365 gene locus_tag LOCUS_09580 gene dxs 16479 18365 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_09580 18467 18541 gene locus_tag LOCUS_t00160 18467 18541 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18569 18652 gene locus_tag LOCUS_t00170 18569 18652 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence036 648 124 gene locus_tag LOCUS_09590 648 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 796 1077 gene locus_tag LOCUS_09600 796 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2153 1626 gene locus_tag LOCUS_09610 2153 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3612 2299 gene locus_tag LOCUS_09620 gene dnaB 3612 2299 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229347.1 protein_id gnl|my_center|LOCUS_09620 4490 3612 gene locus_tag LOCUS_09630 4490 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4795 4511 gene locus_tag LOCUS_09640 4795 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5250 5645 gene locus_tag LOCUS_09650 5250 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 5780 6097 gene locus_tag LOCUS_09660 5780 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 6766 6077 gene locus_tag LOCUS_09670 6766 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 7240 6938 gene locus_tag LOCUS_09680 7240 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 7430 7266 gene locus_tag LOCUS_09690 7430 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 7755 7459 gene locus_tag LOCUS_09700 7755 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8017 7942 gene locus_tag LOCUS_t00180 8017 7942 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8590 7994 gene locus_tag LOCUS_09710 8590 7994 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_09710 9384 8578 gene locus_tag LOCUS_09720 9384 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 9991 9389 gene locus_tag LOCUS_09730 9991 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_09730 10089 11099 gene locus_tag LOCUS_09740 10089 11099 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_09740 11112 11645 gene locus_tag LOCUS_09750 11112 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 11660 12688 gene locus_tag LOCUS_09760 11660 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 13898 12822 gene locus_tag LOCUS_09770 13898 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 14033 17269 gene locus_tag LOCUS_09780 14033 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 <18399 17279 gene locus_tag LOCUS_09790 <18399 17279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203230.1:alpha-amylase family glycosyl hydrolase >Feature sequence037 1480 2868 gene locus_tag LOCUS_09800 1480 2868 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_09800 3571 2879 gene locus_tag LOCUS_09810 3571 2879 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_09810 4652 3582 gene locus_tag LOCUS_09820 4652 3582 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_09820 5452 4655 gene locus_tag LOCUS_09830 5452 4655 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_09830 5541 6761 gene locus_tag LOCUS_09840 5541 6761 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582859.1 protein_id gnl|my_center|LOCUS_09840 7360 6713 gene locus_tag LOCUS_09850 7360 6713 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761607.1 protein_id gnl|my_center|LOCUS_09850 9197 7353 gene locus_tag LOCUS_09860 9197 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 9337 10137 gene locus_tag LOCUS_09870 9337 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 10705 10148 gene locus_tag LOCUS_09880 10705 10148 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802164.1 protein_id gnl|my_center|LOCUS_09880 12870 10705 gene locus_tag LOCUS_09890 12870 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 13050 13370 gene locus_tag LOCUS_09900 13050 13370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 14802 13531 gene locus_tag LOCUS_09910 14802 13531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_09910 15557 14799 gene locus_tag LOCUS_09920 15557 14799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100836.1 protein_id gnl|my_center|LOCUS_09920 16560 15550 gene locus_tag LOCUS_09930 16560 15550 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_09930 17033 16563 gene locus_tag LOCUS_09940 17033 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 17616 17017 gene locus_tag LOCUS_09950 17616 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 17821 17618 gene locus_tag LOCUS_09960 17821 17618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence038 1871 228 gene locus_tag LOCUS_09970 1871 228 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_09970 4090 1877 gene locus_tag LOCUS_09980 4090 1877 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107207.1 protein_id gnl|my_center|LOCUS_09980 4847 4116 gene locus_tag LOCUS_09990 4847 4116 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674352.1 protein_id gnl|my_center|LOCUS_09990 6659 4911 gene locus_tag LOCUS_10000 6659 4911 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_10000 8389 6656 gene locus_tag LOCUS_10010 8389 6656 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_10010 10036 8408 gene locus_tag LOCUS_10020 10036 8408 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_10020 13426 10052 gene locus_tag LOCUS_10030 13426 10052 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_10030 14452 13433 gene locus_tag LOCUS_10040 14452 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 15123 14533 gene locus_tag LOCUS_10050 15123 14533 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_10050 16253 15126 gene locus_tag LOCUS_10060 16253 15126 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 protein_id gnl|my_center|LOCUS_10060 16346 17023 gene locus_tag LOCUS_10070 16346 17023 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_10070 17686 17006 gene locus_tag LOCUS_10080 17686 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence039 46 279 gene locus_tag LOCUS_10090 46 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4258 332 gene locus_tag LOCUS_10100 4258 332 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_10100 7040 4266 gene locus_tag LOCUS_10110 7040 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8623 7067 gene locus_tag LOCUS_10120 8623 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9582 8620 gene locus_tag LOCUS_10130 9582 8620 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767017.1 protein_id gnl|my_center|LOCUS_10130 12101 9681 gene locus_tag LOCUS_10140 12101 9681 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_10140 13806 12112 gene locus_tag LOCUS_10150 13806 12112 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_10150 16935 13819 gene locus_tag LOCUS_10160 16935 13819 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence040 276 1613 gene locus_tag LOCUS_10170 gene murD 276 1613 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_10170 1622 2851 gene locus_tag LOCUS_10180 1622 2851 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763712.1 protein_id gnl|my_center|LOCUS_10180 2829 3947 gene locus_tag LOCUS_10190 gene murG 2829 3947 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_10190 3944 5317 gene locus_tag LOCUS_10200 gene murC 3944 5317 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_10200 5314 6105 gene locus_tag LOCUS_10210 5314 6105 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_10210 6127 7464 gene locus_tag LOCUS_10220 gene ftsA 6127 7464 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_10220 7470 8873 gene locus_tag LOCUS_10230 7470 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 8875 10428 gene locus_tag LOCUS_10240 gene gltX 8875 10428 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964585.1 protein_id gnl|my_center|LOCUS_10240 10430 11635 gene locus_tag LOCUS_10250 10430 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 11635 12168 gene locus_tag LOCUS_10260 gene rfbC 11635 12168 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_10260 12173 12904 gene locus_tag LOCUS_10270 gene truB 12173 12904 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_10270 12963 14012 gene locus_tag LOCUS_10280 gene queA 12963 14012 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762821.1 protein_id gnl|my_center|LOCUS_10280 14083 15147 gene locus_tag LOCUS_10290 gene dprA 14083 15147 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_10290 15144 15905 gene locus_tag LOCUS_10300 15144 15905 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_10300 15902 16933 gene locus_tag LOCUS_10310 15902 16933 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_10310 16998 17086 gene locus_tag LOCUS_t00190 16998 17086 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 140 1192 gene locus_tag LOCUS_10320 140 1192 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_10320 1204 2883 gene locus_tag LOCUS_10330 1204 2883 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_10330 2893 3579 gene locus_tag LOCUS_10340 2893 3579 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_10340 3586 7602 gene locus_tag LOCUS_10350 3586 7602 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_10350 7843 10284 gene locus_tag LOCUS_10360 7843 10284 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_10360 10311 13370 gene locus_tag LOCUS_10370 10311 13370 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_10370 13383 14990 gene locus_tag LOCUS_10380 13383 14990 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_10380 15063 15878 gene locus_tag LOCUS_10390 15063 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence042 702 391 gene locus_tag LOCUS_10400 702 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 884 1582 gene locus_tag LOCUS_10410 884 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3493 1880 gene locus_tag LOCUS_10420 3493 1880 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918673.1 protein_id gnl|my_center|LOCUS_10420 4902 3496 gene locus_tag LOCUS_10430 4902 3496 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_10430 3514 3613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6237 4906 gene locus_tag LOCUS_10440 6237 4906 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_10440 6883 6446 gene locus_tag LOCUS_10450 6883 6446 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_10450 6984 7667 gene locus_tag LOCUS_10460 6984 7667 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880279.1 protein_id gnl|my_center|LOCUS_10460 9973 7664 gene locus_tag LOCUS_10470 9973 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 10952 10050 gene locus_tag LOCUS_10480 10952 10050 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962714.1 protein_id gnl|my_center|LOCUS_10480 11562 10996 gene locus_tag LOCUS_10490 11562 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 12092 11613 gene locus_tag LOCUS_10500 12092 11613 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817484.1 protein_id gnl|my_center|LOCUS_10500 12375 13094 gene locus_tag LOCUS_10510 12375 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 13137 13697 gene locus_tag LOCUS_10520 13137 13697 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 protein_id gnl|my_center|LOCUS_10520 14622 13672 gene locus_tag LOCUS_10530 14622 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 15735 14641 gene locus_tag LOCUS_10540 15735 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence043 1275 127 gene locus_tag LOCUS_10550 1275 127 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_10550 3094 1418 gene locus_tag LOCUS_10560 3094 1418 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_10560 6215 3114 gene locus_tag LOCUS_10570 6215 3114 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_10570 6554 10480 gene locus_tag LOCUS_10580 6554 10480 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_10580 10575 11642 gene locus_tag LOCUS_10590 10575 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 11664 14294 gene locus_tag LOCUS_10600 11664 14294 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence044 <1 686 gene locus_tag LOCUS_10610 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792001.1:energy transducer TonB 2619 661 gene locus_tag LOCUS_10620 2619 661 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_10620 2672 3253 gene locus_tag LOCUS_10630 2672 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4175 3228 gene locus_tag LOCUS_10640 4175 3228 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_10640 6681 4177 gene locus_tag LOCUS_10650 6681 4177 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_10650 6878 10762 gene locus_tag LOCUS_10660 6878 10762 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303138.1 protein_id gnl|my_center|LOCUS_10660 10888 13404 gene locus_tag LOCUS_10670 gene galB 10888 13404 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence045 4140 61 gene locus_tag LOCUS_10680 4140 61 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203327.1 protein_id gnl|my_center|LOCUS_10680 4330 5373 gene locus_tag LOCUS_10690 4330 5373 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989598.1 protein_id gnl|my_center|LOCUS_10690 5375 6631 gene locus_tag LOCUS_10700 5375 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 6634 8331 gene locus_tag LOCUS_10710 6634 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 8334 11417 gene locus_tag LOCUS_10720 8334 11417 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_10720 11430 12851 gene locus_tag LOCUS_10730 11430 12851 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_10730 12838 13956 gene locus_tag LOCUS_10740 12838 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence046 <1 1154 gene locus_tag LOCUS_10750 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798907.1:TonB-dependent receptor 1167 2837 gene locus_tag LOCUS_10760 1167 2837 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_10760 2859 3953 gene locus_tag LOCUS_10770 2859 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3974 6535 gene locus_tag LOCUS_10780 3974 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6540 8576 gene locus_tag LOCUS_10790 6540 8576 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108937.1 protein_id gnl|my_center|LOCUS_10790 8584 10659 gene locus_tag LOCUS_10800 8584 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 10703 12013 gene locus_tag LOCUS_10810 10703 12013 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_10810 12018 13856 gene locus_tag LOCUS_10820 12018 13856 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence047 15 908 gene locus_tag LOCUS_10830 15 908 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763289.1 protein_id gnl|my_center|LOCUS_10830 905 1783 gene locus_tag LOCUS_10840 905 1783 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_10840 1864 4956 gene locus_tag LOCUS_10850 1864 4956 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_10850 4963 6825 gene locus_tag LOCUS_10860 4963 6825 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_10860 6900 7781 gene locus_tag LOCUS_10870 6900 7781 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_10870 7809 8912 gene locus_tag LOCUS_10880 7809 8912 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_10880 8921 10660 gene locus_tag LOCUS_10890 8921 10660 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_10890 10650 12059 gene locus_tag LOCUS_10900 10650 12059 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346611.1 protein_id gnl|my_center|LOCUS_10900 12172 13521 gene locus_tag LOCUS_10910 12172 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence048 3121 62 gene locus_tag LOCUS_10920 3121 62 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_10920 6163 3200 gene locus_tag LOCUS_10930 6163 3200 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_10930 6166 6265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9300 6850 gene locus_tag LOCUS_10940 9300 6850 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence049 1747 428 gene locus_tag LOCUS_10950 gene argH 1747 428 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_10950 2802 1747 gene locus_tag LOCUS_10960 2802 1747 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_10960 3539 2799 gene locus_tag LOCUS_10970 gene argB 3539 2799 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_10970 4507 3542 gene locus_tag LOCUS_10980 4507 3542 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_10980 5631 4486 gene locus_tag LOCUS_10990 5631 4486 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_10990 6650 5643 gene locus_tag LOCUS_11000 gene argC 6650 5643 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_11000 7830 6640 gene locus_tag LOCUS_11010 7830 6640 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_11010 8414 7827 gene locus_tag LOCUS_11020 8414 7827 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_11020 8727 10256 gene locus_tag LOCUS_11030 8727 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 11151 10234 gene locus_tag LOCUS_11040 11151 10234 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_11040 11193 12449 gene locus_tag LOCUS_11050 11193 12449 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_11050 13159 12443 gene locus_tag LOCUS_11060 13159 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence050 <1 1184 gene locus_tag LOCUS_11070 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203179.1:cytochrome c biogenesis protein CcdA 1191 2549 gene locus_tag LOCUS_11080 1191 2549 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_11080 3472 2552 gene locus_tag LOCUS_11090 3472 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 5920 3479 gene locus_tag LOCUS_11100 5920 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 7041 6160 gene locus_tag LOCUS_11110 7041 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 7051 7150 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8823 7291 gene locus_tag LOCUS_11120 8823 7291 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_11120 11979 8842 gene locus_tag LOCUS_11130 11979 8842 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_11130 12311 12072 gene locus_tag LOCUS_11140 12311 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 12667 13176 gene locus_tag LOCUS_11150 12667 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence051 402 3773 gene locus_tag LOCUS_11160 402 3773 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107893.1 protein_id gnl|my_center|LOCUS_11160 3785 5710 gene locus_tag LOCUS_11170 3785 5710 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201999.1 protein_id gnl|my_center|LOCUS_11170 6726 5902 gene locus_tag LOCUS_11180 gene tsf 6726 5902 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_11180 7778 6741 gene locus_tag LOCUS_11190 gene rpsB 7778 6741 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_11190 8324 7935 gene locus_tag LOCUS_11200 gene rpsI 8324 7935 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_11200 8784 8332 gene locus_tag LOCUS_11210 gene rplM 8784 8332 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_11210 9850 8870 gene locus_tag LOCUS_11220 gene pfkA 9850 8870 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_11220 9886 10860 gene locus_tag LOCUS_11230 gene dusB 9886 10860 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_11230 10851 11849 gene locus_tag LOCUS_11240 gene lpxK 10851 11849 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_11240 <12983 11773 gene locus_tag LOCUS_11250 <12983 11773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076055503.1:glycoside hydrolase family 95 protein >Feature sequence052 4144 137 gene locus_tag LOCUS_11260 4144 137 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_11260 4398 5999 gene locus_tag LOCUS_11270 4398 5999 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_11270 6025 9117 gene locus_tag LOCUS_11280 6025 9117 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_11280 9165 10703 gene locus_tag LOCUS_11290 9165 10703 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_11290 10738 11919 gene locus_tag LOCUS_11300 10738 11919 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence053 2746 149 gene locus_tag LOCUS_11310 2746 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4549 2759 gene locus_tag LOCUS_11320 4549 2759 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_11320 7575 4552 gene locus_tag LOCUS_11330 7575 4552 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_11330 7815 11822 gene locus_tag LOCUS_11340 7815 11822 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence054 3 1949 gene locus_tag LOCUS_11350 3 1949 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_11350 3049 1946 gene locus_tag LOCUS_11360 gene ychF 3049 1946 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_11360 3139 4074 gene locus_tag LOCUS_11370 3139 4074 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_11370 4085 6664 gene locus_tag LOCUS_11380 gene mutS 4085 6664 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_11380 6661 7938 gene locus_tag LOCUS_11390 6661 7938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_11390 8740 7922 gene locus_tag LOCUS_11400 gene rsmA 8740 7922 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_11400 8790 9950 gene locus_tag LOCUS_11410 8790 9950 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_11410 11725 9962 gene locus_tag LOCUS_11420 gene aspS 11725 9962 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202848.1 protein_id gnl|my_center|LOCUS_11420 11782 12576 gene locus_tag LOCUS_11430 11782 12576 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence055 507 19 gene locus_tag LOCUS_11440 507 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 998 495 gene locus_tag LOCUS_11450 998 495 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_11450 2128 1007 gene locus_tag LOCUS_11460 2128 1007 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_11460 2278 5478 gene locus_tag LOCUS_11470 2278 5478 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_11470 5545 7389 gene locus_tag LOCUS_11480 gene htpG 5545 7389 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_11480 9531 7381 gene locus_tag LOCUS_11490 9531 7381 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_11490 9576 10178 gene locus_tag LOCUS_11500 gene thiF 9576 10178 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939369.1 protein_id gnl|my_center|LOCUS_11500 10175 10378 gene locus_tag LOCUS_11510 10175 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 10399 11475 gene locus_tag LOCUS_11520 10399 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 11483 12376 gene locus_tag LOCUS_11530 gene wtpA 11483 12376 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684400.