>Feature sequence01 11 86 gene locus_tag LOCUS_t00010 11 86 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1063 212 gene locus_tag LOCUS_00010 1063 212 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810342.1 protein_id gnl|my_center|LOCUS_00010 2135 1056 gene locus_tag LOCUS_00020 2135 1056 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459052.1 protein_id gnl|my_center|LOCUS_00020 3236 2142 gene locus_tag LOCUS_00030 3236 2142 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156275681.1 protein_id gnl|my_center|LOCUS_00030 3859 3332 gene locus_tag LOCUS_00040 3859 3332 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810340.1 protein_id gnl|my_center|LOCUS_00040 4480 3941 gene locus_tag LOCUS_00050 4480 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4764 5141 gene locus_tag LOCUS_00060 4764 5141 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_00060 5574 5260 gene locus_tag LOCUS_00070 5574 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7507 5576 gene locus_tag LOCUS_00080 7507 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8326 7841 gene locus_tag LOCUS_00090 8326 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8570 10657 gene locus_tag LOCUS_00100 8570 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10769 11218 gene locus_tag LOCUS_00110 10769 11218 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990835.1 protein_id gnl|my_center|LOCUS_00110 11459 12103 gene locus_tag LOCUS_00120 11459 12103 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618925.1 protein_id gnl|my_center|LOCUS_00120 12157 13065 gene locus_tag LOCUS_00130 12157 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 protein_id gnl|my_center|LOCUS_00130 13092 13877 gene locus_tag LOCUS_00140 13092 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14049 14801 gene locus_tag LOCUS_00150 14049 14801 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020379.1 protein_id gnl|my_center|LOCUS_00150 15617 14850 gene locus_tag LOCUS_00160 15617 14850 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_00160 15874 16407 gene locus_tag LOCUS_00170 gene hpt 15874 16407 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_00170 16422 18128 gene locus_tag LOCUS_00180 gene ade 16422 18128 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_00180 18934 18185 gene locus_tag LOCUS_00190 18934 18185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19684 18944 gene locus_tag LOCUS_00200 19684 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20610 19681 gene locus_tag LOCUS_00210 20610 19681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386870.1 protein_id gnl|my_center|LOCUS_00210 20906 20649 gene locus_tag LOCUS_00220 20906 20649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21132 21845 gene locus_tag LOCUS_00230 21132 21845 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_00230 21845 22183 gene locus_tag LOCUS_00240 gene azlD 21845 22183 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_00240 23056 22229 gene locus_tag LOCUS_00250 23056 22229 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109283.1 protein_id gnl|my_center|LOCUS_00250 23688 23215 gene locus_tag LOCUS_00260 23688 23215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24677 23868 gene locus_tag LOCUS_00270 24677 23868 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_00270 25021 24737 gene locus_tag LOCUS_00280 25021 24737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25157 25029 gene locus_tag LOCUS_00290 25157 25029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 25657 27042 gene locus_tag LOCUS_00300 25657 27042 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_00300 28229 27702 gene locus_tag LOCUS_00310 28229 27702 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020793.1 protein_id gnl|my_center|LOCUS_00310 30260 28296 gene locus_tag LOCUS_00320 30260 28296 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_00320 31423 30389 gene locus_tag LOCUS_00330 31423 30389 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_00330 36983 31407 gene locus_tag LOCUS_00340 36983 31407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00340 37424 37032 gene locus_tag LOCUS_00350 37424 37032 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_00350 39213 37444 gene locus_tag LOCUS_00360 39213 37444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39530 39605 gene locus_tag LOCUS_t00020 39530 39605 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 43719 39691 gene locus_tag LOCUS_00370 43719 39691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47264 43743 gene locus_tag LOCUS_00380 47264 43743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47941 49455 gene locus_tag LOCUS_00390 47941 49455 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_00390 49740 50747 gene locus_tag LOCUS_00400 49740 50747 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546217.1 protein_id gnl|my_center|LOCUS_00400 50774 51037 gene locus_tag LOCUS_00410 50774 51037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 51037 51561 gene locus_tag LOCUS_00420 51037 51561 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 protein_id gnl|my_center|LOCUS_00420 51849 51586 gene locus_tag LOCUS_00430 51849 51586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065696.1 protein_id gnl|my_center|LOCUS_00430 52170 51940 gene locus_tag LOCUS_00440 52170 51940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52882 52172 gene locus_tag LOCUS_00450 52882 52172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53222 52899 gene locus_tag LOCUS_00460 53222 52899 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_00460 54160 53243 gene locus_tag LOCUS_00470 gene nadA 54160 53243 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_00470 55249 54185 gene locus_tag LOCUS_00480 55249 54185 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846612.1 protein_id gnl|my_center|LOCUS_00480 55614 55372 gene locus_tag LOCUS_00490 55614 55372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 56486 55713 gene locus_tag LOCUS_00500 gene tatC 56486 55713 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259255.1 protein_id gnl|my_center|LOCUS_00500 57168 56491 gene locus_tag LOCUS_00510 57168 56491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57520 57320 gene locus_tag LOCUS_00520 57520 57320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 57997 57713 gene locus_tag LOCUS_00530 57997 57713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 58295 58906 gene locus_tag LOCUS_00540 58295 58906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60176 58896 gene locus_tag LOCUS_00550 60176 58896 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618783.1 protein_id gnl|my_center|LOCUS_00550 61468 60431 gene locus_tag LOCUS_00560 gene argC 61468 60431 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_00560 61667 62905 gene locus_tag LOCUS_00570 61667 62905 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545541.1 protein_id gnl|my_center|LOCUS_00570 63033 63704 gene locus_tag LOCUS_00580 63033 63704 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_00580 63706 64266 gene locus_tag LOCUS_00590 63706 64266 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140095.1 protein_id gnl|my_center|LOCUS_00590 64271 65050 gene locus_tag LOCUS_00600 64271 65050 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545809.1 protein_id gnl|my_center|LOCUS_00600 65777 65088 gene locus_tag LOCUS_00610 65777 65088 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_00610 66351 65851 gene locus_tag LOCUS_00620 66351 65851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 67040 66360 gene locus_tag LOCUS_00630 gene plsY 67040 66360 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056950.1 protein_id gnl|my_center|LOCUS_00630 68407 67574 gene locus_tag LOCUS_00640 68407 67574 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_00640 69177 68407 gene locus_tag LOCUS_00650 69177 68407 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_00650 70985 69447 gene locus_tag LOCUS_00660 gene rny 70985 69447 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_00660 71711 71037 gene locus_tag LOCUS_00670 71711 71037 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_00670 72827 71814 gene locus_tag LOCUS_00680 gene recA 72827 71814 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_00680 74268 72934 gene locus_tag LOCUS_00690 gene nhaA 74268 72934 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_00690 74527 74682 gene locus_tag LOCUS_00700 74527 74682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 74718 74942 gene locus_tag LOCUS_00710 74718 74942 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_00710 76241 75015 gene locus_tag LOCUS_00720 76241 75015 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583724.1 protein_id gnl|my_center|LOCUS_00720 77094 76297 gene locus_tag LOCUS_00730 77094 76297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 78294 77110 gene locus_tag LOCUS_00740 78294 77110 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_00740 78516 78591 gene locus_tag LOCUS_t00030 78516 78591 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 78633 79415 gene locus_tag LOCUS_00750 78633 79415 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890817.1 protein_id gnl|my_center|LOCUS_00750 80599 79817 gene locus_tag LOCUS_00760 80599 79817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 81747 80815 gene locus_tag LOCUS_00770 gene fmt 81747 80815 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_00770 82176 83513 gene locus_tag LOCUS_00780 gene dnaA 82176 83513 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_00780 84087 84992 gene locus_tag LOCUS_00790 84087 84992 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549090.1 protein_id gnl|my_center|LOCUS_00790 85152 85517 gene locus_tag LOCUS_00800 85152 85517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85583 86851 gene locus_tag LOCUS_00810 gene obgE 85583 86851 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257169.1 protein_id gnl|my_center|LOCUS_00810 86856 87455 gene locus_tag LOCUS_00820 86856 87455 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699801.1 protein_id gnl|my_center|LOCUS_00820 89753 87825 gene locus_tag LOCUS_00830 gene gyrB 89753 87825 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_00830 90237 90001 gene locus_tag LOCUS_00840 90237 90001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 90676 90293 gene locus_tag LOCUS_00850 90676 90293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 90988 90913 gene locus_tag LOCUS_t00040 90988 90913 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 91237 92076 gene locus_tag LOCUS_00860 91237 92076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 92082 92585 gene locus_tag LOCUS_00870 gene folK 92082 92585 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_00870 92733 93104 gene locus_tag LOCUS_00880 gene queD 92733 93104 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_00880 93691 93107 gene locus_tag LOCUS_00890 93691 93107 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_00890 93992 94825 gene locus_tag LOCUS_00900 93992 94825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 94832 97282 gene locus_tag LOCUS_00910 gene gyrA 94832 97282 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_00910 98630 97386 gene locus_tag LOCUS_00920 98630 97386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 99395 98823 gene locus_tag LOCUS_00930 gene sigY 99395 98823 CDS product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 protein_id gnl|my_center|LOCUS_00930 99705 99532 gene locus_tag LOCUS_00940 99705 99532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 101568 99736 gene locus_tag LOCUS_00950 101568 99736 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_00950 101935 102408 gene locus_tag LOCUS_00960 101935 102408 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_00960 103631 102600 gene locus_tag LOCUS_00970 103631 102600 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113129.1 protein_id gnl|my_center|LOCUS_00970 104231 103737 gene locus_tag LOCUS_00980 104231 103737 CDS product AmiS/UreI family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098725.1 protein_id gnl|my_center|LOCUS_00980 106608 105115 gene locus_tag LOCUS_00990 106608 105115 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 protein_id gnl|my_center|LOCUS_00990 107470 106970 gene locus_tag LOCUS_01000 107470 106970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 <108413 107491 gene locus_tag LOCUS_01010 <108413 107491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080372.1:histidine--tRNA ligase >Feature sequence02 229 642 gene locus_tag LOCUS_01020 229 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 756 1898 gene locus_tag LOCUS_01030 gene purD 756 1898 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_01030 1924 2400 gene locus_tag LOCUS_01040 gene purE 1924 2400 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_01040 2397 3752 gene locus_tag LOCUS_01050 gene purB 2397 3752 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_01050 3755 4669 gene locus_tag LOCUS_01060 3755 4669 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_01060 5561 4983 gene locus_tag LOCUS_01070 gene hisB 5561 4983 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_01070 6666 5566 gene locus_tag LOCUS_01080 gene hisC 6666 5566 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_01080 8007 6685 gene locus_tag LOCUS_01090 gene hisD 8007 6685 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_01090 9427 8009 gene locus_tag LOCUS_01100 9427 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 10661 9417 gene locus_tag LOCUS_01110 gene hisS 10661 9417 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496694.1 protein_id gnl|my_center|LOCUS_01110 10835 11134 gene locus_tag LOCUS_01120 10835 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 11134 11886 gene locus_tag LOCUS_01130 11134 11886 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_01130 12705 11920 gene locus_tag LOCUS_01140 12705 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 13783 12731 gene locus_tag LOCUS_01150 13783 12731 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_01150 14284 14018 gene locus_tag LOCUS_01160 14284 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 14175 16577 gene locus_tag LOCUS_01170 14175 16577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 16747 18888 gene locus_tag LOCUS_01180 16747 18888 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_01180 18980 20398 gene locus_tag LOCUS_01190 18980 20398 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_01190 20448 21464 gene locus_tag LOCUS_01200 20448 21464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 21663 23168 gene locus_tag LOCUS_01210 21663 23168 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765644.1 protein_id gnl|my_center|LOCUS_01210 23967 23419 gene locus_tag LOCUS_01220 23967 23419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 24206 25375 gene locus_tag LOCUS_01230 24206 25375 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_01230 25509 26498 gene locus_tag LOCUS_01240 25509 26498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01240 26559 27149 gene locus_tag LOCUS_01250 26559 27149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 27140 27448 gene locus_tag LOCUS_01260 27140 27448 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_01260 27463 28077 gene locus_tag LOCUS_01270 gene recR 27463 28077 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_01270 28090 28425 gene locus_tag LOCUS_01280 28090 28425 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_01280 28513 29274 gene locus_tag LOCUS_01290 gene recO 28513 29274 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_01290 29391 30872 gene locus_tag LOCUS_01300 gene lysS 29391 30872 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_01300 30878 32119 gene locus_tag LOCUS_01310 gene serS 30878 32119 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_01310 32162 33157 gene locus_tag LOCUS_01320 32162 33157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 33824 33177 gene locus_tag LOCUS_01330 33824 33177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 33915 34004 gene locus_tag LOCUS_t00050 33915 34004 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35485 34007 gene locus_tag LOCUS_01340 35485 34007 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_01340 36736 35621 gene locus_tag LOCUS_01350 36736 35621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 37628 36729 gene locus_tag LOCUS_01360 gene prfB 37628 36729 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 38559 37894 gene locus_tag LOCUS_01370 gene nfi 38559 37894 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_01370 38692 38961 gene locus_tag LOCUS_01380 gene rpsP 38692 38961 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419338.1 protein_id gnl|my_center|LOCUS_01380 38958 39185 gene locus_tag LOCUS_01390 38958 39185 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_01390 39775 39350 gene locus_tag LOCUS_01400 39775 39350 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_01400 41189 39798 gene locus_tag LOCUS_01410 gene atpD 41189 39798 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_01410 42056 41199 gene locus_tag LOCUS_01420 42056 41199 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_01420 43576 42065 gene locus_tag LOCUS_01430 gene atpA 43576 42065 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_01430 44148 43618 gene locus_tag LOCUS_01440 44148 43618 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_01440 44672 44172 gene locus_tag LOCUS_01450 gene atpF 44672 44172 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552096.1 protein_id gnl|my_center|LOCUS_01450 44928 44698 gene locus_tag LOCUS_01460 44928 44698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 45950 44991 gene locus_tag LOCUS_01470 gene atpB 45950 44991 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_01470 46174 45950 gene locus_tag LOCUS_01480 46174 45950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 46939 46367 gene locus_tag LOCUS_01490 46939 46367 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_01490 47104 49353 gene locus_tag LOCUS_01500 gene ppsA 47104 49353 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250243.1 protein_id gnl|my_center|LOCUS_01500 49350 50390 gene locus_tag LOCUS_01510 49350 50390 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_01510 50570 52393 gene locus_tag LOCUS_01520 gene dnaG 50570 52393 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258766.1 protein_id gnl|my_center|LOCUS_01520 52347 53882 gene locus_tag LOCUS_01530 52347 53882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 54054 54782 gene locus_tag LOCUS_01540 54054 54782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 54837 57407 gene locus_tag LOCUS_01550 54837 57407 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839328.1 protein_id gnl|my_center|LOCUS_01550 57955 57404 gene locus_tag LOCUS_01560 57955 57404 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583840.1 protein_id gnl|my_center|LOCUS_01560 61220 58392 gene locus_tag LOCUS_01570 gene uvrA 61220 58392 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_01570 61562 62485 gene locus_tag LOCUS_01580 gene trxB 61562 62485 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_01580 62544 62999 gene locus_tag LOCUS_01590 gene rplI 62544 62999 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288372.1 protein_id gnl|my_center|LOCUS_01590 63001 64371 gene locus_tag LOCUS_01600 gene dnaB 63001 64371 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_01600 64368 65066 gene locus_tag LOCUS_01610 64368 65066 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_01610 64984 66396 gene locus_tag LOCUS_01620 64984 66396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 66580 67101 gene locus_tag LOCUS_01630 66580 67101 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_01630 67635 67462 gene locus_tag LOCUS_01640 67635 67462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 68916 67879 gene locus_tag LOCUS_01650 68916 67879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 69953 68922 gene locus_tag LOCUS_01660 gene holB 69953 68922 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_01660 71290 69980 gene locus_tag LOCUS_01670 gene lysA 71290 69980 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_01670 71488 72186 gene locus_tag LOCUS_01680 71488 72186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 72215 72682 gene locus_tag LOCUS_01690 72215 72682 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_01690 72731 73123 gene locus_tag LOCUS_01700 72731 73123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 74130 73375 gene locus_tag LOCUS_01710 74130 73375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 74281 75057 gene locus_tag LOCUS_01720 74281 75057 CDS product DpnI domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678771.1 protein_id gnl|my_center|LOCUS_01720 75073 75243 gene locus_tag LOCUS_01730 75073 75243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 76044 75325 gene locus_tag LOCUS_01740 76044 75325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 76181 76585 gene locus_tag LOCUS_01750 76181 76585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 77267 76911 gene locus_tag LOCUS_01760 77267 76911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 78086 77376 gene locus_tag LOCUS_01770 78086 77376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 78842 78213 gene locus_tag LOCUS_01780 gene nth 78842 78213 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_01780 79123 78983 gene locus_tag LOCUS_01790 79123 78983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 79791 79213 gene locus_tag LOCUS_01800 79791 79213 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545523.1 protein_id gnl|my_center|LOCUS_01800 79934 80218 gene locus_tag LOCUS_01810 79934 80218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 80729 80133 gene locus_tag LOCUS_01820 80729 80133 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_01820 83225 80754 gene locus_tag LOCUS_01830 83225 80754 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966917.1 protein_id gnl|my_center|LOCUS_01830 83469 83245 gene locus_tag LOCUS_01840 83469 83245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 83784 84068 gene locus_tag LOCUS_01850 83784 84068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 84122 84197 gene locus_tag LOCUS_t00060 84122 84197 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 84254 84751 gene locus_tag LOCUS_01860 84254 84751 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459575.1 protein_id gnl|my_center|LOCUS_01860 86121 85150 gene locus_tag LOCUS_01870 86121 85150 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842263.1 protein_id gnl|my_center|LOCUS_01870 87098 86118 gene locus_tag LOCUS_01880 87098 86118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 88346 87192 gene locus_tag LOCUS_01890 88346 87192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 88572 88336 gene locus_tag LOCUS_01900 88572 88336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 88945 88748 gene locus_tag LOCUS_01910 88945 88748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 89104 90105 gene locus_tag LOCUS_01920 89104 90105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 90115 91245 gene locus_tag LOCUS_01930 90115 91245 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_01930 91354 91429 gene locus_tag LOCUS_t00070 91354 91429 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 91468 92115 gene locus_tag LOCUS_01940 91468 92115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 92293 92613 gene locus_tag LOCUS_01950 92293 92613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 92616 93341 gene locus_tag LOCUS_01960 92616 93341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 93351 94655 gene locus_tag LOCUS_01970 93351 94655 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296319.1 protein_id gnl|my_center|LOCUS_01970 95340 94747 gene locus_tag LOCUS_01980 95340 94747 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107351.1 protein_id gnl|my_center|LOCUS_01980 >Feature sequence03 1485 544 gene locus_tag LOCUS_01990 1485 544 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_01990 2564 1569 gene locus_tag LOCUS_02000 2564 1569 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_02000 3460 2561 gene locus_tag LOCUS_02010 3460 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4451 3468 gene locus_tag LOCUS_02020 4451 3468 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315203.1 protein_id gnl|my_center|LOCUS_02020 5189 4506 gene locus_tag LOCUS_02030 5189 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 5877 5200 gene locus_tag LOCUS_02040 gene fsa 5877 5200 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699371.1 protein_id gnl|my_center|LOCUS_02040 6495 5902 gene locus_tag LOCUS_02050 gene gmhB 6495 5902 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_02050 7106 6510 gene locus_tag LOCUS_02060 7106 6510 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_02060 8104 7103 gene locus_tag LOCUS_02070 8104 7103 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_02070 8814 8101 gene locus_tag LOCUS_02080 8814 8101 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_02080 9624 13448 gene locus_tag LOCUS_02090 9624 13448 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088923.1 protein_id gnl|my_center|LOCUS_02090 14197 13568 gene locus_tag LOCUS_02100 14197 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 15887 14190 gene locus_tag LOCUS_02110 gene nuoF 15887 14190 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_02110 16640 15915 gene locus_tag LOCUS_02120 16640 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 17287 19350 gene locus_tag LOCUS_02130 17287 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 20500 19493 gene locus_tag LOCUS_02140 gene gap 20500 19493 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_02140 21527 20532 gene locus_tag LOCUS_02150 21527 20532 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949099.1 protein_id gnl|my_center|LOCUS_02150 22363 21533 gene locus_tag LOCUS_02160 22363 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 23652 22369 gene locus_tag LOCUS_02170 gene eno 23652 22369 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_02170 24165 23683 gene locus_tag LOCUS_02180 24165 23683 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880029.1 protein_id gnl|my_center|LOCUS_02180 25318 24392 gene locus_tag LOCUS_02190 25318 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 26462 25305 gene locus_tag LOCUS_02200 26462 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249548.1 protein_id gnl|my_center|LOCUS_02200 27258 26680 gene locus_tag LOCUS_02210 gene pth 27258 26680 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_02210 27327 29345 gene locus_tag LOCUS_02220 gene ligA 27327 29345 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_02220 29378 30685 gene locus_tag LOCUS_02230 29378 30685 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_02230 31680 31093 gene locus_tag LOCUS_02240 gene pdxT 31680 31093 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_02240 33260 31686 gene locus_tag LOCUS_02250 gene serA 33260 31686 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256188.1 protein_id gnl|my_center|LOCUS_02250 34356 33262 gene locus_tag LOCUS_02260 34356 33262 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_02260 35612 34401 gene locus_tag LOCUS_02270 gene tyrS 35612 34401 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258930.1 protein_id gnl|my_center|LOCUS_02270 36549 35617 gene locus_tag LOCUS_02280 36549 35617 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_02280 36910 40728 gene locus_tag LOCUS_02290 36910 40728 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256763.1 protein_id gnl|my_center|LOCUS_02290 40733 44752 gene locus_tag LOCUS_02300 40733 44752 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_02300 45246 44857 gene locus_tag LOCUS_02310 45246 44857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 45510 46115 gene locus_tag LOCUS_02320 45510 46115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 46712 47353 gene locus_tag LOCUS_02330 46712 47353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02330 47354 47530 gene locus_tag LOCUS_02340 47354 47530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 47764 48039 gene locus_tag LOCUS_02350 47764 48039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 48088 48522 gene locus_tag LOCUS_02360 48088 48522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 49659 51299 gene locus_tag LOCUS_02370 49659 51299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 51338 52144 gene locus_tag LOCUS_02380 51338 52144 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_02380 52446 54869 gene locus_tag LOCUS_02390 52446 54869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 54984 56984 gene locus_tag LOCUS_02400 gene tkt 54984 56984 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_02400 57637 56993 gene locus_tag LOCUS_02410 gene rpe 57637 56993 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933334.1 protein_id gnl|my_center|LOCUS_02410 58391 57642 gene locus_tag LOCUS_02420 58391 57642 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_02420 58806 58396 gene locus_tag LOCUS_02430 58806 58396 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_02430 60038 58830 gene locus_tag LOCUS_02440 60038 58830 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_02440 60367 61044 gene locus_tag LOCUS_02450 60367 61044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 61651 61091 gene locus_tag LOCUS_02460 61651 61091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 61779 62060 gene locus_tag LOCUS_02470 61779 62060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 64428 62212 gene locus_tag LOCUS_02480 64428 62212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 66290 65460 gene locus_tag LOCUS_02490 66290 65460 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460004.1 protein_id gnl|my_center|LOCUS_02490 66656 66438 gene locus_tag LOCUS_02500 66656 66438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 67239 66853 gene locus_tag LOCUS_02510 67239 66853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 68168 67407 gene locus_tag LOCUS_02520 68168 67407 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_02520 68992 68171 gene locus_tag LOCUS_02530 68992 68171 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022984.1 protein_id gnl|my_center|LOCUS_02530 69635 69012 gene locus_tag LOCUS_02540 69635 69012 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927082.1 protein_id gnl|my_center|LOCUS_02540 70477 69632 gene locus_tag LOCUS_02550 70477 69632 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392941.1 protein_id gnl|my_center|LOCUS_02550 70973 70398 gene locus_tag LOCUS_02560 70973 70398 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048165599.1 protein_id gnl|my_center|LOCUS_02560 71796 71011 gene locus_tag LOCUS_02570 71796 71011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_02570 72851 71787 gene locus_tag LOCUS_02580 72851 71787 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_02580 73739 72888 gene locus_tag LOCUS_02590 73739 72888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02590 74116 73625 gene locus_tag LOCUS_02600 74116 73625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 74613 75173 gene locus_tag LOCUS_02610 74613 75173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 75170 76039 gene locus_tag LOCUS_02620 75170 76039 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_02620 76054 79401 gene locus_tag LOCUS_02630 76054 79401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 79398 79817 gene locus_tag LOCUS_02640 79398 79817 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_02640 79810 80766 gene locus_tag LOCUS_02650 79810 80766 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_02650 80766 82223 gene locus_tag LOCUS_02660 80766 82223 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_02660 82237 82728 gene locus_tag LOCUS_02670 82237 82728 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545540.1 protein_id gnl|my_center|LOCUS_02670 82796 83887 gene locus_tag LOCUS_02680 82796 83887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 83892 85838 gene locus_tag LOCUS_02690 83892 85838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 85822 87180 gene locus_tag LOCUS_02700 85822 87180 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_02700 87779 88795 gene locus_tag LOCUS_02710 87779 88795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 90513 88912 gene locus_tag LOCUS_02720 90513 88912 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477327.1 protein_id gnl|my_center|LOCUS_02720 <91343 90506 gene locus_tag LOCUS_02730 <91343 90506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417347.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence04 708 1424 gene locus_tag LOCUS_02740 gene rsmG 708 1424 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476459.1 protein_id gnl|my_center|LOCUS_02740 1454 1984 gene locus_tag LOCUS_02750 1454 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2205 3500 gene locus_tag LOCUS_02760 gene thiC 2205 3500 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_02760 3817 4398 gene locus_tag LOCUS_02770 3817 4398 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903443.1 protein_id gnl|my_center|LOCUS_02770 4429 5928 gene locus_tag LOCUS_02780 4429 5928 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_02780 6205 7107 gene locus_tag LOCUS_02790 6205 7107 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933596.1 protein_id gnl|my_center|LOCUS_02790 7213 7884 gene locus_tag LOCUS_02800 7213 7884 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257105.1 protein_id gnl|my_center|LOCUS_02800 7952 8155 gene locus_tag LOCUS_02810 7952 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 8379 8612 gene locus_tag LOCUS_02820 8379 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 8961 8632 gene locus_tag LOCUS_02830 8961 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 9171 8965 gene locus_tag LOCUS_02840 9171 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 9282 9761 gene locus_tag LOCUS_02850 9282 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 11035 9794 gene locus_tag LOCUS_02860 11035 9794 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_02860 11165 11401 gene locus_tag LOCUS_02870 11165 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 11653 11438 gene locus_tag LOCUS_02880 11653 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02880 11783 11601 gene locus_tag LOCUS_02890 11783 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02890 12475 11798 gene locus_tag LOCUS_02900 12475 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12744 13478 gene locus_tag LOCUS_02910 gene rph 12744 13478 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_02910 15150 13873 gene locus_tag LOCUS_02920 15150 13873 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966528.1 protein_id gnl|my_center|LOCUS_02920 15540 15229 gene locus_tag LOCUS_02930 15540 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 15850 15587 gene locus_tag LOCUS_02940 15850 15587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 17001 15874 gene locus_tag LOCUS_02950 gene proB 17001 15874 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909083.1 protein_id gnl|my_center|LOCUS_02950 17136 20573 gene locus_tag LOCUS_02960 gene mfd 17136 20573 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_02960 21002 20634 gene locus_tag LOCUS_02970 21002 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 21430 21017 gene locus_tag LOCUS_02980 gene nusB 21430 21017 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_02980 21996 21796 gene locus_tag LOCUS_02990 gene rpmF 21996 21796 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258267.1 protein_id gnl|my_center|LOCUS_02990 22480 22064 gene locus_tag LOCUS_03000 22480 22064 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_03000 22638 22868 gene locus_tag LOCUS_03010 22638 22868 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256580.1 protein_id gnl|my_center|LOCUS_03010 24549 22876 gene locus_tag LOCUS_03020 gene argS 24549 22876 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_03020 24941 24657 gene locus_tag LOCUS_03030 24941 24657 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545162.1 protein_id gnl|my_center|LOCUS_03030 28004 25545 gene locus_tag LOCUS_03040 gene recG 28004 25545 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_03040 28988 28050 gene locus_tag LOCUS_03050 28988 28050 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256169.1 protein_id gnl|my_center|LOCUS_03050 29845 29006 gene locus_tag LOCUS_03060 29845 29006 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169470.1 protein_id gnl|my_center|LOCUS_03060 31514 29868 gene locus_tag LOCUS_03070 gene fakA 31514 29868 CDS product fatty acid kinase catalytic subunit FakA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623903.1 protein_id gnl|my_center|LOCUS_03070 31646 31837 gene locus_tag LOCUS_03080 gene rpmB 31646 31837 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_03080 33245 31872 gene locus_tag LOCUS_03090 gene argH 33245 31872 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_03090 34459 33263 gene locus_tag LOCUS_03100 34459 33263 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_03100 35390 34500 gene locus_tag LOCUS_03110 35390 34500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 36757 35564 gene locus_tag LOCUS_03120 36757 35564 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_03120 37572 36769 gene locus_tag LOCUS_03130 gene argB 37572 36769 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_03130 38815 37607 gene locus_tag LOCUS_03140 gene argJ 38815 37607 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_03140 40491 39163 gene locus_tag LOCUS_03150 40491 39163 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_03150 42115 41339 gene locus_tag LOCUS_03160 gene trpA 42115 41339 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_03160 43299 42112 gene locus_tag LOCUS_03170 gene trpB 43299 42112 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_03170 44532 43534 gene locus_tag LOCUS_03180 gene aroF 44532 43534 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256593.1 protein_id gnl|my_center|LOCUS_03180 45313 44663 gene locus_tag LOCUS_03190 45313 44663 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258566.1 protein_id gnl|my_center|LOCUS_03190 46086 45310 gene locus_tag LOCUS_03200 gene trpC 46086 45310 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_03200 47369 46359 gene locus_tag LOCUS_03210 gene trpD 47369 46359 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_03210 47950 47372 gene locus_tag LOCUS_03220 47950 47372 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_03220 49413 47962 gene locus_tag LOCUS_03230 gene trpE 49413 47962 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257292.1 protein_id gnl|my_center|LOCUS_03230 52101 49987 gene locus_tag LOCUS_03240 52101 49987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 53975 52098 gene locus_tag LOCUS_03250 gene nuoF 53975 52098 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_03250 54435 53965 gene locus_tag LOCUS_03260 gene nuoE 54435 53965 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_03260 55882 54626 gene locus_tag LOCUS_03270 55882 54626 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_03270 56946 55951 gene locus_tag LOCUS_03280 56946 55951 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584126.1 protein_id gnl|my_center|LOCUS_03280 58777 57101 gene locus_tag LOCUS_03290 58777 57101 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_03290 61443 58795 gene locus_tag LOCUS_03300 61443 58795 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_03300 61725 61967 gene locus_tag LOCUS_03310 61725 61967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 64574 62007 gene locus_tag LOCUS_03320 64574 62007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 64781 66607 gene locus_tag LOCUS_03330 gene iorA 64781 66607 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_03330 66600 67187 gene locus_tag LOCUS_03340 66600 67187 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_03340 67207 67656 gene locus_tag LOCUS_03350 gene paaI 67207 67656 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_03350 67988 68362 gene locus_tag LOCUS_03360 67988 68362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 71909 68838 gene locus_tag LOCUS_03370 71909 68838 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024289.1 protein_id gnl|my_center|LOCUS_03370 72112 72597 gene locus_tag LOCUS_03380 72112 72597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 72815 73981 gene locus_tag LOCUS_03390 72815 73981 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_03390 74060 74557 gene locus_tag LOCUS_03400 74060 74557 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942698.1 protein_id gnl|my_center|LOCUS_03400 74558 75862 gene locus_tag LOCUS_03410 74558 75862 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_03410 75889 77451 gene locus_tag LOCUS_03420 gene fadD5 75889 77451 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_03420 77626 77468 gene locus_tag LOCUS_03430 77626 77468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 77726 78301 gene locus_tag LOCUS_03440 77726 78301 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_03440 78384 78623 gene locus_tag LOCUS_03450 78384 78623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 78646 79473 gene locus_tag LOCUS_03460 78646 79473 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_03460 79608 81608 gene locus_tag LOCUS_03470 79608 81608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence05 350 841 gene locus_tag LOCUS_03480 350 841 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_03480 860 1954 gene locus_tag LOCUS_03490 860 1954 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_03490 1954 2883 gene locus_tag LOCUS_03500 gene mdh 1954 2883 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_03500 3111 3956 gene locus_tag LOCUS_03510 3111 3956 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_03510 4104 4850 gene locus_tag LOCUS_03520 4104 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 5030 5272 gene locus_tag LOCUS_03530 5030 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5275 5514 gene locus_tag LOCUS_03540 5275 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 6691 7251 gene locus_tag LOCUS_03550 6691 7251 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_03550 7256 7600 gene locus_tag LOCUS_03560 7256 7600 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 protein_id gnl|my_center|LOCUS_03560 8444 7920 gene locus_tag LOCUS_03570 8444 7920 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_03570 8916 8446 gene locus_tag LOCUS_03580 8916 8446 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_03580 9745 8921 gene locus_tag LOCUS_03590 9745 8921 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_03590 10208 9837 gene locus_tag LOCUS_03600 10208 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 11578 10337 gene locus_tag LOCUS_03610 11578 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 11904 12953 gene locus_tag LOCUS_03620 gene hrcA 11904 12953 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_03620 12975 13508 gene locus_tag LOCUS_03630 gene grpE 12975 13508 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_03630 13557 15473 gene locus_tag LOCUS_03640 gene dnaK 13557 15473 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_03640 15945 17021 gene locus_tag LOCUS_03650 gene dnaJ 15945 17021 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_03650 18408 17341 gene locus_tag LOCUS_03660 18408 17341 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_03660 19133 18429 gene locus_tag LOCUS_03670 gene plsY 19133 18429 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_03670 20443 19130 gene locus_tag LOCUS_03680 gene der 20443 19130 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_03680 21177 20500 gene locus_tag LOCUS_03690 21177 20500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 22131 21193 gene locus_tag LOCUS_03700 gene argF 22131 21193 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_03700 22472 22768 gene locus_tag LOCUS_03710 22472 22768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 22854 23177 gene locus_tag LOCUS_03720 22854 23177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 23500 23351 gene locus_tag LOCUS_03730 23500 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 23730 24134 gene locus_tag LOCUS_03740 23730 24134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 24418 27147 gene locus_tag LOCUS_03750 gene polA 24418 27147 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_03750 27151 27786 gene locus_tag LOCUS_03760 27151 27786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 27756 28568 gene locus_tag LOCUS_03770 gene mutM 27756 28568 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_03770 28790 28918 gene locus_tag LOCUS_03780 28790 28918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 29563 29102 gene locus_tag LOCUS_03790 29563 29102 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990733.1 protein_id gnl|my_center|LOCUS_03790 30582 29596 gene locus_tag LOCUS_03800 30582 29596 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_03800 30950 30699 gene locus_tag LOCUS_03810 30950 30699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 32460 30973 gene locus_tag LOCUS_03820 gene gltX 32460 30973 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_03820 33031 32510 gene locus_tag LOCUS_03830 33031 32510 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_03830 34023 33118 gene locus_tag LOCUS_03840 34023 33118 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 protein_id gnl|my_center|LOCUS_03840 34548 34036 gene locus_tag LOCUS_03850 gene lspA 34548 34036 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_03850 34882 34523 gene locus_tag LOCUS_03860 34882 34523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 35289 35753 gene locus_tag LOCUS_03870 35289 35753 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_03870 35839 36768 gene locus_tag LOCUS_03880 35839 36768 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_03880 36772 37536 gene locus_tag LOCUS_03890 36772 37536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_03890 37536 38366 gene locus_tag LOCUS_03900 37536 38366 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_03900 38403 39323 gene locus_tag LOCUS_03910 38403 39323 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_03910 39351 40943 gene locus_tag LOCUS_03920 39351 40943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 41512 40940 gene locus_tag LOCUS_03930 41512 40940 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_03930 41991 41509 gene locus_tag LOCUS_03940 gene ybeY 41991 41509 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_03940 42260 43540 gene locus_tag LOCUS_03950 42260 43540 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_03950 43570 44913 gene locus_tag LOCUS_03960 43570 44913 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_03960 45143 45234 gene locus_tag LOCUS_t00080 45143 45234 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45384 46607 gene locus_tag LOCUS_03970 gene miaB 45384 46607 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_03970 46623 46991 gene locus_tag LOCUS_03980 46623 46991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 47029 48627 gene locus_tag LOCUS_03990 gene nadB 47029 48627 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_03990 48620 49474 gene locus_tag LOCUS_04000 gene nadC 48620 49474 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_04000 49458 49904 gene locus_tag LOCUS_04010 49458 49904 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790413.1 protein_id gnl|my_center|LOCUS_04010 50067 49879 gene locus_tag LOCUS_04020 50067 