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence056 69 3194 gene locus_tag LOCUS_11540 69 3194 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_11540 3221 4744 gene locus_tag LOCUS_11550 3221 4744 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_11550 4767 5591 gene locus_tag LOCUS_11560 4767 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6430 5627 gene locus_tag LOCUS_11570 6430 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 6576 8207 gene locus_tag LOCUS_11580 6576 8207 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_11580 8211 9638 gene locus_tag LOCUS_11590 8211 9638 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_11590 9628 12240 gene locus_tag LOCUS_11600 9628 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence057 2979 1033 gene locus_tag LOCUS_11610 2979 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 6138 3007 gene locus_tag LOCUS_11620 6138 3007 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_11620 6624 9995 gene locus_tag LOCUS_11630 6624 9995 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107893.1 protein_id gnl|my_center|LOCUS_11630 10007 11932 gene locus_tag LOCUS_11640 10007 11932 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201999.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence058 1256 123 gene locus_tag LOCUS_11650 1256 123 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_11650 2716 1283 gene locus_tag LOCUS_11660 2716 1283 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 protein_id gnl|my_center|LOCUS_11660 2994 6791 gene locus_tag LOCUS_11670 2994 6791 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789596.1 protein_id gnl|my_center|LOCUS_11670 6994 9999 gene locus_tag LOCUS_11680 6994 9999 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_11680 10012 11967 gene locus_tag LOCUS_11690 10012 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence059 962 642 gene locus_tag LOCUS_11700 962 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1027 1236 gene locus_tag LOCUS_11710 1027 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1970 5578 gene locus_tag LOCUS_11720 1970 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5604 6302 gene locus_tag LOCUS_11730 5604 6302 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_11730 6309 7046 gene locus_tag LOCUS_11740 gene zupT 6309 7046 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851840.1 protein_id gnl|my_center|LOCUS_11740 8408 7053 gene locus_tag LOCUS_11750 8408 7053 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_11750 8471 9595 gene locus_tag LOCUS_11760 8471 9595 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020737.1 protein_id gnl|my_center|LOCUS_11760 9541 9975 gene locus_tag LOCUS_11770 9541 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 9979 10269 gene locus_tag LOCUS_11780 gene cas2 9979 10269 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_11780 10445 11005 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaccccatgcgggtgcgtggattgaaac 11970 11356 gene locus_tag LOCUS_11790 11970 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence060 <1 1356 gene locus_tag LOCUS_11800 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796991.1:DNA polymerase I 1358 2494 gene locus_tag LOCUS_11810 1358 2494 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107806.1 protein_id gnl|my_center|LOCUS_11810 2496 3050 gene locus_tag LOCUS_11820 2496 3050 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_11820 3053 3739 gene locus_tag LOCUS_11830 gene rsmG 3053 3739 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_11830 3754 3906 gene locus_tag LOCUS_11840 gene rpmH 3754 3906 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_11840 3964 4725 gene locus_tag LOCUS_11850 3964 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4726 5754 gene locus_tag LOCUS_11860 4726 5754 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_11860 6280 5723 gene locus_tag LOCUS_11870 gene ruvC 6280 5723 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_11870 7551 6283 gene locus_tag LOCUS_11880 gene serS 7551 6283 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_11880 9214 7556 gene locus_tag LOCUS_11890 9214 7556 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_11890 9342 11039 gene locus_tag LOCUS_11900 9342 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence061 <1 875 gene locus_tag LOCUS_11910 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962843.1:transketolase C-terminal domain-containing protein 856 1389 gene locus_tag LOCUS_11920 856 1389 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_11920 1573 1672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2044 2658 gene locus_tag LOCUS_11930 2044 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3337 2666 gene locus_tag LOCUS_11940 3337 2666 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_11940 4043 3390 gene locus_tag LOCUS_11950 4043 3390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_11950 6213 4060 gene locus_tag LOCUS_11960 6213 4060 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_11960 6231 6911 gene locus_tag LOCUS_11970 6231 6911 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_11970 6964 9123 gene locus_tag LOCUS_11980 6964 9123 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766213.1 protein_id gnl|my_center|LOCUS_11980 9428 9527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence062 1009 575 gene locus_tag LOCUS_11990 1009 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1407 1009 gene locus_tag LOCUS_12000 1407 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2150 1404 gene locus_tag LOCUS_12010 2150 1404 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_12010 2425 2147 gene locus_tag LOCUS_12020 2425 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2576 2950 gene locus_tag LOCUS_12030 2576 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2832 5885 gene locus_tag LOCUS_12040 2832 5885 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_12040 6816 5869 gene locus_tag LOCUS_12050 6816 5869 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_12050 8335 6803 gene locus_tag LOCUS_12060 8335 6803 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_12060 9079 8351 gene locus_tag LOCUS_12070 9079 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 9789 9076 gene locus_tag LOCUS_12080 9789 9076 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_12080 9698 11257 gene locus_tag LOCUS_12090 9698 11257 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_12090 11292 11735 gene locus_tag LOCUS_12100 11292 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence063 528 713 gene locus_tag LOCUS_12110 528 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 906 1655 gene locus_tag LOCUS_12120 gene istB 906 1655 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268417.1 protein_id gnl|my_center|LOCUS_12120 2288 3583 gene locus_tag LOCUS_12130 2288 3583 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974358.1 protein_id gnl|my_center|LOCUS_12130 3762 4313 gene locus_tag LOCUS_12140 3762 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12140 4291 4839 gene locus_tag LOCUS_12150 4291 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4836 6002 gene locus_tag LOCUS_12160 4836 6002 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_12160 6004 6951 gene locus_tag LOCUS_12170 6004 6951 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_12170 7141 7524 gene locus_tag LOCUS_12180 7141 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 7552 8631 gene locus_tag LOCUS_12190 gene gmd 7552 8631 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786803.1 protein_id gnl|my_center|LOCUS_12190 8631 9713 gene locus_tag LOCUS_12200 8631 9713 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_12200 9724 10878 gene locus_tag LOCUS_12210 9724 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence064 1632 442 gene locus_tag LOCUS_12220 1632 442 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_12220 1704 3647 gene locus_tag LOCUS_12230 1704 3647 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_12230 3649 4401 gene locus_tag LOCUS_12240 3649 4401 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_12240 4948 4331 gene locus_tag LOCUS_12250 4948 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4979 5752 gene locus_tag LOCUS_12260 4979 5752 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_12260 6437 5745 gene locus_tag LOCUS_12270 6437 5745 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_12270 7712 6555 gene locus_tag LOCUS_12280 gene hflX 7712 6555 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_12280 8468 7776 gene locus_tag LOCUS_12290 8468 7776 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_12290 8562 8488 gene locus_tag LOCUS_t00200 8562 8488 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8637 9077 gene locus_tag LOCUS_12300 gene ybeY 8637 9077 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_12300 9067 10944 gene locus_tag LOCUS_12310 gene mnmG 9067 10944 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762875.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence065 188 802 gene locus_tag LOCUS_12320 188 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 799 1581 gene locus_tag LOCUS_12330 799 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1742 2140 gene locus_tag LOCUS_12340 1742 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2163 3530 gene locus_tag LOCUS_12350 2163 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3018 3043 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3643 4158 gene locus_tag LOCUS_12360 3643 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 4358 4981 gene locus_tag LOCUS_12370 4358 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4978 5796 gene locus_tag LOCUS_12380 4978 5796 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_12380 6050 5865 gene locus_tag LOCUS_12390 6050 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6600 6947 gene locus_tag LOCUS_12400 6600 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 7385 8842 gene locus_tag LOCUS_12410 7385 8842 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795105.1 protein_id gnl|my_center|LOCUS_12410 8847 9359 gene locus_tag LOCUS_12420 8847 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence066 3524 2589 gene locus_tag LOCUS_12430 3524 2589 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_12430 3614 4717 gene locus_tag LOCUS_12440 gene ychF 3614 4717 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_12440 6804 4714 gene locus_tag LOCUS_12450 6804 4714 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_12450 7453 6782 gene locus_tag LOCUS_12460 7453 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 8793 7453 gene locus_tag LOCUS_12470 8793 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 10028 8805 gene locus_tag LOCUS_12480 10028 8805 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_12480 <11537 10132 gene locus_tag LOCUS_12490 <11537 10132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766199.1:transcription-repair coupling factor >Feature sequence067 2078 504 gene locus_tag LOCUS_12500 2078 504 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_12500 5183 2091 gene locus_tag LOCUS_12510 5183 2091 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_12510 7009 5213 gene locus_tag LOCUS_12520 7009 5213 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_12520 7081 11133 gene locus_tag LOCUS_12530 7081 11133 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence068 <1 930 gene locus_tag LOCUS_12540 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794948.1:alkaline phosphatase 1956 916 gene locus_tag LOCUS_12550 1956 916 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093830137.1 protein_id gnl|my_center|LOCUS_12550 2276 1980 gene locus_tag LOCUS_12560 2276 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4738 2255 gene locus_tag LOCUS_12570 4738 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2279 2378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4850 5287 gene locus_tag LOCUS_12580 gene mscL 4850 5287 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759941.1 protein_id gnl|my_center|LOCUS_12580 6206 5277 gene locus_tag LOCUS_12590 6206 5277 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_12590 7065 6211 gene locus_tag LOCUS_12600 7065 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 7191 8342 gene locus_tag LOCUS_12610 7191 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 9275 8346 gene locus_tag LOCUS_12620 9275 8346 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_12620 9400 9876 gene locus_tag LOCUS_12630 9400 9876 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766771.1 protein_id gnl|my_center|LOCUS_12630 9943 10668 gene locus_tag LOCUS_12640 9943 10668 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_12640 10763 10945 gene locus_tag LOCUS_12650 10763 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence069 3132 1906 gene locus_tag LOCUS_12660 3132 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 4158 3145 gene locus_tag LOCUS_12670 gene ruvB 4158 3145 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_12670 4723 4346 gene locus_tag LOCUS_12680 4723 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6974 4713 gene locus_tag LOCUS_12690 gene xdhB 6974 4713 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_12690 8376 6967 gene locus_tag LOCUS_12700 gene xdhA 8376 6967 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186232.1 protein_id gnl|my_center|LOCUS_12700 10582 8381 gene locus_tag LOCUS_12710 10582 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence070 1120 218 gene locus_tag LOCUS_12720 gene ptb 1120 218 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_12720 2338 1127 gene locus_tag LOCUS_12730 2338 1127 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_12730 2481 4832 gene locus_tag LOCUS_12740 2481 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3379 3478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4856 6670 gene locus_tag LOCUS_12750 4856 6670 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_12750 6723 7001 gene locus_tag LOCUS_12760 6723 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 9487 7073 gene locus_tag LOCUS_12770 9487 7073 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_12770 7096 7195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <10357 9521 gene locus_tag LOCUS_12780 <10357 9521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202926.1:glycosyltransferase >Feature sequence071 3492 1018 gene locus_tag LOCUS_12790 3492 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3588 4541 gene locus_tag LOCUS_12800 3588 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4532 5497 gene locus_tag LOCUS_12810 4532 5497 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_12810 5509 6657 gene locus_tag LOCUS_12820 5509 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6638 7102 gene locus_tag LOCUS_12830 6638 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7089 7793 gene locus_tag LOCUS_12840 gene trmB 7089 7793 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_12840 8706 7735 gene locus_tag LOCUS_12850 8706 7735 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403976.1 protein_id gnl|my_center|LOCUS_12850 9327 8713 gene locus_tag LOCUS_12860 9327 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 9653 9333 gene locus_tag LOCUS_12870 gene trxA 9653 9333 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_12870 <10337 9708 gene locus_tag LOCUS_12880 <10337 9708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022470187.1:L-serine ammonia-lyase >Feature sequence072 2224 1256 gene locus_tag LOCUS_12890 gene rsgA 2224 1256 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_12890 2258 3256 gene locus_tag LOCUS_12900 2258 3256 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_12900 3259 3870 gene locus_tag LOCUS_12910 3259 3870 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_12910 3854 4837 gene locus_tag LOCUS_12920 3854 4837 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_12920 4848 6065 gene locus_tag LOCUS_12930 4848 6065 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_12930 6955 6062 gene locus_tag LOCUS_12940 6955 6062 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_12940 8168 6948 gene locus_tag LOCUS_12950 gene rocD 8168 6948 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_12950 8223 9215 gene locus_tag LOCUS_12960 8223 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 9283 9828 gene locus_tag LOCUS_12970 9283 9828 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence073 1965 1036 gene locus_tag LOCUS_12980 gene rfbA 1965 1036 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107280.1 protein_id gnl|my_center|LOCUS_12980 2163 3164 gene locus_tag LOCUS_12990 2163 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2841 2940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3116 