49879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 50225 51070 gene locus_tag LOCUS_04030 gene ispH 50225 51070 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_04030 52342 51071 gene locus_tag LOCUS_04040 52342 51071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966846.1 protein_id gnl|my_center|LOCUS_04040 53013 52339 gene locus_tag LOCUS_04050 53013 52339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966848.1 protein_id gnl|my_center|LOCUS_04050 53146 54120 gene locus_tag LOCUS_04060 gene trpS 53146 54120 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869523.1 protein_id gnl|my_center|LOCUS_04060 55894 54710 gene locus_tag LOCUS_04070 55894 54710 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_04070 56431 55949 gene locus_tag LOCUS_04080 56431 55949 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_04080 56660 57250 gene locus_tag LOCUS_04090 56660 57250 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_04090 57325 57930 gene locus_tag LOCUS_04100 gene coaE 57325 57930 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_04100 58082 58294 gene locus_tag LOCUS_04110 58082 58294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 58295 58549 gene locus_tag LOCUS_04120 gene rpmA 58295 58549 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_04120 58555 58758 gene locus_tag LOCUS_04130 gene rpmE 58555 58758 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_04130 59225 58902 gene locus_tag LOCUS_04140 gene hisI 59225 58902 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 protein_id gnl|my_center|LOCUS_04140 60201 59485 gene locus_tag LOCUS_04150 gene hisA 60201 59485 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140708.1 protein_id gnl|my_center|LOCUS_04150 60999 60598 gene locus_tag LOCUS_04160 60999 60598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 61397 61636 gene locus_tag LOCUS_04170 61397 61636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 62701 61979 gene locus_tag LOCUS_04180 62701 61979 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_04180 63211 63864 gene locus_tag LOCUS_04190 63211 63864 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_04190 63888 64112 gene locus_tag LOCUS_04200 63888 64112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 64988 64155 gene locus_tag LOCUS_04210 64988 64155 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_04210 65517 65125 gene locus_tag LOCUS_04220 65517 65125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 66182 65517 gene locus_tag LOCUS_04230 66182 65517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 66656 66225 gene locus_tag LOCUS_04240 66656 66225 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081895.1 protein_id gnl|my_center|LOCUS_04240 67007 66750 gene locus_tag LOCUS_04250 67007 66750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 67193 67729 gene locus_tag LOCUS_04260 67193 67729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 67849 68538 gene locus_tag LOCUS_04270 67849 68538 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_04270 68535 69968 gene locus_tag LOCUS_04280 68535 69968 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256764.1 protein_id gnl|my_center|LOCUS_04280 70381 71139 gene locus_tag LOCUS_04290 70381 71139 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_04290 71459 74185 gene locus_tag LOCUS_04300 71459 74185 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_04300 74660 74274 gene locus_tag LOCUS_04310 gene mgsA 74660 74274 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289508.1 protein_id gnl|my_center|LOCUS_04310 75200 74895 gene locus_tag LOCUS_04320 75200 74895 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812401.1 protein_id gnl|my_center|LOCUS_04320 75425 75907 gene locus_tag LOCUS_04330 75425 75907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 75961 76815 gene locus_tag LOCUS_04340 75961 76815 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_04340 77505 76939 gene locus_tag LOCUS_04350 77505 76939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022298.1 protein_id gnl|my_center|LOCUS_04350 77690 78445 gene locus_tag LOCUS_04360 77690 78445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 78565 80031 gene locus_tag LOCUS_04370 78565 80031 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence06 375 863 gene locus_tag LOCUS_04380 375 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 1210 926 gene locus_tag LOCUS_04390 1210 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3851 1260 gene locus_tag LOCUS_04400 gene mutS 3851 1260 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_04400 4248 5063 gene locus_tag LOCUS_04410 4248 5063 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_04410 5429 5070 gene locus_tag LOCUS_04420 5429 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 7462 5624 gene locus_tag LOCUS_04430 gene uvrC 7462 5624 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_04430 8488 7640 gene locus_tag LOCUS_04440 8488 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8655 9569 gene locus_tag LOCUS_04450 gene xerD 8655 9569 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_04450 9597 9896 gene locus_tag LOCUS_04460 9597 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 9921 10559 gene locus_tag LOCUS_04470 9921 10559 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_04470 10549 11175 gene locus_tag LOCUS_04480 10549 11175 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188542542.1 protein_id gnl|my_center|LOCUS_04480 11254 13332 gene locus_tag LOCUS_04490 gene fusA 11254 13332 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_04490 14516 13686 gene locus_tag LOCUS_04500 gene prmC 14516 13686 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_04500 15583 14513 gene locus_tag LOCUS_04510 gene prfA 15583 14513 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_04510 16793 15705 gene locus_tag LOCUS_04520 16793 15705 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258545.1 protein_id gnl|my_center|LOCUS_04520 17012 18274 gene locus_tag LOCUS_04530 17012 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 18307 19608 gene locus_tag LOCUS_04540 18307 19608 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_04540 19610 20662 gene locus_tag LOCUS_04550 gene thrC 19610 20662 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865143.1 protein_id gnl|my_center|LOCUS_04550 20865 21452 gene locus_tag LOCUS_04560 20865 21452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 21818 22384 gene locus_tag LOCUS_04570 gene folE 21818 22384 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_04570 23047 22631 gene locus_tag LOCUS_04580 23047 22631 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_04580 23323 23069 gene locus_tag LOCUS_04590 23323 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 23678 23860 gene locus_tag LOCUS_04600 23678 23860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 24326 24586 gene locus_tag LOCUS_04610 24326 24586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 24608 24850 gene locus_tag LOCUS_04620 24608 24850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 25124 26221 gene locus_tag LOCUS_04630 25124 26221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 26218 27642 gene locus_tag LOCUS_04640 26218 27642 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_04640 27715 28212 gene locus_tag LOCUS_04650 27715 28212 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584056.1 protein_id gnl|my_center|LOCUS_04650 28222 29688 gene locus_tag LOCUS_04660 28222 29688 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_04660 29730 29966 gene locus_tag LOCUS_04670 29730 29966 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_04670 30051 30503 gene locus_tag LOCUS_04680 30051 30503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 31869 30511 gene locus_tag LOCUS_04690 31869 30511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 33136 32129 gene locus_tag LOCUS_04700 33136 32129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 33671 33129 gene locus_tag LOCUS_04710 33671 33129 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258966.1 protein_id gnl|my_center|LOCUS_04710 33921 34115 gene locus_tag LOCUS_04720 33921 34115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 34144 34815 gene locus_tag LOCUS_04730 34144 34815 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_04730 34863 36464 gene locus_tag LOCUS_04740 34863 36464 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_04740 36478 37683 gene locus_tag LOCUS_04750 36478 37683 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_04750 37756 38217 gene locus_tag LOCUS_04760 37756 38217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 38214 38810 gene locus_tag LOCUS_04770 38214 38810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 38826 40073 gene locus_tag LOCUS_04780 38826 40073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 40107 41348 gene locus_tag LOCUS_04790 40107 41348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 41348 42889 gene locus_tag LOCUS_04800 41348 42889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 42906 44006 gene locus_tag LOCUS_04810 42906 44006 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_04810 44437 45297 gene locus_tag LOCUS_04820 gene ruvB 44437 45297 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_04820 45299 45862 gene locus_tag LOCUS_04830 45299 45862 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_04830 45995 46555 gene locus_tag LOCUS_04840 gene rimI 45995 46555 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_04840 46743 46564 gene locus_tag LOCUS_04850 46743 46564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 46994 46776 gene locus_tag LOCUS_04860 46994 46776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 47708 47052 gene locus_tag LOCUS_04870 47708 47052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 47811 49193 gene locus_tag LOCUS_04880 47811 49193 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496733.1 protein_id gnl|my_center|LOCUS_04880 49511 49197 gene locus_tag LOCUS_04890 49511 49197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 49874 49557 gene locus_tag LOCUS_04900 gene trxA 49874 49557 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852918.1 protein_id gnl|my_center|LOCUS_04900 51016 50138 gene locus_tag LOCUS_04910 51016 50138 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_04910 52373 51027 gene locus_tag LOCUS_04920 gene acsC 52373 51027 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545537.1 protein_id gnl|my_center|LOCUS_04920 53647 52394 gene locus_tag LOCUS_04930 53647 52394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 54638 53685 gene locus_tag LOCUS_04940 gene cdhD 54638 53685 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_04940 55542 54652 gene locus_tag LOCUS_04950 gene folD 55542 54652 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_04950 57457 55544 gene locus_tag LOCUS_04960 57457 55544 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_04960 59240 57459 gene locus_tag LOCUS_04970 59240 57459 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_04970 59570 61375 gene locus_tag LOCUS_04980 gene aspS 59570 61375 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_04980 61394 62695 gene locus_tag LOCUS_04990 gene tig 61394 62695 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_04990 62720 63331 gene locus_tag LOCUS_05000 62720 63331 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257401.1 protein_id gnl|my_center|LOCUS_05000 63747 64811 gene locus_tag LOCUS_05010 63747 64811 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875763.1 protein_id gnl|my_center|LOCUS_05010 64814 65122 gene locus_tag LOCUS_05020 64814 65122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 66136 65330 gene locus_tag LOCUS_05030 66136 65330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 66785 66138 gene locus_tag LOCUS_05040 66785 66138 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618925.1 protein_id gnl|my_center|LOCUS_05040 67346 66789 gene locus_tag LOCUS_05050 gene efp 67346 66789 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_05050 68436 67363 gene locus_tag LOCUS_05060 68436 67363 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087103.1 protein_id gnl|my_center|LOCUS_05060 69367 68417 gene locus_tag LOCUS_05070 gene xerD 69367 68417 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_05070 71475 69373 gene locus_tag LOCUS_05080 gene topA 71475 69373 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_05080 72615 71476 gene locus_tag LOCUS_05090 gene dprA 72615 71476 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_05090 72806 72717 gene locus_tag LOCUS_t00090 72806 72717 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 73541 72924 gene locus_tag LOCUS_05100 73541 72924 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_05100 74498 73788 gene locus_tag LOCUS_05110 74498 73788 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_05110 74625 74536 gene locus_tag LOCUS_t00100 74625 74536 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 74948 76045 gene locus_tag LOCUS_05120 74948 76045 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence07 1604 837 gene locus_tag LOCUS_05130 1604 837 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_05130 3184 1646 gene locus_tag LOCUS_05140 3184 1646 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_05140 3961 3362 gene locus_tag LOCUS_05150 3961 3362 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582742.1 protein_id gnl|my_center|LOCUS_05150 4917 4441 gene locus_tag LOCUS_05160 4917 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 5710 4937 gene locus_tag LOCUS_05170 5710 4937 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_05170 6400 5741 gene locus_tag LOCUS_05180 6400 5741 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_05180 7378 6431 gene locus_tag LOCUS_05190 gene corA 7378 6431 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 protein_id gnl|my_center|LOCUS_05190 7750 7822 gene locus_tag LOCUS_t00110 7750 7822 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8236 7904 gene locus_tag LOCUS_05200 8236 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8569 9234 gene locus_tag LOCUS_05210 8569 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 9758 9321 gene locus_tag LOCUS_05220 9758 9321 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_05220 10047 10385 gene locus_tag LOCUS_05230 10047 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 10531 10740 gene locus_tag LOCUS_05240 10531 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 10901 11350 gene locus_tag LOCUS_05250 10901 11350 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941051.1 protein_id gnl|my_center|LOCUS_05250 11792 11421 gene locus_tag LOCUS_05260 11792 11421 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986720.1 protein_id gnl|my_center|LOCUS_05260 12539 11928 gene locus_tag LOCUS_05270 12539 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 13006 13347 gene locus_tag LOCUS_05280 13006 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 13547 14515 gene locus_tag LOCUS_05290 13547 14515 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_05290 15010 14621 gene locus_tag LOCUS_05300 15010 14621 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085581.1 protein_id gnl|my_center|LOCUS_05300 15231 15764 gene locus_tag LOCUS_05310 15231 15764 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_05310 15757 16617 gene locus_tag LOCUS_05320 15757 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 16972 17304 gene locus_tag LOCUS_05330 16972 17304 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 protein_id gnl|my_center|LOCUS_05330 18221 17781 gene locus_tag LOCUS_05340 18221 17781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 18904 18407 gene locus_tag LOCUS_05350 18904 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 19176 19403 gene locus_tag LOCUS_05360 19176 19403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 19766 19533 gene locus_tag LOCUS_05370 19766 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 19938 20654 gene locus_tag LOCUS_05380 19938 20654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 20707 20949 gene locus_tag LOCUS_05390 20707 20949 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496763.1 protein_id gnl|my_center|LOCUS_05390 20996 21673 gene locus_tag LOCUS_05400 20996 21673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 21762 21938 gene locus_tag LOCUS_05410 21762 21938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 21973 22767 gene locus_tag LOCUS_05420 21973 22767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 22996 22805 gene locus_tag LOCUS_05430 22996 22805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 23206 23009 gene locus_tag LOCUS_05440 23206 23009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 23737 23225 gene locus_tag LOCUS_05450 23737 23225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 24490 23873 gene locus_tag LOCUS_05460 24490 23873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 24862 24590 gene locus_tag LOCUS_05470 24862 24590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 25011 25247 gene locus_tag LOCUS_05480 25011 25247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 25460 25263 gene locus_tag LOCUS_05490 25460 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 25357 25929 gene locus_tag LOCUS_05500 25357 25929 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860219.1 protein_id gnl|my_center|LOCUS_05500 26764 26309 gene locus_tag LOCUS_05510 26764 26309 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_05510 27761 26862 gene locus_tag LOCUS_05520 27761 26862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 28126 27854 gene locus_tag LOCUS_05530 28126 27854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 28411 29187 gene locus_tag LOCUS_05540 28411 29187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 29231 29677 gene locus_tag LOCUS_05550 gene mscL 29231 29677 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_05550 29758 29970 gene locus_tag LOCUS_05560 29758 29970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 30416 30171 gene locus_tag LOCUS_05570 30416 30171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 30564 31103 gene locus_tag LOCUS_05580 30564 31103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 31244 31795 gene locus_tag LOCUS_05590 31244 31795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 31937 32476 gene locus_tag LOCUS_05600 31937 32476 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_05600 33099 32488 gene locus_tag LOCUS_05610 33099 32488 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938652.1 protein_id gnl|my_center|LOCUS_05610 33174 33491 gene locus_tag LOCUS_05620 33174 33491 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065892.1 protein_id gnl|my_center|LOCUS_05620 34268 33753 gene locus_tag LOCUS_05630 34268 33753 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814552.1 protein_id gnl|my_center|LOCUS_05630 35417 34497 gene locus_tag LOCUS_05640 35417 34497 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_05640 36581 35892 gene locus_tag LOCUS_05650 36581 35892 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_05650 39870 36880 gene locus_tag LOCUS_05660 39870 36880 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392203.1 protein_id gnl|my_center|LOCUS_05660 40508 39966 gene locus_tag LOCUS_05670 40508 39966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 40882 40640 gene locus_tag LOCUS_05680 40882 40640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 41976 41143 gene locus_tag LOCUS_05690 41976 41143 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_05690 42639 42061 gene locus_tag LOCUS_05700 42639 42061 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883304.1 protein_id gnl|my_center|LOCUS_05700 42820 43536 gene locus_tag LOCUS_05710 42820 43536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 43830 43636 gene locus_tag LOCUS_05720 43830 43636 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870242.1 protein_id gnl|my_center|LOCUS_05720 44705 43941 gene locus_tag LOCUS_05730 gene hisF 44705 43941 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_05730 44878 45492 gene locus_tag LOCUS_05740 44878 45492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 45568 45846 gene locus_tag LOCUS_05750 45568 45846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 46077 45940 gene locus_tag LOCUS_05760 46077 45940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 46320 46661 gene locus_tag LOCUS_05770 46320 46661 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459318.1 protein_id gnl|my_center|LOCUS_05770 47193 46699 gene locus_tag LOCUS_05780 47193 46699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_05780 48280 47258 gene locus_tag LOCUS_05790 48280 47258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 48400 49038 gene locus_tag LOCUS_05800 48400 49038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 49047 49427 gene locus_tag LOCUS_05810 49047 49427 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878637.1 protein_id gnl|my_center|LOCUS_05810 49678 49424 gene locus_tag LOCUS_05820 49678 49424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 50070 50699 gene locus_tag LOCUS_05830 50070 50699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 50894 51406 gene locus_tag LOCUS_05840 50894 51406 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_05840 52324 51410 gene locus_tag LOCUS_05850 52324 51410 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_05850 53171 52368 gene locus_tag LOCUS_05860 53171 52368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 53889 53164 gene locus_tag LOCUS_05870 53889 53164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 54886 54413 gene locus_tag LOCUS_05880 54886 54413 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_05880 55434 54883 gene locus_tag LOCUS_05890 55434 54883 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903833.1 protein_id gnl|my_center|LOCUS_05890 56267 59323 gene locus_tag LOCUS_05900 56267 59323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 59987 59355 gene locus_tag LOCUS_05910 59987 59355 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_05910 60087 60824 gene locus_tag LOCUS_05920 60087 60824 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_05920 60828 61727 gene locus_tag LOCUS_05930 gene rsmA 60828 61727 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_05930 61714 62595 gene locus_tag LOCUS_05940 gene ispE 61714 62595 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_05940 62597 63229 gene locus_tag LOCUS_05950 gene plsY 62597 63229 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_05950 63506 63952 gene locus_tag LOCUS_05960 63506 63952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 63939 64229 gene locus_tag LOCUS_05970 63939 64229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 65493 64237 gene locus_tag LOCUS_05980 65493 64237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence08 706 1389 gene locus_tag LOCUS_05990 706 1389 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_05990 1376 2797 gene locus_tag LOCUS_06000 1376 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 3688 5064 gene locus_tag LOCUS_06010 3688 5064 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_06010 5064 6368 gene locus_tag LOCUS_06020 5064 6368 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140609.1 protein_id gnl|my_center|LOCUS_06020 6413 7210 gene locus_tag LOCUS_06030 6413 7210 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867971.1 protein_id gnl|my_center|LOCUS_06030 7212 8171 gene locus_tag LOCUS_06040 7212 8171 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258205.1 protein_id gnl|my_center|LOCUS_06040 8171 8716 gene locus_tag LOCUS_06050 8171 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 9161 10123 gene locus_tag LOCUS_06060 9161 10123 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_06060 10120 11217 gene locus_tag LOCUS_06070 10120 11217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 11320 14052 gene locus_tag LOCUS_06080 11320 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 14111 14398 gene locus_tag LOCUS_06090 14111 14398 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_06090 14521 15408 gene locus_tag LOCUS_06100 14521 15408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 16628 15474 gene locus_tag LOCUS_06110 16628 15474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 16899 16606 gene locus_tag LOCUS_06120 16899 16606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 17096 18121 gene locus_tag LOCUS_06130 17096 18121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_06130 18131 18331 gene locus_tag LOCUS_06140 18131 18331 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106005441.1 protein_id gnl|my_center|LOCUS_06140 18781 20340 gene locus_tag LOCUS_06150 18781 20340 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_06150 20416 21678 gene locus_tag LOCUS_06160 gene ahcY 20416 21678 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_06160 21693 22898 gene locus_tag LOCUS_06170 gene metK 21693 22898 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_06170 23130 24560 gene locus_tag LOCUS_06180 23130 24560 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_06180 24565 25632 gene locus_tag LOCUS_06190 24565 25632 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_06190 25720 26640 gene locus_tag LOCUS_06200 25720 26640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_06200 26637 27449 gene locus_tag LOCUS_06210 26637 27449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 27576 27758 gene locus_tag LOCUS_06220 27576 27758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 28353 27958 gene locus_tag LOCUS_06230 gene rpsI 28353 27958 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476332.1 protein_id gnl|my_center|LOCUS_06230 28803 28381 gene locus_tag LOCUS_06240 gene rplM 28803 28381 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_06240 29596 28790 gene locus_tag LOCUS_06250 gene truA 29596 28790 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_06250 29990 29628 gene locus_tag LOCUS_06260 29990 29628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 31018 30014 gene locus_tag LOCUS_06270 31018 30014 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_06270 31665 31042 gene locus_tag LOCUS_06280 gene rpsD 31665 31042 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_06280 32067 31669 gene locus_tag LOCUS_06290 gene rpsK 32067 31669 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_06290 32479 32090 gene locus_tag LOCUS_06300 gene rpsM 32479 32090 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_06300 32872 32654 gene locus_tag LOCUS_06310 gene infA 32872 32654 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720929.1 protein_id gnl|my_center|LOCUS_06310 33648 32884 gene locus_tag LOCUS_06320 gene map 33648 32884 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_06320 34308 33658 gene locus_tag LOCUS_06330 34308 33658 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_06330 35638 34334 gene locus_tag LOCUS_06340 gene secY 35638 34334 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_06340 36086 35631 gene locus_tag LOCUS_06350 gene rplO 36086 35631 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_06350 36268 36086 gene locus_tag LOCUS_06360 gene rpmD 36268 36086 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_06360 36803 36261 gene locus_tag LOCUS_06370 gene rpsE 36803 36261 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_06370 37184 36819 gene locus_tag LOCUS_06380 gene rplR 37184 36819 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_06380 37738 37184 gene locus_tag LOCUS_06390 gene rplF 37738 37184 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_06390 38161 37763 gene locus_tag LOCUS_06400 gene rpsH 38161 37763 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_06400 38384 38199 gene locus_tag LOCUS_06410 38384 38199 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_06410 38933 38385 gene locus_tag LOCUS_06420 gene rplE 38933 38385 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_06420 39245 38934 gene locus_tag LOCUS_06430 gene rplX 39245 38934 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_06430 39630 39262 gene locus_tag LOCUS_06440 gene rplN 39630 39262 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615912.1 protein_id gnl|my_center|LOCUS_06440 39927 39646 gene locus_tag LOCUS_06450 gene rpsQ 39927 39646 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_06450 40134 39937 gene locus_tag LOCUS_06460 gene rpmC 40134 39937 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_06460 40588 40124 gene locus_tag LOCUS_06470 gene rplP 40588 40124 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_06470 41633 40620 gene locus_tag LOCUS_06480 41633 40620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 41971 41633 gene locus_tag LOCUS_06490 41971 41633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 42283 42002 gene locus_tag LOCUS_06500 gene rpsS 42283 42002 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_06500 43116 42289 gene locus_tag LOCUS_06510 gene rplB 43116 42289 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_06510 43416 43132 gene locus_tag LOCUS_06520 43416 43132 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140091.1 protein_id gnl|my_center|LOCUS_06520 44051 43419 gene locus_tag LOCUS_06530 gene rplD 44051 43419 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_06530 44672 44055 gene locus_tag LOCUS_06540 gene rplC 44672 44055 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_06540 44995 44687 gene locus_tag LOCUS_06550 gene rpsJ 44995 44687 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_06550 47210 45018 gene locus_tag LOCUS_06560 gene fusA 47210 45018 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258228.1 protein_id gnl|my_center|LOCUS_06560 47661 47191 gene locus_tag LOCUS_06570 gene rpsG 47661 47191 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_06570 48102 47674 gene locus_tag LOCUS_06580 gene rpsL 48102 47674 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_06580 48596 49666 gene locus_tag LOCUS_06590 gene aroF 48596 49666 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256593.1 protein_id gnl|my_center|LOCUS_06590 49667 50740 gene locus_tag LOCUS_06600 gene aroB 49667 50740 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_06600 50741 51394 gene locus_tag LOCUS_06610 50741 51394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06610 51391 52269 gene locus_tag LOCUS_06620 51391 52269 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_06620 52395 52925 gene locus_tag LOCUS_06630 52395 52925 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_06630 52909 54165 gene locus_tag LOCUS_06640 gene aroA 52909 54165 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496517.1 protein_id gnl|my_center|LOCUS_06640 54158 55249 gene locus_tag LOCUS_06650 gene aroC 54158 55249 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence09 1434 352 gene locus_tag LOCUS_06660 1434 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2550 1501 gene locus_tag LOCUS_06670 2550 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2767 3222 gene locus_tag LOCUS_06680 gene smpB 2767 3222 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356550.1 protein_id gnl|my_center|LOCUS_06680 3244 3598 gene locus_tag LOCUS_tm00010 3244 3598 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4608 3670 gene locus_tag LOCUS_06690 4608 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4821 4678 gene locus_tag LOCUS_06700 4821 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5017 5766 gene locus_tag LOCUS_06710 gene radC 5017 5766 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_06710 5850 6584 gene locus_tag LOCUS_06720 gene radC 5850 6584 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_06720 6637 7020 gene locus_tag LOCUS_06730 6637 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7519 7013 gene locus_tag LOCUS_06740 7519 7013 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289775.1 protein_id gnl|my_center|LOCUS_06740 8314 7610 gene locus_tag LOCUS_06750 8314 7610 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_06750 8574 8362 gene locus_tag LOCUS_06760 8574 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9244 8651 gene locus_tag LOCUS_06770 gene thpR 9244 8651 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545374.1 protein_id gnl|my_center|LOCUS_06770 10089 9247 gene locus_tag LOCUS_06780 10089 9247 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_06780 11381 10161 gene locus_tag LOCUS_06790 11381 10161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_06790 12294 11374 gene locus_tag LOCUS_06800 12294 11374 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_06800 13008 12340 gene locus_tag LOCUS_06810 13008 12340 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_06810 13686 13279 gene locus_tag LOCUS_06820 13686 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 13846 13691 gene locus_tag LOCUS_06830 13846 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 14065 15051 gene locus_tag LOCUS_06840 14065 15051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 15216 15356 gene locus_tag LOCUS_06850 15216 15356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 15504 15920 gene locus_tag LOCUS_06860 15504 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 16332 16248 gene locus_tag LOCUS_t00120 16332 16248 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16440 16859 gene locus_tag LOCUS_06870 16440 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 17287 16856 gene locus_tag LOCUS_06880 17287 16856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 18014 17391 gene locus_tag LOCUS_06890 18014 17391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 19253 18051 gene locus_tag LOCUS_06900 19253 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 19819 19250 gene locus_tag LOCUS_06910 19819 19250 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930688.1 protein_id gnl|my_center|LOCUS_06910 19996 19856 gene locus_tag LOCUS_06920 19996 19856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 20381 19947 gene locus_tag LOCUS_06930 20381 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 20840 20400 gene locus_tag LOCUS_06940 20840 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 21238 21164 gene locus_tag LOCUS_t00130 21238 21164 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 21325 21251 gene locus_tag LOCUS_t00140 21325 21251 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21421 21336 gene locus_tag LOCUS_t00150 21421 21336 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21499 21423 gene locus_tag LOCUS_t00160 21499 21423 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 21774 23039 gene locus_tag LOCUS_06950 21774 23039 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258489.1 protein_id gnl|my_center|LOCUS_06950 23181 23657 gene locus_tag LOCUS_06960 23181 23657 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_06960 25440 23809 gene locus_tag LOCUS_06970 gene groL 25440 23809 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_06970 25780 25487 gene locus_tag LOCUS_06980 gene groES 25780 25487 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583188.1 protein_id gnl|my_center|LOCUS_06980 27036 26044 gene locus_tag LOCUS_06990 gene tsaD 27036 26044 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_06990 27185 28474 gene locus_tag LOCUS_07000 27185 28474 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_07000 28449 29093 gene locus_tag LOCUS_07010 28449 29093 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_07010 29097 30260 gene locus_tag LOCUS_07020 29097 30260 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392745.1 protein_id gnl|my_center|LOCUS_07020 30271 30912 gene locus_tag LOCUS_07030 30271 30912 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081572.1 protein_id gnl|my_center|LOCUS_07030 30923 32368 gene locus_tag LOCUS_07040 gene tilS 30923 32368 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_07040 33182 32355 gene locus_tag LOCUS_07050 gene arsM 33182 32355 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_07050 33448 33194 gene locus_tag LOCUS_07060 33448 33194 CDS product HgcAB-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877983.1 protein_id gnl|my_center|LOCUS_07060 35419 33875 gene locus_tag LOCUS_07070 gene purH 35419 33875 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_07070 36328 35420 gene locus_tag LOCUS_07080 gene purM 36328 35420 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_07080 38083 36659 gene locus_tag LOCUS_07090 gene purF 38083 36659 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257473.1 protein_id gnl|my_center|LOCUS_07090 38720 38193 gene locus_tag LOCUS_07100 38720 38193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 39490 38810 gene locus_tag LOCUS_07110 39490 38810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 41972 39483 gene locus_tag LOCUS_07120 41972 39483 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_07120 42279 41959 gene locus_tag LOCUS_07130 42279 41959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 43300 42302 gene locus_tag LOCUS_07140 gene dnaJ 43300 42302 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_07140 43652 45286 gene locus_tag LOCUS_07150 43652 45286 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_07150 45300 45956 gene locus_tag LOCUS_07160 gene fsa 45300 45956 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869995.1 protein_id gnl|my_center|LOCUS_07160 46123 47385 gene locus_tag LOCUS_07170 gene rho 46123 47385 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence10 2443 926 gene locus_tag LOCUS_07180 2443 926 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225725.1 protein_id gnl|my_center|LOCUS_07180 3866 2463 gene locus_tag LOCUS_07190 3866 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 4230 4673 gene locus_tag LOCUS_07200 4230 4673 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_07200 4692 5690 gene locus_tag LOCUS_07210 gene cysK 4692 5690 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_07210 5743 6204 gene locus_tag LOCUS_07220 5743 6204 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943409.1 protein_id gnl|my_center|LOCUS_07220 6987 6367 gene locus_tag LOCUS_07230 6987 6367 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950348.1 protein_id gnl|my_center|LOCUS_07230 8195 7041 gene locus_tag LOCUS_07240 8195 7041 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868007.1 protein_id gnl|my_center|LOCUS_07240 8452 8204 gene locus_tag LOCUS_07250 8452 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 11087 8559 gene locus_tag LOCUS_07260 gene clpC 11087 8559 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_07260 11382 11272 gene locus_tag LOCUS_r00010 11382 11272 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 13389 11581 gene locus_tag LOCUS_07270 13389 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 18700 13982 gene locus_tag LOCUS_07280 18700 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 18957 19406 gene locus_tag LOCUS_07290 gene dtd 18957 19406 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_07290 19641 20060 gene locus_tag LOCUS_07300 19641 20060 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_07300 20125 20763 gene locus_tag LOCUS_07310 20125 20763 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_07310 20779 21075 gene locus_tag LOCUS_07320 20779 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07320 21354 22136 gene locus_tag LOCUS_07330 gene cbiQ 21354 22136 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023913.1 protein_id gnl|my_center|LOCUS_07330 22151 22873 gene locus_tag LOCUS_07340 22151 22873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_07340 24073 22874 gene locus_tag LOCUS_07350 24073 22874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_07350 24358 24155 gene locus_tag LOCUS_07360 24358 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 26865 24421 gene locus_tag LOCUS_07370 26865 24421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 27550 27059 gene locus_tag LOCUS_07380 27550 27059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 27683 27946 gene locus_tag LOCUS_07390 27683 27946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 28616 27954 gene locus_tag LOCUS_07400 28616 27954 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_07400 29022 28624 gene locus_tag LOCUS_07410 29022 28624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 29490 29035 gene locus_tag LOCUS_07420 29490 29035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 31137 29740 gene locus_tag LOCUS_07430 31137 29740 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021495.1 protein_id gnl|my_center|LOCUS_07430 32570 31206 gene locus_tag LOCUS_07440 gene trkA 32570 31206 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_07440 32943 33572 gene locus_tag LOCUS_07450 32943 33572 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_07450 33565 34563 gene locus_tag LOCUS_07460 33565 34563 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_07460 35205 34570 gene locus_tag LOCUS_07470 35205 34570 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_07470 35479 35186 gene locus_tag LOCUS_07480 35479 35186 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_07480 36937 35834 gene locus_tag LOCUS_07490 gene ychF 36937 35834 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_07490 37246 37025 gene locus_tag LOCUS_07500 37246 37025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 37678 37953 gene locus_tag LOCUS_07510 37678 37953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 38194 39201 gene locus_tag LOCUS_07520 gene holA 38194 39201 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460882.1 protein_id gnl|my_center|LOCUS_07520 39496 39720 gene locus_tag LOCUS_07530 39496 39720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 39801 42383 gene locus_tag LOCUS_07540 gene alaS 39801 42383 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_07540 42673 43116 gene locus_tag LOCUS_07550 gene ruvX 42673 43116 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_07550 43113 44285 gene locus_tag LOCUS_07560 gene tgt 43113 44285 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_07560 44667 44455 gene locus_tag LOCUS_07570 44667 44455 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_07570 44871 45467 gene locus_tag LOCUS_07580 44871 45467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 45587 46084 gene locus_tag LOCUS_07590 45587 46084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 protein_id gnl|my_center|LOCUS_07590 46274 46798 gene locus_tag LOCUS_07600 46274 46798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 46969 48252 gene locus_tag LOCUS_07610 46969 48252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence11 523 203 gene locus_tag LOCUS_07620 523 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1234 659 gene locus_tag LOCUS_07630 1234 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2165 1359 gene locus_tag LOCUS_07640 2165 1359 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459311.1 protein_id gnl|my_center|LOCUS_07640 5056 2165 gene locus_tag LOCUS_07650 5056 2165 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809925.1 protein_id gnl|my_center|LOCUS_07650 5515 5150 gene locus_tag LOCUS_07660 5515 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6569 5886 gene locus_tag LOCUS_07670 6569 5886 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730508.1 protein_id gnl|my_center|LOCUS_07670 9406 6596 gene locus_tag LOCUS_07680 9406 6596 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024434.1 protein_id gnl|my_center|LOCUS_07680 10706 9648 gene locus_tag LOCUS_07690 10706 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 10660 11025 gene locus_tag LOCUS_07700 10660 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 11207 12232 gene locus_tag LOCUS_07710 gene amrS 11207 12232 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_07710 12229 13569 gene locus_tag LOCUS_07720 12229 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 13795 14310 gene locus_tag LOCUS_07730 13795 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 14591 15928 gene locus_tag LOCUS_07740 14591 15928 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_07740 16012 16086 gene locus_tag LOCUS_t00170 16012 16086 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16210 16431 gene locus_tag LOCUS_07750 16210 16431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 16428 16658 gene locus_tag LOCUS_07760 16428 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 16667 16801 gene locus_tag LOCUS_07770 16667 16801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 17172 16909 gene locus_tag LOCUS_07780 17172 16909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 17852 17397 gene locus_tag LOCUS_07790 17852 17397 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_07790 17910 18389 gene locus_tag LOCUS_07800 17910 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 18389 18835 gene locus_tag LOCUS_07810 18389 18835 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990835.1 protein_id gnl|my_center|LOCUS_07810 18823 19305 gene locus_tag LOCUS_07820 18823 19305 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_07820 20096 19719 gene locus_tag LOCUS_07830 20096 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 20282 20905 gene locus_tag LOCUS_07840 20282 20905 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_07840 20909 22579 gene locus_tag LOCUS_07850 20909 22579 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_07850 22616 25105 gene locus_tag LOCUS_07860 22616 25105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 25161 25652 gene locus_tag LOCUS_07870 25161 25652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 26363 25638 gene locus_tag LOCUS_07880 26363 25638 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_07880 27201 26368 gene locus_tag LOCUS_07890 gene tcmP 27201 26368 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445522.1 protein_id gnl|my_center|LOCUS_07890 27915 27763 gene locus_tag LOCUS_07900 27915 27763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 29903 27912 gene locus_tag LOCUS_07910 gene uvrB 29903 27912 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256952.1 protein_id gnl|my_center|LOCUS_07910 30304 30534 gene locus_tag LOCUS_07920 30304 30534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 30678 31532 gene locus_tag LOCUS_07930 30678 31532 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 protein_id gnl|my_center|LOCUS_07930 31675 32085 gene locus_tag LOCUS_07940 31675 32085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 32906 32166 gene locus_tag LOCUS_07950 32906 32166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 33095 34207 gene locus_tag LOCUS_07960 33095 34207 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146468.1 protein_id gnl|my_center|LOCUS_07960 34195 35535 gene locus_tag LOCUS_07970 34195 35535 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085199.1 protein_id gnl|my_center|LOCUS_07970 35578 36825 gene locus_tag LOCUS_07980 35578 36825 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_07980 36864 37808 gene locus_tag LOCUS_07990 36864 37808 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_07990 37819 38058 gene locus_tag LOCUS_08000 37819 38058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 38113 40776 gene locus_tag LOCUS_08010 gene secA 38113 40776 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256432.1 protein_id gnl|my_center|LOCUS_08010 41151 41843 gene locus_tag LOCUS_08020 41151 41843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 41948 42331 gene locus_tag LOCUS_08030 41948 42331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 45059 42390 gene locus_tag LOCUS_08040 45059 42390 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_08040 45760 45167 gene locus_tag LOCUS_08050 45760 45167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 <46420 45842 gene locus_tag LOCUS_08060 <46420 45842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392412.