4051 gene locus_tag LOCUS_13000 3116 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4360 4459 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5279 5206 gene locus_tag LOCUS_t00210 5279 5206 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5424 7016 gene locus_tag LOCUS_13010 5424 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 7180 7279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7490 8374 gene locus_tag LOCUS_13020 7490 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 8431 8530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9207 8620 gene locus_tag LOCUS_13030 9207 8620 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_13030 <10270 9363 gene locus_tag LOCUS_13040 <10270 9363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788747.1:3'-5' exonuclease >Feature sequence074 2524 1643 gene locus_tag LOCUS_13050 2524 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3765 2521 gene locus_tag LOCUS_13060 3765 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 4865 3768 gene locus_tag LOCUS_13070 4865 3768 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_13070 5793 4855 gene locus_tag LOCUS_13080 5793 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 6260 5790 gene locus_tag LOCUS_13090 6260 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7080 6268 gene locus_tag LOCUS_13100 gene moaA 7080 6268 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_13100 8265 7087 gene locus_tag LOCUS_13110 8265 7087 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_13110 8318 9109 gene locus_tag LOCUS_13120 gene wtpB 8318 9109 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_13120 9111 9737 gene locus_tag LOCUS_13130 9111 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence075 1654 575 gene locus_tag LOCUS_13140 1654 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2174 4717 gene locus_tag LOCUS_13150 2174 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 5171 4731 gene locus_tag LOCUS_13160 5171 4731 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133916.1 protein_id gnl|my_center|LOCUS_13160 5660 5178 gene locus_tag LOCUS_13170 5660 5178 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964878.1 protein_id gnl|my_center|LOCUS_13170 6372 5746 gene locus_tag LOCUS_13180 6372 5746 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_13180 7345 6386 gene locus_tag LOCUS_13190 7345 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 8120 7458 gene locus_tag LOCUS_13200 8120 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 8632 8117 gene locus_tag LOCUS_13210 8632 8117 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_13210 9597 8629 gene locus_tag LOCUS_13220 9597 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence076 1382 159 gene locus_tag LOCUS_13230 1382 159 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_13230 2941 1526 gene locus_tag LOCUS_13240 gene xylE 2941 1526 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107448.1 protein_id gnl|my_center|LOCUS_13240 4259 2943 gene locus_tag LOCUS_13250 gene xylA 4259 2943 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_13250 5756 4272 gene locus_tag LOCUS_13260 5756 4272 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_13260 6474 5758 gene locus_tag LOCUS_13270 6474 5758 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_13270 <9865 6539 gene locus_tag LOCUS_13280 <9865 6539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275545.1:alpha-glucuronidase family glycosyl hydrolase 7757 7856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence077 197 1516 gene locus_tag LOCUS_13290 197 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1504 1986 gene locus_tag LOCUS_13300 1504 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2770 1970 gene locus_tag LOCUS_13310 2770 1970 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_13310 2920 3957 gene locus_tag LOCUS_13320 gene asnA 2920 3957 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_13320 4099 5055 gene locus_tag LOCUS_13330 4099 5055 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_13330 5062 5997 gene locus_tag LOCUS_13340 gene fabK 5062 5997 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_13340 6014 7246 gene locus_tag LOCUS_13350 gene fabF 6014 7246 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_13350 7251 7676 gene locus_tag LOCUS_13360 gene fabZ 7251 7676 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565430.1 protein_id gnl|my_center|LOCUS_13360 7824 8438 gene locus_tag LOCUS_13370 7824 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8442 9134 gene locus_tag LOCUS_13380 8442 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence078 503 1396 gene locus_tag LOCUS_13390 503 1396 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107322.1 protein_id gnl|my_center|LOCUS_13390 5302 1418 gene locus_tag LOCUS_13400 5302 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5886 5389 gene locus_tag LOCUS_13410 5886 5389 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_13410 7595 5883 gene locus_tag LOCUS_13420 7595 5883 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_13420 7898 7617 gene locus_tag LOCUS_13430 7898 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8972 7911 gene locus_tag LOCUS_13440 8972 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 <9717 8991 gene locus_tag LOCUS_13450 <9717 8991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766031.1:exo-alpha-sialidase >Feature sequence079 60 707 gene locus_tag LOCUS_13460 60 707 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 protein_id gnl|my_center|LOCUS_13460 730 1974 gene locus_tag LOCUS_13470 730 1974 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_13470 1989 2816 gene locus_tag LOCUS_13480 1989 2816 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_13480 2858 3898 gene locus_tag LOCUS_13490 gene kdd 2858 3898 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_13490 3911 5158 gene locus_tag LOCUS_13500 gene ablA 3911 5158 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_13500 5167 6183 gene locus_tag LOCUS_13510 5167 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6180 7577 gene locus_tag LOCUS_13520 6180 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 7574 9130 gene locus_tag LOCUS_13530 7574 9130 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence080 <1 1139 gene locus_tag LOCUS_13540 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764311.1:alpha/beta hydrolase-fold protein 1146 2705 gene locus_tag LOCUS_13550 1146 2705 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 protein_id gnl|my_center|LOCUS_13550 2722 3882 gene locus_tag LOCUS_13560 2722 3882 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_13560 3889 5007 gene locus_tag LOCUS_13570 3889 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 5048 5980 gene locus_tag LOCUS_13580 5048 5980 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_13580 6007 7344 gene locus_tag LOCUS_13590 6007 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 7314 8816 gene locus_tag LOCUS_13600 7314 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence081 504 1562 gene locus_tag LOCUS_13610 504 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1808 2029 gene locus_tag LOCUS_13620 1808 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2158 3822 gene locus_tag LOCUS_13630 2158 3822 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 protein_id gnl|my_center|LOCUS_13630 3956 4261 gene locus_tag LOCUS_13640 3956 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5019 6422 gene locus_tag LOCUS_13650 5019 6422 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243737.1 protein_id gnl|my_center|LOCUS_13650 6502 7266 gene locus_tag LOCUS_13660 6502 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7266 8195 gene locus_tag LOCUS_13670 7266 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8982 8275 gene locus_tag LOCUS_13680 8982 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence082 121 306 gene locus_tag LOCUS_13690 121 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 320 1849 gene locus_tag LOCUS_13700 320 1849 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_13700 1861 2742 gene locus_tag LOCUS_13710 1861 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2748 3857 gene locus_tag LOCUS_13720 2748 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3857 5419 gene locus_tag LOCUS_13730 3857 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 5428 8964 gene locus_tag LOCUS_13740 5428 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence083 3025 863 gene locus_tag LOCUS_13750 3025 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3244 3618 gene locus_tag LOCUS_13760 3244 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3615 4193 gene locus_tag LOCUS_13770 3615 4193 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_13770 4843 4190 gene locus_tag LOCUS_13780 4843 4190 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496401.1 protein_id gnl|my_center|LOCUS_13780 5551 4847 gene locus_tag LOCUS_13790 5551 4847 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869613.1 protein_id gnl|my_center|LOCUS_13790 6311 5559 gene locus_tag LOCUS_13800 6311 5559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 protein_id gnl|my_center|LOCUS_13800 7062 6415 gene locus_tag LOCUS_13810 7062 6415 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_13810 8015 7059 gene locus_tag LOCUS_13820 8015 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 8918 8094 gene locus_tag LOCUS_13830 8918 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence084 120 944 gene locus_tag LOCUS_13840 120 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 978 1817 gene locus_tag LOCUS_13850 978 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1829 2908 gene locus_tag LOCUS_13860 1829 2908 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_13860 3994 2903 gene locus_tag LOCUS_13870 3994 2903 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_13870 5052 4006 gene locus_tag LOCUS_13880 5052 4006 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_13880 5511 5095 gene locus_tag LOCUS_13890 5511 5095 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_13890 6018 7262 gene locus_tag LOCUS_13900 6018 7262 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_13900 8843 7350 gene locus_tag LOCUS_13910 8843 7350 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761361.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence085 297 3305 gene locus_tag LOCUS_13920 297 3305 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_13920 3326 4954 gene locus_tag LOCUS_13930 3326 4954 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_13930 4972 6072 gene locus_tag LOCUS_13940 4972 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 8585 6141 gene locus_tag LOCUS_13950 8585 6141 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027341.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence086 2053 1019 gene locus_tag LOCUS_13960 gene pdxB 2053 1019 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108789.1 protein_id gnl|my_center|LOCUS_13960 2346 2056 gene locus_tag LOCUS_13970 2346 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3433 2327 gene locus_tag LOCUS_13980 gene recF 3433 2327 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_13980 3504 4202 gene locus_tag LOCUS_13990 3504 4202 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_13990 4216 4935 gene locus_tag LOCUS_14000 4216 4935 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_14000 6644 4932 gene locus_tag LOCUS_14010 6644 4932 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_14010 6912 7319 gene locus_tag LOCUS_14020 gene mce 6912 7319 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_14020 7339 8892 gene locus_tag LOCUS_14030 7339 8892 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence087 309 950 gene locus_tag LOCUS_14040 309 950 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775527.1 protein_id gnl|my_center|LOCUS_14040 967 1200 gene locus_tag LOCUS_14050 967 1200 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775528.1 protein_id gnl|my_center|LOCUS_14050 1197 2255 gene locus_tag LOCUS_14060 1197 2255 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_14060 2259 3005 gene locus_tag LOCUS_14070 2259 3005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 protein_id gnl|my_center|LOCUS_14070 3012 4019 gene locus_tag LOCUS_14080 3012 4019 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202790.1 protein_id gnl|my_center|LOCUS_14080 4020 5162 gene locus_tag LOCUS_14090 4020 5162 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_14090 5159 6808 gene locus_tag LOCUS_14100 5159 6808 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084529509.1 protein_id gnl|my_center|LOCUS_14100 6819 7793 gene locus_tag LOCUS_14110 6819 7793 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence088 340 1494 gene locus_tag LOCUS_14120 gene galK 340 1494 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_14120 1776 1594 gene locus_tag LOCUS_14130 1776 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1918 2688 gene locus_tag LOCUS_14140 1918 2688 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_14140 2748 3605 gene locus_tag LOCUS_14150 2748 3605 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764904.1 protein_id gnl|my_center|LOCUS_14150 3692 4135 gene locus_tag LOCUS_14160 3692 4135 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039007.1 protein_id gnl|my_center|LOCUS_14160 4362 4643 gene locus_tag LOCUS_14170 4362 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4899 5489 gene locus_tag LOCUS_14180 4899 5489 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_14180 5564 6322 gene locus_tag LOCUS_14190 5564 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 6309 6812 gene locus_tag LOCUS_14200 6309 6812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966715.1 protein_id gnl|my_center|LOCUS_14200 7930 6980 gene locus_tag LOCUS_14210 7930 6980 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_14210 <8754 7935 gene locus_tag LOCUS_14220 <8754 7935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941639.1:ATP-binding protein >Feature sequence089 3 593 gene locus_tag LOCUS_14230 3 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 724 1071 gene locus_tag LOCUS_14240 724 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1379 2050 gene locus_tag LOCUS_14250 1379 2050 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_14250 2171 2920 gene locus_tag LOCUS_14260 2171 2920 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_14260 3705 3025 gene locus_tag LOCUS_14270 3705 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6419 3705 gene locus_tag LOCUS_14280 6419 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 7841 6426 gene locus_tag LOCUS_14290 7841 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 8480 8028 gene locus_tag LOCUS_14300 8480 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence090 120 1832 gene locus_tag LOCUS_14310 120 1832 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_14310 1829 2326 gene locus_tag LOCUS_14320 1829 2326 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_14320 2413 6297 gene locus_tag LOCUS_14330 2413 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 7212 6319 gene locus_tag LOCUS_14340 7212 6319 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107322.1 protein_id gnl|my_center|LOCUS_14340 7334 8344 gene locus_tag LOCUS_14350 7334 8344 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_14350 8394 8481 gene locus_tag LOCUS_t00220 8394 8481 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence091 219 764 gene locus_tag LOCUS_14360 219 764 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966715.1 protein_id gnl|my_center|LOCUS_14360 1849 1595 gene locus_tag LOCUS_14370 1849 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2483 1842 gene locus_tag LOCUS_14380 2483 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3679 2651 gene locus_tag LOCUS_14390 3679 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4193 3978 gene locus_tag LOCUS_14400 4193 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 5097 4177 gene locus_tag LOCUS_14410 5097 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 5316 5122 gene locus_tag LOCUS_14420 5316 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6058 6444 gene locus_tag LOCUS_14430 6058 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6916 7332 gene locus_tag LOCUS_14440 6916 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence092 3381 2425 gene locus_tag LOCUS_14450 3381 2425 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_14450 3545 4126 gene locus_tag LOCUS_14460 3545 4126 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_14460 5750 4104 gene locus_tag LOCUS_14470 5750 4104 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_14470 7026 5821 gene locus_tag LOCUS_14480 7026 5821 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903642.1 protein_id gnl|my_center|LOCUS_14480 7701 7048 gene locus_tag LOCUS_14490 7701 7048 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 protein_id gnl|my_center|LOCUS_14490 8515 7727 gene locus_tag LOCUS_14500 8515 7727 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence093 647 1369 gene locus_tag LOCUS_14510 647 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1366 3927 gene locus_tag LOCUS_14520 1366 3927 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_14520 3785 3884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3900 4355 gene locus_tag LOCUS_14530 3900 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 4355 5542 gene locus_tag LOCUS_14540 4355 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5527 7248 gene locus_tag LOCUS_14550 5527 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence094 1324 152 gene locus_tag LOCUS_14560 1324 152 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919017.1 protein_id gnl|my_center|LOCUS_14560 2565 1408 gene locus_tag LOCUS_14570 2565 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3525 2890 gene locus_tag LOCUS_14580 3525 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 5535 3649 gene locus_tag LOCUS_14590 5535 3649 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794975.1 protein_id gnl|my_center|LOCUS_14590 <8384 5535 gene locus_tag LOCUS_14600 <8384 5535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202547.