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC >Feature sequence12 3885 1228 gene locus_tag LOCUS_08070 3885 1228 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_08070 4424 3891 gene locus_tag LOCUS_08080 gene nrdR 4424 3891 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203687.1 protein_id gnl|my_center|LOCUS_08080 5175 5360 gene locus_tag LOCUS_08090 5175 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6591 5407 gene locus_tag LOCUS_08100 6591 5407 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020613.1 protein_id gnl|my_center|LOCUS_08100 8480 7344 gene locus_tag LOCUS_08110 gene ftsZ 8480 7344 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_08110 9730 8513 gene locus_tag LOCUS_08120 gene ftsA 9730 8513 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_08120 10873 9827 gene locus_tag LOCUS_08130 gene rsmH 10873 9827 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_08130 11322 10879 gene locus_tag LOCUS_08140 gene mraZ 11322 10879 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052541.1 protein_id gnl|my_center|LOCUS_08140 11952 11785 gene locus_tag LOCUS_08150 11952 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 12008 13156 gene locus_tag LOCUS_08160 12008 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 13450 13869 gene locus_tag LOCUS_08170 13450 13869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 13903 14655 gene locus_tag LOCUS_08180 gene trmD 13903 14655 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_08180 14739 15086 gene locus_tag LOCUS_08190 gene rplS 14739 15086 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065250.1 protein_id gnl|my_center|LOCUS_08190 15179 17602 gene locus_tag LOCUS_08200 gene priA 15179 17602 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259672.1 protein_id gnl|my_center|LOCUS_08200 17831 18607 gene locus_tag LOCUS_08210 17831 18607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 18607 18942 gene locus_tag LOCUS_08220 18607 18942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 19117 19503 gene locus_tag LOCUS_08230 19117 19503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 19573 21072 gene locus_tag LOCUS_08240 19573 21072 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_08240 21168 22514 gene locus_tag LOCUS_08250 gene secD 21168 22514 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144152.1 protein_id gnl|my_center|LOCUS_08250 22507 23439 gene locus_tag LOCUS_08260 gene secF 22507 23439 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_08260 23487 24389 gene locus_tag LOCUS_08270 23487 24389 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_08270 25006 24386 gene locus_tag LOCUS_08280 25006 24386 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_08280 25128 25637 gene locus_tag LOCUS_08290 25128 25637 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_08290 25991 27199 gene locus_tag LOCUS_08300 25991 27199 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256341.1 protein_id gnl|my_center|LOCUS_08300 27190 27588 gene locus_tag LOCUS_08310 27190 27588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 27663 28484 gene locus_tag LOCUS_08320 27663 28484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 28713 29312 gene locus_tag LOCUS_08330 28713 29312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 29309 30919 gene locus_tag LOCUS_08340 29309 30919 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_08340 30939 31769 gene locus_tag LOCUS_08350 30939 31769 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_08350 31998 32071 gene locus_tag LOCUS_t00180 31998 32071 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 32641 33105 gene locus_tag LOCUS_08360 32641 33105 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_08360 33711 34415 gene locus_tag LOCUS_08370 33711 34415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 36240 34450 gene locus_tag LOCUS_08380 36240 34450 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038616.1 protein_id gnl|my_center|LOCUS_08380 36426 37175 gene locus_tag LOCUS_08390 36426 37175 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240990.1 protein_id gnl|my_center|LOCUS_08390 38523 37180 gene locus_tag LOCUS_08400 gene mgtE 38523 37180 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_08400 39493 39047 gene locus_tag LOCUS_08410 39493 39047 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295200.1 protein_id gnl|my_center|LOCUS_08410 40232 39498 gene locus_tag LOCUS_08420 40232 39498 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296408.1 protein_id gnl|my_center|LOCUS_08420 40924 40229 gene locus_tag LOCUS_08430 40924 40229 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296409.1 protein_id gnl|my_center|LOCUS_08430 41670 41080 gene locus_tag LOCUS_08440 41670 41080 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_08440 43052 41931 gene locus_tag LOCUS_08450 gene rsgA 43052 41931 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_08450 43552 43379 gene locus_tag LOCUS_08460 43552 43379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 44366 43554 gene locus_tag LOCUS_08470 gene alsD 44366 43554 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 protein_id gnl|my_center|LOCUS_08470 44976 44401 gene locus_tag LOCUS_08480 44976 44401 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496558.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence13 1 1527 gene locus_tag LOCUS_08490 1 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1529 2686 gene locus_tag LOCUS_08500 1529 2686 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_08500 3146 3646 gene locus_tag LOCUS_08510 3146 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3654 3776 gene locus_tag LOCUS_08520 3654 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4141 3839 gene locus_tag LOCUS_08530 4141 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4876 4289 gene locus_tag LOCUS_08540 gene thyX 4876 4289 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583167.1 protein_id gnl|my_center|LOCUS_08540 5084 6310 gene locus_tag LOCUS_08550 5084 6310 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799743.1 protein_id gnl|my_center|LOCUS_08550 7905 6796 gene locus_tag LOCUS_08560 7905 6796 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_08560 8220 9515 gene locus_tag LOCUS_08570 gene ablA 8220 9515 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_08570 9493 10497 gene locus_tag LOCUS_08580 9493 10497 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_08580 10482 11489 gene locus_tag LOCUS_08590 10482 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 11479 11961 gene locus_tag LOCUS_08600 11479 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 12393 12986 gene locus_tag LOCUS_08610 12393 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 13138 13710 gene locus_tag LOCUS_08620 13138 13710 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675556.1 protein_id gnl|my_center|LOCUS_08620 13707 14954 gene locus_tag LOCUS_08630 13707 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 15115 16434 gene locus_tag LOCUS_08640 15115 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 16524 17225 gene locus_tag LOCUS_08650 16524 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 17356 17748 gene locus_tag LOCUS_08660 17356 17748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 18280 19608 gene locus_tag LOCUS_08670 gene rsxC 18280 19608 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 protein_id gnl|my_center|LOCUS_08670 19612 20577 gene locus_tag LOCUS_08680 19612 20577 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_08680 20581 21120 gene locus_tag LOCUS_08690 20581 21120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 21145 21759 gene locus_tag LOCUS_08700 gene rsxE 21145 21759 CDS product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583456.1 protein_id gnl|my_center|LOCUS_08700 21752 22330 gene locus_tag LOCUS_08710 gene rsxA 21752 22330 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_08710 22330 22467 gene locus_tag LOCUS_08720 22330 22467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 22904 23974 gene locus_tag LOCUS_08730 22904 23974 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811615.1 protein_id gnl|my_center|LOCUS_08730 23975 25561 gene locus_tag LOCUS_08740 23975 25561 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811612.1 protein_id gnl|my_center|LOCUS_08740 25574 26197 gene locus_tag LOCUS_08750 gene cybH 25574 26197 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811610.1 protein_id gnl|my_center|LOCUS_08750 26219 26704 gene locus_tag LOCUS_08760 26219 26704 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459789.1 protein_id gnl|my_center|LOCUS_08760 26719 26898 gene locus_tag LOCUS_08770 26719 26898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 27184 26981 gene locus_tag LOCUS_08780 27184 26981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 27319 29643 gene locus_tag LOCUS_08790 gene hypF 27319 29643 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582504.1 protein_id gnl|my_center|LOCUS_08790 29656 29895 gene locus_tag LOCUS_08800 29656 29895 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_08800 29895 30989 gene locus_tag LOCUS_08810 gene hypD 29895 30989 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_08810 30979 31983 gene locus_tag LOCUS_08820 gene hypE 30979 31983 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_08820 31986 32327 gene locus_tag LOCUS_08830 gene hypA 31986 32327 CDS product hydrogenase/urease nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545280.1 protein_id gnl|my_center|LOCUS_08830 32328 32984 gene locus_tag LOCUS_08840 gene hypB 32328 32984 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939602.1 protein_id gnl|my_center|LOCUS_08840 33620 33907 gene locus_tag LOCUS_08850 gene gatC 33620 33907 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257310.1 protein_id gnl|my_center|LOCUS_08850 33935 35395 gene locus_tag LOCUS_08860 gene gatA 33935 35395 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_08860 35421 35972 gene locus_tag LOCUS_08870 35421 35972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 36655 37425 gene locus_tag LOCUS_08880 36655 37425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 39085 37583 gene locus_tag LOCUS_08890 39085 37583 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 protein_id gnl|my_center|LOCUS_08890 39770 39123 gene locus_tag LOCUS_08900 39770 39123 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_08900 42029 39897 gene locus_tag LOCUS_08910 42029 39897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 43231 42176 gene locus_tag LOCUS_08920 43231 42176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 43603 43259 gene locus_tag LOCUS_08930 43603 43259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 44701 43694 gene locus_tag LOCUS_08940 44701 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 45581 44721 gene locus_tag LOCUS_08950 45581 44721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence14 1654 3060 gene locus_tag LOCUS_08960 1654 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3183 3530 gene locus_tag LOCUS_08970 3183 3530 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_08970 3749 4306 gene locus_tag LOCUS_08980 3749 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4352 5356 gene locus_tag LOCUS_08990 4352 5356 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392665.1 protein_id gnl|my_center|LOCUS_08990 5347 6429 gene locus_tag LOCUS_09000 5347 6429 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392884.1 protein_id gnl|my_center|LOCUS_09000 6441 7445 gene locus_tag LOCUS_09010 6441 7445 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392663.1 protein_id gnl|my_center|LOCUS_09010 9081 8887 gene locus_tag LOCUS_09020 9081 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 10003 9308 gene locus_tag LOCUS_09030 10003 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 11315 10161 gene locus_tag LOCUS_09040 11315 10161 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939609.1 protein_id gnl|my_center|LOCUS_09040 12315 11446 gene locus_tag LOCUS_09050 12315 11446 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594344.1 protein_id gnl|my_center|LOCUS_09050 13013 12561 gene locus_tag LOCUS_09060 13013 12561 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_09060 13369 17124 gene locus_tag LOCUS_09070 13369 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 17129 18118 gene locus_tag LOCUS_09080 17129 18118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 18864 21887 gene locus_tag LOCUS_09090 18864 21887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 21919 22608 gene locus_tag LOCUS_09100 gene yycF 21919 22608 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722073.1 protein_id gnl|my_center|LOCUS_09100 22912 23367 gene locus_tag LOCUS_09110 22912 23367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 23484 26477 gene locus_tag LOCUS_09120 23484 26477 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809161.1 protein_id gnl|my_center|LOCUS_09120 26478 27293 gene locus_tag LOCUS_09130 26478 27293 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459311.1 protein_id gnl|my_center|LOCUS_09130 27388 27960 gene locus_tag LOCUS_09140 27388 27960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 28291 28980 gene locus_tag LOCUS_09150 28291 28980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 29018 29773 gene locus_tag LOCUS_09160 29018 29773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 29988 30443 gene locus_tag LOCUS_09170 29988 30443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 30493 32142 gene locus_tag LOCUS_09180 30493 32142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 33766 32750 gene locus_tag LOCUS_09190 33766 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence15 <1 2132 gene locus_tag LOCUS_09200 <1 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120422.1:phosphoribosylformylglycinamidine synthase subunit PurL 2141 2914 gene locus_tag LOCUS_09210 gene purQ 2141 2914 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_09210 3016 3771 gene locus_tag LOCUS_09220 gene rpsB 3016 3771 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_09220 3805 4326 gene locus_tag LOCUS_09230 gene tsf 3805 4326 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869491.1 protein_id gnl|my_center|LOCUS_09230 4339 5061 gene locus_tag LOCUS_09240 gene pyrH 4339 5061 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810668.1 protein_id gnl|my_center|LOCUS_09240 5051 5623 gene locus_tag LOCUS_09250 gene frr 5051 5623 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_09250 5720 5866 gene locus_tag LOCUS_09260 5720 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6337 7038 gene locus_tag LOCUS_09270 6337 7038 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_09270 7039 7845 gene locus_tag LOCUS_09280 7039 7845 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_09280 8703 8212 gene locus_tag LOCUS_09290 8703 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 8884 10026 gene locus_tag LOCUS_09300 8884 10026 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_09300 10026 11273 gene locus_tag LOCUS_09310 gene rseP 10026 11273 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_09310 11286 12332 gene locus_tag LOCUS_09320 gene ispG 11286 12332 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546314.1 protein_id gnl|my_center|LOCUS_09320 12859 13293 gene locus_tag LOCUS_09330 12859 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 13300 15000 gene locus_tag LOCUS_09340 13300 15000 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_09340 15080 15544 gene locus_tag LOCUS_09350 15080 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 16118 15717 gene locus_tag LOCUS_09360 16118 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 18895 16499 gene locus_tag LOCUS_09370 gene pheT 18895 16499 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_09370 19941 18898 gene locus_tag LOCUS_09380 gene pheS 19941 18898 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_09380 20570 20415 gene locus_tag LOCUS_09390 20570 20415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 20780 21136 gene locus_tag LOCUS_09400 20780 21136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 21171 22496 gene locus_tag LOCUS_09410 21171 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 25390 22925 gene locus_tag LOCUS_09420 25390 22925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 25663 25941 gene locus_tag LOCUS_09430 25663 25941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 26079 27464 gene locus_tag LOCUS_09440 26079 27464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 27487 27948 gene locus_tag LOCUS_09450 27487 27948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 28191 29111 gene locus_tag LOCUS_09460 28191 29111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130336.1 protein_id gnl|my_center|LOCUS_09460 29252 29884 gene locus_tag LOCUS_09470 29252 29884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 29945 30187 gene locus_tag LOCUS_09480 29945 30187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 30184 32193 gene locus_tag LOCUS_09490 30184 32193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 32208 32420 gene locus_tag LOCUS_09500 32208 32420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 32785 32991 gene locus_tag LOCUS_09510 32785 32991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 33007 33459 gene locus_tag LOCUS_09520 33007 33459 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460866.1 protein_id gnl|my_center|LOCUS_09520 <34437 33760 gene locus_tag LOCUS_09530 <34437 33760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943687.1:radical SAM protein >Feature sequence16 559 1020 gene locus_tag LOCUS_09540 559 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1247 1795 gene locus_tag LOCUS_09550 gene pyrR 1247 1795 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_09550 1798 2805 gene locus_tag LOCUS_09560 1798 2805 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_09560 2798 4117 gene locus_tag LOCUS_09570 2798 4117 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_09570 4114 5205 gene locus_tag LOCUS_09580 gene carA 4114 5205 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880225.1 protein_id gnl|my_center|LOCUS_09580 5215 5706 gene locus_tag LOCUS_09590 5215 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 5799 6179 gene locus_tag LOCUS_09600 5799 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 6205 6345 gene locus_tag LOCUS_09610 6205 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 6412 9657 gene locus_tag LOCUS_09620 gene carB 6412 9657 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_09620 9667 10473 gene locus_tag LOCUS_09630 9667 10473 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_09630 10519 10725 gene locus_tag LOCUS_09640 10519 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 11573 10740 gene locus_tag LOCUS_09650 11573 10740 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250141.1 protein_id gnl|my_center|LOCUS_09650 11743 12591 gene locus_tag LOCUS_09660 11743 12591 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921895.1 protein_id gnl|my_center|LOCUS_09660 12874 12692 gene locus_tag LOCUS_09670 12874 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 13034 14368 gene locus_tag LOCUS_09680 gene rimO 13034 14368 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_09680 15457 14510 gene locus_tag LOCUS_09690 15457 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 16126 15659 gene locus_tag LOCUS_09700 gene bfr 16126 15659 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675504.1 protein_id gnl|my_center|LOCUS_09700 17245 16475 gene locus_tag LOCUS_09710 17245 16475 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_09710 17662 18780 gene locus_tag LOCUS_09720 17662 18780 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_09720 20325 18775 gene locus_tag LOCUS_09730 20325 18775 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_09730 20831 20400 gene locus_tag LOCUS_09740 20831 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 21281 20847 gene locus_tag LOCUS_09750 21281 20847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 22416 21397 gene locus_tag LOCUS_09760 gene plsX 22416 21397 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_09760 22889 22635 gene locus_tag LOCUS_09770 gene acpP 22889 22635 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_09770 23805 23062 gene locus_tag LOCUS_09780 gene fabG 23805 23062 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_09780 24793 23849 gene locus_tag LOCUS_09790 gene fabD 24793 23849 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989819.1 protein_id gnl|my_center|LOCUS_09790 25297 26556 gene locus_tag LOCUS_09800 gene fabF 25297 26556 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257003.1 protein_id gnl|my_center|LOCUS_09800 26681 27826 gene locus_tag LOCUS_09810 26681 27826 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_09810 27967 27893 gene locus_tag LOCUS_t00190 27967 27893 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29416 28322 gene locus_tag LOCUS_09820 gene ftsZ 29416 28322 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_09820 30629 29442 gene locus_tag LOCUS_09830 gene ftsA 30629 29442 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_09830 32706 30853 gene locus_tag LOCUS_09840 32706 30853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence17 247 900 gene locus_tag LOCUS_09850 247 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 981 2048 gene locus_tag LOCUS_09860 981 2048 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_09860 2098 3147 gene locus_tag LOCUS_09870 gene aroF 2098 3147 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_09870 3567 3334 gene locus_tag LOCUS_09880 3567 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4091 4166 gene locus_tag LOCUS_t00200 4091 4166 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5625 4318 gene locus_tag LOCUS_09890 gene tig 5625 4318 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292069.1 protein_id gnl|my_center|LOCUS_09890 6426 5692 gene locus_tag LOCUS_09900 6426 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8116 6473 gene locus_tag LOCUS_09910 8116 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 9832 8201 gene locus_tag LOCUS_09920 9832 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 10543 9947 gene locus_tag LOCUS_09930 10543 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 11501 10662 gene locus_tag LOCUS_09940 11501 10662 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459311.1 protein_id gnl|my_center|LOCUS_09940 14502 11506 gene locus_tag LOCUS_09950 14502 11506 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809161.1 protein_id gnl|my_center|LOCUS_09950 15124 14714 gene locus_tag LOCUS_09960 15124 14714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 16200 15508 gene locus_tag LOCUS_09970 16200 15508 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081527.1 protein_id gnl|my_center|LOCUS_09970 17870 16203 gene locus_tag LOCUS_09980 17870 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 18257 19267 gene locus_tag LOCUS_09990 18257 19267 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065541.1 protein_id gnl|my_center|LOCUS_09990 19248 20162 gene locus_tag LOCUS_10000 19248 20162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 20191 21216 gene locus_tag LOCUS_10010 20191 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 21204 22181 gene locus_tag LOCUS_10020 21204 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 22196 22786 gene locus_tag LOCUS_10030 22196 22786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 22811 23842 gene locus_tag LOCUS_10040 22811 23842 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_10040 23865 24320 gene locus_tag LOCUS_10050 23865 24320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 25625 24558 gene locus_tag LOCUS_10060 25625 24558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258885.1 protein_id gnl|my_center|LOCUS_10060 26680 25622 gene locus_tag LOCUS_10070 26680 25622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258884.1 protein_id gnl|my_center|LOCUS_10070 27540 26677 gene locus_tag LOCUS_10080 27540 26677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258883.1 protein_id gnl|my_center|LOCUS_10080 28164 27547 gene locus_tag LOCUS_10090 28164 27547 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003291871.1 protein_id gnl|my_center|LOCUS_10090 28274 28347 gene locus_tag LOCUS_t00210 28274 28347 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 28561 29622 gene locus_tag LOCUS_10100 gene xerC 28561 29622 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 protein_id gnl|my_center|LOCUS_10100 29555 30235 gene locus_tag LOCUS_10110 29555 30235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 31504 31998 gene locus_tag LOCUS_10120 31504 31998 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014810586.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence18 540 1193 gene locus_tag LOCUS_10130 540 1193 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929250.1 protein_id gnl|my_center|LOCUS_10130 1190 1936 gene locus_tag LOCUS_10140 1190 1936 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898975.1 protein_id gnl|my_center|LOCUS_10140 1926 2654 gene locus_tag LOCUS_10150 1926 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2907 3674 gene locus_tag LOCUS_10160 2907 3674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546695.1 protein_id gnl|my_center|LOCUS_10160 3659 4891 gene locus_tag LOCUS_10170 3659 4891 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_10170 5857 5252 gene locus_tag LOCUS_10180 5857 5252 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_10180 6667 5873 gene locus_tag LOCUS_10190 6667 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7102 6776 gene locus_tag LOCUS_10200 7102 6776 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_10200 8017 7184 gene locus_tag LOCUS_10210 8017 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 9228 8065 gene locus_tag LOCUS_10220 9228 8065 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_10220 9795 11159 gene locus_tag LOCUS_10230 9795 11159 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_10230 14278 11234 gene locus_tag LOCUS_10240 gene ileS 14278 11234 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583781.1 protein_id gnl|my_center|LOCUS_10240 15298 14633 gene locus_tag LOCUS_10250 15298 14633 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_10250 16187 15186 gene locus_tag LOCUS_10260 16187 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 17362 16211 gene locus_tag LOCUS_10270 17362 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 17625 17395 gene locus_tag LOCUS_10280 gene yidD 17625 17395 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_10280 17872 17597 gene locus_tag LOCUS_10290 17872 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 18768 18328 gene locus_tag LOCUS_10300 18768 18328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 19225 18818 gene locus_tag LOCUS_10310 19225 18818 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256912.1 protein_id gnl|my_center|LOCUS_10310 19625 19269 gene locus_tag LOCUS_10320 19625 19269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 19822 19898 gene locus_tag LOCUS_t00220 19822 19898 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 21034 20171 gene locus_tag LOCUS_10330 21034 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 21167 21373 gene locus_tag LOCUS_10340 21167 21373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 21426 22121 gene locus_tag LOCUS_10350 21426 22121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 23401 23895 gene locus_tag LOCUS_10360 23401 23895 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014810586.1 protein_id gnl|my_center|LOCUS_10360 24159 26246 gene locus_tag LOCUS_10370 24159 26246 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022273.1 protein_id gnl|my_center|LOCUS_10370 26243 26932 gene locus_tag LOCUS_10380 gene yycF 26243 26932 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722073.1 protein_id gnl|my_center|LOCUS_10380 27417 27815 gene locus_tag LOCUS_10390 27417 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 27868 28299 gene locus_tag LOCUS_10400 27868 28299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 28396 28587 gene locus_tag LOCUS_10410 28396 28587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 28680 29141 gene locus_tag LOCUS_10420 28680 29141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 29163 30665 gene locus_tag LOCUS_10430 29163 30665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence19 119 1951 gene locus_tag LOCUS_10440 119 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2460 2023 gene locus_tag LOCUS_10450 2460 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2747 2917 gene locus_tag LOCUS_10460 2747 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4161 3238 gene locus_tag LOCUS_10470 gene epmA 4161 3238 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_10470 4729 4166 gene locus_tag LOCUS_10480 gene efp 4729 4166 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_10480 5286 6074 gene locus_tag LOCUS_10490 gene modA 5286 6074 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_10490 6117 6812 gene locus_tag LOCUS_10500 gene modB 6117 6812 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_10500 6848 7927 gene locus_tag LOCUS_10510 6848 7927 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_10510 8195 9412 gene locus_tag LOCUS_10520 8195 9412 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393897.1 protein_id gnl|my_center|LOCUS_10520 10373 9504 gene locus_tag LOCUS_10530 10373 9504 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932511.1 protein_id gnl|my_center|LOCUS_10530 10715 11791 gene locus_tag LOCUS_10540 10715 11791 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_10540 13317 11812 gene locus_tag LOCUS_10550 13317 11812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 13668 16559 gene locus_tag LOCUS_10560 13668 16559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 18390 16864 gene locus_tag LOCUS_10570 18390 16864 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_10570 19305 19799 gene locus_tag LOCUS_10580 19305 19799 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014810586.1 protein_id gnl|my_center|LOCUS_10580 19975 20946 gene locus_tag LOCUS_10590 19975 20946 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 protein_id gnl|my_center|LOCUS_10590 20970 23777 gene locus_tag LOCUS_10600 gene cas3 20970 23777 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_10600 23788 25449 gene locus_tag LOCUS_10610 gene casA 23788 25449 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_10610 25442 26032 gene locus_tag LOCUS_10620 25442 26032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 26052 27173 gene locus_tag LOCUS_10630 gene cas7e 26052 27173 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227612.1 protein_id gnl|my_center|LOCUS_10630 27184 27891 gene locus_tag LOCUS_10640 gene cas5e 27184 27891 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_10640 27873 28508 gene locus_tag LOCUS_10650 gene cas6e 27873 28508 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281400.1 protein_id gnl|my_center|LOCUS_10650 28512 29402 gene locus_tag LOCUS_10660 gene cas1e 28512 29402 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_10660 29329 29667 gene locus_tag LOCUS_10670 29329 29667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 29710 30472 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattccccatgcgtatgggggtgtaccg >Feature sequence20 4537 1034 gene locus_tag LOCUS_10680 4537 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5703 4540 gene locus_tag LOCUS_10690 5703 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6598 5717 gene locus_tag LOCUS_10700 6598 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 7028 6600 gene locus_tag LOCUS_10710 7028 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7963 7040 gene locus_tag LOCUS_10720 7963 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 8268 7960 gene locus_tag LOCUS_10730 8268 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 9845 8349 gene locus_tag LOCUS_10740 9845 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 10253 9846 gene locus_tag LOCUS_10750 10253 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 11323 10256 gene locus_tag LOCUS_10760 11323 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 11935 11336 gene locus_tag LOCUS_10770 11935 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 12291 11989 gene locus_tag LOCUS_10780 12291 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 14498 12357 gene locus_tag LOCUS_10790 14498 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 15638 14565 gene locus_tag LOCUS_10800 15638 14565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 16545 15643 gene locus_tag LOCUS_10810 16545 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 18290 16566 gene locus_tag LOCUS_10820 18290 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 19767 18556 gene locus_tag LOCUS_10830 19767 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 20351 19878 gene locus_tag LOCUS_10840 20351 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 20569 20348 gene locus_tag LOCUS_10850 20569 20348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 21032 20553 gene locus_tag LOCUS_10860 21032 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 21387 21109 gene locus_tag LOCUS_10870 21387 21109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 21813 21604 gene locus_tag LOCUS_10880 21813 21604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 22031 21825 gene locus_tag LOCUS_10890 22031 21825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 22183 22028 gene locus_tag LOCUS_10900 22183 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 22917 22498 gene locus_tag LOCUS_10910 22917 22498 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101098.1 protein_id gnl|my_center|LOCUS_10910 23189 22914 gene locus_tag LOCUS_10920 23189 22914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 23440 23288 gene locus_tag LOCUS_10930 23440 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 23990 23412 gene locus_tag LOCUS_10940 23990 23412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 24754 24047 gene locus_tag LOCUS_10950 24754 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 25268 24687 gene locus_tag LOCUS_10960 25268 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 25908 25606 gene locus_tag LOCUS_10970 25908 25606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 26084 25905 gene locus_tag LOCUS_10980 26084 25905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 27174 26065 gene locus_tag LOCUS_10990 27174 26065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 27526 27338 gene locus_tag LOCUS_11000 27526 27338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 27784 27530 gene locus_tag LOCUS_11010 27784 27530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 28205 27798 gene locus_tag LOCUS_11020 28205 27798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 29086 28202 gene locus_tag LOCUS_11030 29086 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 29859 29104 gene locus_tag LOCUS_11040 29859 29104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence21 780 1181 gene locus_tag LOCUS_11050 780 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1995 1231 gene locus_tag LOCUS_11060 1995 1231 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_11060 2188 2727 gene locus_tag LOCUS_11070 gene cobO 2188 2727 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_11070 2770 3870 gene locus_tag LOCUS_11080 gene fbp 2770 3870 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_11080 3871 4485 gene locus_tag LOCUS_11090 3871 4485 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_11090 4553 5689 gene locus_tag LOCUS_11100 gene dnaN 4553 5689 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_11100 5848 6660 gene locus_tag LOCUS_11110 5848 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 6696 7052 gene locus_tag LOCUS_11120 6696 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 7798 7361 gene locus_tag LOCUS_11130 7798 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8359 8120 gene locus_tag LOCUS_11140 8359 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 9239 8508 gene locus_tag LOCUS_11150 9239 8508 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_11150 9928 9407 gene locus_tag LOCUS_11160 9928 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 10841 10347 gene locus_tag LOCUS_11170 10841 10347 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939267.1 protein_id gnl|my_center|LOCUS_11170 11165 10947 gene locus_tag LOCUS_11180 11165 10947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 11602 11204 gene locus_tag LOCUS_11190 11602 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 11952 11764 gene locus_tag LOCUS_11200 11952 11764 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_11200 12172 12002 gene locus_tag LOCUS_11210 12172 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 12433 12762 gene locus_tag LOCUS_11220 12433 12762 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_11220 12800 13183 gene locus_tag LOCUS_11230 12800 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 13083 13355 gene locus_tag LOCUS_11240 13083 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 13345 14607 gene locus_tag LOCUS_11250 13345 14607 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_11250 14699 16528 gene locus_tag LOCUS_11260 gene typA 14699 16528 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_11260 16706 17713 gene locus_tag LOCUS_11270 gene hemW 16706 17713 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_11270 17752 19575 gene locus_tag LOCUS_11280 gene lepA 17752 19575 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_11280 20196 19942 gene locus_tag LOCUS_11290 20196 19942 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_11290 20744 20265 gene locus_tag LOCUS_11300 20744 20265 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_11300 21077 23038 gene locus_tag LOCUS_11310 21077 23038 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_11310 23038 23922 gene locus_tag LOCUS_11320 23038 23922 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_11320 23925 24983 gene locus_tag LOCUS_11330 23925 24983 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_11330 25021 26307 gene locus_tag LOCUS_11340 25021 26307 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228048.1 protein_id gnl|my_center|LOCUS_11340 26739 27530 gene locus_tag LOCUS_11350 26739 27530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_11350 27521 28813 gene locus_tag LOCUS_11360 27521 28813 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence22 1265 528 gene locus_tag LOCUS_11370 1265 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2231 1470 gene locus_tag LOCUS_11380 2231 1470 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933546.1 protein_id gnl|my_center|LOCUS_11380 3328 2681 gene locus_tag LOCUS_11390 3328 2681 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_11390 4330 3374 gene locus_tag LOCUS_11400 4330 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 4286 4516 gene locus_tag LOCUS_11410 4286 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4919 5191 gene locus_tag LOCUS_11420 4919 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_11420 5222 6076 gene locus_tag LOCUS_11430 5222 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7428 6073 gene locus_tag LOCUS_11440 7428 6073 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_11440 8245 7463 gene locus_tag LOCUS_11450 8245 7463 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_11450 8383 9186 gene locus_tag LOCUS_11460 gene pyrF 8383 9186 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_11460 9198 9389 gene locus_tag LOCUS_11470 9198 9389 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398916.1 protein_id gnl|my_center|LOCUS_11470 9455 10657 gene locus_tag LOCUS_11480 9455 10657 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228861.1 protein_id gnl|my_center|LOCUS_11480 11878 11042 gene locus_tag LOCUS_11490 11878 11042 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392942.1 protein_id gnl|my_center|LOCUS_11490 12384 13163 gene locus_tag LOCUS_11500 gene modA 12384 13163 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_11500 13230 13988 gene locus_tag LOCUS_11510 13230 13988 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 protein_id gnl|my_center|LOCUS_11510 14456 14004 gene locus_tag LOCUS_11520 gene nifU 14456 14004 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_11520 15255 14470 gene locus_tag LOCUS_11530 15255 14470 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327221.1 protein_id gnl|my_center|LOCUS_11530 15670 15278 gene locus_tag LOCUS_11540 15670 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 16096 15719 gene locus_tag LOCUS_11550 16096 15719 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_11550 17279 16416 gene locus_tag LOCUS_11560 17279 16416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_11560 18117 17251 gene locus_tag LOCUS_11570 18117 17251 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_11570 18316 18119 gene locus_tag LOCUS_11580 18316 18119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 18735 18370 gene locus_tag LOCUS_11590 18735 18370 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_11590 19023 18763 gene locus_tag LOCUS_11600 19023 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 19542 19081 gene locus_tag LOCUS_11610 19542 19081 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_11610 19648 20313 gene locus_tag LOCUS_11620 19648 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 20294 20653 gene locus_tag LOCUS_11630 20294 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 20678 21031 gene locus_tag LOCUS_11640 20678 21031 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096245.1 protein_id gnl|my_center|LOCUS_11640 21135 22046 gene locus_tag LOCUS_11650 21135 22046 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_11650 22084 22725 gene locus_tag LOCUS_11660 22084 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 23356 22808 gene locus_tag LOCUS_11670 23356 22808 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_11670 24415 23768 gene locus_tag LOCUS_11680 gene lexA 24415 23768 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_11680 24841 24563 gene locus_tag LOCUS_11690 gene rpsT 24841 24563 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_11690 25157 24969 gene locus_tag LOCUS_11700 25157 24969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 27326 25200 gene locus_tag LOCUS_11710 27326 25200 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence23 1353 946 gene locus_tag LOCUS_11720 1353 946 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_11720 3063 1357 gene locus_tag LOCUS_11730 3063 1357 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_11730 3599 3351 gene locus_tag LOCUS_11740 3599 3351 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933389.1 protein_id gnl|my_center|LOCUS_11740 4656 3619 gene locus_tag LOCUS_11750 4656 3619 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546326.1 protein_id gnl|my_center|LOCUS_11750 5040 4684 gene locus_tag LOCUS_11760 5040 4684 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461621.1 protein_id gnl|my_center|LOCUS_11760 5252 5638 gene locus_tag LOCUS_11770 5252 5638 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020395.1 protein_id gnl|my_center|LOCUS_11770 5639 6211 gene locus_tag LOCUS_11780 5639 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6193 6438 gene locus_tag LOCUS_11790 6193 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6997 9207 gene locus_tag LOCUS_11800 6997 9207 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_11800 9364 11067 gene locus_tag LOCUS_11810 gene mutL 9364 11067 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583440.1 protein_id gnl|my_center|LOCUS_11810 11852 11382 gene locus_tag LOCUS_11820 11852 11382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 12448 11876 gene locus_tag LOCUS_11830 gene pyrE 12448 11876 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_11830 12884 12453 gene locus_tag LOCUS_11840 12884 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 12883 13068 gene locus_tag LOCUS_11850 12883 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 13155 13901 gene locus_tag LOCUS_11860 13155 13901 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 protein_id gnl|my_center|LOCUS_11860 14042 15034 gene locus_tag LOCUS_11870 14042 15034 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 protein_id gnl|my_center|LOCUS_11870 15123 16217 gene locus_tag LOCUS_11880 gene ribD 15123 16217 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_11880 16222 16860 gene locus_tag LOCUS_11890 gene ribE 16222 16860 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987155.1 protein_id gnl|my_center|LOCUS_11890 16883 18079 gene locus_tag LOCUS_11900 16883 18079 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_11900 18110 18577 gene locus_tag LOCUS_11910 gene ribE 18110 18577 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_11910 18843 18592 gene locus_tag LOCUS_11920 18843 18592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 19016 19222 gene locus_tag LOCUS_11930 19016 19222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 19244 19861 gene locus_tag LOCUS_11940 19244 19861 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_11940 19918 19994 gene locus_tag LOCUS_t00230 19918 19994 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21235 20171 gene locus_tag LOCUS_11950 21235 20171 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867332.1 protein_id gnl|my_center|LOCUS_11950 22279 21260 gene locus_tag LOCUS_11960 gene ahbD 22279 21260 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_11960 22457 23164 gene locus_tag LOCUS_11970 22457 23164 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_11970 24528 23206 gene locus_tag LOCUS_11980 24528 23206 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_11980 24759 25610 gene locus_tag LOCUS_11990 24759 25610 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868724.