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence095 3494 249 gene locus_tag LOCUS_14610 3494 249 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_14610 5728 3644 gene locus_tag LOCUS_14620 5728 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 6006 7217 gene locus_tag LOCUS_14630 gene metK 6006 7217 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_14630 7595 7209 gene locus_tag LOCUS_14640 7595 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <8286 7613 gene locus_tag LOCUS_14650 <8286 7613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795608.1:endonuclease MutS2 >Feature sequence096 429 1691 gene locus_tag LOCUS_14660 429 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3170 1704 gene locus_tag LOCUS_14670 3170 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3622 6051 gene locus_tag LOCUS_14680 3622 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 6139 6354 gene locus_tag LOCUS_14690 6139 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6395 8191 gene locus_tag LOCUS_14700 6395 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence097 1143 730 gene locus_tag LOCUS_14710 1143 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1665 1171 gene locus_tag LOCUS_14720 1665 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3660 2758 gene locus_tag LOCUS_14730 3660 2758 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962714.1 protein_id gnl|my_center|LOCUS_14730 5330 3666 gene locus_tag LOCUS_14740 5330 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6506 5550 gene locus_tag LOCUS_14750 6506 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680251.1 protein_id gnl|my_center|LOCUS_14750 7627 6728 gene locus_tag LOCUS_14760 7627 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence098 2082 1603 gene locus_tag LOCUS_14770 2082 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2480 3739 gene locus_tag LOCUS_14780 2480 3739 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681485.1 protein_id gnl|my_center|LOCUS_14780 3758 6118 gene locus_tag LOCUS_14790 3758 6118 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_14790 6120 7142 gene locus_tag LOCUS_14800 6120 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 7148 7669 gene locus_tag LOCUS_14810 7148 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7730 8065 gene locus_tag LOCUS_14820 7730 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence099 343 1539 gene locus_tag LOCUS_14830 343 1539 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_14830 1590 1910 gene locus_tag LOCUS_14840 gene trxA 1590 1910 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_14840 1916 2527 gene locus_tag LOCUS_14850 1916 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2534 3505 gene locus_tag LOCUS_14860 2534 3505 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403976.1 protein_id gnl|my_center|LOCUS_14860 4151 3447 gene locus_tag LOCUS_14870 gene trmB 4151 3447 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_14870 4506 4138 gene locus_tag LOCUS_14880 4506 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 5731 4583 gene locus_tag LOCUS_14890 5731 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 6708 5743 gene locus_tag LOCUS_14900 6708 5743 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_14900 7652 6699 gene locus_tag LOCUS_14910 7652 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence100 2166 1057 gene locus_tag LOCUS_14920 2166 1057 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_14920 3185 2163 gene locus_tag LOCUS_14930 3185 2163 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817159.1 protein_id gnl|my_center|LOCUS_14930 4456 3188 gene locus_tag LOCUS_14940 4456 3188 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_14940 5626 4781 gene locus_tag LOCUS_14950 5626 4781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_14950 7182 5884 gene locus_tag LOCUS_14960 7182 5884 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_14960 7977 7369 gene locus_tag LOCUS_14970 7977 7369 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801359.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence101 1435 512 gene locus_tag LOCUS_14980 1435 512 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250218.1 protein_id gnl|my_center|LOCUS_14980 3940 1475 gene locus_tag LOCUS_14990 3940 1475 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_14990 5424 3943 gene locus_tag LOCUS_15000 5424 3943 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_15000 6228 5542 gene locus_tag LOCUS_15010 6228 5542 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_15010 6741 6238 gene locus_tag LOCUS_15020 6741 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 6698 7027 gene locus_tag LOCUS_15030 6698 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence102 3670 1670 gene locus_tag LOCUS_15040 3670 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3842 7651 gene locus_tag LOCUS_15050 3842 7651 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence103 2142 1009 gene locus_tag LOCUS_15060 gene wecB 2142 1009 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 protein_id gnl|my_center|LOCUS_15060 3269 2160 gene locus_tag LOCUS_15070 3269 2160 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_15070 4288 3266 gene locus_tag LOCUS_15080 4288 3266 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817159.1 protein_id gnl|my_center|LOCUS_15080 5346 4288 gene locus_tag LOCUS_15090 gene rfbB 5346 4288 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202143.1 protein_id gnl|my_center|LOCUS_15090 6206 5343 gene locus_tag LOCUS_15100 gene rfbD 6206 5343 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_15100 6751 6203 gene locus_tag LOCUS_15110 gene rfbC 6751 6203 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_15110 7619 6759 gene locus_tag LOCUS_15120 gene rfbA 7619 6759 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108090.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence104 144 761 gene locus_tag LOCUS_15130 144 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 776 3520 gene locus_tag LOCUS_15140 776 3520 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_15140 3520 4701 gene locus_tag LOCUS_15150 3520 4701 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801400.1 protein_id gnl|my_center|LOCUS_15150 4686 6407 gene locus_tag LOCUS_15160 4686 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence105 1173 163 gene locus_tag LOCUS_15170 1173 163 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759775.1 protein_id gnl|my_center|LOCUS_15170 1240 2700 gene locus_tag LOCUS_15180 1240 2700 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016326.1 protein_id gnl|my_center|LOCUS_15180 2693 3259 gene locus_tag LOCUS_15190 2693 3259 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948788.1 protein_id gnl|my_center|LOCUS_15190 3269 4201 gene locus_tag LOCUS_15200 3269 4201 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_15200 4188 5333 gene locus_tag LOCUS_15210 4188 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5330 6097 gene locus_tag LOCUS_15220 5330 6097 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_15220 6116 6757 gene locus_tag LOCUS_15230 6116 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence106 2 1099 gene locus_tag LOCUS_15240 2 1099 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_15240 1089 2033 gene locus_tag LOCUS_15250 1089 2033 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759763.1 protein_id gnl|my_center|LOCUS_15250 3603 1981 gene locus_tag LOCUS_15260 3603 1981 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_15260 5051 3600 gene locus_tag LOCUS_15270 gene putP 5051 3600 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_15270 5222 5878 gene locus_tag LOCUS_15280 5222 5878 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838096.1 protein_id gnl|my_center|LOCUS_15280 5979 6407 gene locus_tag LOCUS_15290 5979 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6424 6744 gene locus_tag LOCUS_15300 6424 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 6754 7089 gene locus_tag LOCUS_15310 6754 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence107 1353 382 gene locus_tag LOCUS_15320 1353 382 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_15320 2489 1356 gene locus_tag LOCUS_15330 2489 1356 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_15330 3949 2501 gene locus_tag LOCUS_15340 3949 2501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence108 <1 1969 gene locus_tag LOCUS_15350 <1 1969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784672.1:SusD/RagB family nutrient-binding outer membrane lipoprotein 2027 3775 gene locus_tag LOCUS_15360 2027 3775 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_15360 3780 5267 gene locus_tag LOCUS_15370 3780 5267 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_15370 5953 5264 gene locus_tag LOCUS_15380 5953 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 7157 5955 gene locus_tag LOCUS_15390 7157 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence109 226 1428 gene locus_tag LOCUS_15400 226 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1430 2119 gene locus_tag LOCUS_15410 1430 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3603 2116 gene locus_tag LOCUS_15420 3603 2116 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_15420 5356 3608 gene locus_tag LOCUS_15430 5356 3608 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_15430 <7382 5414 gene locus_tag LOCUS_15440 <7382 5414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766147.1:SusD/RagB family nutrient-binding outer membrane lipoprotein >Feature sequence110 2292 1267 gene locus_tag LOCUS_15450 2292 1267 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108001.1 protein_id gnl|my_center|LOCUS_15450 2670 2293 gene locus_tag LOCUS_15460 gene gcvH 2670 2293 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_15460 3318 2728 gene locus_tag LOCUS_15470 gene ruvA 3318 2728 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_15470 3370 4617 gene locus_tag LOCUS_15480 3370 4617 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_15480 4630 5055 gene locus_tag LOCUS_15490 4630 5055 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_15490 5056 5379 gene locus_tag LOCUS_15500 5056 5379 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_15500 5392 5844 gene locus_tag LOCUS_15510 gene folK 5392 5844 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence111 300 725 gene locus_tag LOCUS_15520 300 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15520 782 1357 gene locus_tag LOCUS_15530 782 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15530 1693 1478 gene locus_tag LOCUS_15540 1693 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2923 1763 gene locus_tag LOCUS_15550 2923 1763 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_15550 3338 3087 gene locus_tag LOCUS_15560 3338 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3748 3350 gene locus_tag LOCUS_15570 3748 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 4868 3969 gene locus_tag LOCUS_15580 4868 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 6631 5552 gene locus_tag LOCUS_15590 6631 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 <7184 6628 gene locus_tag LOCUS_15600 <7184 6628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759964.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence112 4802 1542 gene locus_tag LOCUS_15610 4802 1542 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_15610 5593 4805 gene locus_tag LOCUS_15620 5593 4805 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661702.1 protein_id gnl|my_center|LOCUS_15620 <6928 5600 gene locus_tag LOCUS_15630 <6928 5600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108647.1:sialate O-acetylesterase >Feature sequence113 219 294 gene locus_tag LOCUS_t00230 219 294 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 393 821 gene locus_tag LOCUS_15640 393 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2036 942 gene locus_tag LOCUS_15650 2036 942 CDS product IS3-like element ISRj2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166204126.1 protein_id gnl|my_center|LOCUS_15650 2695 2132 gene locus_tag LOCUS_15660 2695 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 4244 2706 gene locus_tag LOCUS_15670 4244 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 5190 4987 gene locus_tag LOCUS_15680 5190 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 5208 5957 gene locus_tag LOCUS_15690 5208 5957 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_15690 6487 6227 gene locus_tag LOCUS_15700 6487 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence114 823 74 gene locus_tag LOCUS_15710 gene istB 823 74 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_15710 2407 830 gene locus_tag LOCUS_15720 gene istA 2407 830 CDS product IS21-like element ISRsp2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440448.1 protein_id gnl|my_center|LOCUS_15720 2842 2513 gene locus_tag LOCUS_15730 2842 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15730 3147 2989 gene locus_tag LOCUS_15740 3147 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4023 3244 gene locus_tag LOCUS_15750 gene kdsA 4023 3244 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_15750 4589 4038 gene locus_tag LOCUS_15760 4589 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5367 4657 gene locus_tag LOCUS_15770 5367 4657 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216898.1 protein_id gnl|my_center|LOCUS_15770 5820 5569 gene locus_tag LOCUS_15780 5820 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 6314 5820 gene locus_tag LOCUS_15790 gene kdsC 6314 5820 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence115 422 2017 gene locus_tag LOCUS_15800 422 2017 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_15800 2050 2436 gene locus_tag LOCUS_15810 2050 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2433 3524 gene locus_tag LOCUS_15820 2433 3524 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_15820 3521 4792 gene locus_tag LOCUS_15830 3521 4792 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_15830 4803 5567 gene locus_tag LOCUS_15840 4803 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 5584 6615 gene locus_tag LOCUS_15850 gene pheS 5584 6615 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_15850 6680 6755 gene locus_tag LOCUS_t00240 6680 6755 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence116 1 282 gene locus_tag LOCUS_15860 1 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2861 279 gene locus_tag LOCUS_15870 gene clpB 2861 279 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_15870 2940 3563 gene locus_tag LOCUS_15880 2940 3563 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_15880 3575 4777 gene locus_tag LOCUS_15890 3575 4777 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_15890 4810 5868 gene locus_tag LOCUS_15900 4810 5868 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_15900 5865 6581 gene locus_tag LOCUS_15910 gene pssA 5865 6581 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence117 26 110 gene locus_tag LOCUS_t00250 26 110 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1243 398 gene locus_tag LOCUS_15920 1243 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2808 1402 gene locus_tag LOCUS_15930 2808 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3929 3207 gene locus_tag LOCUS_15940 3929 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 5488 4340 gene locus_tag LOCUS_15950 5488 4340 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120046688.1 protein_id gnl|my_center|LOCUS_15950 5887 5498 gene locus_tag LOCUS_15960 5887 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence118 413 75 gene locus_tag LOCUS_15970 413 75 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818131.1 protein_id gnl|my_center|LOCUS_15970 2830 464 gene locus_tag LOCUS_15980 2830 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 4998 2869 gene locus_tag LOCUS_15990 4998 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 5840 5986 gene locus_tag LOCUS_16000 5840 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence119 584 231 gene locus_tag LOCUS_16010 584 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2335 584 gene locus_tag LOCUS_16020 2335 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2844 2332 gene locus_tag LOCUS_16030 2844 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3948 2884 gene locus_tag LOCUS_16040 gene rfbB 3948 2884 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202143.1 protein_id gnl|my_center|LOCUS_16040 4817 3945 gene locus_tag LOCUS_16050 gene rfbA 4817 3945 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_16050 5955 4831 gene locus_tag LOCUS_16060 5955 4831 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_16060 6508 5963 gene locus_tag LOCUS_16070 6508 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence120 484 903 gene locus_tag LOCUS_16080 gene crcB 484 903 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_16080 1372 929 gene locus_tag LOCUS_16090 1372 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1548 2465 gene locus_tag LOCUS_16100 1548 2465 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929006.1 protein_id gnl|my_center|LOCUS_16100 3394 2423 gene locus_tag LOCUS_16110 3394 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4880 3375 gene locus_tag LOCUS_16120 4880 3375 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686168.1 protein_id gnl|my_center|LOCUS_16120 4963 5565 gene locus_tag LOCUS_16130 4963 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5608 5682 gene locus_tag LOCUS_t00260 5608 5682 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence121 <1 1558 gene locus_tag LOCUS_16140 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803715.1:DUF1593 domain-containing protein 1582 2757 gene locus_tag LOCUS_16150 1582 2757 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346611.1 protein_id gnl|my_center|LOCUS_16150 2761 4296 gene locus_tag LOCUS_16160 2761 4296 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803715.1 protein_id gnl|my_center|LOCUS_16160 4404 5561 gene locus_tag LOCUS_16170 4404 5561 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346611.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence122 2592 2116 gene locus_tag LOCUS_16180 gene rpsG 2592 2116 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_16180 2992 2612 gene locus_tag LOCUS_16190 gene rpsL 2992 2612 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_16190 4674 3100 gene locus_tag LOCUS_16200 4674 3100 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202272.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence123 670 134 gene locus_tag LOCUS_16210 670 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 735 2621 gene locus_tag LOCUS_16220 735 2621 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_16220 4579 2606 gene locus_tag LOCUS_16230 4579 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5154 4576 gene locus_tag LOCUS_16240 5154 4576 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_16240 5858 5151 gene locus_tag LOCUS_16250 5858 5151 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202968.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence124 244 1350 gene locus_tag LOCUS_16260 244 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2216 1455 gene locus_tag LOCUS_16270 2216 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3275 2265 gene locus_tag LOCUS_16280 3275 2265 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_16280 4812 3280 gene locus_tag LOCUS_16290 4812 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence125 304 1119 gene locus_tag LOCUS_16300 304 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1113 2186 gene locus_tag LOCUS_16310 1113 2186 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_16310 2263 2643 gene locus_tag LOCUS_16320 gene rplS 2263 2643 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_16320 2650 2724 gene locus_tag LOCUS_t00270 2650 2724 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2764 2863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2960 3382 gene locus_tag LOCUS_16330 gene umuD 2960 3382 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_16330 3385 4650 gene locus_tag LOCUS_16340 3385 4650 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_16340 4706 5455 gene locus_tag LOCUS_16350 4706 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5533 5892 gene locus_tag LOCUS_16360 5533 5892 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence126 232 978 gene locus_tag LOCUS_16370 232 978 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272170.1 protein_id gnl|my_center|LOCUS_16370 1135 1833 gene locus_tag LOCUS_16380 1135 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1872 2462 gene locus_tag LOCUS_16390 1872 2462 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459818.1 protein_id gnl|my_center|LOCUS_16390 2566 3414 gene locus_tag LOCUS_16400 2566 3414 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_16400 3411 4190 gene locus_tag LOCUS_16410 3411 4190 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414900.1 protein_id gnl|my_center|LOCUS_16410 4200 5510 gene locus_tag LOCUS_16420 4200 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence127 1054 1749 gene locus_tag LOCUS_16430 1054 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1908 2276 gene locus_tag LOCUS_16440 1908 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2936 2574 gene locus_tag LOCUS_16450 2936 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3279 3632 gene locus_tag LOCUS_16460 3279 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3795 5369 gene locus_tag LOCUS_16470 3795 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 5464 5688 gene locus_tag LOCUS_16480 5464 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence128 248 1132 gene locus_tag LOCUS_16490 gene prmA 248 1132 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_16490 1146 1586 gene locus_tag LOCUS_16500 1146 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1591 2670 gene locus_tag LOCUS_16510 gene orr 1591 2670 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_16510 2682 3356 gene locus_tag LOCUS_16520 gene mtgA 2682 3356 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_16520 4632 3367 gene locus_tag LOCUS_16530 4632 3367 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_16530 5595 4648 gene locus_tag LOCUS_16540 5595 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence129 367 65 gene locus_tag LOCUS_16550 367 65 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022669.1 protein_id gnl|my_center|LOCUS_16550 606 3149 gene locus_tag LOCUS_16560 606 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3850 3164 gene locus_tag LOCUS_16570 3850 3164 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_16570 4450 3881 gene locus_tag LOCUS_16580 4450 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 5957 4602 gene locus_tag LOCUS_16590 5957 4602 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence130 777 1007 gene locus_tag LOCUS_16600 777 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3337 905 gene locus_tag LOCUS_16610 3337 905 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_16610 4066 4590 gene locus_tag LOCUS_16620 gene updY 4066 4590 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_16620 4790 5842 gene locus_tag LOCUS_16630 4790 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence131 3266 96 gene locus_tag LOCUS_16640 3266 96 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_16640 3425 4918 gene locus_tag LOCUS_16650 gene hutH 3425 4918 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence132 2578 194 gene locus_tag LOCUS_16660 2578 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 3135 2614 gene locus_tag LOCUS_16670 3135 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4540 3215 gene locus_tag LOCUS_16680 4540 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 5721 5479 gene locus_tag LOCUS_16690 5721 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence133 <1 650 gene locus_tag LOCUS_16700 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869614.1:ABC transporter ATP-binding protein 664 1365 gene locus_tag LOCUS_16710 664 1365 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 protein_id gnl|my_center|LOCUS_16710 1368 2060 gene locus_tag LOCUS_16720 1368 2060 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496401.1 protein_id gnl|my_center|LOCUS_16720 2604 2029 gene locus_tag LOCUS_16730 2604 2029 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_16730 2762 3133 gene locus_tag LOCUS_16740 2762 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3126 4064 gene locus_tag LOCUS_16750 3126 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 4335 5147 gene locus_tag LOCUS_16760 4335 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 5161 5676 gene locus_tag LOCUS_16770 gene cobO 5161 5676 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence134 266 1873 gene locus_tag LOCUS_16780 266 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1860 3329 gene locus_tag LOCUS_16790 1860 3329 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_16790 3329 5104 gene locus_tag LOCUS_16800 3329 5104 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence135 1373 681 gene locus_tag LOCUS_16810 1373 681 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_16810 1542 2225 gene locus_tag LOCUS_16820 1542 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 protein_id gnl|my_center|LOCUS_16820 2814 2305 gene locus_tag LOCUS_16830 2814 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3586 2900 gene locus_tag LOCUS_16840 3586 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 5070 3628 gene locus_tag LOCUS_16850 5070 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5408 5103 gene locus_tag LOCUS_16860 5408 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence136 1202 102 gene locus_tag LOCUS_16870 1202 102 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_16870 1624 1199 gene locus_tag LOCUS_16880 1624 1199 CDS product radical SAM-associated putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797215.1 protein_id gnl|my_center|LOCUS_16880 3389 1944 gene locus_tag LOCUS_16890 3389 1944 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795105.1 protein_id gnl|my_center|LOCUS_16890 5361 5576 gene locus_tag LOCUS_16900 5361 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence137 <1 1475 gene locus_tag LOCUS_16910 <1 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870275.1:type I restriction-modification system subunit M 1495 2322 gene locus_tag LOCUS_16920 1495 2322 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_16920 2315 3478 gene locus_tag LOCUS_16930 2315 3478 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933538.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence138 2191 245 gene locus_tag LOCUS_16940 2191 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5326 2219 gene locus_tag LOCUS_16950 5326 2219 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence139 <1 836 gene locus_tag LOCUS_16960 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784016.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH 829 1155 gene locus_tag LOCUS_16970 829 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1152 2927 gene locus_tag LOCUS_16980 1152 2927 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_16980 2944 4419 gene locus_tag LOCUS_16990 2944 4419 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence140 <1 2081 gene locus_tag LOCUS_17000 <1 2081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107158.1:TonB-dependent receptor 2094 3737 gene locus_tag LOCUS_17010 2094 3737 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_17010 3813 5270 gene locus_tag LOCUS_17020 3813 5270 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence141 2634 1297 gene locus_tag LOCUS_17030 2634 1297 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_17030 2699 5191 gene locus_tag LOCUS_17040 2699 5191 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_17040 5549 5142 gene locus_tag LOCUS_17050 5549 5142 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence142 266 601 gene locus_tag LOCUS_17060 266 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_17060 604 1311 gene locus_tag LOCUS_17070 604 1311 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_17070 1316 1870 gene locus_tag LOCUS_17080 1316 1870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_17080 1929 2318 gene locus_tag LOCUS_17090 1929 2318 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868904.1 protein_id gnl|my_center|LOCUS_17090 2343 4130 gene locus_tag LOCUS_17100 gene nuoF 2343 4130 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence143 2297 1599 gene locus_tag LOCUS_17110 2297 1599 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047978.1 protein_id gnl|my_center|LOCUS_17110 2447 3082 gene locus_tag LOCUS_17120 2447 3082 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769271.1 protein_id gnl|my_center|LOCUS_17120 3276 3079 gene locus_tag LOCUS_17130 3276 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3351 4160 gene locus_tag LOCUS_17140 3351 4160 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791727.1 protein_id gnl|my_center|LOCUS_17140 4206 4751 gene locus_tag LOCUS_17150 4206 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 4828 5280 gene locus_tag LOCUS_17160 gene trxA 4828 5280 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence144 2113 923 gene locus_tag LOCUS_17170 gene kbl 2113 923 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_17170 2461 2120 gene locus_tag LOCUS_17180 gene secG 2461 2120 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_17180 3190 2465 gene locus_tag LOCUS_17190 3190 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_17190 3717 3202 gene locus_tag LOCUS_17200 3717 3202 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_17200 4917 3718 gene locus_tag LOCUS_17210 4917 3718 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence145 556 5 gene locus_tag LOCUS_17220 556 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1002 553 gene locus_tag LOCUS_17230 1002 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1292 1783 gene locus_tag LOCUS_17240 gene nuoE 1292 1783 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_17240 1773 2957 gene locus_tag LOCUS_17250 1773 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2976 4763 gene locus_tag LOCUS_17260 2976 4763 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence146 1352 105 gene locus_tag LOCUS_17270 1352 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1427 3325 gene locus_tag LOCUS_17280 1427 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence147 <1 605 gene locus_tag LOCUS_17290 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034100836.1:ABC transporter ATP-binding protein 602 1873 gene locus_tag LOCUS_17300 602 1873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_17300 2477 1845 gene locus_tag LOCUS_17310 2477 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2535 4700 gene locus_tag LOCUS_17320 2535 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4700 5257 gene locus_tag LOCUS_17330 4700 5257 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764211.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence148 268 1320 gene locus_tag LOCUS_17340 268 1320 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_17340 1332 3011 gene locus_tag LOCUS_17350 1332 3011 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_17350 3021 3707 gene locus_tag LOCUS_17360 3021 3707 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_17360 3694 5265 gene locus_tag LOCUS_17370 3694 5265 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence149 1471 236 gene locus_tag LOCUS_17380 1471 236 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857806.1 protein_id gnl|my_center|LOCUS_17380 3259 1790 gene locus_tag LOCUS_17390 3259 1790 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_17390 3472 4242 gene locus_tag LOCUS_17400 3472 4242 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_17400 4239 5297 gene locus_tag LOCUS_17410 gene rsgA 4239 5297 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence150 86 2344 gene locus_tag LOCUS_17420 86 2344 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_17420 4300 2348 gene locus_tag LOCUS_17430 4300 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 3518 3617 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5301 4348 gene locus_tag LOCUS_17440 <5301 4348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765915.1:replication-associated recombination protein A >Feature sequence151 50 124 gene locus_tag LOCUS_t00280 50 124 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 618 1280 gene locus_tag LOCUS_17450 618 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1703 1440 gene locus_tag LOCUS_17460 1703 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2089 2460 gene locus_tag LOCUS_17470 2089 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2397 3287 gene locus_tag LOCUS_17480 2397 3287 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_17480 3404 3814 gene locus_tag LOCUS_17490 3404 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4124 4966 gene locus_tag LOCUS_17500 4124 4966 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence152 1160 279 gene locus_tag LOCUS_17510 1160 279 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_17510 1954 1181 gene locus_tag LOCUS_17520 gene zupT 1954 1181 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262376.1 protein_id gnl|my_center|LOCUS_17520 3065 1944 gene locus_tag LOCUS_17530 3065 1944 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_17530 4402 3107 gene locus_tag LOCUS_17540 4402 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence153 36 120 gene locus_tag LOCUS_t00290 36 120 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 867 340 gene locus_tag LOCUS_17550 867 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793705.1 protein_id gnl|my_center|LOCUS_17550 1301 864 gene locus_tag LOCUS_17560 1301 864 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793703.1 protein_id gnl|my_center|LOCUS_17560 1678 1298 gene locus_tag LOCUS_17570 1678 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2463 1777 gene locus_tag LOCUS_17580 2463 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 3289 2576 gene locus_tag LOCUS_17590 3289 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4369 3302 gene locus_tag LOCUS_17600 4369 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 5121 4456 gene locus_tag LOCUS_17610 5121 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence154 2379 385 gene locus_tag LOCUS_17620 2379 385 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107228.1 protein_id gnl|my_center|LOCUS_17620 3422 2526 gene locus_tag LOCUS_17630 3422 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 4146 3622 gene locus_tag LOCUS_17640 gene updY 4146 3622 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence155 1942 866 gene locus_tag LOCUS_17650 1942 866 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_17650 2358 2113 gene locus_tag LOCUS_17660 2358 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 3208 2426 gene locus_tag LOCUS_17670 3208 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17670 4276 3941 gene locus_tag LOCUS_17680 4276 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 4444 4286 gene locus_tag LOCUS_17690 4444 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 <5210 4432 gene locus_tag LOCUS_17700 <5210 4432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021591.1:ATP-binding protein >Feature sequence156 566 3586 gene locus_tag LOCUS_17710 566 3586 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_17710 3607 5067 gene locus_tag LOCUS_17720 3607 5067 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence157 69 3209 gene locus_tag LOCUS_17730 69 3209 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_17730 3223 4800 gene locus_tag LOCUS_17740 3223 4800 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence158 1036 236 gene locus_tag LOCUS_17750 1036 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4578 1174 gene locus_tag LOCUS_17760 4578 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 4979 4581 gene locus_tag LOCUS_17770 4979 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence159 2921 492 gene locus_tag LOCUS_17780 2921 492 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107358.1 protein_id gnl|my_center|LOCUS_17780 3710 2931 gene locus_tag LOCUS_17790 3710 2931 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_17790 3795 5051 gene locus_tag LOCUS_17800 3795 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence160 3537 1750 gene locus_tag LOCUS_17810 gene nuoF 3537 1750 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_17810 3951 3562 gene locus_tag LOCUS_17820 3951 3562 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868904.1 protein_id gnl|my_center|LOCUS_17820 4564 4010 gene locus_tag LOCUS_17830 4564 4010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_17830 5010 4561 gene locus_tag LOCUS_17840 5010 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence161 70 897 gene locus_tag LOCUS_17850 70 897 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_17850 894 2237 gene locus_tag LOCUS_17860 894 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2279 2352 gene locus_tag LOCUS_t00300 2279 2352 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2355 2753 gene locus_tag LOCUS_17870 2355 2753 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398485.1 protein_id gnl|my_center|LOCUS_17870 3463 2747 gene locus_tag LOCUS_17880 3463 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4716 3466 gene locus_tag LOCUS_17890 gene fabF 4716 3466 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762962.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence162 1835 4828 gene locus_tag LOCUS_17900 1835 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence163 1 123 gene locus_tag LOCUS_17910 1 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 254 586 gene locus_tag LOCUS_17920 254 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 632 2101 gene locus_tag LOCUS_17930 gene cysS 632 2101 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence164 236 1879 gene locus_tag LOCUS_17940 236 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1882 4155 gene locus_tag LOCUS_17950 1882 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence165 2719 2030 gene locus_tag LOCUS_17960 2719 2030 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_17960 3882 2716 gene locus_tag LOCUS_17970 3882 2716 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_17970 4053 4361 gene locus_tag LOCUS_17980 4053 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 4380 4652 gene locus_tag LOCUS_17990 gene rpmA 4380 4652 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence166 2204 624 gene locus_tag LOCUS_18000 2204 624 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_18000 4599 3082 gene locus_tag LOCUS_18010 4599 3082 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence167 478 1086 gene locus_tag LOCUS_18020 478 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1089 2567 gene locus_tag LOCUS_18030 1089 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3263 4129 gene locus_tag LOCUS_18040 3263 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 4686 4177 gene locus_tag LOCUS_18050 4686 4177 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence168 405 947 gene locus_tag LOCUS_18060 405 947 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_18060 2012 948 gene locus_tag LOCUS_18070 gene rsgA 2012 948 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_18070 2239 2925 gene locus_tag LOCUS_18080 2239 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2941 4005 gene locus_tag LOCUS_18090 2941 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4002 4754 gene locus_tag LOCUS_18100 4002 4754 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence169 604 1230 gene locus_tag LOCUS_18110 604 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1223 1525 gene locus_tag LOCUS_18120 1223 1525 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_18120 1544 2143 gene locus_tag LOCUS_18130 1544 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3635 2172 gene locus_tag LOCUS_18140 3635 2172 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_18140 <4858 3632 gene locus_tag LOCUS_18150 <4858 3632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108580.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence170 3019 1073 gene locus_tag LOCUS_18160 3019 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 <4812 3047 gene locus_tag LOCUS_18170 <4812 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108195.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence171 1047 376 gene locus_tag LOCUS_18180 1047 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1810 971 gene locus_tag LOCUS_18190 1810 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2882 2466 gene locus_tag LOCUS_18200 2882 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3649 2879 gene locus_tag LOCUS_18210 3649 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4568 3630 gene locus_tag LOCUS_18220 4568 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence172 1645 788 gene locus_tag LOCUS_18230 1645 788 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_18230 1993 1658 gene locus_tag LOCUS_18240 1993 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2323 2003 gene locus_tag LOCUS_18250 2323 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2768 2340 gene locus_tag LOCUS_18260 2768 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3693 2869 gene locus_tag LOCUS_18270 3693 2869 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838096.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence173 1037 312 gene locus_tag LOCUS_18280 1037 312 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829499.1 protein_id gnl|my_center|LOCUS_18280 1845 1048 gene locus_tag LOCUS_18290 1845 1048 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566220.1 protein_id gnl|my_center|LOCUS_18290 2420 1842 gene locus_tag LOCUS_18300 2420 1842 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_18300 2843 2430 gene locus_tag LOCUS_18310 2843 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2927 3454 gene locus_tag LOCUS_18320 2927 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3756 3457 gene locus_tag LOCUS_18330 3756 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence174 3338 750 gene locus_tag LOCUS_18340 3338 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 4018 3356 gene locus_tag LOCUS_18350 4018 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence175 763 326 gene locus_tag LOCUS_18360 gene cdd 763 326 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_18360 899 1789 gene locus_tag LOCUS_18370 899 1789 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_18370 1800 2855 gene locus_tag LOCUS_18380 gene mltG 1800 2855 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_18380 2852 3568 gene locus_tag LOCUS_18390 2852 3568 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_18390 3571 3936 gene locus_tag LOCUS_18400 3571 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence176 <1 696 gene locus_tag LOCUS_18410 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039190.1:MFS transporter 717 1688 gene locus_tag LOCUS_18420 717 1688 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_18420 2857 1685 gene locus_tag LOCUS_18430 2857 1685 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence177 268 642 gene locus_tag LOCUS_18440 268 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 639 3557 gene locus_tag LOCUS_18450 639 3557 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_18450 3621 4445 gene locus_tag LOCUS_18460 3621 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence178 >Feature sequence179 579 652 gene locus_tag LOCUS_t00310 579 652 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 903 1601 gene locus_tag LOCUS_18470 903 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2025 4454 gene locus_tag LOCUS_18480 2025 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence180 <1 1601 gene locus_tag LOCUS_18490 <1 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202522.1:SLBB domain-containing protein 1609 2727 gene locus_tag LOCUS_18500 1609 2727 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_18500 2842 3855 gene locus_tag LOCUS_18510 gene pseB 2842 3855 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence181 89 3241 gene locus_tag LOCUS_18520 89 3241 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence182 3103 1742 gene locus_tag LOCUS_18530 3103 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3993 3115 gene locus_tag LOCUS_18540 3993 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 <4589 4019 gene locus_tag LOCUS_18550 <4589 4019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789572.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence183 1952 945 gene locus_tag LOCUS_18560 1952 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2271 1936 gene locus_tag LOCUS_18570 2271 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2488 2967 gene locus_tag LOCUS_18580 2488 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence184 464 922 gene locus_tag LOCUS_18590 gene tsaE 464 922 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_18590 2179 995 gene locus_tag LOCUS_18600 2179 995 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_18600 3585 2254 gene locus_tag LOCUS_18610 3585 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 <4566 3557 gene locus_tag LOCUS_18620 <4566 3557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937872.1:tRNA 2-selenouridine(34) synthase MnmH >Feature sequence185 1902 397 gene locus_tag LOCUS_18630 1902 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2543 1905 gene locus_tag LOCUS_18640 2543 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence186 <1 828 gene locus_tag LOCUS_18650 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108629.1:TonB-dependent receptor 849 2543 gene locus_tag LOCUS_18660 849 2543 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_18660 2685 4358 gene locus_tag LOCUS_18670 2685 4358 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence187 2747 1962 gene locus_tag LOCUS_18680 gene cdaA 2747 1962 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_18680 3315 2767 gene locus_tag LOCUS_18690 3315 2767 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence188 2926 1793 gene locus_tag LOCUS_18700 2926 1793 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_18700 3860 3042 gene locus_tag LOCUS_18710 gene rpsC 3860 3042 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_18710 4281 3862 gene locus_tag LOCUS_18720 gene rplV 4281 3862 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence189 <1 1752 gene locus_tag LOCUS_18730 <1 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086596.1:HAD-IC family P-type ATPase 1842 2318 gene locus_tag LOCUS_18740 1842 2318 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206731.1 protein_id gnl|my_center|LOCUS_18740 2397 2909 gene locus_tag LOCUS_18750 2397 2909 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203292.1 protein_id gnl|my_center|LOCUS_18750 3039 3380 gene locus_tag LOCUS_18760 3039 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence190 <1 1463 gene locus_tag LOCUS_18770 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202809.1:isoleucine--tRNA ligase 1502 1924 gene locus_tag LOCUS_18780 1502 1924 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_18780 1932 2558 gene locus_tag LOCUS_18790 1932 2558 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_18790 2665 2754 gene locus_tag LOCUS_t00320 2665 2754 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3678 4172 gene locus_tag LOCUS_18800 3678 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence191 128 808 gene locus_tag LOCUS_18810 128 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 768 2771 gene locus_tag LOCUS_18820 768 2771 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_18820 2781 4004 gene locus_tag LOCUS_18830 gene pepT 2781 4004 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence192 4164 1648 gene locus_tag LOCUS_18840 4164 1648 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765027.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence193 2143 65 gene locus_tag LOCUS_18850 2143 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3074 2118 gene locus_tag LOCUS_18860 3074 2118 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086100.1 protein_id gnl|my_center|LOCUS_18860 3142 4200 gene locus_tag LOCUS_18870 3142 4200 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence194 1563 166 gene locus_tag LOCUS_18880 1563 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2001 2594 gene locus_tag LOCUS_18890 2001 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2587 2877 gene locus_tag LOCUS_18900 2587 2877 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence195 865 323 gene locus_tag LOCUS_18910 865 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2106 862 gene locus_tag LOCUS_18920 2106 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3920 2109 gene locus_tag LOCUS_18930 3920 2109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403374.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence196 <1 1419 gene locus_tag LOCUS_18940 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117740.1:prolyl oligopeptidase family serine peptidase 2637 1546 gene locus_tag LOCUS_18950 2637 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3941 2826 gene locus_tag LOCUS_18960 3941 2826 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence197 106 1113 gene locus_tag LOCUS_18970 106 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1110 3401 gene locus_tag LOCUS_18980 1110 3401 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_18980 3538 3996 gene locus_tag LOCUS_18990 3538 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence198 661 1827 gene locus_tag LOCUS_19000 661 1827 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_19000 2920 2030 gene locus_tag LOCUS_19010 2920 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence199 3 1799 gene locus_tag LOCUS_19020 3 1799 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_19020 3968 1800 gene locus_tag LOCUS_19030 3968 1800 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_19030 4028 4102 gene locus_tag LOCUS_t00330 4028 4102 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence200 460 1245 gene locus_tag LOCUS_19040 460 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1424 2371 gene locus_tag LOCUS_19050 1424 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2374 2895 gene locus_tag LOCUS_19060 2374 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2892 3746 gene locus_tag LOCUS_19070 2892 3746 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060859.1 protein_id gnl|my_center|LOCUS_19070 3862 4164 gene locus_tag LOCUS_19080 3862 4164 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022669.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence201 <4221 1013 gene locus_tag LOCUS_19090 <4221 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107158.1:TonB-dependent receptor >Feature sequence202 >Feature sequence203 3528 1156 gene locus_tag LOCUS_19100 3528 1156 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_19100 4162 3557 gene locus_tag LOCUS_19110 4162 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence204 1411 677 gene locus_tag LOCUS_19120 1411 677 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_19120 2517 1408 gene locus_tag LOCUS_19130 2517 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3738 2653 gene locus_tag LOCUS_19140 3738 2653 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461658.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence205 309 644 gene locus_tag LOCUS_19150 309 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788335.1 protein_id gnl|my_center|LOCUS_19150 712 3018 gene locus_tag LOCUS_19160 712 3018 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence206 27 2573 gene locus_tag LOCUS_19170 27 2573 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765726.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence207 955 1854 gene locus_tag LOCUS_19180 gene rbsK 955 1854 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence208 422 1069 gene locus_tag LOCUS_19190 422 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1142 1990 gene locus_tag LOCUS_19200 1142 1990 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_19200 1987 2760 gene locus_tag LOCUS_19210 1987 2760 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876764.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence209 1109 345 gene locus_tag LOCUS_19220 1109 345 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_19220 3232 1106 gene locus_tag LOCUS_19230 3232 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence210 3601 617 gene locus_tag LOCUS_19240 3601 617 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence211 2045 945 gene locus_tag LOCUS_19250 2045 945 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405546.1 protein_id gnl|my_center|LOCUS_19250 3947 2064 gene locus_tag LOCUS_19260 3947 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence212 437 1450 gene locus_tag LOCUS_19270 437 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1494 1727 gene locus_tag LOCUS_19280 1494 1727 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_19280 1724 2056 gene locus_tag LOCUS_19290 1724 2056 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_19290 2118 2990 gene locus_tag LOCUS_19300 2118 2990 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence213 904 47 gene locus_tag LOCUS_19310 904 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2454 1144 gene locus_tag LOCUS_19320 2454 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 <4048 2648 gene locus_tag LOCUS_19330 <4048 2648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787886.1:DNA gyrase subunit A >Feature sequence214 110 1834 gene locus_tag LOCUS_19340 gene glaB 110 1834 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence215 75 614 gene locus_tag LOCUS_19350 75 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 619 1380 gene locus_tag LOCUS_19360 gene rhaD 619 1380 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence216 3444 1066 gene locus_tag LOCUS_19370 3444 1066 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_19370 <4036 3459 gene locus_tag LOCUS_19380 <4036 3459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764311.1:alpha/beta hydrolase-fold protein >Feature sequence217 <1 2426 gene locus_tag LOCUS_19390 <1 2426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106605886.1:SusC/RagA family TonB-linked outer membrane protein 2445 3911 gene locus_tag LOCUS_19400 2445 3911 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence218 1002 169 gene locus_tag LOCUS_19410 1002 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1947 1030 gene locus_tag LOCUS_19420 1947 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2640 1978 gene locus_tag LOCUS_19430 2640 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3830 3024 gene locus_tag LOCUS_19440 3830 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence219 239 2023 gene locus_tag LOCUS_19450 239 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence220 134 1687 gene locus_tag LOCUS_19460 134 1687 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_19460 1800 3986 gene locus_tag LOCUS_19470 1800 3986 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence221 761 1201 gene locus_tag LOCUS_19480 761 1201 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_19480 1223 1924 gene locus_tag LOCUS_19490 1223 1924 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 protein_id gnl|my_center|LOCUS_19490 2085 2990 gene locus_tag LOCUS_19500 2085 2990 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 protein_id gnl|my_center|LOCUS_19500 2995 3840 gene locus_tag LOCUS_19510 2995 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence222 <1 682 gene locus_tag LOCUS_19520 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108940.1:1-acyl-sn-glycerol-3-phosphate acyltransferase 3722 753 gene locus_tag LOCUS_19530 3722 753 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence223 <1 2610 gene locus_tag LOCUS_19540 <1 2610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789596.1:response regulator 3583 3320 gene locus_tag LOCUS_19550 3583 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence224 252 455 gene locus_tag LOCUS_19560 252 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3058 437 gene locus_tag LOCUS_19570 3058 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 <3984 3124 gene locus_tag LOCUS_19580 <3984 3124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887299.1:alpha/beta hydrolase >Feature sequence225 412 104 gene locus_tag LOCUS_19590 412 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1544 402 gene locus_tag LOCUS_19600 1544 402 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_19600 2135 1545 gene locus_tag LOCUS_19610 2135 1545 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220670.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence226 132 206 gene locus_tag LOCUS_t00340 132 206 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 220 294 gene locus_tag LOCUS_t00350 220 294 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 344 1912 gene locus_tag LOCUS_19620 344 1912 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108692.1 protein_id gnl|my_center|LOCUS_19620 1924 3156 gene locus_tag LOCUS_19630 1924 3156 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_19630 3798 3151 gene locus_tag LOCUS_19640 3798 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3885 3959 gene locus_tag LOCUS_t00360 3885 3959 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence227 1295 465 gene locus_tag LOCUS_19650 1295 465 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_19650 1539 2294 gene locus_tag LOCUS_19660 1539 2294 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_19660 3853 2306 gene locus_tag LOCUS_19670 3853 2306 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence228 1288 77 gene locus_tag LOCUS_19680 1288 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3326 1536 gene locus_tag LOCUS_19690 3326 1536 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681765.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence229 782 1183 gene locus_tag LOCUS_19700 782 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1536 2945 gene locus_tag LOCUS_19710 1536 2945 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795105.1 protein_id gnl|my_center|LOCUS_19710 2992 3603 gene locus_tag LOCUS_19720 2992 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence230 <1 1862 gene locus_tag LOCUS_19730 <1 1862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918674.1:glycoside hydrolase family 31 protein >Feature sequence231 <1 1197 gene locus_tag LOCUS_19740 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109352.1:RagB/SusD family nutrient uptake outer membrane protein 1226 2062 gene locus_tag LOCUS_19750 1226 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2140 2709 gene locus_tag LOCUS_19760 2140 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence232 3492 2416 gene locus_tag LOCUS_19770 gene carA 3492 2416 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence233 41 1411 gene locus_tag LOCUS_19780 41 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1423 3348 gene locus_tag LOCUS_19790 1423 3348 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201999.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence234 3158 234 gene locus_tag LOCUS_19800 3158 234 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_19800 <3918 3178 gene locus_tag LOCUS_19810 <3918 3178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761960.1:ribokinase >Feature sequence235 818 1900 gene locus_tag LOCUS_19820 818 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1911 2627 gene locus_tag LOCUS_19830 1911 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2740 3426 gene locus_tag LOCUS_19840 2740 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence236 3189 2527 gene locus_tag LOCUS_19850 3189 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence237 652 1551 gene locus_tag LOCUS_19860 652 1551 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_19860 2227 1508 gene locus_tag LOCUS_19870 2227 1508 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_19870 3222 2224 gene locus_tag LOCUS_19880 3222 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence238 101 1402 gene locus_tag LOCUS_19890 101 1402 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_19890 2236 1424 gene locus_tag LOCUS_19900 2236 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3609 2293 gene locus_tag LOCUS_19910 3609 2293 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence239 382 1695 gene locus_tag LOCUS_19920 382 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1692 3611 gene locus_tag LOCUS_19930 1692 3611 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence240 2901 1681 gene locus_tag LOCUS_19940 2901 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3278 3009 gene locus_tag LOCUS_19950 3278 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence241 <1 696 gene locus_tag LOCUS_19960 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202132.1:carboxypeptidase-like regulatory domain-containing protein 707 1879 gene locus_tag LOCUS_19970 707 1879 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801400.1 protein_id gnl|my_center|LOCUS_19970 1899 3599 gene locus_tag LOCUS_19980 1899 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence242 <1 1184 gene locus_tag LOCUS_19990 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203179.1:cytochrome c biogenesis protein CcdA 1191 2540 gene locus_tag LOCUS_20000 1191 2540 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence243 3 479 gene locus_tag LOCUS_20010 3 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 485 844 gene locus_tag LOCUS_20020 485 844 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_20020 841 2361 gene locus_tag LOCUS_20030 841 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3538 2348 gene locus_tag LOCUS_20040 gene kbl 3538 2348 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence244 718 1116 gene locus_tag LOCUS_20050 718 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1421 1149 gene locus_tag LOCUS_20060 1421 1149 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_20060 1740 1426 gene locus_tag LOCUS_20070 1740 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2120 2047 gene locus_tag LOCUS_t00370 2120 2047 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3531 2146 gene locus_tag LOCUS_20080 gene hisS 3531 2146 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence245 2 1051 gene locus_tag LOCUS_20090 2 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1176 1775 gene locus_tag LOCUS_20100 gene rplC 1176 1775 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_20100 1780 2421 gene locus_tag LOCUS_20110 gene rplD 1780 2421 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_20110 2424 2714 gene locus_tag LOCUS_20120 gene rplW 2424 2714 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_20120 2718 3545 gene locus_tag LOCUS_20130 gene rplB 2718 3545 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence246 101 541 gene locus_tag LOCUS_20140 101 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 1891 635 gene locus_tag LOCUS_20150 1891 635 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_20150 2411 2887 gene locus_tag LOCUS_20160 2411 2887 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence247 <1 1089 gene locus_tag LOCUS_20170 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361992.1:tyrosine-type recombinase/integrase >Feature sequence248 <1 971 gene locus_tag LOCUS_20180 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001153181.1:ATP-binding protein 968 1615 gene locus_tag LOCUS_20190 968 1615 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_20190 1719 2471 gene locus_tag LOCUS_20200 1719 2471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 protein_id gnl|my_center|LOCUS_20200 2482 3183 gene locus_tag LOCUS_20210 2482 3183 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869613.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence249 <1 1359 gene locus_tag LOCUS_20220 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108627.1:SusF/SusE family outer membrane protein 1538 3112 gene locus_tag LOCUS_20230 1538 3112 CDS product glycoside hydrolase family 66 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108626.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence250 <1 767 gene locus_tag LOCUS_20240 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867662.1:pyridoxal-phosphate dependent enzyme 767 1390 gene locus_tag LOCUS_20250 767 1390 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538559.1 protein_id gnl|my_center|LOCUS_20250 1381 2610 gene locus_tag LOCUS_20260 1381 2610 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_20260 <3720 2588 gene locus_tag LOCUS_20270 <3720 2588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203147.1:patatin-like phospholipase family protein >Feature sequence251 1180 3648 gene locus_tag LOCUS_20280 1180 3648 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence252 401 2167 gene locus_tag LOCUS_20290 401 2167 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_20290 2167 3651 gene locus_tag LOCUS_20300 2167 3651 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence253 203 955 gene locus_tag LOCUS_20310 203 955 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_20310 2408 894 gene locus_tag LOCUS_20320 2408 894 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_20320 3153 2416 gene locus_tag LOCUS_20330 gene rlmB 3153 2416 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_20330 3674 3156 gene locus_tag LOCUS_20340 3674 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence254 210 1139 gene locus_tag LOCUS_20350 210 1139 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_20350 2316 1129 gene locus_tag LOCUS_20360 2316 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2438 3331 gene locus_tag LOCUS_20370 2438 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence255 <1 2285 gene locus_tag LOCUS_20380 <1 2285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS type A sorting domain-containing protein >Feature sequence256 1392 2618 gene locus_tag LOCUS_20390 1392 2618 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963042.1 protein_id gnl|my_center|LOCUS_20390 3561 2689 gene locus_tag LOCUS_20400 3561 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence257 2967 49 gene locus_tag LOCUS_20410 2967 49 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_20410 3338 2964 gene locus_tag LOCUS_20420 3338 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence258 188 2431 gene locus_tag LOCUS_20430 188 2431 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_20430 2437 3492 gene locus_tag LOCUS_20440 2437 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence259 1354 212 gene locus_tag LOCUS_20450 1354 212 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 protein_id gnl|my_center|LOCUS_20450 2405 1392 gene locus_tag LOCUS_20460 2405 1392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_20460 <3536 2508 gene locus_tag LOCUS_20470 <3536 2508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107326.1:ABC transporter permease >Feature sequence260 1616 945 gene locus_tag LOCUS_20480 1616 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2830 2561 gene locus_tag LOCUS_20490 2830 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence261 <1 503 gene locus_tag LOCUS_20500 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785877.1:TrpB-like pyridoxal phosphate-dependent enzyme 1278 487 gene locus_tag LOCUS_20510 1278 487 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681526.1 protein_id gnl|my_center|LOCUS_20510 2744 1275 gene locus_tag LOCUS_20520 2744 1275 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530657.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence262 1552 653 gene locus_tag LOCUS_20530 1552 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1595 2167 gene locus_tag LOCUS_20540 1595 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2164 2460 gene locus_tag LOCUS_20550 2164 2460 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence263 <1 2579 gene locus_tag LOCUS_20560 <1 2579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203678.1:TonB-dependent receptor >Feature sequence264 109 1422 gene locus_tag LOCUS_20570 109 1422 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201962.1 protein_id gnl|my_center|LOCUS_20570 1426 3015 gene locus_tag LOCUS_20580 1426 3015 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431748.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence265 >Feature sequence266 3 1142 gene locus_tag LOCUS_20590 3 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1250 1630 gene locus_tag LOCUS_20600 gene rpsL 1250 1630 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_20600 1650 2126 gene locus_tag LOCUS_20610 gene rpsG 1650 2126 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence267 245 1321 gene locus_tag LOCUS_20620 gene buk 245 1321 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence268 1240 1662 gene locus_tag LOCUS_20630 1240 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 <3446 1729 gene locus_tag LOCUS_20640 <3446 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117740.1:prolyl oligopeptidase family serine peptidase >Feature sequence269 <1 2069 gene locus_tag LOCUS_20650 <1 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103036562.1:TonB-dependent receptor >Feature sequence270 <1 1688 gene locus_tag LOCUS_20660 <1 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769027.1:TonB-dependent receptor 1726 2943 gene locus_tag LOCUS_20670 1726 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3187 3105 gene locus_tag LOCUS_t00380 3187 3105 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence271 1617 268 gene locus_tag LOCUS_20680 1617 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence272 727 56 gene locus_tag LOCUS_20690 727 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1427 651 gene locus_tag LOCUS_20700 1427 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2111 1704 gene locus_tag LOCUS_20710 2111 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2522 2118 gene locus_tag LOCUS_20720 2522 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3289 2519 gene locus_tag LOCUS_20730 3289 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence273 3 743 gene locus_tag LOCUS_20740 3 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence274 <1 2930 gene locus_tag LOCUS_20750 <1 2930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107165.1:TonB-dependent receptor >Feature sequence275 214 1068 gene locus_tag LOCUS_20760 gene rfbD 214 1068 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_20760 1075 2799 gene locus_tag LOCUS_20770 1075 2799 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_20770 3338 2790 gene locus_tag LOCUS_20780 3338 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence276 1042 1761 gene locus_tag LOCUS_20790 1042 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1865 2551 gene locus_tag LOCUS_20800 1865 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2651 3031 gene locus_tag LOCUS_20810 2651 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence277 >Feature sequence278 <1 2330 gene locus_tag LOCUS_20820 <1 2330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202496.1:TonB-dependent receptor >Feature sequence279 365 1198 gene locus_tag LOCUS_20830 365 1198 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_20830 2414 1170 gene locus_tag LOCUS_20840 2414 1170 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_20840 2853 2401 gene locus_tag LOCUS_20850 2853 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence280 <1 2070 gene locus_tag LOCUS_20860 <1 2070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202101.1:M1 family aminopeptidase >Feature sequence281 491 1600 gene locus_tag LOCUS_20870 gene dprA 491 1600 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_20870 1597 2370 gene locus_tag LOCUS_20880 1597 2370 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence282 2971 299 gene locus_tag LOCUS_20890 2971 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence283 <1 1974 gene locus_tag LOCUS_20900 <1 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107799.1:carboxypeptidase-like regulatory domain-containing protein 2688 1978 gene locus_tag LOCUS_20910 2688 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 <3319 2669 gene locus_tag LOCUS_20920 <3319 2669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963830.1:AMP-dependent synthetase/ligase >Feature sequence284 1129 236 gene locus_tag LOCUS_20930 1129 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20930 1625 1119 gene locus_tag LOCUS_20940 1625 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20940 >Feature sequence285 3053 843 gene locus_tag LOCUS_20950 3053 843 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence286 <1 2447 gene locus_tag LOCUS_20960 <1 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202910.1:3'-5' exonuclease <3288 2521 gene locus_tag LOCUS_20970 <3288 2521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404376.1:proline iminopeptidase-family hydrolase >Feature sequence287 1372 377 gene locus_tag LOCUS_20980 1372 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 1524 2957 gene locus_tag LOCUS_20990 1524 2957 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064476.1 protein_id gnl|my_center|LOCUS_20990 3272 3199 gene locus_tag LOCUS_t00390 3272 3199 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence288 1236 103 gene locus_tag LOCUS_21000 1236 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1563 1366 gene locus_tag LOCUS_21010 1563 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1580 1679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence289 745 257 gene locus_tag LOCUS_21020 745 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 827 1684 gene locus_tag LOCUS_21030 827 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1759 2820 gene locus_tag LOCUS_21040 gene hemW 1759 2820 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence290 <1 2996 gene locus_tag LOCUS_21050 <1 2996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108531.1:hybrid sensor histidine kinase/response regulator transcription factor >Feature sequence291 >Feature sequence292 <1 587 gene locus_tag LOCUS_21060 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103036562.1:TonB-dependent receptor 600 2192 gene locus_tag LOCUS_21070 600 2192 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence293 978 325 gene locus_tag LOCUS_21080 gene fsa 978 325 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789246.1 protein_id gnl|my_center|LOCUS_21080 2132 975 gene locus_tag LOCUS_21090 2132 975 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_21090 2743 2138 gene locus_tag LOCUS_21100 2743 2138 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_21100 3163 2747 gene locus_tag LOCUS_21110 3163 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence294 452 1738 gene locus_tag LOCUS_21120 452 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1858 2562 gene locus_tag LOCUS_21130 1858 2562 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922437.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence295 883 380 gene locus_tag LOCUS_21140 gene cobO 883 380 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081762.1 protein_id gnl|my_center|LOCUS_21140 1371 880 gene locus_tag LOCUS_21150 1371 880 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020819.1 protein_id gnl|my_center|LOCUS_21150 1879 1421 gene locus_tag LOCUS_21160 1879 1421 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173534.1 protein_id gnl|my_center|LOCUS_21160 2286 1876 gene locus_tag LOCUS_21170 2286 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 <3144 2305 gene locus_tag LOCUS_21180 <3144 2305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922157.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence296 1985 2074 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence297 <1 2348 gene locus_tag LOCUS_21190 <1 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870273.1:type I restriction endonuclease subunit R >Feature sequence298 374 75 gene locus_tag LOCUS_21200 374 75 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_21200 993 367 gene locus_tag LOCUS_21210 993 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence299 504 1139 gene locus_tag LOCUS_21220 504 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1793 1386 gene locus_tag LOCUS_21230 1793 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1966 2658 gene locus_tag LOCUS_21240 1966 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence300 1940 2314 gene locus_tag LOCUS_21250 1940 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2311 2889 gene locus_tag LOCUS_21260 2311 2889 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence301 1363 1097 gene locus_tag LOCUS_21270 1363 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2542 1496 gene locus_tag LOCUS_21280 2542 1496 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_21280 3045 2713 gene locus_tag LOCUS_21290 3045 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence302 1580 264 gene locus_tag LOCUS_21300 gene xylA 1580 264 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_21300 3076 1592 gene locus_tag LOCUS_21310 3076 1592 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence303 2277 910 gene locus_tag LOCUS_21320 2277 910 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_21320 2389 2901 gene locus_tag LOCUS_21330 2389 2901 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203292.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence304 1296 511 gene locus_tag LOCUS_21340 1296 511 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903461.1 protein_id gnl|my_center|LOCUS_21340 2448 1303 gene locus_tag LOCUS_21350 2448 1303 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_21350 <3113 2452 gene locus_tag LOCUS_21360 <3113 2452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903642.1:acetyl-CoA C-acetyltransferase >Feature sequence305 <1 521 gene locus_tag LOCUS_21370 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008657498.1:FISUMP domain-containing protein >Feature sequence306 82 900 gene locus_tag LOCUS_21380 82 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 897 1688 gene locus_tag LOCUS_21390 897 1688 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_21390 1716 2252 gene locus_tag LOCUS_21400 1716 2252 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence307 3054 2023 gene locus_tag LOCUS_21410 3054 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence308 922 437 gene locus_tag LOCUS_21420 922 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1438 962 gene locus_tag LOCUS_21430 1438 962 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_21430 1612 2898 gene locus_tag LOCUS_21440 1612 2898 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_21440 3035 2962 gene locus_tag LOCUS_t00400 3035 2962 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence309 348 1379 gene locus_tag LOCUS_21450 348 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1384 1716 gene locus_tag LOCUS_21460 1384 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1728 2762 gene locus_tag LOCUS_21470 gene arsB 1728 2762 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107122.1 protein_id gnl|my_center|LOCUS_21470 2793 3023 gene locus_tag LOCUS_21480 2793 3023 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292400.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence310 94 1572 gene locus_tag LOCUS_21490 94 1572 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence311 2780 1503 gene locus_tag LOCUS_21500 2780 1503 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence312 43 795 gene locus_tag LOCUS_21510 43 795 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_21510 876 2267 gene locus_tag LOCUS_21520 876 2267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence313 1783 1421 gene locus_tag LOCUS_21530 gene tnpB 1783 1421 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108244.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence314 725 150 gene locus_tag LOCUS_21540 725 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1081 737 gene locus_tag LOCUS_21550 1081 737 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827865.1 protein_id gnl|my_center|LOCUS_21550 1649 1748 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2968 2185 gene locus_tag LOCUS_21560 <2968 2185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761919.1:tetratricopeptide repeat protein >Feature sequence315 <1 2426 gene locus_tag LOCUS_21570 <1 2426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106605886.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence316 214 675 gene locus_tag LOCUS_21580 214 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1710 814 gene locus_tag LOCUS_21590 1710 814 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_21590 1837 2661 gene locus_tag LOCUS_21600 1837 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence317 968 249 gene locus_tag LOCUS_21610 968 249 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_21610 <2960 976 gene locus_tag LOCUS_21620 <2960 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107358.1:tyrosine-protein kinase >Feature sequence318 538 5 gene locus_tag LOCUS_21630 538 5 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_21630 577 1176 gene locus_tag LOCUS_21640 577 1176 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_21640 <2959 1130 gene locus_tag LOCUS_21650 <2959 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108029.1:glycoside hydrolase family 97 protein >Feature sequence319 809 1339 gene locus_tag LOCUS_21660 809 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence320 900 2072 gene locus_tag LOCUS_21670 900 2072 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920069.1 protein_id gnl|my_center|LOCUS_21670 2127 2717 gene locus_tag LOCUS_21680 2127 2717 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795589.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence321 <1 1194 gene locus_tag LOCUS_21690 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814911.1:phosphoribosylformylglycinamidine synthase <2956 1163 gene locus_tag LOCUS_21700 <2956 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066403458.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence322 628 71 gene locus_tag LOCUS_21710 628 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1133 633 gene locus_tag LOCUS_21720 gene atpF 1133 633 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_21720 1400 1146 gene locus_tag LOCUS_21730 gene atpE 1400 1146 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777530.1 protein_id gnl|my_center|LOCUS_21730 2472 1426 gene locus_tag LOCUS_21740 gene atpB 2472 1426 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence323 628 71 gene locus_tag LOCUS_21750 628 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1133 633 gene locus_tag LOCUS_21760 gene atpF 1133 633 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_21760 1399 1145 gene locus_tag LOCUS_21770 gene atpE 1399 1145 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777530.1 protein_id gnl|my_center|LOCUS_21770 2543 1425 gene locus_tag LOCUS_21780 gene atpB 2543 1425 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence324 <1 519 gene locus_tag LOCUS_21790 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785889.1:RNA polymerase sigma-70 factor 579 1541 gene locus_tag LOCUS_21800 579 1541 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108163.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence325 125 823 gene locus_tag LOCUS_21810 125 823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766586.1 protein_id gnl|my_center|LOCUS_21810 2137 923 gene locus_tag LOCUS_21820 2137 923 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_21820 2295 2726 gene locus_tag LOCUS_21830 2295 2726 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence326 2534 891 gene locus_tag LOCUS_21840 gene araB 2534 891 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951836.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence327 <1 2385 gene locus_tag LOCUS_21850 <1 2385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303191.1:glycoside hydrolase family 95 protein >Feature sequence328 1209 1886 gene locus_tag LOCUS_21860 1209 1886 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_21860 2531 1869 gene locus_tag LOCUS_21870 2531 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence329 86 241 gene locus_tag LOCUS_21880 86 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 235 1803 gene locus_tag LOCUS_21890 235 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1846 2184 gene locus_tag LOCUS_21900 1846 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence330 1816 2442 gene locus_tag LOCUS_21910 1816 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2435 2734 gene locus_tag LOCUS_21920 2435 2734 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence331 2291 2737 gene locus_tag LOCUS_21930 2291 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence332 1759 158 gene locus_tag LOCUS_21940 1759 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2868 1756 gene locus_tag LOCUS_21950 2868 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence333 1032 295 gene locus_tag LOCUS_21960 1032 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2532 1489 gene locus_tag LOCUS_21970 2532 1489 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225411.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence334 1147 461 gene locus_tag LOCUS_21980 1147 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1976 1260 gene locus_tag LOCUS_21990 1976 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence335 98 463 gene locus_tag LOCUS_22000 98 463 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_22000 495 1058 gene locus_tag LOCUS_22010 495 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 1064 1492 gene locus_tag LOCUS_22020 1064 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1495 2505 gene locus_tag LOCUS_22030 1495 2505 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence336 <1 970 gene locus_tag LOCUS_22040 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767240.1:TonB-dependent receptor 982 2502 gene locus_tag LOCUS_22050 982 2502 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence337 808 338 gene locus_tag LOCUS_22060 808 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1267 848 gene locus_tag LOCUS_22070 1267 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1549 2778 gene locus_tag LOCUS_22080 1549 2778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence338 1430 462 gene locus_tag LOCUS_22090 gene fmt 1430 462 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109030.1 protein_id gnl|my_center|LOCUS_22090 <2843 1405 gene locus_tag LOCUS_22100 <2843 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784513.1:LptF/LptG family permease >Feature sequence339 973 677 gene locus_tag LOCUS_22110 973 677 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_22110 1686 970 gene locus_tag LOCUS_22120 1686 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence340 <1 764 gene locus_tag LOCUS_22130 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962323.1:TonB-dependent receptor 2061 880 gene locus_tag LOCUS_22140 2061 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 <2822 2067 gene locus_tag LOCUS_22150 <2822 2067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202762.1:ABC transporter permease >Feature sequence341 476 1855 gene locus_tag LOCUS_22160 476 1855 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366380.1 protein_id gnl|my_center|LOCUS_22160 <2816 1932 gene locus_tag LOCUS_22170 <2816 1932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054993324.1:beta-glucosidase BglX >Feature sequence342 1782 115 gene locus_tag LOCUS_22180 1782 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2446 1787 gene locus_tag LOCUS_22190 2446 1787 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence343 84 416 gene locus_tag LOCUS_22200 84 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 587 1633 gene locus_tag LOCUS_22210 587 1633 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence344 286 2643 gene locus_tag LOCUS_22220 286 2643 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence345 128 490 gene locus_tag LOCUS_22230 128 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 495 650 gene locus_tag LOCUS_22240 495 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 662 997 gene locus_tag LOCUS_22250 662 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1237 1530 gene locus_tag LOCUS_22260 1237 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1527 1673 gene locus_tag LOCUS_22270 1527 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1705 2310 gene locus_tag LOCUS_22280 1705 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence346 1095 331 gene locus_tag LOCUS_22290 1095 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2625 1222 gene locus_tag LOCUS_22300 2625 1222 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243737.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence347 84 524 gene locus_tag LOCUS_22310 84 524 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_22310 546 1247 gene locus_tag LOCUS_22320 546 1247 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 protein_id gnl|my_center|LOCUS_22320 1326 2312 gene locus_tag LOCUS_22330 1326 2312 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence348 249 764 gene locus_tag LOCUS_22340 249 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1364 717 gene locus_tag LOCUS_22350 1364 717 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_22350 1413 2141 gene locus_tag LOCUS_22360 gene pyrH 1413 2141 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_22360 2149 2715 gene locus_tag LOCUS_22370 gene frr 2149 2715 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence349 1216 215 gene locus_tag LOCUS_22380 1216 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2001 1348 gene locus_tag LOCUS_22390 2001 1348 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151672826.1 protein_id gnl|my_center|LOCUS_22390 <2771 2004 gene locus_tag LOCUS_22400 <2771 2004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109331.1:ATP-binding protein >Feature sequence350 1247 867 gene locus_tag LOCUS_22410 1247 867 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_22410 2056 1286 gene locus_tag LOCUS_22420 2056 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2475 2083 gene locus_tag LOCUS_22430 2475 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence351 >Feature sequence352 694 41 gene locus_tag LOCUS_22440 694 41 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_22440 1787 771 gene locus_tag LOCUS_22450 1787 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2515 1955 gene locus_tag LOCUS_22460 2515 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence353 >Feature sequence354 99 983 gene locus_tag LOCUS_22470 gene prmA 99 983 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_22470 997 1437 gene locus_tag LOCUS_22480 997 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1442 2521 gene locus_tag LOCUS_22490 gene orr 1442 2521 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence355 >Feature sequence356 482 1639 gene locus_tag LOCUS_22500 482 1639 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861810.1 protein_id gnl|my_center|LOCUS_22500 2480 1641 gene locus_tag LOCUS_22510 2480 1641 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760846.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence357 1792 641 gene locus_tag LOCUS_22520 1792 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence358 71 148 gene locus_tag LOCUS_t00410 71 148 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 157 1125 gene locus_tag LOCUS_22530 gene iolU 157 1125 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence359 1589 705 gene locus_tag LOCUS_22540 1589 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2377 1859 gene locus_tag LOCUS_22550 2377 1859 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788621.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence360 1099 878 gene locus_tag LOCUS_22560 1099 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1173 2288 gene locus_tag LOCUS_22570 1173 2288 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence361 1087 317 gene locus_tag LOCUS_22580 1087 317 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_22580 1351 2547 gene locus_tag LOCUS_22590 1351 2547 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857806.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence362 997 137 gene locus_tag LOCUS_22600 997 137 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256283.1 protein_id gnl|my_center|LOCUS_22600 1121 1366 gene locus_tag LOCUS_22610 1121 1366 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546690.1 protein_id gnl|my_center|LOCUS_22610 1507 2418 gene locus_tag LOCUS_22620 1507 2418 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence363 2592 562 gene locus_tag LOCUS_22630 2592 562 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence364 595 116 gene locus_tag LOCUS_22640 595 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 634 1239 gene locus_tag LOCUS_22650 634 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1508 1224 gene locus_tag LOCUS_22660 1508 1224 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_22660 2100 1501 gene locus_tag LOCUS_22670 2100 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107867.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence365 1635 181 gene locus_tag LOCUS_22680 1635 181 CDS product PKD-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293827.1 protein_id gnl|my_center|LOCUS_22680 2657 1632 gene locus_tag LOCUS_22690 2657 1632 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293828.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence366 929 153 gene locus_tag LOCUS_22700 929 153 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22700 2589 940 gene locus_tag LOCUS_22710 2589 940 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084529509.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence367 23 880 gene locus_tag LOCUS_22720 23 880 CDS product BT1926 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203631.1 protein_id gnl|my_center|LOCUS_22720 962 1441 gene locus_tag LOCUS_22730 962 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1438 2007 gene locus_tag LOCUS_22740 1438 2007 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_22740 <2642 1979 gene locus_tag LOCUS_22750 <2642 1979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763952.1:radical SAM family heme chaperone HemW >Feature sequence368 <1 645 gene locus_tag LOCUS_22760 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948667.1:GNAT family N-acetyltransferase 642 1073 gene locus_tag LOCUS_22770 642 1073 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022708.1 protein_id gnl|my_center|LOCUS_22770 1084 1803 gene locus_tag LOCUS_22780 1084 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence369 303 2234 gene locus_tag LOCUS_22790 303 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence370 162 1769 gene locus_tag LOCUS_22800 162 1769 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_22800 2521 1784 gene locus_tag LOCUS_22810 2521 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence371 >Feature sequence372 >Feature sequence373 <1 964 gene locus_tag LOCUS_22820 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor 1054 1899 gene locus_tag LOCUS_22830 1054 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 <2609 1926 gene locus_tag LOCUS_22840 <2609 1926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769027.1:TonB-dependent receptor >Feature sequence374 1159 761 gene locus_tag LOCUS_22850 1159 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2323 1373 gene locus_tag LOCUS_22860 2323 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence375 682 470 gene locus_tag LOCUS_22870 682 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 941 684 gene locus_tag LOCUS_22880 941 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2486 1317 gene locus_tag LOCUS_22890 2486 1317 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence376 1156 230 gene locus_tag LOCUS_22900 1156 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2054 1788 gene locus_tag LOCUS_22910 2054 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence377 943 194 gene locus_tag LOCUS_22920 943 194 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_22920 1150 2412 gene locus_tag LOCUS_22930 1150 2412 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250265.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence378 47 784 gene locus_tag LOCUS_22940 47 784 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_22940 794 1219 gene locus_tag LOCUS_22950 794 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1240 1824 gene locus_tag LOCUS_22960 1240 1824 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_22960 1837 2316 gene locus_tag LOCUS_22970 1837 2316 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence379 <1 826 gene locus_tag LOCUS_22980 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764441.1:aminoglycoside phosphotransferase family protein >Feature sequence380 <1 681 gene locus_tag LOCUS_22990 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203461.1:4-alpha-glucanotransferase 1664 690 gene locus_tag LOCUS_23000 gene iaaA 1664 690 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513763.1 protein_id gnl|my_center|LOCUS_23000 1762 2319 gene locus_tag LOCUS_23010 1762 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence381 2455 797 gene locus_tag LOCUS_23020 2455 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence382 <1 1286 gene locus_tag LOCUS_23030 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107519.1:translocation/assembly module TamB domain-containing protein 2546 1278 gene locus_tag LOCUS_23040 2546 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence383 59 397 gene locus_tag LOCUS_23050 59 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23050 458 886 gene locus_tag LOCUS_23060 458 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 883 1194 gene locus_tag LOCUS_23070 883 1194 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545235.1 protein_id gnl|my_center|LOCUS_23070 1191 1526 gene locus_tag LOCUS_23080 1191 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 1536 2408 gene locus_tag LOCUS_23090 1536 2408 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence384 <1 989 gene locus_tag LOCUS_23100 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963429.1:SDR family oxidoreductase 1019 2287 gene locus_tag LOCUS_23110 1019 2287 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence385 1155 241 gene locus_tag LOCUS_23120 1155 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1195 1121 gene locus_tag LOCUS_t00420 1195 1121 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1249 1941 gene locus_tag LOCUS_23130 1249 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2390 1938 gene locus_tag LOCUS_23140 2390 1938 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108716.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence386 2502 1078 gene locus_tag LOCUS_23150 2502 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150