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence24 2399 1056 gene locus_tag LOCUS_12000 gene glnA 2399 1056 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582594.1 protein_id gnl|my_center|LOCUS_12000 2807 2466 gene locus_tag LOCUS_12010 gene glnK1 2807 2466 CDS product P-II family nitrogen regulator GlnK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869551.1 protein_id gnl|my_center|LOCUS_12010 3328 2990 gene locus_tag LOCUS_12020 gene glnK1 3328 2990 CDS product P-II family nitrogen regulator GlnK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869551.1 protein_id gnl|my_center|LOCUS_12020 4554 3325 gene locus_tag LOCUS_12030 4554 3325 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_12030 5475 4795 gene locus_tag LOCUS_12040 5475 4795 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_12040 6297 5539 gene locus_tag LOCUS_12050 6297 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_12050 7807 6302 gene locus_tag LOCUS_12060 7807 6302 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_12060 8590 7823 gene locus_tag LOCUS_12070 gene hisF 8590 7823 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_12070 9741 8593 gene locus_tag LOCUS_12080 9741 8593 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878452.1 protein_id gnl|my_center|LOCUS_12080 11105 9792 gene locus_tag LOCUS_12090 11105 9792 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878451.1 protein_id gnl|my_center|LOCUS_12090 11750 11133 gene locus_tag LOCUS_12100 gene hisH 11750 11133 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 protein_id gnl|my_center|LOCUS_12100 12331 11849 gene locus_tag LOCUS_12110 12331 11849 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064659.1 protein_id gnl|my_center|LOCUS_12110 12683 12946 gene locus_tag LOCUS_12120 12683 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 12943 13914 gene locus_tag LOCUS_12130 12943 13914 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_12130 13924 14715 gene locus_tag LOCUS_12140 13924 14715 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_12140 14994 15299 gene locus_tag LOCUS_12150 14994 15299 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_12150 15549 15971 gene locus_tag LOCUS_12160 15549 15971 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_12160 16891 15968 gene locus_tag LOCUS_12170 16891 15968 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948021.1 protein_id gnl|my_center|LOCUS_12170 18147 17452 gene locus_tag LOCUS_12180 18147 17452 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_12180 19390 18158 gene locus_tag LOCUS_12190 19390 18158 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_12190 21109 19760 gene locus_tag LOCUS_12200 21109 19760 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_12200 21777 21142 gene locus_tag LOCUS_12210 21777 21142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 22178 22747 gene locus_tag LOCUS_12220 22178 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 22875 23441 gene locus_tag LOCUS_12230 22875 23441 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_12230 23443 24459 gene locus_tag LOCUS_12240 23443 24459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 24651 24947 gene locus_tag LOCUS_12250 24651 24947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 25119 25667 gene locus_tag LOCUS_12260 25119 25667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence25 1487 1900 gene locus_tag LOCUS_12270 1487 1900 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_12270 1952 2518 gene locus_tag LOCUS_12280 1952 2518 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_12280 2535 3734 gene locus_tag LOCUS_12290 gene htpX 2535 3734 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_12290 3915 3999 gene locus_tag LOCUS_t00240 3915 3999 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4257 4096 gene locus_tag LOCUS_12300 4257 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 4212 5969 gene locus_tag LOCUS_12310 4212 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6142 7896 gene locus_tag LOCUS_12320 gene thrS 6142 7896 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_12320 8124 8540 gene locus_tag LOCUS_12330 8124 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8527 8727 gene locus_tag LOCUS_12340 gene rpmI 8527 8727 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393258.1 protein_id gnl|my_center|LOCUS_12340 8746 9096 gene locus_tag LOCUS_12350 gene rplT 8746 9096 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_12350 11856 9172 gene locus_tag LOCUS_12360 11856 9172 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141077.1 protein_id gnl|my_center|LOCUS_12360 12300 13109 gene locus_tag LOCUS_12370 12300 13109 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_12370 13480 13124 gene locus_tag LOCUS_12380 13480 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 13572 13724 gene locus_tag LOCUS_12390 13572 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 13915 14517 gene locus_tag LOCUS_12400 gene pgsA 13915 14517 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262451.1 protein_id gnl|my_center|LOCUS_12400 14907 14833 gene locus_tag LOCUS_t00250 14907 14833 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15524 14964 gene locus_tag LOCUS_12410 15524 14964 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_12410 15693 17570 gene locus_tag LOCUS_12420 gene dxs 15693 17570 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_12420 17653 18852 gene locus_tag LOCUS_12430 17653 18852 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583493.1 protein_id gnl|my_center|LOCUS_12430 18874 20085 gene locus_tag LOCUS_12440 18874 20085 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_12440 20092 20853 gene locus_tag LOCUS_12450 gene tpiA 20092 20853 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_12450 20928 21842 gene locus_tag LOCUS_12460 gene miaA 20928 21842 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_12460 21851 22711 gene locus_tag LOCUS_12470 gene dapF 21851 22711 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_12470 22757 23932 gene locus_tag LOCUS_12480 22757 23932 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_12480 23999 25144 gene locus_tag LOCUS_12490 gene hflX 23999 25144 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence26 497 1315 gene locus_tag LOCUS_12500 gene lgt 497 1315 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_12500 1296 1814 gene locus_tag LOCUS_12510 1296 1814 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022634.1 protein_id gnl|my_center|LOCUS_12510 2069 2782 gene locus_tag LOCUS_12520 2069 2782 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_12520 3489 2854 gene locus_tag LOCUS_12530 gene plsY 3489 2854 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583521.1 protein_id gnl|my_center|LOCUS_12530 5114 3522 gene locus_tag LOCUS_12540 gene recJ 5114 3522 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_12540 5413 6684 gene locus_tag LOCUS_12550 gene mtaB 5413 6684 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_12550 6803 7297 gene locus_tag LOCUS_12560 6803 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 7745 7428 gene locus_tag LOCUS_12570 7745 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8060 8299 gene locus_tag LOCUS_12580 8060 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 8324 9055 gene locus_tag LOCUS_12590 8324 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 9185 9111 gene locus_tag LOCUS_t00260 9185 9111 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9370 9297 gene locus_tag LOCUS_t00270 9370 9297 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9489 9401 gene locus_tag LOCUS_t00280 9489 9401 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9602 9527 gene locus_tag LOCUS_t00290 9602 9527 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9769 9996 gene locus_tag LOCUS_12600 9769 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 10000 10386 gene locus_tag LOCUS_12610 10000 10386 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665986.1 protein_id gnl|my_center|LOCUS_12610 11244 10411 gene locus_tag LOCUS_12620 gene panC 11244 10411 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_12620 12082 11252 gene locus_tag LOCUS_12630 gene panB 12082 11252 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_12630 12458 12093 gene locus_tag LOCUS_12640 12458 12093 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830619.1 protein_id gnl|my_center|LOCUS_12640 13354 12497 gene locus_tag LOCUS_12650 13354 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 14344 13565 gene locus_tag LOCUS_12660 gene surE 14344 13565 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_12660 14465 15340 gene locus_tag LOCUS_12670 gene metF 14465 15340 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_12670 15356 16411 gene locus_tag LOCUS_12680 gene queA 15356 16411 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583955.1 protein_id gnl|my_center|LOCUS_12680 16992 16756 gene locus_tag LOCUS_12690 16992 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12690 19107 17020 gene locus_tag LOCUS_12700 19107 17020 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12700 19520 19906 gene locus_tag LOCUS_12710 19520 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 19983 21017 gene locus_tag LOCUS_12720 19983 21017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 23522 21105 gene locus_tag LOCUS_12730 gene acs 23522 21105 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_12730 23797 24288 gene locus_tag LOCUS_12740 23797 24288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence27 407 189 gene locus_tag LOCUS_12750 407 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1183 623 gene locus_tag LOCUS_12760 1183 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1368 1183 gene locus_tag LOCUS_12770 1368 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2217 1564 gene locus_tag LOCUS_12780 2217 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2338 3006 gene locus_tag LOCUS_12790 2338 3006 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_12790 3003 4394 gene locus_tag LOCUS_12800 3003 4394 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_12800 6047 4935 gene locus_tag LOCUS_12810 6047 4935 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_12810 6310 6750 gene locus_tag LOCUS_12820 6310 6750 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_12820 6796 8211 gene locus_tag LOCUS_12830 6796 8211 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087600.1 protein_id gnl|my_center|LOCUS_12830 8532 9269 gene locus_tag LOCUS_12840 8532 9269 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_12840 9271 11244 gene locus_tag LOCUS_12850 gene feoB 9271 11244 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060770.1 protein_id gnl|my_center|LOCUS_12850 11418 11490 gene locus_tag LOCUS_t00300 11418 11490 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11531 11618 gene locus_tag LOCUS_t00310 11531 11618 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 11710 11782 gene locus_tag LOCUS_t00320 11710 11782 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11802 13010 gene locus_tag LOCUS_12860 gene tuf 11802 13010 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_12860 13209 13427 gene locus_tag LOCUS_12870 13209 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 13497 14024 gene locus_tag LOCUS_12880 gene nusG 13497 14024 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_12880 14055 14477 gene locus_tag LOCUS_12890 gene rplK 14055 14477 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_12890 14479 15189 gene locus_tag LOCUS_12900 gene rplA 14479 15189 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_12900 15370 15894 gene locus_tag LOCUS_12910 gene rplJ 15370 15894 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_12910 15941 16324 gene locus_tag LOCUS_12920 gene rplL 15941 16324 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_12920 16481 16738 gene locus_tag LOCUS_12930 16481 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 17425 16703 gene locus_tag LOCUS_12940 17425 16703 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_12940 19005 17443 gene locus_tag LOCUS_12950 19005 17443 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_12950 19509 20918 gene locus_tag LOCUS_12960 gene nusA 19509 20918 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258863.1 protein_id gnl|my_center|LOCUS_12960 20929 21174 gene locus_tag LOCUS_12970 20929 21174 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence28 1077 1 gene locus_tag LOCUS_12980 1077 1 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879688.1 protein_id gnl|my_center|LOCUS_12980 3009 1168 gene locus_tag LOCUS_12990 gene oadA 3009 1168 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_12990 3288 3719 gene locus_tag LOCUS_13000 gene nuoE 3288 3719 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_13000 3709 6729 gene locus_tag LOCUS_13010 3709 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6902 9571 gene locus_tag LOCUS_13020 gene fdhF 6902 9571 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_13020 9651 10040 gene locus_tag LOCUS_13030 9651 10040 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_13030 10132 10884 gene locus_tag LOCUS_13040 10132 10884 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_13040 10898 11404 gene locus_tag LOCUS_13050 gene ruvC 10898 11404 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_13050 11401 11985 gene locus_tag LOCUS_13060 gene ruvA 11401 11985 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_13060 12815 12015 gene locus_tag LOCUS_13070 12815 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 13097 13297 gene locus_tag LOCUS_13080 13097 13297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 13298 13543 gene locus_tag LOCUS_13090 13298 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 14317 13790 gene locus_tag LOCUS_13100 14317 13790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 15081 14356 gene locus_tag LOCUS_13110 15081 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 16134 15082 gene locus_tag LOCUS_13120 16134 15082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 16742 16140 gene locus_tag LOCUS_13130 16742 16140 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704892.1 protein_id gnl|my_center|LOCUS_13130 16921 16751 gene locus_tag LOCUS_13140 16921 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 18344 17127 gene locus_tag LOCUS_13150 18344 17127 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_13150 19640 18360 gene locus_tag LOCUS_13160 19640 18360 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_13160 20901 19879 gene locus_tag LOCUS_13170 20901 19879 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_13170 21067 21627 gene locus_tag LOCUS_13180 21067 21627 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence29 1436 459 gene locus_tag LOCUS_13190 1436 459 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_13190 1589 2332 gene locus_tag LOCUS_13200 1589 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870951.1 protein_id gnl|my_center|LOCUS_13200 2560 3948 gene locus_tag LOCUS_13210 gene radA 2560 3948 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_13210 4079 4339 gene locus_tag LOCUS_13220 4079 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4387 5064 gene locus_tag LOCUS_13230 gene ispD 4387 5064 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_13230 5066 5545 gene locus_tag LOCUS_13240 gene ispF 5066 5545 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_13240 5542 7017 gene locus_tag LOCUS_13250 gene cysS 5542 7017 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_13250 7496 7571 gene locus_tag LOCUS_t00330 7496 7571 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7661 8539 gene locus_tag LOCUS_13260 7661 8539 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_13260 9037 10425 gene locus_tag LOCUS_13270 9037 10425 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_13270 11304 10744 gene locus_tag LOCUS_13280 11304 10744 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948700.1 protein_id gnl|my_center|LOCUS_13280 11998 11348 gene locus_tag LOCUS_13290 11998 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 12132 12851 gene locus_tag LOCUS_13300 12132 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 12910 13416 gene locus_tag LOCUS_13310 12910 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 14239 13436 gene locus_tag LOCUS_13320 gene zupT 14239 13436 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176713.1 protein_id gnl|my_center|LOCUS_13320 14477 15355 gene locus_tag LOCUS_13330 14477 15355 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_13330 15372 15554 gene locus_tag LOCUS_13340 15372 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 15589 15801 gene locus_tag LOCUS_13350 15589 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 15798 16112 gene locus_tag LOCUS_13360 15798 16112 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_13360 16461 16889 gene locus_tag LOCUS_13370 16461 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 16924 17376 gene locus_tag LOCUS_13380 16924 17376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 17369 17575 gene locus_tag LOCUS_13390 17369 17575 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_13390 18988 17585 gene locus_tag LOCUS_13400 18988 17585 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_13400 19586 19236 gene locus_tag LOCUS_13410 19586 19236 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_13410 19969 19586 gene locus_tag LOCUS_13420 gene crcB 19969 19586 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_13420 <21104 20147 gene locus_tag LOCUS_13430 <21104 20147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583271.1:LemA family protein >Feature sequence30 1495 896 gene locus_tag LOCUS_13440 gene cobC 1495 896 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_13440 2245 1508 gene locus_tag LOCUS_13450 gene cobS 2245 1508 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_13450 3313 2246 gene locus_tag LOCUS_13460 gene cobT 3313 2246 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_13460 4148 3351 gene locus_tag LOCUS_13470 gene yfmF 4148 3351 CDS product Fe(3+)-citrate ABC transporter ATP-binding protein YfmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233737.1 protein_id gnl|my_center|LOCUS_13470 5231 4164 gene locus_tag LOCUS_13480 5231 4164 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_13480 6408 5335 gene locus_tag LOCUS_13490 6408 5335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_13490 7206 6580 gene locus_tag LOCUS_13500 7206 6580 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 protein_id gnl|my_center|LOCUS_13500 8046 7264 gene locus_tag LOCUS_13510 8046 7264 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_13510 8197 9249 gene locus_tag LOCUS_13520 8197 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9569 10489 gene locus_tag LOCUS_13530 9569 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 11426 10563 gene locus_tag LOCUS_13540 11426 10563 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769585.1 protein_id gnl|my_center|LOCUS_13540 12428 11520 gene locus_tag LOCUS_13550 12428 11520 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022132.1 protein_id gnl|my_center|LOCUS_13550 13620 12415 gene locus_tag LOCUS_13560 13620 12415 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814530.1 protein_id gnl|my_center|LOCUS_13560 14606 13983 gene locus_tag LOCUS_13570 14606 13983 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022152.1 protein_id gnl|my_center|LOCUS_13570 14896 15408 gene locus_tag LOCUS_13580 gene ectA 14896 15408 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930801.1 protein_id gnl|my_center|LOCUS_13580 15410 16705 gene locus_tag LOCUS_13590 gene ectB 15410 16705 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 protein_id gnl|my_center|LOCUS_13590 16686 17081 gene locus_tag LOCUS_13600 16686 17081 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810601.1 protein_id gnl|my_center|LOCUS_13600 19383 17623 gene locus_tag LOCUS_13610 gene recN 19383 17623 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_13610 19801 20505 gene locus_tag LOCUS_13620 19801 20505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence31 197 724 gene locus_tag LOCUS_13630 gene cobU 197 724 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_13630 994 734 gene locus_tag LOCUS_13640 994 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1306 995 gene locus_tag LOCUS_13650 1306 995 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942689.1 protein_id gnl|my_center|LOCUS_13650 1920 1453 gene locus_tag LOCUS_13660 1920 1453 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_13660 3584 2226 gene locus_tag LOCUS_13670 3584 2226 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_13670 3901 3632 gene locus_tag LOCUS_13680 3901 3632 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_13680 5095 4079 gene locus_tag LOCUS_13690 5095 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 protein_id gnl|my_center|LOCUS_13690 5433 6206 gene locus_tag LOCUS_13700 gene vanR 5433 6206 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_13700 6465 6938 gene locus_tag LOCUS_13710 6465 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7590 10865 gene locus_tag LOCUS_13720 7590 10865 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_13720 10894 11574 gene locus_tag LOCUS_13730 10894 11574 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_13730 11847 12233 gene locus_tag LOCUS_13740 11847 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 12314 15241 gene locus_tag LOCUS_13750 12314 15241 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809161.1 protein_id gnl|my_center|LOCUS_13750 15241 16053 gene locus_tag LOCUS_13760 15241 16053 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809159.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence32 <1 1318 gene locus_tag LOCUS_13770 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142287.1:2-isopropylmalate synthase 1351 1761 gene locus_tag LOCUS_13780 1351 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1794 3047 gene locus_tag LOCUS_13790 gene leuC 1794 3047 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_13790 3051 3647 gene locus_tag LOCUS_13800 3051 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3724 4218 gene locus_tag LOCUS_13810 gene leuD 3724 4218 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_13810 4219 5307 gene locus_tag LOCUS_13820 gene leuB 4219 5307 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_13820 5320 6897 gene locus_tag LOCUS_13830 gene cimA 5320 6897 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146979.1 protein_id gnl|my_center|LOCUS_13830 7806 6901 gene locus_tag LOCUS_13840 7806 6901 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943779.1 protein_id gnl|my_center|LOCUS_13840 7949 8539 gene locus_tag LOCUS_13850 7949 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 8563 9264 gene locus_tag LOCUS_13860 8563 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 9645 10628 gene locus_tag LOCUS_13870 gene moaA 9645 10628 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_13870 10651 11127 gene locus_tag LOCUS_13880 gene moaC 10651 11127 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965292.1 protein_id gnl|my_center|LOCUS_13880 12353 11142 gene locus_tag LOCUS_13890 12353 11142 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_13890 12853 12350 gene locus_tag LOCUS_13900 12853 12350 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_13900 13032 14069 gene locus_tag LOCUS_13910 13032 14069 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583459.1 protein_id gnl|my_center|LOCUS_13910 14657 14214 gene locus_tag LOCUS_13920 14657 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 14829 15218 gene locus_tag LOCUS_13930 14829 15218 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546328.1 protein_id gnl|my_center|LOCUS_13930 15469 15397 gene locus_tag LOCUS_t00340 15469 15397 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16018 15644 gene locus_tag LOCUS_13940 16018 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence33 205 567 gene locus_tag LOCUS_13950 205 567 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480250.1 protein_id gnl|my_center|LOCUS_13950 564 845 gene locus_tag LOCUS_13960 564 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 868 1350 gene locus_tag LOCUS_13970 868 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1585 1788 gene locus_tag LOCUS_13980 1585 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13980 1848 2789 gene locus_tag LOCUS_13990 1848 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13990 2814 3464 gene locus_tag LOCUS_14000 2814 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4673 3606 gene locus_tag LOCUS_14010 gene rlmN 4673 3606 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_14010 4812 5039 gene locus_tag LOCUS_14020 4812 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 6337 5147 gene locus_tag LOCUS_14030 6337 5147 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_14030 6539 6378 gene locus_tag LOCUS_14040 6539 6378 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_14040 6762 7205 gene locus_tag LOCUS_14050 6762 7205 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392789.1 protein_id gnl|my_center|LOCUS_14050 7240 8157 gene locus_tag LOCUS_14060 7240 8157 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_14060 8257 9093 gene locus_tag LOCUS_14070 gene pstC 8257 9093 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_14070 9105 9956 gene locus_tag LOCUS_14080 gene pstA 9105 9956 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_14080 9958 10761 gene locus_tag LOCUS_14090 gene pstB 9958 10761 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_14090 10781 11449 gene locus_tag LOCUS_14100 gene phoU 10781 11449 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_14100 11644 12339 gene locus_tag LOCUS_14110 11644 12339 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_14110 12339 14093 gene locus_tag LOCUS_14120 gene phoR 12339 14093 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_14120 14192 14989 gene locus_tag LOCUS_14130 14192 14989 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897160.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence34 140 1423 gene locus_tag LOCUS_14140 140 1423 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048438.1 protein_id gnl|my_center|LOCUS_14140 2791 1898 gene locus_tag LOCUS_14150 gene dapA 2791 1898 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_14150 3820 2795 gene locus_tag LOCUS_14160 3820 2795 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_14160 4623 3829 gene locus_tag LOCUS_14170 gene dapB 4623 3829 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920961.1 protein_id gnl|my_center|LOCUS_14170 6819 4642 gene locus_tag LOCUS_14180 gene pnp 6819 4642 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_14180 7124 6861 gene locus_tag LOCUS_14190 gene rpsO 7124 6861 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111957.1 protein_id gnl|my_center|LOCUS_14190 8175 7258 gene locus_tag LOCUS_14200 8175 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 9491 8358 gene locus_tag LOCUS_14210 9491 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 10769 9669 gene locus_tag LOCUS_14220 gene ilvC 10769 9669 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962615.1 protein_id gnl|my_center|LOCUS_14220 11636 10896 gene locus_tag LOCUS_14230 11636 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 12185 11853 gene locus_tag LOCUS_14240 12185 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 12324 12614 gene locus_tag LOCUS_14250 12324 12614 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047972.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence35 1715 63 gene locus_tag LOCUS_14260 1715 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1681 1848 gene locus_tag LOCUS_14270 1681 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6804 2335 gene locus_tag LOCUS_14280 6804 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 7599 6979 gene locus_tag LOCUS_14290 7599 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 11657 7605 gene locus_tag LOCUS_14300 11657 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 <13582 11728 gene locus_tag LOCUS_14310 <13582 11728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226244.1:alpha-L-arabinofuranosidase C-terminal domain-containing protein >Feature sequence36 687 208 gene locus_tag LOCUS_14320 687 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1351 938 gene locus_tag LOCUS_14330 1351 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3320 1380 gene locus_tag LOCUS_14340 gene ftsH 3320 1380 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_14340 4372 3506 gene locus_tag LOCUS_14350 4372 3506 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_14350 4940 5143 gene locus_tag LOCUS_14360 4940 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 5581 5159 gene locus_tag LOCUS_14370 gene ndk 5581 5159 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250258.1 protein_id gnl|my_center|LOCUS_14370 6373 5669 gene locus_tag LOCUS_14380 gene tsaB 6373 5669 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546261.1 protein_id gnl|my_center|LOCUS_14380 6862 6377 gene locus_tag LOCUS_14390 gene tsaE 6862 6377 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049629.1 protein_id gnl|my_center|LOCUS_14390 7850 6852 gene locus_tag LOCUS_14400 gene thiL 7850 6852 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_14400 8322 9047 gene locus_tag LOCUS_14410 8322 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 9435 9142 gene locus_tag LOCUS_14420 9435 9142 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_14420 9592 9452 gene locus_tag LOCUS_14430 9592 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 10356 9661 gene locus_tag LOCUS_14440 gene rncS 10356 9661 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146873.1 protein_id gnl|my_center|LOCUS_14440 10511 10584 gene locus_tag LOCUS_t00350 10511 10584 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10621 10842 gene locus_tag LOCUS_14450 10621 10842 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546765.1 protein_id gnl|my_center|LOCUS_14450 10839 11066 gene locus_tag LOCUS_14460 10839 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 11676 11155 gene locus_tag LOCUS_14470 11676 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 12288 11866 gene locus_tag LOCUS_14480 12288 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 13321 12440 gene locus_tag LOCUS_14490 13321 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence37 <1 913 gene locus_tag LOCUS_14500 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258704.1:UDP-glucose/GDP-mannose dehydrogenase family protein 915 1754 gene locus_tag LOCUS_14510 915 1754 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_14510 1748 2761 gene locus_tag LOCUS_14520 1748 2761 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_14520 2798 3598 gene locus_tag LOCUS_14530 2798 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3598 4806 gene locus_tag LOCUS_14540 3598 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 4873 6669 gene locus_tag LOCUS_14550 4873 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 6684 7508 gene locus_tag LOCUS_14560 6684 7508 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250673.1 protein_id gnl|my_center|LOCUS_14560 8456 7668 gene locus_tag LOCUS_14570 8456 7668 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682206.1 protein_id gnl|my_center|LOCUS_14570 10032 8461 gene locus_tag LOCUS_14580 10032 8461 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545223.1 protein_id gnl|my_center|LOCUS_14580 10674 10135 gene locus_tag LOCUS_14590 10674 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 11751 10993 gene locus_tag LOCUS_14600 11751 10993 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_14600 <12565 11754 gene locus_tag LOCUS_14610 <12565 11754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005085629.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence38 2638 1997 gene locus_tag LOCUS_14620 2638 1997 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_14620 3698 2631 gene locus_tag LOCUS_14630 3698 2631 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_14630 3888 4757 gene locus_tag LOCUS_14640 3888 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4770 5750 gene locus_tag LOCUS_14650 4770 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 6755 6387 gene locus_tag LOCUS_14660 6755 6387 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_14660 7384 6752 gene locus_tag LOCUS_14670 7384 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8187 7459 gene locus_tag LOCUS_14680 8187 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 9277 8237 gene locus_tag LOCUS_14690 gene mnmA 9277 8237 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_14690 9996 9277 gene locus_tag LOCUS_14700 gene tmk 9996 9277 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_14700 11537 9999 gene locus_tag LOCUS_14710 11537 9999 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583152.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence39 636 968 gene locus_tag LOCUS_14720 636 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1232 1714 gene locus_tag LOCUS_14730 1232 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2534 1758 gene locus_tag LOCUS_14740 2534 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3094 2558 gene locus_tag LOCUS_14750 3094 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4075 3155 gene locus_tag LOCUS_14760 4075 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4245 4173 gene locus_tag LOCUS_t00360 4245 4173 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4370 4296 gene locus_tag LOCUS_t00370 4370 4296 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4578 5675 gene locus_tag LOCUS_14770 4578 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5807 6211 gene locus_tag LOCUS_14780 5807 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6208 6867 gene locus_tag LOCUS_14790 6208 6867 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_14790 7524 6868 gene locus_tag LOCUS_14800 gene mtnX 7524 6868 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 protein_id gnl|my_center|LOCUS_14800 8037 7531 gene locus_tag LOCUS_14810 gene def 8037 7531 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_14810 8188 8264 gene locus_tag LOCUS_t00380 8188 8264 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8826 8227 gene locus_tag LOCUS_14820 8826 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9056 9646 gene locus_tag LOCUS_14830 9056 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9776 9852 gene locus_tag LOCUS_t00390 9776 9852 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10246 9854 gene locus_tag LOCUS_14840 10246 9854 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_14840 10473 10234 gene locus_tag LOCUS_14850 10473 10234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 10705 11493 gene locus_tag LOCUS_14860 10705 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence40 190 831 gene locus_tag LOCUS_14870 190 831 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_14870 1084 1821 gene locus_tag LOCUS_14880 1084 1821 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944017.1 protein_id gnl|my_center|LOCUS_14880 1869 2693 gene locus_tag LOCUS_14890 1869 2693 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_14890 2695 3432 gene locus_tag LOCUS_14900 2695 3432 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_14900 3533 4444 gene locus_tag LOCUS_14910 3533 4444 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195333.1 protein_id gnl|my_center|LOCUS_14910 4678 6192 gene locus_tag LOCUS_14920 4678 6192 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 protein_id gnl|my_center|LOCUS_14920 6777 6313 gene locus_tag LOCUS_14930 6777 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184134.1 protein_id gnl|my_center|LOCUS_14930 7065 7673 gene locus_tag LOCUS_14940 7065 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 7862 8386 gene locus_tag LOCUS_14950 7862 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 8411 8815 gene locus_tag LOCUS_14960 8411 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 9053 8892 gene locus_tag LOCUS_14970 9053 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 9546 9070 gene locus_tag LOCUS_14980 9546 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence41 1533 703 gene locus_tag LOCUS_14990 1533 703 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_14990 1672 1935 gene locus_tag LOCUS_15000 1672 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1993 2068 gene locus_tag LOCUS_t00400 1993 2068 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2096 2872 gene locus_tag LOCUS_15010 2096 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4384 3236 gene locus_tag LOCUS_15020 4384 3236 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_15020 4570 5385 gene locus_tag LOCUS_15030 gene rsmI 4570 5385 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_15030 5429 5665 gene locus_tag LOCUS_15040 5429 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5672 7348 gene locus_tag LOCUS_15050 gene metG 5672 7348 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_15050 7370 8347 gene locus_tag LOCUS_15060 7370 8347 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546623.1 protein_id gnl|my_center|LOCUS_15060 8466 8630 gene locus_tag LOCUS_15070 8466 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 9065 8631 gene locus_tag LOCUS_15080 9065 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence42 1262 267 gene locus_tag LOCUS_15090 gene ilvC 1262 267 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_15090 1840 1310 gene locus_tag LOCUS_15100 gene ilvN 1840 1310 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_15100 3532 1841 gene locus_tag LOCUS_15110 3532 1841 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_15110 5212 3545 gene locus_tag LOCUS_15120 gene ilvD 5212 3545 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_15120 5821 5360 gene locus_tag LOCUS_15130 gene rpiB 5821 5360 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_15130 6450 5821 gene locus_tag LOCUS_15140 6450 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6516 8207 gene locus_tag LOCUS_15150 gene guaA 6516 8207 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence43 607 2787 gene locus_tag LOCUS_15160 607 2787 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_15160 3042 3269 gene locus_tag LOCUS_15170 3042 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 3259 3453 gene locus_tag LOCUS_15180 3259 3453 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965790.1 protein_id gnl|my_center|LOCUS_15180 3885 5327 gene locus_tag LOCUS_15190 3885 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 5580 6122 gene locus_tag LOCUS_15200 5580 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6457 7281 gene locus_tag LOCUS_15210 6457 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 8101 7337 gene locus_tag LOCUS_15220 8101 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence44 1262 1903 gene locus_tag LOCUS_15230 1262 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1900 2160 gene locus_tag LOCUS_15240 1900 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2757 2212 gene locus_tag LOCUS_15250 2757 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3699 2962 gene locus_tag LOCUS_15260 gene ubiE 3699 2962 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_15260 4611 3700 gene locus_tag LOCUS_15270 4611 3700 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425747.1 protein_id gnl|my_center|LOCUS_15270 5461 4625 gene locus_tag LOCUS_15280 5461 4625 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_15280 5699 5478 gene locus_tag LOCUS_15290 gene secG 5699 5478 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258195.1 protein_id gnl|my_center|LOCUS_15290 7158 5701 gene locus_tag LOCUS_15300 gene gatB 7158 5701 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_15300 7427 7502 gene locus_tag LOCUS_t00410 7427 7502 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence45 1008 244 gene locus_tag LOCUS_15310 1008 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1065 1325 gene locus_tag LOCUS_15320 1065 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1374 1643 gene locus_tag LOCUS_15330 1374 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1935 1786 gene locus_tag LOCUS_15340 1935 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2010 2777 gene locus_tag LOCUS_15350 2010 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 3093 2815 gene locus_tag LOCUS_15360 3093 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3936 4115 gene locus_tag LOCUS_15370 3936 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 6075 5074 gene locus_tag LOCUS_15380 6075 5074 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_15380 6230 6391 gene locus_tag LOCUS_15390 6230 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 <7283 6600 gene locus_tag LOCUS_15400 <7283 6600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989462.1:class 1 internalin InlA >Feature sequence46 743 1423 gene locus_tag LOCUS_15410 743 1423 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_15410 3035 1467 gene locus_tag LOCUS_15420 3035 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence47 >Feature sequence48 29 766 gene locus_tag LOCUS_15430 29 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 782 2125 gene locus_tag LOCUS_15440 782 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2137 2583 gene locus_tag LOCUS_15450 2137 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2633 3994 gene locus_tag LOCUS_15460 2633 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3991 4200 gene locus_tag LOCUS_15470 3991 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4216 4461 gene locus_tag LOCUS_15480 4216 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4353 4892 gene locus_tag LOCUS_15490 4353 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4961 5149 gene locus_tag LOCUS_15500 4961 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5151 5651 gene locus_tag LOCUS_15510 5151 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 5959 6141 gene locus_tag LOCUS_15520 5959 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 6141 6437 gene locus_tag LOCUS_15530 6141 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence49 559 1734 gene locus_tag LOCUS_15540 gene hflX 559 1734 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_15540 2338 2970 gene locus_tag LOCUS_15550 2338 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3052 3426 gene locus_tag LOCUS_15560 3052 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4672 3509 gene locus_tag LOCUS_15570 4672 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence50 622 215 gene locus_tag LOCUS_15580 622 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3141 3066 gene locus_tag LOCUS_t00420 3141 3066 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3240 3164 gene locus_tag LOCUS_t00430 3240 3164 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3344 3269 gene locus_tag LOCUS_t00440 3344 3269 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3432 3356 gene locus_tag LOCUS_t00450 3432 3356 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5258 3525 gene locus_tag LOCUS_15590 5258 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence51 457 813 gene locus_tag LOCUS_15600 gene rbfA 457 813 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144020.1 protein_id gnl|my_center|LOCUS_15600 816 1700 gene locus_tag LOCUS_15610 gene truB 816 1700 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_15610 1955 3100 gene locus_tag LOCUS_15620 1955 3100 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_15620 3156 4325 gene locus_tag LOCUS_15630 3156 4325 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907730.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence52 290 550 gene locus_tag LOCUS_15640 290 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1142 726 gene locus_tag LOCUS_15650 1142 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1429 2583 gene locus_tag LOCUS_15660 1429 2583 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_15660 2653 3528 gene locus_tag LOCUS_15670 2653 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3677 4516 gene locus_tag LOCUS_15680 3677 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence53 <1 2529 gene locus_tag LOCUS_15690 <1 2529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 2582 3628 gene locus_tag LOCUS_15700 2582 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3791 4072 gene locus_tag LOCUS_15710 3791 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence54 987 844 gene locus_tag LOCUS_15720 987 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2312 1026 gene locus_tag LOCUS_15730 2312 1026 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_15730 3393 2383 gene locus_tag LOCUS_15740 3393 2383 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584126.1 protein_id gnl|my_center|LOCUS_15740 4234 3554 gene locus_tag LOCUS_15750 4234 3554 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence55 1809 958 gene locus_tag LOCUS_15760 gene ccsB 1809 958 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_15760 3151 1802 gene locus_tag LOCUS_15770 3151 1802 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546737.1 protein_id gnl|my_center|LOCUS_15770 3271 3894 gene locus_tag LOCUS_15780 3271 3894 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence56 1703 414 gene locus_tag LOCUS_15790 1703 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3171 1828 gene locus_tag LOCUS_15800 3171 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence57 2248 158 gene locus_tag LOCUS_15810 2248 158 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_15810 <4047 2421 gene locus_tag LOCUS_15820 <4047 2421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392653.1:UPF0182 family protein >Feature sequence58 854 375 gene locus_tag LOCUS_15830 854 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3346 1505 gene locus_tag LOCUS_15840 gene mrdA 3346 1505 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence59 500 1258 gene locus_tag LOCUS_15850 500 1258 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392770.1 protein_id gnl|my_center|LOCUS_15850 1272 2414 gene locus_tag LOCUS_15860 1272 2414 CDS product PrpF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040164.1 protein_id gnl|my_center|LOCUS_15860 <3433 2621 gene locus_tag LOCUS_15870 <3433 2621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731590.1:isocitrate lyase/PEP mutase family protein >Feature sequence60 301 375 gene locus_tag LOCUS_t00460 301 375 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 403 984 gene locus_tag LOCUS_15880 403 984 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_15880 977 1267 gene locus_tag LOCUS_15890 gene porD 977 1267 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_15890 1267 2448 gene locus_tag LOCUS_15900 gene porA 1267 2448 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_15900 2448 3404 gene locus_tag LOCUS_15910 gene porB 2448 3404 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence61 <1 1643 gene locus_tag LOCUS_15920 <1 1643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546166.1:aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein 1627 1833 gene locus_tag LOCUS_15930 1627 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2106 2387 gene locus_tag LOCUS_15940 2106 2387 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_15940 2374 2694 gene locus_tag LOCUS_15950 2374 2694 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814555.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence62 3101 2340 gene locus_tag LOCUS_15960 3101 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence63 2088 1420 gene locus_tag LOCUS_15970 2088 1420 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_15970 2258 2671 gene locus_tag LOCUS_15980 2258 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence64 1346 1194 gene locus_tag LOCUS_15990 1346 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2010 1405 gene locus_tag LOCUS_16000 2010 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2812 2234 gene locus_tag LOCUS_16010 2812 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence65 1655 450 gene locus_tag LOCUS_16020 1655 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1654 1824 gene locus_tag LOCUS_16030 1654 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2077 1904 gene locus_tag LOCUS_16040 2077 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2519 2061 gene locus_tag LOCUS_16050 2519 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence66 1916 441 gene locus_tag LOCUS_16060 1916 441 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838734.1 protein_id gnl|my_center|LOCUS_16060 2103 2504 gene locus_tag LOCUS_16070 2103 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence67 74 826 gene locus_tag LOCUS_16080 74 826 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064266.1 protein_id gnl|my_center|LOCUS_16080 1109 2527 gene locus_tag LOCUS_16090 1109 2527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence68 790 32 gene locus_tag LOCUS_16100 790 32 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948648.1 protein_id gnl|my_center|LOCUS_16100 1602 781 gene locus_tag LOCUS_16110 gene modA 1602 781 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932353.1 protein_id gnl|my_center|LOCUS_16110 2420 1656 gene locus_tag LOCUS_16120 gene modA 2420 1656 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932353.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence69