>Feature sequence01 136 528 gene locus_tag LOCUS_00010 gene tagD 136 528 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_00010 528 1376 gene locus_tag LOCUS_00020 528 1376 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_00020 1394 2875 gene locus_tag LOCUS_00030 gene tacF 1394 2875 CDS product type IV teichoic acid flippase TacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835918.1 protein_id gnl|my_center|LOCUS_00030 2868 4085 gene locus_tag LOCUS_00040 2868 4085 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594817.1 protein_id gnl|my_center|LOCUS_00040 4276 4929 gene locus_tag LOCUS_00050 4276 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5238 6110 gene locus_tag LOCUS_00060 5238 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6107 6964 gene locus_tag LOCUS_00070 6107 6964 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087598.1 protein_id gnl|my_center|LOCUS_00070 6961 8004 gene locus_tag LOCUS_00080 6961 8004 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 protein_id gnl|my_center|LOCUS_00080 10287 8200 gene locus_tag LOCUS_00090 10287 8200 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681061.1 protein_id gnl|my_center|LOCUS_00090 12027 10384 gene locus_tag LOCUS_00100 12027 10384 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_00100 12752 12069 gene locus_tag LOCUS_00110 12752 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13665 12835 gene locus_tag LOCUS_00120 13665 12835 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_00120 14719 13682 gene locus_tag LOCUS_00130 14719 13682 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_00130 15681 14719 gene locus_tag LOCUS_00140 15681 14719 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_00140 16106 15666 gene locus_tag LOCUS_00150 16106 15666 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_00150 18171 16159 gene locus_tag LOCUS_00160 18171 16159 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_00160 18577 18182 gene locus_tag LOCUS_00170 18577 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19409 18570 gene locus_tag LOCUS_00180 19409 18570 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_00180 20862 19474 gene locus_tag LOCUS_00190 gene fumC 20862 19474 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 protein_id gnl|my_center|LOCUS_00190 21804 20863 gene locus_tag LOCUS_00200 21804 20863 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_00200 22078 24525 gene locus_tag LOCUS_00210 22078 24525 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679730.1 protein_id gnl|my_center|LOCUS_00210 25239 24529 gene locus_tag LOCUS_00220 25239 24529 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 protein_id gnl|my_center|LOCUS_00220 25442 25224 gene locus_tag LOCUS_00230 25442 25224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25391 26023 gene locus_tag LOCUS_00240 25391 26023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26023 27000 gene locus_tag LOCUS_00250 26023 27000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28128 27031 gene locus_tag LOCUS_00260 28128 27031 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658381.1 protein_id gnl|my_center|LOCUS_00260 29483 28146 gene locus_tag LOCUS_00270 gene serS 29483 28146 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_00270 30211 29516 gene locus_tag LOCUS_00280 30211 29516 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679259.1 protein_id gnl|my_center|LOCUS_00280 31721 30228 gene locus_tag LOCUS_00290 gene bamD 31721 30228 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679155.1 protein_id gnl|my_center|LOCUS_00290 32089 31718 gene locus_tag LOCUS_00300 32089 31718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35040 32086 gene locus_tag LOCUS_00310 35040 32086 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679154.1 protein_id gnl|my_center|LOCUS_00310 36262 35096 gene locus_tag LOCUS_00320 36262 35096 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_00320 36311 37429 gene locus_tag LOCUS_00330 36311 37429 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956987.1 protein_id gnl|my_center|LOCUS_00330 38738 37476 gene locus_tag LOCUS_00340 gene clpX 38738 37476 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679368.1 protein_id gnl|my_center|LOCUS_00340 39349 38738 gene locus_tag LOCUS_00350 gene clpP 39349 38738 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679367.1 protein_id gnl|my_center|LOCUS_00350 40808 39438 gene locus_tag LOCUS_00360 gene tig 40808 39438 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679366.1 protein_id gnl|my_center|LOCUS_00360 41017 40945 gene locus_tag LOCUS_t00010 41017 40945 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41137 41065 gene locus_tag LOCUS_t00020 41137 41065 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41272 41192 gene locus_tag LOCUS_t00030 41272 41192 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41384 41312 gene locus_tag LOCUS_t00040 41384 41312 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 41465 41392 gene locus_tag LOCUS_t00050 41465 41392 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41568 41496 gene locus_tag LOCUS_t00060 41568 41496 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 42418 41648 gene locus_tag LOCUS_00370 42418 41648 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399515.1 protein_id gnl|my_center|LOCUS_00370 43242 42415 gene locus_tag LOCUS_00380 43242 42415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44081 43239 gene locus_tag LOCUS_00390 44081 43239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 44668 44111 gene locus_tag LOCUS_00400 44668 44111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115564.1 protein_id gnl|my_center|LOCUS_00400 44810 45709 gene locus_tag LOCUS_00410 44810 45709 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957234.1 protein_id gnl|my_center|LOCUS_00410 45716 46867 gene locus_tag LOCUS_00420 gene murG 45716 46867 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957113.1 protein_id gnl|my_center|LOCUS_00420 46864 47397 gene locus_tag LOCUS_00430 46864 47397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 47400 48638 gene locus_tag LOCUS_00440 47400 48638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679703.1 protein_id gnl|my_center|LOCUS_00440 48658 49845 gene locus_tag LOCUS_00450 48658 49845 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_00450 49916 51289 gene locus_tag LOCUS_00460 49916 51289 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_00460 51282 51701 gene locus_tag LOCUS_00470 51282 51701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 52537 51704 gene locus_tag LOCUS_00480 52537 51704 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_00480 52683 54170 gene locus_tag LOCUS_00490 gene xylB 52683 54170 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_00490 54242 55555 gene locus_tag LOCUS_00500 gene xylA 54242 55555 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_00500 55840 57258 gene locus_tag LOCUS_00510 gene murC 55840 57258 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956876.1 protein_id gnl|my_center|LOCUS_00510 57268 58137 gene locus_tag LOCUS_00520 57268 58137 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_00520 58146 58706 gene locus_tag LOCUS_00530 58146 58706 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_00530 60187 58775 gene locus_tag LOCUS_00540 gene thrC 60187 58775 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680037.1 protein_id gnl|my_center|LOCUS_00540 60890 60240 gene locus_tag LOCUS_00550 60890 60240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60986 62101 gene locus_tag LOCUS_00560 60986 62101 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678853.1 protein_id gnl|my_center|LOCUS_00560 62171 63331 gene locus_tag LOCUS_00570 62171 63331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63325 64590 gene locus_tag LOCUS_00580 63325 64590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 64606 65481 gene locus_tag LOCUS_00590 gene rsmA 64606 65481 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_00590 65496 66212 gene locus_tag LOCUS_00600 65496 66212 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_00600 66217 66702 gene locus_tag LOCUS_00610 66217 66702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682391.1 protein_id gnl|my_center|LOCUS_00610 66703 67683 gene locus_tag LOCUS_00620 66703 67683 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682393.1 protein_id gnl|my_center|LOCUS_00620 67690 68418 gene locus_tag LOCUS_00630 67690 68418 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682394.1 protein_id gnl|my_center|LOCUS_00630 68636 69925 gene locus_tag LOCUS_00640 68636 69925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 69922 71337 gene locus_tag LOCUS_00650 69922 71337 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665464.1 protein_id gnl|my_center|LOCUS_00650 71339 72292 gene locus_tag LOCUS_00660 71339 72292 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658190.1 protein_id gnl|my_center|LOCUS_00660 72296 75484 gene locus_tag LOCUS_00670 72296 75484 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_00670 75505 75822 gene locus_tag LOCUS_00680 75505 75822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 76118 76324 gene locus_tag LOCUS_00690 76118 76324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 76488 76688 gene locus_tag LOCUS_00700 76488 76688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77762 76803 gene locus_tag LOCUS_00710 gene rfbD 77762 76803 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_00710 78908 77793 gene locus_tag LOCUS_00720 78908 77793 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080489.1 protein_id gnl|my_center|LOCUS_00720 79664 78909 gene locus_tag LOCUS_00730 79664 78909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 79829 80716 gene locus_tag LOCUS_00740 79829 80716 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_00740 80706 81425 gene locus_tag LOCUS_00750 80706 81425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 81422 83653 gene locus_tag LOCUS_00760 81422 83653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 83650 84498 gene locus_tag LOCUS_00770 83650 84498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 84495 85928 gene locus_tag LOCUS_00780 84495 85928 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682395.1 protein_id gnl|my_center|LOCUS_00780 87046 85922 gene locus_tag LOCUS_00790 gene alr 87046 85922 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682404.1 protein_id gnl|my_center|LOCUS_00790 87417 88136 gene locus_tag LOCUS_00800 87417 88136 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575791.1 protein_id gnl|my_center|LOCUS_00800 88225 88140 gene locus_tag LOCUS_t00070 88225 88140 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 88691 88302 gene locus_tag LOCUS_00810 88691 88302 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667147.1 protein_id gnl|my_center|LOCUS_00810 89668 88691 gene locus_tag LOCUS_00820 89668 88691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670623.1 protein_id gnl|my_center|LOCUS_00820 89777 93517 gene locus_tag LOCUS_00830 89777 93517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 96351 93634 gene locus_tag LOCUS_00840 96351 93634 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545608.1 protein_id gnl|my_center|LOCUS_00840 97667 96348 gene locus_tag LOCUS_00850 gene rodA 97667 96348 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677908.1 protein_id gnl|my_center|LOCUS_00850 99577 97664 gene locus_tag LOCUS_00860 gene mrdA 99577 97664 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671463.1 protein_id gnl|my_center|LOCUS_00860 100985 100107 gene locus_tag LOCUS_00870 gene mreC 100985 100107 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668697.1 protein_id gnl|my_center|LOCUS_00870 102058 101006 gene locus_tag LOCUS_00880 102058 101006 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668696.1 protein_id gnl|my_center|LOCUS_00880 103058 102096 gene locus_tag LOCUS_00890 103058 102096 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678909.1 protein_id gnl|my_center|LOCUS_00890 104385 103522 gene locus_tag LOCUS_00900 104385 103522 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671470.1 protein_id gnl|my_center|LOCUS_00900 106432 104465 gene locus_tag LOCUS_00910 gene rpoD 106432 104465 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678907.1 protein_id gnl|my_center|LOCUS_00910 108238 106436 gene locus_tag LOCUS_00920 gene dnaG 108238 106436 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678905.1 protein_id gnl|my_center|LOCUS_00920 109300 108245 gene locus_tag LOCUS_00930 gene mltG 109300 108245 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671179.1 protein_id gnl|my_center|LOCUS_00930 110241 109297 gene locus_tag LOCUS_00940 110241 109297 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669065.1 protein_id gnl|my_center|LOCUS_00940 111643 110315 gene locus_tag LOCUS_00950 gene dnaB 111643 110315 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669313.1 protein_id gnl|my_center|LOCUS_00950 112309 111788 gene locus_tag LOCUS_00960 112309 111788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 112691 112377 gene locus_tag LOCUS_00970 gene rpsR 112691 112377 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669347.1 protein_id gnl|my_center|LOCUS_00970 113225 112737 gene locus_tag LOCUS_00980 gene ssb 113225 112737 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_00980 113539 113249 gene locus_tag LOCUS_00990 gene rpsF 113539 113249 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669351.1 protein_id gnl|my_center|LOCUS_00990 >Feature sequence02 724 284 gene locus_tag LOCUS_01000 724 284 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074962.1 protein_id gnl|my_center|LOCUS_01000 785 1609 gene locus_tag LOCUS_01010 785 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 1723 2370 gene locus_tag LOCUS_01020 1723 2370 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682388.1 protein_id gnl|my_center|LOCUS_01020 3558 2401 gene locus_tag LOCUS_01030 3558 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679110.1 protein_id gnl|my_center|LOCUS_01030 3652 4323 gene locus_tag LOCUS_01040 3652 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 4605 5348 gene locus_tag LOCUS_01050 4605 5348 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_01050 5430 5915 gene locus_tag LOCUS_01060 gene ruvC 5430 5915 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679556.1 protein_id gnl|my_center|LOCUS_01060 6618 5881 gene locus_tag LOCUS_01070 6618 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 6804 7247 gene locus_tag LOCUS_01080 gene mraZ 6804 7247 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_01080 7244 8266 gene locus_tag LOCUS_01090 gene rsmH 7244 8266 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678681.1 protein_id gnl|my_center|LOCUS_01090 8266 8565 gene locus_tag LOCUS_01100 8266 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 8552 9985 gene locus_tag LOCUS_01110 gene murF 8552 9985 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678687.1 protein_id gnl|my_center|LOCUS_01110 9988 11196 gene locus_tag LOCUS_01120 gene ftsW 9988 11196 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677685.1 protein_id gnl|my_center|LOCUS_01120 11189 12031 gene locus_tag LOCUS_01130 11189 12031 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668441.1 protein_id gnl|my_center|LOCUS_01130 12044 13288 gene locus_tag LOCUS_01140 gene ftsA 12044 13288 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656287.1 protein_id gnl|my_center|LOCUS_01140 13365 14852 gene locus_tag LOCUS_01150 13365 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 14856 15749 gene locus_tag LOCUS_01160 14856 15749 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044909847.1 protein_id gnl|my_center|LOCUS_01160 15767 16501 gene locus_tag LOCUS_01170 15767 16501 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678696.1 protein_id gnl|my_center|LOCUS_01170 16540 17496 gene locus_tag LOCUS_01180 gene dprA 16540 17496 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677699.1 protein_id gnl|my_center|LOCUS_01180 17507 19702 gene locus_tag LOCUS_01190 gene topA 17507 19702 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678704.1 protein_id gnl|my_center|LOCUS_01190 19695 20618 gene locus_tag LOCUS_01200 19695 20618 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678705.1 protein_id gnl|my_center|LOCUS_01200 20652 21194 gene locus_tag LOCUS_01210 gene hslV 20652 21194 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_01210 21196 22719 gene locus_tag LOCUS_01220 gene hslU 21196 22719 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677705.1 protein_id gnl|my_center|LOCUS_01220 25548 22807 gene locus_tag LOCUS_01230 gene secA 25548 22807 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679596.1 protein_id gnl|my_center|LOCUS_01230 25724 27418 gene locus_tag LOCUS_01240 25724 27418 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680894.1 protein_id gnl|my_center|LOCUS_01240 29532 27523 gene locus_tag LOCUS_01250 gene priA 29532 27523 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680463.1 protein_id gnl|my_center|LOCUS_01250 30346 29522 gene locus_tag LOCUS_01260 30346 29522 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680465.1 protein_id gnl|my_center|LOCUS_01260 31569 30343 gene locus_tag LOCUS_01270 31569 30343 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_01270 31630 33321 gene locus_tag LOCUS_01280 31630 33321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678730.1 protein_id gnl|my_center|LOCUS_01280 33341 35233 gene locus_tag LOCUS_01290 33341 35233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668497.1 protein_id gnl|my_center|LOCUS_01290 35245 36474 gene locus_tag LOCUS_01300 gene thiI 35245 36474 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680552.1 protein_id gnl|my_center|LOCUS_01300 36450 37535 gene locus_tag LOCUS_01310 36450 37535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 37905 40013 gene locus_tag LOCUS_01320 37905 40013 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044978168.1 protein_id gnl|my_center|LOCUS_01320 42199 40229 gene locus_tag LOCUS_01330 42199 40229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 42695 42252 gene locus_tag LOCUS_01340 42695 42252 CDS product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_01340 43547 42840 gene locus_tag LOCUS_01350 43547 42840 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_01350 43916 44344 gene locus_tag LOCUS_01360 43916 44344 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_01360 44683 45618 gene locus_tag LOCUS_01370 gene cysK 44683 45618 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_01370 45815 47158 gene locus_tag LOCUS_01380 45815 47158 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_01380 47220 50159 gene locus_tag LOCUS_01390 gene uvrA 47220 50159 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956862.1 protein_id gnl|my_center|LOCUS_01390 50162 53398 gene locus_tag LOCUS_01400 50162 53398 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682325.1 protein_id gnl|my_center|LOCUS_01400 53428 53796 gene locus_tag LOCUS_01410 53428 53796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 53879 55636 gene locus_tag LOCUS_01420 gene lepB 53879 55636 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680071.1 protein_id gnl|my_center|LOCUS_01420 55685 56575 gene locus_tag LOCUS_01430 55685 56575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 56593 57468 gene locus_tag LOCUS_01440 gene rfbA 56593 57468 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679070.1 protein_id gnl|my_center|LOCUS_01440 57468 58067 gene locus_tag LOCUS_01450 gene rfbC 57468 58067 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_01450 58069 59184 gene locus_tag LOCUS_01460 gene rfbB 58069 59184 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679073.1 protein_id gnl|my_center|LOCUS_01460 59674 59240 gene locus_tag LOCUS_01470 59674 59240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 59610 59819 gene locus_tag LOCUS_01480 59610 59819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 61891 59864 gene locus_tag LOCUS_01490 61891 59864 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682194.1 protein_id gnl|my_center|LOCUS_01490 63741 61921 gene locus_tag LOCUS_01500 63741 61921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 64130 65419 gene locus_tag LOCUS_01510 64130 65419 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_01510 65523 66155 gene locus_tag LOCUS_01520 65523 66155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678886.1 protein_id gnl|my_center|LOCUS_01520 66210 67592 gene locus_tag LOCUS_01530 66210 67592 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680832.1 protein_id gnl|my_center|LOCUS_01530 67614 68063 gene locus_tag LOCUS_01540 gene flgD 67614 68063 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666981.1 protein_id gnl|my_center|LOCUS_01540 68109 69500 gene locus_tag LOCUS_01550 gene flgE 68109 69500 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_01550 69722 69943 gene locus_tag LOCUS_01560 69722 69943 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666823.1 protein_id gnl|my_center|LOCUS_01560 69969 70901 gene locus_tag LOCUS_01570 gene miaA 69969 70901 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680912.1 protein_id gnl|my_center|LOCUS_01570 72258 70882 gene locus_tag LOCUS_01580 72258 70882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 72956 72255 gene locus_tag LOCUS_01590 72956 72255 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062021.1 protein_id gnl|my_center|LOCUS_01590 73092 73748 gene locus_tag LOCUS_01600 73092 73748 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_01600 73868 74059 gene locus_tag LOCUS_01610 73868 74059 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680829.1 protein_id gnl|my_center|LOCUS_01610 74084 74866 gene locus_tag LOCUS_01620 74084 74866 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666986.1 protein_id gnl|my_center|LOCUS_01620 74884 75606 gene locus_tag LOCUS_01630 gene motB 74884 75606 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666988.1 protein_id gnl|my_center|LOCUS_01630 75697 76251 gene locus_tag LOCUS_01640 75697 76251 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666989.1 protein_id gnl|my_center|LOCUS_01640 76275 77309 gene locus_tag LOCUS_01650 gene fliM 76275 77309 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_01650 77306 78547 gene locus_tag LOCUS_01660 gene fliN 77306 78547 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680828.1 protein_id gnl|my_center|LOCUS_01660 78669 79334 gene locus_tag LOCUS_01670 78669 79334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 79469 80176 gene locus_tag LOCUS_01680 gene fliP 79469 80176 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680826.1 protein_id gnl|my_center|LOCUS_01680 80213 80482 gene locus_tag LOCUS_01690 gene fliQ 80213 80482 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666830.1 protein_id gnl|my_center|LOCUS_01690 80484 81305 gene locus_tag LOCUS_01700 gene fliR 80484 81305 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673318.1 protein_id gnl|my_center|LOCUS_01700 81305 82402 gene locus_tag LOCUS_01710 gene flhB 81305 82402 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680909.1 protein_id gnl|my_center|LOCUS_01710 82500 84626 gene locus_tag LOCUS_01720 gene flhA 82500 84626 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889723.1 protein_id gnl|my_center|LOCUS_01720 84619 85962 gene locus_tag LOCUS_01730 gene flhF 84619 85962 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957291.1 protein_id gnl|my_center|LOCUS_01730 85998 86873 gene locus_tag LOCUS_01740 85998 86873 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_01740 86936 87676 gene locus_tag LOCUS_01750 86936 87676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 87737 88534 gene locus_tag LOCUS_01760 gene whiG 87737 88534 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_01760 88543 90510 gene locus_tag LOCUS_01770 88543 90510 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667114.1 protein_id gnl|my_center|LOCUS_01770 91529 90531 gene locus_tag LOCUS_01780 91529 90531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 91707 92729 gene locus_tag LOCUS_01790 91707 92729 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107344.1 protein_id gnl|my_center|LOCUS_01790 94169 93102 gene locus_tag LOCUS_01800 gene gap 94169 93102 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_01800 95147 94218 gene locus_tag LOCUS_01810 95147 94218 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_01810 95890 95156 gene locus_tag LOCUS_01820 95890 95156 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_01820 98304 95887 gene locus_tag LOCUS_01830 98304 95887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 99507 98314 gene locus_tag LOCUS_01840 99507 98314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 100211 99528 gene locus_tag LOCUS_01850 100211 99528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 100416 101300 gene locus_tag LOCUS_01860 gene folD 100416 101300 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_01860 101293 102078 gene locus_tag LOCUS_01870 gene folE2 101293 102078 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_01870 102591 102232 gene locus_tag LOCUS_01880 102591 102232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 102798 104180 gene locus_tag LOCUS_01890 gene miaB 102798 104180 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679246.1 protein_id gnl|my_center|LOCUS_01890 104283 105056 gene locus_tag LOCUS_01900 104283 105056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 105072 105740 gene locus_tag LOCUS_01910 105072 105740 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_01910 105727 106449 gene locus_tag LOCUS_01920 105727 106449 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_01920 106573 106749 gene locus_tag LOCUS_01930 106573 106749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 106838 107080 gene locus_tag LOCUS_01940 106838 107080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 107112 108377 gene locus_tag LOCUS_01950 107112 108377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 108470 108545 gene locus_tag LOCUS_t00080 108470 108545 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 108832 108545 gene locus_tag LOCUS_01960 108832 108545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 109066 109347 gene locus_tag LOCUS_01970 109066 109347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 110666 109509 gene locus_tag LOCUS_01980 110666 109509 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680092.1 protein_id gnl|my_center|LOCUS_01980 >Feature sequence03 2395 179 gene locus_tag LOCUS_01990 2395 179 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167180.1 protein_id gnl|my_center|LOCUS_01990 3436 2399 gene locus_tag LOCUS_02000 3436 2399 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363445.1 protein_id gnl|my_center|LOCUS_02000 3727 3933 gene locus_tag LOCUS_02010 3727 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4043 4321 gene locus_tag LOCUS_02020 4043 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 4776 6281 gene locus_tag LOCUS_02030 4776 6281 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_02030 6585 6716 gene locus_tag LOCUS_02040 6585 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 7009 8229 gene locus_tag LOCUS_02050 7009 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 8635 8345 gene locus_tag LOCUS_02060 8635 8345 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_02060 8895 8629 gene locus_tag LOCUS_02070 8895 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 9233 8952 gene locus_tag LOCUS_02080 9233 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 10361 9351 gene locus_tag LOCUS_02090 10361 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 10654 10358 gene locus_tag LOCUS_02100 10654 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 11106 10750 gene locus_tag LOCUS_02110 11106 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 11324 11109 gene locus_tag LOCUS_02120 11324 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 12779 11640 gene locus_tag LOCUS_02130 12779 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 13925 12867 gene locus_tag LOCUS_02140 13925 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 14483 14061 gene locus_tag LOCUS_02150 14483 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 15988 14795 gene locus_tag LOCUS_02160 15988 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 17145 16009 gene locus_tag LOCUS_02170 17145 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 17683 17132 gene locus_tag LOCUS_02180 17683 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 18124 17783 gene locus_tag LOCUS_02190 18124 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 18315 18575 gene locus_tag LOCUS_02200 18315 18575 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667543.1 protein_id gnl|my_center|LOCUS_02200 19254 18595 gene locus_tag LOCUS_02210 19254 18595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 19444 21828 gene locus_tag LOCUS_02220 19444 21828 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527693.1 protein_id gnl|my_center|LOCUS_02220 22958 21912 gene locus_tag LOCUS_02230 22958 21912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 23330 23659 gene locus_tag LOCUS_02240 23330 23659 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080382.1 protein_id gnl|my_center|LOCUS_02240 23666 24562 gene locus_tag LOCUS_02250 23666 24562 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680667.1 protein_id gnl|my_center|LOCUS_02250 25458 24559 gene locus_tag LOCUS_02260 25458 24559 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_02260 25549 26472 gene locus_tag LOCUS_02270 25549 26472 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584158.1 protein_id gnl|my_center|LOCUS_02270 27433 26477 gene locus_tag LOCUS_02280 gene rsgA 27433 26477 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679106.1 protein_id gnl|my_center|LOCUS_02280 27572 27646 gene locus_tag LOCUS_t00090 27572 27646 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29825 27792 gene locus_tag LOCUS_02290 gene fusA 29825 27792 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681223.1 protein_id gnl|my_center|LOCUS_02290 30010 31035 gene locus_tag LOCUS_02300 30010 31035 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102241.1 protein_id gnl|my_center|LOCUS_02300 31077 33065 gene locus_tag LOCUS_02310 31077 33065 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_02310 33059 33901 gene locus_tag LOCUS_02320 gene rlmJ 33059 33901 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 protein_id gnl|my_center|LOCUS_02320 34722 33904 gene locus_tag LOCUS_02330 34722 33904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679875.1 protein_id gnl|my_center|LOCUS_02330 35389 34715 gene locus_tag LOCUS_02340 35389 34715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 36997 35450 gene locus_tag LOCUS_02350 36997 35450 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_02350 39355 37010 gene locus_tag LOCUS_02360 gene rpsA 39355 37010 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679883.1 protein_id gnl|my_center|LOCUS_02360 40112 39369 gene locus_tag LOCUS_02370 40112 39369 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682155.1 protein_id gnl|my_center|LOCUS_02370 40761 40102 gene locus_tag LOCUS_02380 gene scpB 40761 40102 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672067.1 protein_id gnl|my_center|LOCUS_02380 41492 40737 gene locus_tag LOCUS_02390 41492 40737 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670199.1 protein_id gnl|my_center|LOCUS_02390 42021 41515 gene locus_tag LOCUS_02400 42021 41515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 43295 42027 gene locus_tag LOCUS_02410 gene recA 43295 42027 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682153.1 protein_id gnl|my_center|LOCUS_02410 43681 44526 gene locus_tag LOCUS_02420 43681 44526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 44928 45098 gene locus_tag LOCUS_02430 44928 45098 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670897.1 protein_id gnl|my_center|LOCUS_02430 45161 46048 gene locus_tag LOCUS_02440 45161 46048 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679456.1 protein_id gnl|my_center|LOCUS_02440 46192 47100 gene locus_tag LOCUS_02450 46192 47100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 47490 47789 gene locus_tag LOCUS_02460 47490 47789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 48517 47804 gene locus_tag LOCUS_02470 48517 47804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 48709 50226 gene locus_tag LOCUS_02480 48709 50226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 50228 51856 gene locus_tag LOCUS_02490 50228 51856 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680487.1 protein_id gnl|my_center|LOCUS_02490 53665 51860 gene locus_tag LOCUS_02500 gene lepA 53665 51860 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_02500 55361 53697 gene locus_tag LOCUS_02510 55361 53697 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678901.1 protein_id gnl|my_center|LOCUS_02510 57381 55345 gene locus_tag LOCUS_02520 57381 55345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 58811 57459 gene locus_tag LOCUS_02530 gene tilS 58811 57459 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678896.1 protein_id gnl|my_center|LOCUS_02530 59480 58926 gene locus_tag LOCUS_02540 59480 58926 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889819.1 protein_id gnl|my_center|LOCUS_02540 59592 59518 gene locus_tag LOCUS_t00100 59592 59518 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 59891 59613 gene locus_tag LOCUS_02550 gene spoVG 59891 59613 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_02550 60875 59988 gene locus_tag LOCUS_02560 gene ispE 60875 59988 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_02560 61043 61336 gene locus_tag LOCUS_02570 61043 61336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 62645 61428 gene locus_tag LOCUS_02580 62645 61428 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671534.1 protein_id gnl|my_center|LOCUS_02580 63445 62645 gene locus_tag LOCUS_02590 63445 62645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668611.1 protein_id gnl|my_center|LOCUS_02590 65142 63445 gene locus_tag LOCUS_02600 gene recN 65142 63445 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_02600 65989 65135 gene locus_tag LOCUS_02610 65989 65135 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679270.1 protein_id gnl|my_center|LOCUS_02610 67062 65986 gene locus_tag LOCUS_02620 67062 65986 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679269.1 protein_id gnl|my_center|LOCUS_02620 67667 67176 gene locus_tag LOCUS_02630 67667 67176 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669135.1 protein_id gnl|my_center|LOCUS_02630 68498 67737 gene locus_tag LOCUS_02640 68498 67737 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682284.1 protein_id gnl|my_center|LOCUS_02640 71142 68551 gene locus_tag LOCUS_02650 gene mutS 71142 68551 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920616.1 protein_id gnl|my_center|LOCUS_02650 71743 71210 gene locus_tag LOCUS_02660 71743 71210 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667237.1 protein_id gnl|my_center|LOCUS_02660 74259 71782 gene locus_tag LOCUS_02670 gene bamA 74259 71782 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667239.1 protein_id gnl|my_center|LOCUS_02670 78681 74281 gene locus_tag LOCUS_02680 78681 74281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680585.1 protein_id gnl|my_center|LOCUS_02680 78758 79402 gene locus_tag LOCUS_02690 gene tmk 78758 79402 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_02690 79522 80064 gene locus_tag LOCUS_02700 79522 80064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680583.1 protein_id gnl|my_center|LOCUS_02700 80116 81564 gene locus_tag LOCUS_02710 80116 81564 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_02710 81586 82458 gene locus_tag LOCUS_02720 gene metF 81586 82458 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_02720 82474 85047 gene locus_tag LOCUS_02730 82474 85047 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_02730 85044 85988 gene locus_tag LOCUS_02740 85044 85988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 86791 86000 gene locus_tag LOCUS_02750 86791 86000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 87700 86792 gene locus_tag LOCUS_02760 87700 86792 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681782.1 protein_id gnl|my_center|LOCUS_02760 88587 87886 gene locus_tag LOCUS_02770 gene deoD 88587 87886 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681557.1 protein_id gnl|my_center|LOCUS_02770 89190 88654 gene locus_tag LOCUS_02780 89190 88654 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678446.1 protein_id gnl|my_center|LOCUS_02780 89824 90267 gene locus_tag LOCUS_02790 89824 90267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 90267 91208 gene locus_tag LOCUS_02800 90267 91208 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676765.1 protein_id gnl|my_center|LOCUS_02800 91211 93352 gene locus_tag LOCUS_02810 91211 93352 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681441.1 protein_id gnl|my_center|LOCUS_02810 94275 93382 gene locus_tag LOCUS_02820 94275 93382 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_02820 95373 94339 gene locus_tag LOCUS_02830 gene aroF 95373 94339 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_02830 95868 95641 gene locus_tag LOCUS_02840 95868 95641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 97156 95870 gene locus_tag LOCUS_02850 97156 95870 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_02850 99134 97191 gene locus_tag LOCUS_02860 99134 97191 CDS product ribonuclease catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678953.1 protein_id gnl|my_center|LOCUS_02860 100491 99286 gene locus_tag LOCUS_02870 gene ugpC 100491 99286 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_02870 101114 100584 gene locus_tag LOCUS_02880 101114 100584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence04 221 6 gene locus_tag LOCUS_02890 221 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 297 575 gene locus_tag LOCUS_02900 297 575 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_02900 759 1103 gene locus_tag LOCUS_02910 759 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 1177 1251 gene locus_tag LOCUS_t00110 1177 1251 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1258 1332 gene locus_tag LOCUS_t00120 1258 1332 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1499 1840 gene locus_tag LOCUS_02920 1499 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1854 2969 gene locus_tag LOCUS_02930 1854 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 6248 3048 gene locus_tag LOCUS_02940 6248 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 15918 6271 gene locus_tag LOCUS_02950 15918 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 16891 15959 gene locus_tag LOCUS_02960 16891 15959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 18005 16896 gene locus_tag LOCUS_02970 18005 16896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 18862 18116 gene locus_tag LOCUS_02980 18862 18116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 19085 19546 gene locus_tag LOCUS_02990 19085 19546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 19543 20250 gene locus_tag LOCUS_03000 19543 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 20316 21128 gene locus_tag LOCUS_03010 20316 21128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 21079 21342 gene locus_tag LOCUS_03020 21079 21342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 23365 21413 gene locus_tag LOCUS_03030 23365 21413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 24351 23386 gene locus_tag LOCUS_03040 24351 23386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 26950 24377 gene locus_tag LOCUS_03050 gene trbE 26950 24377 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 protein_id gnl|my_center|LOCUS_03050 27216 26950 gene locus_tag LOCUS_03060 27216 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 27714 27289 gene locus_tag LOCUS_03070 27714 27289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 28852 27875 gene locus_tag LOCUS_03080 gene trbB 28852 27875 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 protein_id gnl|my_center|LOCUS_03080 29289 28849 gene locus_tag LOCUS_03090 29289 28849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 30059 29286 gene locus_tag LOCUS_03100 30059 29286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 32219 30072 gene locus_tag LOCUS_03110 32219 30072 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_03110 32397 32636 gene locus_tag LOCUS_03120 32397 32636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 32792 33109 gene locus_tag LOCUS_03130 32792 33109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 33229 33462 gene locus_tag LOCUS_03140 33229 33462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 33459 34103 gene locus_tag LOCUS_03150 33459 34103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 34155 34862 gene locus_tag LOCUS_03160 34155 34862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 34883 36430 gene locus_tag LOCUS_03170 34883 36430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 42476 36531 gene locus_tag LOCUS_03180 42476 36531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 44004 42607 gene locus_tag LOCUS_03190 44004 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 45088 43994 gene locus_tag LOCUS_03200 45088 43994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 45795 45085 gene locus_tag LOCUS_03210 gene trbF 45795 45085 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090989.1 protein_id gnl|my_center|LOCUS_03210 47101 45908 gene locus_tag LOCUS_03220 47101 45908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 47599 47117 gene locus_tag LOCUS_03230 47599 47117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 48201 47602 gene locus_tag LOCUS_03240 48201 47602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 48840 48220 gene locus_tag LOCUS_03250 48840 48220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 50327 48972 gene locus_tag LOCUS_03260 50327 48972 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072910.1 protein_id gnl|my_center|LOCUS_03260 50636 50337 gene locus_tag LOCUS_03270 50636 50337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 51234 50647 gene locus_tag LOCUS_03280 51234 50647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 51739 53826 gene locus_tag LOCUS_03290 51739 53826 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948909.1 protein_id gnl|my_center|LOCUS_03290 54137 54394 gene locus_tag LOCUS_03300 54137 54394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 54391 54651 gene locus_tag LOCUS_03310 54391 54651 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681985.1 protein_id gnl|my_center|LOCUS_03310 54905 55117 gene locus_tag LOCUS_03320 54905 55117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 55086 55352 gene locus_tag LOCUS_03330 55086 55352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 56353 55496 gene locus_tag LOCUS_03340 56353 55496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 56757 56392 gene locus_tag LOCUS_03350 56757 56392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 57067 56771 gene locus_tag LOCUS_03360 57067 56771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 57301 57068 gene locus_tag LOCUS_03370 57301 57068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 57642 57298 gene locus_tag LOCUS_03380 57642 57298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 57917 57639 gene locus_tag LOCUS_03390 57917 57639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 58390 57920 gene locus_tag LOCUS_03400 58390 57920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 59760 58654 gene locus_tag LOCUS_03410 59760 58654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 59993 59757 gene locus_tag LOCUS_03420 59993 59757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 60131 60012 gene locus_tag LOCUS_03430 60131 60012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 60652 60128 gene locus_tag LOCUS_03440 60652 60128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 60859 60656 gene locus_tag LOCUS_03450 60859 60656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 61405 61034 gene locus_tag LOCUS_03460 61405 61034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 61863 61402 gene locus_tag LOCUS_03470 61863 61402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 62203 61886 gene locus_tag LOCUS_03480 62203 61886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 62583 62200 gene locus_tag LOCUS_03490 62583 62200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 62804 62580 gene locus_tag LOCUS_03500 62804 62580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 63600 62818 gene locus_tag LOCUS_03510 63600 62818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 63873 63604 gene locus_tag LOCUS_03520 63873 63604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 64100 63870 gene locus_tag LOCUS_03530 64100 63870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 64207 64058 gene locus_tag LOCUS_03540 64207 64058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 64566 64222 gene locus_tag LOCUS_03550 64566 64222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 64963 64571 gene locus_tag LOCUS_03560 64963 64571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 66111 64960 gene locus_tag LOCUS_03570 66111 64960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 66924 66151 gene locus_tag LOCUS_03580 66924 66151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 68222 67341 gene locus_tag LOCUS_03590 68222 67341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 68372 68446 gene locus_tag LOCUS_t00130 68372 68446 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 68501 68677 gene locus_tag LOCUS_03600 68501 68677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 68734 69771 gene locus_tag LOCUS_03610 68734 69771 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_03610 69778 70332 gene locus_tag LOCUS_03620 69778 70332 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586895.1 protein_id gnl|my_center|LOCUS_03620 70352 71464 gene locus_tag LOCUS_03630 70352 71464 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679607.1 protein_id gnl|my_center|LOCUS_03630 72905 71451 gene locus_tag LOCUS_03640 72905 71451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 73208 72993 gene locus_tag LOCUS_03650 gene rpmE 73208 72993 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_03650 73413 74066 gene locus_tag LOCUS_03660 73413 74066 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_03660 74166 75362 gene locus_tag LOCUS_03670 74166 75362 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680626.1 protein_id gnl|my_center|LOCUS_03670 75506 77092 gene locus_tag LOCUS_03680 75506 77092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 77260 78963 gene locus_tag LOCUS_03690 77260 78963 CDS product P83/100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680732.1 protein_id gnl|my_center|LOCUS_03690 80618 79041 gene locus_tag LOCUS_03700 gene glgA 80618 79041 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863328.1 protein_id gnl|my_center|LOCUS_03700 81000 80620 gene locus_tag LOCUS_03710 gene aroH 81000 80620 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679161.1 protein_id gnl|my_center|LOCUS_03710 81847 81017 gene locus_tag LOCUS_03720 81847 81017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957243.1 protein_id gnl|my_center|LOCUS_03720 82963 82277 gene locus_tag LOCUS_03730 82963 82277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 82890 84407 gene locus_tag LOCUS_03740 82890 84407 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_03740 85160 84414 gene locus_tag LOCUS_03750 gene rnc 85160 84414 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_03750 85551 85315 gene locus_tag LOCUS_03760 gene acpP 85551 85315 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670497.1 protein_id gnl|my_center|LOCUS_03760 85754 85566 gene locus_tag LOCUS_03770 gene rpmF 85754 85566 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670496.1 protein_id gnl|my_center|LOCUS_03770 86400 85903 gene locus_tag LOCUS_03780 gene coaD 86400 85903 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678956.1 protein_id gnl|my_center|LOCUS_03780 86716 87312 gene locus_tag LOCUS_03790 86716 87312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 87382 88119 gene locus_tag LOCUS_03800 87382 88119 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674261.1 protein_id gnl|my_center|LOCUS_03800 88345 88272 gene locus_tag LOCUS_t00140 88345 88272 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 88404 88994 gene locus_tag LOCUS_03810 88404 88994 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680263.1 protein_id gnl|my_center|LOCUS_03810 89130 89996 gene locus_tag LOCUS_03820 gene rpsB 89130 89996 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680262.1 protein_id gnl|my_center|LOCUS_03820 90016 90852 gene locus_tag LOCUS_03830 gene tsf 90016 90852 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674264.1 protein_id gnl|my_center|LOCUS_03830 90942 91481 gene locus_tag LOCUS_03840 gene frr 90942 91481 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675802.1 protein_id gnl|my_center|LOCUS_03840 91487 92200 gene locus_tag LOCUS_03850 gene uppS 91487 92200 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675801.1 protein_id gnl|my_center|LOCUS_03850 92197 93078 gene locus_tag LOCUS_03860 92197 93078 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667742.1 protein_id gnl|my_center|LOCUS_03860 93078 94193 gene locus_tag LOCUS_03870 gene dxr 93078 94193 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680260.1 protein_id gnl|my_center|LOCUS_03870 94190 95302 gene locus_tag LOCUS_03880 gene rseP 94190 95302 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_03880 95312 97264 gene locus_tag LOCUS_03890 95312 97264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 98975 97335 gene locus_tag LOCUS_03900 98975 97335 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669145.1 protein_id gnl|my_center|LOCUS_03900 100595 98991 gene locus_tag LOCUS_03910 100595 98991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence05 1506 154 gene locus_tag LOCUS_03920 1506 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1986 1582 gene locus_tag LOCUS_03930 1986 1582 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_03930 2297 1986 gene locus_tag LOCUS_03940 2297 1986 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256312.1 protein_id gnl|my_center|LOCUS_03940 3078 2329 gene locus_tag LOCUS_03950 3078 2329 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_03950 3283 3654 gene locus_tag LOCUS_03960 3283 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 3707 5026 gene locus_tag LOCUS_03970 gene carA 3707 5026 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460017.1 protein_id gnl|my_center|LOCUS_03970 5088 9323 gene locus_tag LOCUS_03980 gene carB 5088 9323 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_03980 11292 9397 gene locus_tag LOCUS_03990 11292 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 13601 11397 gene locus_tag LOCUS_04000 13601 11397 CDS product TIGR03545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957002.1 protein_id gnl|my_center|LOCUS_04000 14119 13598 gene locus_tag LOCUS_04010 14119 13598 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679252.1 protein_id gnl|my_center|LOCUS_04010 14247 14175 gene locus_tag LOCUS_t00150 14247 14175 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14427 15290 gene locus_tag LOCUS_04020 14427 15290 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_04020 15535 16746 gene locus_tag LOCUS_04030 15535 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 16787 18259 gene locus_tag LOCUS_04040 16787 18259 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678947.1 protein_id gnl|my_center|LOCUS_04040 18281 18649 gene locus_tag LOCUS_04050 gene lrgA 18281 18649 CDS product antiholin-like murein hydrolase modulator LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399155.1 protein_id gnl|my_center|LOCUS_04050 18652 19347 gene locus_tag LOCUS_04060 18652 19347 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_04060 19480 20313 gene locus_tag LOCUS_04070 gene proB 19480 20313 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_04070 20310 21089 gene locus_tag LOCUS_04080 gene proC 20310 21089 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783010.1 protein_id gnl|my_center|LOCUS_04080 21913 21092 gene locus_tag LOCUS_04090 21913 21092 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680882.1 protein_id gnl|my_center|LOCUS_04090 23298 21916 gene locus_tag LOCUS_04100 23298 21916 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_04100 23417 24820 gene locus_tag LOCUS_04110 23417 24820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 24826 25296 gene locus_tag LOCUS_04120 24826 25296 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_04120 25384 26301 gene locus_tag LOCUS_04130 25384 26301 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235901447.1 protein_id gnl|my_center|LOCUS_04130 26410 27690 gene locus_tag LOCUS_04140 26410 27690 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_04140 27855 28733 gene locus_tag LOCUS_04150 gene pdxS 27855 28733 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_04150 28730 29287 gene locus_tag LOCUS_04160 gene pdxT 28730 29287 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461704.1 protein_id gnl|my_center|LOCUS_04160 30694 29297 gene locus_tag LOCUS_04170 gene cls 30694 29297 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_04170 31032 34973 gene locus_tag LOCUS_04180 31032 34973 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_04180 34978 35973 gene locus_tag LOCUS_04190 34978 35973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 35973 37247 gene locus_tag LOCUS_04200 35973 37247 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681281.1 protein_id gnl|my_center|LOCUS_04200 37244 38509 gene locus_tag LOCUS_04210 37244 38509 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_04210 39154 38504 gene locus_tag LOCUS_04220 39154 38504 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_04220 39969 39223 gene locus_tag LOCUS_04230 39969 39223 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_04230 40784 40014 gene locus_tag LOCUS_04240 40784 40014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_04240 41740 40772 gene locus_tag LOCUS_04250 41740 40772 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844765.1 protein_id gnl|my_center|LOCUS_04250 42591 41749 gene locus_tag LOCUS_04260 42591 41749 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_04260 43278 42592 gene locus_tag LOCUS_04270 gene pyrE 43278 42592 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_04270 45792 43366 gene locus_tag LOCUS_04280 45792 43366 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583018.1 protein_id gnl|my_center|LOCUS_04280 46075 47379 gene locus_tag LOCUS_04290 46075 47379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_04290 47481 48440 gene locus_tag LOCUS_04300 47481 48440 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311850.1 protein_id gnl|my_center|LOCUS_04300 48456 49295 gene locus_tag LOCUS_04310 gene araQ 48456 49295 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_04310 49320 50915 gene locus_tag LOCUS_04320 49320 50915 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240529.1 protein_id gnl|my_center|LOCUS_04320 51035 52048 gene locus_tag LOCUS_04330 51035 52048 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_04330 52101 52171 gene locus_tag LOCUS_t00160 52101 52171 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 52214 52525 gene locus_tag LOCUS_04340 52214 52525 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669078.1 protein_id gnl|my_center|LOCUS_04340 52529 53116 gene locus_tag LOCUS_04350 gene recR 52529 53116 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_04350 53172 54140 gene locus_tag LOCUS_04360 53172 54140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 54137 56041 gene locus_tag LOCUS_04370 54137 56041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 57306 56038 gene locus_tag LOCUS_04380 57306 56038 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582595.1 protein_id gnl|my_center|LOCUS_04380 57965 57303 gene locus_tag LOCUS_04390 gene rsmG 57965 57303 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957250.1 protein_id gnl|my_center|LOCUS_04390 58852 57968 gene locus_tag LOCUS_04400 58852 57968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 59648 58839 gene locus_tag LOCUS_04410 59648 58839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 59910 60875 gene locus_tag LOCUS_04420 59910 60875 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680524.1 protein_id gnl|my_center|LOCUS_04420 61584 62267 gene locus_tag LOCUS_04430 61584 62267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 62285 63289 gene locus_tag LOCUS_04440 62285 63289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 63681 65135 gene locus_tag LOCUS_04450 63681 65135 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003289.1 protein_id gnl|my_center|LOCUS_04450 65132 65941 gene locus_tag LOCUS_04460 65132 65941 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679573.1 protein_id gnl|my_center|LOCUS_04460 65943 66683 gene locus_tag LOCUS_04470 65943 66683 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675248.1 protein_id gnl|my_center|LOCUS_04470 66690 67751 gene locus_tag LOCUS_04480 66690 67751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 68466 67738 gene locus_tag LOCUS_04490 68466 67738 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679885.1 protein_id gnl|my_center|LOCUS_04490 69027 68479 gene locus_tag LOCUS_04500 69027 68479 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668265.1 protein_id gnl|my_center|LOCUS_04500 69219 70532 gene locus_tag LOCUS_04510 gene hisD 69219 70532 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861261.1 protein_id gnl|my_center|LOCUS_04510 70525 71130 gene locus_tag LOCUS_04520 70525 71130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 71131 72144 gene locus_tag LOCUS_04530 gene fmt 71131 72144 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679327.1 protein_id gnl|my_center|LOCUS_04530 72148 73179 gene locus_tag LOCUS_04540 72148 73179 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678383.1 protein_id gnl|my_center|LOCUS_04540 74713 73367 gene locus_tag LOCUS_04550 74713 73367 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_04550 74862 75965 gene locus_tag LOCUS_04560 74862 75965 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_04560 76812 75970 gene locus_tag LOCUS_04570 76812 75970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948946.1 protein_id gnl|my_center|LOCUS_04570 76886 78952 gene locus_tag LOCUS_04580 76886 78952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 79010 79933 gene locus_tag LOCUS_04590 gene pyrB 79010 79933 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_04590 79933 80370 gene locus_tag LOCUS_04600 79933 80370 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_04600 81574 80597 gene locus_tag LOCUS_04610 gene bioB 81574 80597 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016821.1 protein_id gnl|my_center|LOCUS_04610 82256 81567 gene locus_tag LOCUS_04620 82256 81567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 82963 82247 gene locus_tag LOCUS_04630 82963 82247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679334.1 protein_id gnl|my_center|LOCUS_04630 83539 82967 gene locus_tag LOCUS_04640 83539 82967 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679338.1 protein_id gnl|my_center|LOCUS_04640 84297 83707 gene locus_tag LOCUS_04650 84297 83707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 85368 84427 gene locus_tag LOCUS_04660 85368 84427 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_04660 86298 85405 gene locus_tag LOCUS_04670 86298 85405 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_04670 86396 86689 gene locus_tag LOCUS_04680 86396 86689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 86686 87243 gene locus_tag LOCUS_04690 86686 87243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 88259 87240 gene locus_tag LOCUS_04700 88259 87240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 89280 88261 gene locus_tag LOCUS_04710 89280 88261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence06 1657 1581 gene locus_tag LOCUS_t00170 1657 1581 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2273 1701 gene locus_tag LOCUS_04720 gene efp 2273 1701 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897833.1 protein_id gnl|my_center|LOCUS_04720 3565 2375 gene locus_tag LOCUS_04730 gene earP 3565 2375 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016605.1 protein_id gnl|my_center|LOCUS_04730 3664 5229 gene locus_tag LOCUS_04740 3664 5229 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679741.1 protein_id gnl|my_center|LOCUS_04740 5345 5260 gene locus_tag LOCUS_t00180 5345 5260 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5549 7111 gene locus_tag LOCUS_04750 5549 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 8847 7159 gene locus_tag LOCUS_04760 8847 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 9949 8882 gene locus_tag LOCUS_04770 gene tgt 9949 8882 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681512.1 protein_id gnl|my_center|LOCUS_04770 11113 10043 gene locus_tag LOCUS_04780 11113 10043 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682352.1 protein_id gnl|my_center|LOCUS_04780 12453 11110 gene locus_tag LOCUS_04790 12453 11110 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670521.1 protein_id gnl|my_center|LOCUS_04790 12902 12459 gene locus_tag LOCUS_04800 gene dut 12902 12459 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_04800 14173 12887 gene locus_tag LOCUS_04810 14173 12887 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438321.1 protein_id gnl|my_center|LOCUS_04810 16371 14281 gene locus_tag LOCUS_04820 gene pnp 16371 14281 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682350.1 protein_id gnl|my_center|LOCUS_04820 16847 16578 gene locus_tag LOCUS_04830 gene rpsO 16847 16578 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671840.1 protein_id gnl|my_center|LOCUS_04830 18862 17009 gene locus_tag LOCUS_04840 18862 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 19244 18840 gene locus_tag LOCUS_04850 gene rbfA 19244 18840 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670660.1 protein_id gnl|my_center|LOCUS_04850 21991 19256 gene locus_tag LOCUS_04860 21991 19256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 23464 22010 gene locus_tag LOCUS_04870 gene nusA 23464 22010 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682413.1 protein_id gnl|my_center|LOCUS_04870 23943 23476 gene locus_tag LOCUS_04880 gene rimP 23943 23476 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670663.1 protein_id gnl|my_center|LOCUS_04880 24369 24959 gene locus_tag LOCUS_04890 24369 24959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 25001 25648 gene locus_tag LOCUS_04900 25001 25648 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 protein_id gnl|my_center|LOCUS_04900 25678 26709 gene locus_tag LOCUS_04910 gene sppA 25678 26709 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_04910 27278 26700 gene locus_tag LOCUS_04920 27278 26700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 27709 27317 gene locus_tag LOCUS_04930 gene rpsI 27709 27317 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682117.1 protein_id gnl|my_center|LOCUS_04930 28152 27724 gene locus_tag LOCUS_04940 gene rplM 28152 27724 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682116.1 protein_id gnl|my_center|LOCUS_04940 28562 28341 gene locus_tag LOCUS_04950 28562 28341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 29169 28633 gene locus_tag LOCUS_04960 29169 28633 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_04960 29611 29279 gene locus_tag LOCUS_04970 29611 29279 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928535.1 protein_id gnl|my_center|LOCUS_04970 30363 29608 gene locus_tag LOCUS_04980 30363 29608 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_04980 30604 31794 gene locus_tag LOCUS_04990 30604 31794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_04990 31791 32810 gene locus_tag LOCUS_05000 31791 32810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_05000 32807 33679 gene locus_tag LOCUS_05010 32807 33679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_05010 33738 34781 gene locus_tag LOCUS_05020 33738 34781 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_05020 34783 36174 gene locus_tag LOCUS_05030 gene aroA 34783 36174 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679391.1 protein_id gnl|my_center|LOCUS_05030 36343 36209 gene locus_tag LOCUS_05040 36343 36209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 36889 36428 gene locus_tag LOCUS_05050 36889 36428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05050 37489 37019 gene locus_tag LOCUS_05060 37489 37019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 38000 39070 gene locus_tag LOCUS_05070 38000 39070 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_05070 39299 39799 gene locus_tag LOCUS_05080 39299 39799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05080 39818 40420 gene locus_tag LOCUS_05090 39818 40420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05090 40623 41030 gene locus_tag LOCUS_05100 40623 41030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 41256 42191 gene locus_tag LOCUS_05110 41256 42191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 42217 43071 gene locus_tag LOCUS_05120 42217 43071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 44548 43271 gene locus_tag LOCUS_05130 44548 43271 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 protein_id gnl|my_center|LOCUS_05130 47135 44568 gene locus_tag LOCUS_05140 47135 44568 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679812.1 protein_id gnl|my_center|LOCUS_05140 48257 47145 gene locus_tag LOCUS_05150 48257 47145 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_05150 48793 48257 gene locus_tag LOCUS_05160 48793 48257 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732822.1 protein_id gnl|my_center|LOCUS_05160 50175 48832 gene locus_tag LOCUS_05170 50175 48832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679814.1 protein_id gnl|my_center|LOCUS_05170 50864 50172 gene locus_tag LOCUS_05180 50864 50172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668339.1 protein_id gnl|my_center|LOCUS_05180 52137 50857 gene locus_tag LOCUS_05190 52137 50857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679815.1 protein_id gnl|my_center|LOCUS_05190 53024 52158 gene locus_tag LOCUS_05200 53024 52158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 53899 53024 gene locus_tag LOCUS_05210 gene ftsY 53899 53024 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_05210 55446 53920 gene locus_tag LOCUS_05220 55446 53920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 56672 55581 gene locus_tag LOCUS_05230 gene prfB 56672 55581 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096641376.1 protein_id gnl|my_center|LOCUS_05230 57022 56732 gene locus_tag LOCUS_05240 57022 56732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668328.1 protein_id gnl|my_center|LOCUS_05240 57296 58336 gene locus_tag LOCUS_05250 57296 58336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 59309 58746 gene locus_tag LOCUS_05260 59309 58746 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_05260 59804 59310 gene locus_tag LOCUS_05270 59804 59310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 60727 59807 gene locus_tag LOCUS_05280 60727 59807 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_05280 61699 60860 gene locus_tag LOCUS_05290 61699 60860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 62375 61701 gene locus_tag LOCUS_05300 62375 61701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 63396 62410 gene locus_tag LOCUS_05310 63396 62410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 63556 63888 gene locus_tag LOCUS_05320 63556 63888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 64062 65204 gene locus_tag LOCUS_05330 64062 65204 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939569.1 protein_id gnl|my_center|LOCUS_05330 65265 66947 gene locus_tag LOCUS_05340 gene sulP 65265 66947 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108696.1 protein_id gnl|my_center|LOCUS_05340 67031 67957 gene locus_tag LOCUS_05350 gene era 67031 67957 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679589.1 protein_id gnl|my_center|LOCUS_05350 68071 69201 gene locus_tag LOCUS_05360 gene ychF 68071 69201 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666350.1 protein_id gnl|my_center|LOCUS_05360 70572 69250 gene locus_tag LOCUS_05370 70572 69250 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188230548.1 protein_id gnl|my_center|LOCUS_05370 71410 70580 gene locus_tag LOCUS_05380 71410 70580 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_05380 71511 72968 gene locus_tag LOCUS_05390 71511 72968 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_05390 73570 72992 gene locus_tag LOCUS_05400 73570 72992 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_05400 75524 73614 gene locus_tag LOCUS_05410 75524 73614 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289096.1 protein_id gnl|my_center|LOCUS_05410 77051 75585 gene locus_tag LOCUS_05420 77051 75585 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680143.1 protein_id gnl|my_center|LOCUS_05420 78011 77055 gene locus_tag LOCUS_05430 78011 77055 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680147.1 protein_id gnl|my_center|LOCUS_05430 78060 78974 gene locus_tag LOCUS_05440 gene metA 78060 78974 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121536.1 protein_id gnl|my_center|LOCUS_05440 79057 79248 gene locus_tag LOCUS_05450 79057 79248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 79635 80579 gene locus_tag LOCUS_05460 gene yhdJ 79635 80579 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258898.1 protein_id gnl|my_center|LOCUS_05460 81946 80585 gene locus_tag LOCUS_05470 81946 80585 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002635.1 protein_id gnl|my_center|LOCUS_05470 82098 82337 gene locus_tag LOCUS_05480 82098 82337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence07 214 1731 gene locus_tag LOCUS_05490 gene putP 214 1731 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_05490 2044 3018 gene locus_tag LOCUS_05500 2044 3018 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940885.1 protein_id gnl|my_center|LOCUS_05500 3027 3944 gene locus_tag LOCUS_05510 3027 3944 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940886.1 protein_id gnl|my_center|LOCUS_05510 3941 4744 gene locus_tag LOCUS_05520 3941 4744 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647756.1 protein_id gnl|my_center|LOCUS_05520 4800 6029 gene locus_tag LOCUS_05530 4800 6029 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670666.1 protein_id gnl|my_center|LOCUS_05530 6031 6795 gene locus_tag LOCUS_05540 6031 6795 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_05540 6797 8041 gene locus_tag LOCUS_05550 6797 8041 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061338.1 protein_id gnl|my_center|LOCUS_05550 8691 8038 gene locus_tag LOCUS_05560 8691 8038 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 protein_id gnl|my_center|LOCUS_05560 9707 8688 gene locus_tag LOCUS_05570 9707 8688 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622979.1 protein_id gnl|my_center|LOCUS_05570 10728 9811 gene locus_tag LOCUS_05580 10728 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 10850 11650 gene locus_tag LOCUS_05590 10850 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 11719 13452 gene locus_tag LOCUS_05600 11719 13452 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 protein_id gnl|my_center|LOCUS_05600 14184 13753 gene locus_tag LOCUS_05610 14184 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 14478 15839 gene locus_tag LOCUS_05620 14478 15839 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963801.1 protein_id gnl|my_center|LOCUS_05620 16063 16971 gene locus_tag LOCUS_05630 gene pyrF 16063 16971 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361662.1 protein_id gnl|my_center|LOCUS_05630 17022 18797 gene locus_tag LOCUS_05640 17022 18797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 19390 19022 gene locus_tag LOCUS_05650 19390 19022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 19939 19394 gene locus_tag LOCUS_05660 gene lspA 19939 19394 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680623.1 protein_id gnl|my_center|LOCUS_05660 20026 20583 gene locus_tag LOCUS_05670 gene yfcE 20026 20583 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_05670 21598 20555 gene locus_tag LOCUS_05680 21598 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 22704 21595 gene locus_tag LOCUS_05690 22704 21595 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_05690 23573 22761 gene locus_tag LOCUS_05700 23573 22761 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673320.1 protein_id gnl|my_center|LOCUS_05700 24727 23573 gene locus_tag LOCUS_05710 24727 23573 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676322.1 protein_id gnl|my_center|LOCUS_05710 25091 24804 gene locus_tag LOCUS_05720 25091 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 25764 25063 gene locus_tag LOCUS_05730 gene rsmI 25764 25063 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681097.1 protein_id gnl|my_center|LOCUS_05730 26005 28851 gene locus_tag LOCUS_05740 26005 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 28871 29827 gene locus_tag LOCUS_05750 28871 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 31541 29835 gene locus_tag LOCUS_05760 31541 29835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680819.1 protein_id gnl|my_center|LOCUS_05760 31734 32513 gene locus_tag LOCUS_05770 31734 32513 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_05770 34069 32729 gene locus_tag LOCUS_05780 34069 32729 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667136.1 protein_id gnl|my_center|LOCUS_05780 35356 34184 gene locus_tag LOCUS_05790 35356 34184 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_05790 35851 35357 gene locus_tag LOCUS_05800 35851 35357 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_05800 36496 35879 gene locus_tag LOCUS_05810 gene hisB 36496 35879 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_05810 37381 36509 gene locus_tag LOCUS_05820 gene hisG 37381 36509 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_05820 38152 37433 gene locus_tag LOCUS_05830 gene rpiA 38152 37433 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679325.1 protein_id gnl|my_center|LOCUS_05830 39645 38152 gene locus_tag LOCUS_05840 39645 38152 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679324.1 protein_id gnl|my_center|LOCUS_05840 41743 39647 gene locus_tag LOCUS_05850 41743 39647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681085.1 protein_id gnl|my_center|LOCUS_05850 43527 41740 gene locus_tag LOCUS_05860 43527 41740 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680776.1 protein_id gnl|my_center|LOCUS_05860 44021 44563 gene locus_tag LOCUS_05870 gene rbr3B 44021 44563 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966861.1 protein_id gnl|my_center|LOCUS_05870 44601 45044 gene locus_tag LOCUS_05880 44601 45044 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_05880 45706 45047 gene locus_tag LOCUS_05890 45706 45047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 46310 45708 gene locus_tag LOCUS_05900 46310 45708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 47477 46314 gene locus_tag LOCUS_05910 47477 46314 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682240.1 protein_id gnl|my_center|LOCUS_05910 47790 48206 gene locus_tag LOCUS_05920 47790 48206 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691751.1 protein_id gnl|my_center|LOCUS_05920 48720 48217 gene locus_tag LOCUS_05930 48720 48217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 48976 48740 gene locus_tag LOCUS_05940 48976 48740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 49687 49109 gene locus_tag LOCUS_05950 49687 49109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 50178 49684 gene locus_tag LOCUS_05960 50178 49684 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680355.1 protein_id gnl|my_center|LOCUS_05960 50926 50231 gene locus_tag LOCUS_05970 50926 50231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 51535 50942 gene locus_tag LOCUS_05980 51535 50942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 52403 51621 gene locus_tag LOCUS_05990 52403 51621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 52605 53624 gene locus_tag LOCUS_06000 52605 53624 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_06000 53658 55886 gene locus_tag LOCUS_06010 53658 55886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 56625 55981 gene locus_tag LOCUS_06020 56625 55981 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_06020 56918 57118 gene locus_tag LOCUS_06030 56918 57118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 57474 57196 gene locus_tag LOCUS_06040 57474 57196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 58204 57725 gene locus_tag LOCUS_06050 58204 57725 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 protein_id gnl|my_center|LOCUS_06050 58285 59382 gene locus_tag LOCUS_06060 gene rpsA 58285 59382 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_06060 59969 59496 gene locus_tag LOCUS_06070 59969 59496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 60103 60030 gene locus_tag LOCUS_t00190 60103 60030 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 60236 61645 gene locus_tag LOCUS_06080 60236 61645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 64860 62404 gene locus_tag LOCUS_06090 gene gyrA 64860 62404 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681235.1 protein_id gnl|my_center|LOCUS_06090 66794 64869 gene locus_tag LOCUS_06100 gene gyrB 66794 64869 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666949.1 protein_id gnl|my_center|LOCUS_06100 66906 68363 gene locus_tag LOCUS_06110 gene dnaA 66906 68363 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680852.1 protein_id gnl|my_center|LOCUS_06110 68656 69780 gene locus_tag LOCUS_06120 gene dnaN 68656 69780 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681136.1 protein_id gnl|my_center|LOCUS_06120 69798 70919 gene locus_tag LOCUS_06130 gene recF 69798 70919 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681135.1 protein_id gnl|my_center|LOCUS_06130 70916 71458 gene locus_tag LOCUS_06140 70916 71458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 71515 71670 gene locus_tag LOCUS_06150 gene rpmH 71515 71670 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557032.1 protein_id gnl|my_center|LOCUS_06150 72290 74098 gene locus_tag LOCUS_06160 gene yidC 72290 74098 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680325.1 protein_id gnl|my_center|LOCUS_06160 74122 74838 gene locus_tag LOCUS_06170 74122 74838 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667657.1 protein_id gnl|my_center|LOCUS_06170 74869 75645 gene locus_tag LOCUS_06180 74869 75645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 75660 76682 gene locus_tag LOCUS_06190 75660 76682 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_06190 76910 77443 gene locus_tag LOCUS_06200 76910 77443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 77446 78207 gene locus_tag LOCUS_06210 77446 78207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681806.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence08 269 1471 gene locus_tag LOCUS_06220 269 1471 CDS product YidE/YbjL duplication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280515.1 protein_id gnl|my_center|LOCUS_06220 1769 1697 gene locus_tag LOCUS_t00200 1769 1697 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3114 1861 gene locus_tag LOCUS_06230 3114 1861 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679418.1 protein_id gnl|my_center|LOCUS_06230 4295 3210 gene locus_tag LOCUS_06240 4295 3210 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670927.1 protein_id gnl|my_center|LOCUS_06240 4894 4430 gene locus_tag LOCUS_06250 4894 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 5928 4897 gene locus_tag LOCUS_06260 5928 4897 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679426.1 protein_id gnl|my_center|LOCUS_06260 7493 5925 gene locus_tag LOCUS_06270 7493 5925 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680053.1 protein_id gnl|my_center|LOCUS_06270 10063 7529 gene locus_tag LOCUS_06280 10063 7529 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679616.1 protein_id gnl|my_center|LOCUS_06280 11031 10078 gene locus_tag LOCUS_06290 11031 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679623.1 protein_id gnl|my_center|LOCUS_06290 12628 11006 gene locus_tag LOCUS_06300 12628 11006 CDS product spiro-SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679625.1 protein_id gnl|my_center|LOCUS_06300 12686 13900 gene locus_tag LOCUS_06310 gene xseA 12686 13900 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682333.1 protein_id gnl|my_center|LOCUS_06310 13912 14211 gene locus_tag LOCUS_06320 13912 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 14208 16046 gene locus_tag LOCUS_06330 gene mutL 14208 16046 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656028.1 protein_id gnl|my_center|LOCUS_06330 19471 16067 gene locus_tag LOCUS_06340 19471 16067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06340 20444 19446 gene locus_tag LOCUS_06350 20444 19446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 20677 22050 gene locus_tag LOCUS_06360 20677 22050 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670692.1 protein_id gnl|my_center|LOCUS_06360 22047 22817 gene locus_tag LOCUS_06370 22047 22817 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670690.1 protein_id gnl|my_center|LOCUS_06370 22783 23712 gene locus_tag LOCUS_06380 22783 23712 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_06380 23903 25603 gene locus_tag LOCUS_06390 23903 25603 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682419.1 protein_id gnl|my_center|LOCUS_06390 25633 25971 gene locus_tag LOCUS_06400 25633 25971 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670686.1 protein_id gnl|my_center|LOCUS_06400 25983 26534 gene locus_tag LOCUS_06410 25983 26534 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670683.1 protein_id gnl|my_center|LOCUS_06410 26586 26950 gene locus_tag LOCUS_tm00010 26586 26950 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 27321 26992 gene locus_tag LOCUS_06420 27321 26992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 27694 27308 gene locus_tag LOCUS_06430 27694 27308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 28110 27691 gene locus_tag LOCUS_06440 28110 27691 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115312693.1 protein_id gnl|my_center|LOCUS_06440 28559 28119 gene locus_tag LOCUS_06450 28559 28119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 29180 28614 gene locus_tag LOCUS_06460 29180 28614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 30410 29196 gene locus_tag LOCUS_06470 30410 29196 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682130.1 protein_id gnl|my_center|LOCUS_06470 31246 30461 gene locus_tag LOCUS_06480 gene truA 31246 30461 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667863.1 protein_id gnl|my_center|LOCUS_06480 32147 31239 gene locus_tag LOCUS_06490 32147 31239 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667865.1 protein_id gnl|my_center|LOCUS_06490 32559 32176 gene locus_tag LOCUS_06500 gene acpS 32559 32176 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048318.1 protein_id gnl|my_center|LOCUS_06500 33608 32568 gene locus_tag LOCUS_06510 33608 32568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 34401 33574 gene locus_tag LOCUS_06520 gene cdaA 34401 33574 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_06520 35218 34388 gene locus_tag LOCUS_06530 35218 34388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 37134 35215 gene locus_tag LOCUS_06540 gene dxs 37134 35215 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957098.1 protein_id gnl|my_center|LOCUS_06540 38591 37419 gene locus_tag LOCUS_06550 gene hemW 38591 37419 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679120.1 protein_id gnl|my_center|LOCUS_06550 39233 38598 gene locus_tag LOCUS_06560 gene lepB 39233 38598 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668934.1 protein_id gnl|my_center|LOCUS_06560 39619 40083 gene locus_tag LOCUS_06570 gene smpB 39619 40083 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668932.1 protein_id gnl|my_center|LOCUS_06570 40096 40935 gene locus_tag LOCUS_06580 40096 40935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 41506 40925 gene locus_tag LOCUS_06590 41506 40925 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679118.1 protein_id gnl|my_center|LOCUS_06590 41927 41493 gene locus_tag LOCUS_06600 41927 41493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 42153 45176 gene locus_tag LOCUS_06610 42153 45176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 45266 46771 gene locus_tag LOCUS_06620 45266 46771 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679115.1 protein_id gnl|my_center|LOCUS_06620 46768 48255 gene locus_tag LOCUS_06630 46768 48255 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679114.1 protein_id gnl|my_center|LOCUS_06630 48261 49604 gene locus_tag LOCUS_06640 48261 49604 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679113.1 protein_id gnl|my_center|LOCUS_06640 50219 49611 gene locus_tag LOCUS_06650 50219 49611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679299.1 protein_id gnl|my_center|LOCUS_06650 51154 50216 gene locus_tag LOCUS_06660 51154 50216 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680709.1 protein_id gnl|my_center|LOCUS_06660 54367 51185 gene locus_tag LOCUS_06670 gene ileS 54367 51185 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_06670 54928 56085 gene locus_tag LOCUS_06680 54928 56085 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682269.1 protein_id gnl|my_center|LOCUS_06680 56903 56097 gene locus_tag LOCUS_06690 56903 56097 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564427.1 protein_id gnl|my_center|LOCUS_06690 57054 58355 gene locus_tag LOCUS_06700 gene hisS 57054 58355 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679075.1 protein_id gnl|my_center|LOCUS_06700 59004 58534 gene locus_tag LOCUS_06710 gene ribE 59004 58534 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_06710 60248 59034 gene locus_tag LOCUS_06720 60248 59034 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_06720 60849 60238 gene locus_tag LOCUS_06730 60849 60238 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_06730 62024 60852 gene locus_tag LOCUS_06740 gene ribD 62024 60852 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975998.1 protein_id gnl|my_center|LOCUS_06740 62247 64829 gene locus_tag LOCUS_06750 62247 64829 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679459.1 protein_id gnl|my_center|LOCUS_06750 64859 65272 gene locus_tag LOCUS_06760 64859 65272 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668053.1 protein_id gnl|my_center|LOCUS_06760 65390 67042 gene locus_tag LOCUS_06770 65390 67042 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_06770 67482 67039 gene locus_tag LOCUS_06780 67482 67039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 68828 67479 gene locus_tag LOCUS_06790 gene fliI 68828 67479 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678707.1 protein_id gnl|my_center|LOCUS_06790 69894 68962 gene locus_tag LOCUS_06800 gene fliH 69894 68962 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668471.1 protein_id gnl|my_center|LOCUS_06800 70973 69915 gene locus_tag LOCUS_06810 gene fliG 70973 69915 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668469.1 protein_id gnl|my_center|LOCUS_06810 72683 70977 gene locus_tag LOCUS_06820 gene fliF 72683 70977 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678706.1 protein_id gnl|my_center|LOCUS_06820 73292 72942 gene locus_tag LOCUS_06830 73292 72942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 73783 73322 gene locus_tag LOCUS_06840 gene flgC 73783 73322 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657104.1 protein_id gnl|my_center|LOCUS_06840 74235 73816 gene locus_tag LOCUS_06850 gene flgB 74235 73816 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668460.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence09 411 335 gene locus_tag LOCUS_t00210 411 335 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 547 460 gene locus_tag LOCUS_t00220 547 460 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 657 569 gene locus_tag LOCUS_t00230 657 569 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1342 740 gene locus_tag LOCUS_06860 1342 740 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567066.1 protein_id gnl|my_center|LOCUS_06860 1411 2412 gene locus_tag LOCUS_06870 1411 2412 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680574.1 protein_id gnl|my_center|LOCUS_06870 3578 2409 gene locus_tag LOCUS_06880 3578 2409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_06880 3721 5946 gene locus_tag LOCUS_06890 3721 5946 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_06890 6745 5969 gene locus_tag LOCUS_06900 gene rlmB 6745 5969 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679077.1 protein_id gnl|my_center|LOCUS_06900 7559 7056 gene locus_tag LOCUS_06910 7559 7056 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_06910 8876 7635 gene locus_tag LOCUS_06920 8876 7635 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_06920 9457 8873 gene locus_tag LOCUS_06930 9457 8873 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_06930 11295 9469 gene locus_tag LOCUS_06940 gene iorA 11295 9469 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021731.1 protein_id gnl|my_center|LOCUS_06940 11906 11457 gene locus_tag LOCUS_06950 11906 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 12115 13785 gene locus_tag LOCUS_06960 12115 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 13933 15852 gene locus_tag LOCUS_06970 13933 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 15929 17659 gene locus_tag LOCUS_06980 15929 17659 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679009.1 protein_id gnl|my_center|LOCUS_06980 17734 17970 gene locus_tag LOCUS_06990 17734 17970 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_06990 17974 18519 gene locus_tag LOCUS_07000 17974 18519 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669747.1 protein_id gnl|my_center|LOCUS_07000 19091 18516 gene locus_tag LOCUS_07010 gene aroK 19091 18516 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920267.1 protein_id gnl|my_center|LOCUS_07010 19817 19095 gene locus_tag LOCUS_07020 19817 19095 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_07020 21011 19824 gene locus_tag LOCUS_07030 21011 19824 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_07030 22477 21017 gene locus_tag LOCUS_07040 22477 21017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 22661 24436 gene locus_tag LOCUS_07050 22661 24436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682311.1 protein_id gnl|my_center|LOCUS_07050 24583 26013 gene locus_tag LOCUS_07060 24583 26013 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_07060 26139 27677 gene locus_tag LOCUS_07070 26139 27677 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_07070 27681 29810 gene locus_tag LOCUS_07080 27681 29810 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_07080 30297 30076 gene locus_tag LOCUS_07090 gene infA 30297 30076 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_07090 30420 30776 gene locus_tag LOCUS_07100 30420 30776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 31615 30773 gene locus_tag LOCUS_07110 31615 30773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 32876 31632 gene locus_tag LOCUS_07120 32876 31632 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667421.1 protein_id gnl|my_center|LOCUS_07120 32959 33537 gene locus_tag LOCUS_07130 32959 33537 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_07130 34321 33539 gene locus_tag LOCUS_07140 34321 33539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 34883 34338 gene locus_tag LOCUS_07150 34883 34338 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_07150 35122 35049 gene locus_tag LOCUS_t00240 35122 35049 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35883 35239 gene locus_tag LOCUS_07160 35883 35239 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_07160 36596 35886 gene locus_tag LOCUS_07170 36596 35886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_07170 37407 36583 gene locus_tag LOCUS_07180 37407 36583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_07180 38420 37404 gene locus_tag LOCUS_07190 38420 37404 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_07190 39321 38431 gene locus_tag LOCUS_07200 39321 38431 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642246.1 protein_id gnl|my_center|LOCUS_07200 40584 39442 gene locus_tag LOCUS_07210 40584 39442 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_07210 41002 40754 gene locus_tag LOCUS_07220 41002 40754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 41444 41013 gene locus_tag LOCUS_07230 41444 41013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 42487 41441 gene locus_tag LOCUS_07240 42487 41441 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682041.1 protein_id gnl|my_center|LOCUS_07240 42964 42581 gene locus_tag LOCUS_07250 gene rpsK 42964 42581 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670039.1 protein_id gnl|my_center|LOCUS_07250 43345 42977 gene locus_tag LOCUS_07260 gene rpsM 43345 42977 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670034.1 protein_id gnl|my_center|LOCUS_07260 44960 43626 gene locus_tag LOCUS_07270 gene secY 44960 43626 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670031.1 protein_id gnl|my_center|LOCUS_07270 45449 44976 gene locus_tag LOCUS_07280 gene rplO 45449 44976 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682039.1 protein_id gnl|my_center|LOCUS_07280 45631 45449 gene locus_tag LOCUS_07290 gene rpmD 45631 45449 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 protein_id gnl|my_center|LOCUS_07290 46146 45634 gene locus_tag LOCUS_07300 gene rpsE 46146 45634 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670027.1 protein_id gnl|my_center|LOCUS_07300 46517 46155 gene locus_tag LOCUS_07310 gene rplR 46517 46155 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670026.1 protein_id gnl|my_center|LOCUS_07310 47071 46529 gene locus_tag LOCUS_07320 gene rplF 47071 46529 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656835.1 protein_id gnl|my_center|LOCUS_07320 47485 47084 gene locus_tag LOCUS_07330 gene rpsH 47485 47084 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670022.1 protein_id gnl|my_center|LOCUS_07330 47689 47504 gene locus_tag LOCUS_07340 47689 47504 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557082.1 protein_id gnl|my_center|LOCUS_07340 48252 47701 gene locus_tag LOCUS_07350 gene rplE 48252 47701 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670018.1 protein_id gnl|my_center|LOCUS_07350 48575 48252 gene locus_tag LOCUS_07360 gene rplX 48575 48252 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670017.1 protein_id gnl|my_center|LOCUS_07360 48958 48590 gene locus_tag LOCUS_07370 gene rplN 48958 48590 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670011.1 protein_id gnl|my_center|LOCUS_07370 49246 48974 gene locus_tag LOCUS_07380 gene rpsQ 49246 48974 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670009.1 protein_id gnl|my_center|LOCUS_07380 49499 49257 gene locus_tag LOCUS_07390 49499 49257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 49926 49510 gene locus_tag LOCUS_07400 gene rplP 49926 49510 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670003.1 protein_id gnl|my_center|LOCUS_07400 50671 49919 gene locus_tag LOCUS_07410 gene rpsC 50671 49919 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670002.1 protein_id gnl|my_center|LOCUS_07410 51029 50673 gene locus_tag LOCUS_07420 gene rplV 51029 50673 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670000.1 protein_id gnl|my_center|LOCUS_07420 51328 51044 gene locus_tag LOCUS_07430 gene rpsS 51328 51044 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669999.1 protein_id gnl|my_center|LOCUS_07430 52167 51343 gene locus_tag LOCUS_07440 gene rplB 52167 51343 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669998.1 protein_id gnl|my_center|LOCUS_07440 52481 52197 gene locus_tag LOCUS_07450 52481 52197 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672216.1 protein_id gnl|my_center|LOCUS_07450 53119 52481 gene locus_tag LOCUS_07460 gene rplD 53119 52481 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669996.1 protein_id gnl|my_center|LOCUS_07460 53754 53134 gene locus_tag LOCUS_07470 gene rplC 53754 53134 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669995.1 protein_id gnl|my_center|LOCUS_07470 54144 53836 gene locus_tag LOCUS_07480 gene rpsJ 54144 53836 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669994.1 protein_id gnl|my_center|LOCUS_07480 55380 54193 gene locus_tag LOCUS_07490 gene tuf 55380 54193 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669993.1 protein_id gnl|my_center|LOCUS_07490 56573 56103 gene locus_tag LOCUS_07500 gene rpsG 56573 56103 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670537.1 protein_id gnl|my_center|LOCUS_07500 56963 56589 gene locus_tag LOCUS_07510 gene rpsL 56963 56589 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670535.1 protein_id gnl|my_center|LOCUS_07510 61596 57112 gene locus_tag LOCUS_07520 61596 57112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 65146 61589 gene locus_tag LOCUS_07530 gene rpoB 65146 61589 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680361.1 protein_id gnl|my_center|LOCUS_07530 65761 65387 gene locus_tag LOCUS_07540 gene rplL 65761 65387 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466152.1 protein_id gnl|my_center|LOCUS_07540 66527 65931 gene locus_tag LOCUS_07550 gene rplJ 66527 65931 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680363.1 protein_id gnl|my_center|LOCUS_07550 67204 66527 gene locus_tag LOCUS_07560 gene rplA 67204 66527 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667601.1 protein_id gnl|my_center|LOCUS_07560 67638 67204 gene locus_tag LOCUS_07570 gene rplK 67638 67204 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667599.1 protein_id gnl|my_center|LOCUS_07570 68389 67832 gene locus_tag LOCUS_07580 gene nusG 68389 67832 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667597.1 protein_id gnl|my_center|LOCUS_07580 68578 68399 gene locus_tag LOCUS_07590 68578 68399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 68678 68604 gene locus_tag LOCUS_t00250 68678 68604 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 68891 68715 gene locus_tag LOCUS_07600 gene rpmG 68891 68715 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667594.1 protein_id gnl|my_center|LOCUS_07600 68995 68923 gene locus_tag LOCUS_t00260 68995 68923 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 69981 69118 gene locus_tag LOCUS_07610 69981 69118 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_07610 70523 70017 gene locus_tag LOCUS_07620 70523 70017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 70917 70651 gene locus_tag LOCUS_07630 70917 70651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 71209 70889 gene locus_tag LOCUS_07640 71209 70889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence10 1492 446 gene locus_tag LOCUS_07650 1492 446 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013616093.1 protein_id gnl|my_center|LOCUS_07650 2205 1504 gene locus_tag LOCUS_07660 2205 1504 CDS product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677723.1 protein_id gnl|my_center|LOCUS_07660 3471 2302 gene locus_tag LOCUS_07670 3471 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3684 4397 gene locus_tag LOCUS_07680 3684 4397 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_07680 4447 5121 gene locus_tag LOCUS_07690 4447 5121 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_07690 5170 6525 gene locus_tag LOCUS_07700 5170 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 8554 6584 gene locus_tag LOCUS_07710 8554 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 9826 8588 gene locus_tag LOCUS_07720 9826 8588 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_07720 12540 9823 gene locus_tag LOCUS_07730 12540 9823 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_07730 14219 12630 gene locus_tag LOCUS_07740 14219 12630 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682403.1 protein_id gnl|my_center|LOCUS_07740 14863 14231 gene locus_tag LOCUS_07750 14863 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 15252 16988 gene locus_tag LOCUS_07760 gene ilvB 15252 16988 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298157.1 protein_id gnl|my_center|LOCUS_07760 17605 17081 gene locus_tag LOCUS_07770 17605 17081 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_07770 17708 19228 gene locus_tag LOCUS_07780 17708 19228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 19255 19731 gene locus_tag LOCUS_07790 19255 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 19833 21803 gene locus_tag LOCUS_07800 gene tkt 19833 21803 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678841.1 protein_id gnl|my_center|LOCUS_07800 22638 21880 gene locus_tag LOCUS_07810 22638 21880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 23174 23359 gene locus_tag LOCUS_07820 23174 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 23686 23369 gene locus_tag LOCUS_07830 23686 23369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 23802 24452 gene locus_tag LOCUS_07840 23802 24452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 24543 25961 gene locus_tag LOCUS_07850 24543 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 25963 26925 gene locus_tag LOCUS_07860 25963 26925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 26950 28005 gene locus_tag LOCUS_07870 26950 28005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 28027 29859 gene locus_tag LOCUS_07880 28027 29859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 29868 30497 gene locus_tag LOCUS_07890 29868 30497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 30469 32091 gene locus_tag LOCUS_07900 30469 32091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 33366 32131 gene locus_tag LOCUS_07910 33366 32131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 34354 33470 gene locus_tag LOCUS_07920 34354 33470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 34768 34427 gene locus_tag LOCUS_07930 34768 34427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07930 34928 34710 gene locus_tag LOCUS_07940 34928 34710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 35561 35121 gene locus_tag LOCUS_07950 35561 35121 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_07950 36859 35576 gene locus_tag LOCUS_07960 36859 35576 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_07960 36937 37560 gene locus_tag LOCUS_07970 36937 37560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 39983 37536 gene locus_tag LOCUS_07980 39983 37536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 39976 40191 gene locus_tag LOCUS_07990 39976 40191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 40385 42613 gene locus_tag LOCUS_08000 40385 42613 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682106.1 protein_id gnl|my_center|LOCUS_08000 42864 44546 gene locus_tag LOCUS_08010 gene leuA 42864 44546 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_08010 44880 46301 gene locus_tag LOCUS_08020 44880 46301 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679548.1 protein_id gnl|my_center|LOCUS_08020 46301 47587 gene locus_tag LOCUS_08030 46301 47587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 47592 48425 gene locus_tag LOCUS_08040 47592 48425 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679546.1 protein_id gnl|my_center|LOCUS_08040 48427 49722 gene locus_tag LOCUS_08050 48427 49722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 49829 50167 gene locus_tag LOCUS_08060 49829 50167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667116.1 protein_id gnl|my_center|LOCUS_08060 50225 50752 gene locus_tag LOCUS_08070 50225 50752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 50849 51889 gene locus_tag LOCUS_08080 50849 51889 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_08080 51926 52663 gene locus_tag LOCUS_08090 51926 52663 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678965.1 protein_id gnl|my_center|LOCUS_08090 52663 53211 gene locus_tag LOCUS_08100 52663 53211 CDS product DUF2764 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678963.1 protein_id gnl|my_center|LOCUS_08100 53208 54977 gene locus_tag LOCUS_08110 53208 54977 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_08110 54977 56272 gene locus_tag LOCUS_08120 54977 56272 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_08120 56297 56908 gene locus_tag LOCUS_08130 56297 56908 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_08130 56908 58839 gene locus_tag LOCUS_08140 56908 58839 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_08140 58912 59334 gene locus_tag LOCUS_08150 58912 59334 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_08150 59557 60654 gene locus_tag LOCUS_08160 gene ispG 59557 60654 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678768.1 protein_id gnl|my_center|LOCUS_08160 60659 61774 gene locus_tag LOCUS_08170 60659 61774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668541.1 protein_id gnl|my_center|LOCUS_08170 63392 61776 gene locus_tag LOCUS_08180 63392 61776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 64835 63396 gene locus_tag LOCUS_08190 64835 63396 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922333.1 protein_id gnl|my_center|LOCUS_08190 65923 64895 gene locus_tag LOCUS_08200 65923 64895 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_08200 68624 65940 gene locus_tag LOCUS_08210 68624 65940 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_08210 69423 68617 gene locus_tag LOCUS_08220 gene rdgB 69423 68617 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_08220 70340 69426 gene locus_tag LOCUS_08230 70340 69426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence11 2032 350 gene locus_tag LOCUS_08240 2032 350 CDS product galactoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680065.1 protein_id gnl|my_center|LOCUS_08240 3543 2050 gene locus_tag LOCUS_08250 3543 2050 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_08250 4869 3664 gene locus_tag LOCUS_08260 4869 3664 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_08260 5184 6212 gene locus_tag LOCUS_08270 5184 6212 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_08270 8775 6307 gene locus_tag LOCUS_08280 8775 6307 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583019.1 protein_id gnl|my_center|LOCUS_08280 8983 10269 gene locus_tag LOCUS_08290 8983 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 10272 10841 gene locus_tag LOCUS_08300 gene rsmD 10272 10841 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669684.1 protein_id gnl|my_center|LOCUS_08300 10918 11256 gene locus_tag LOCUS_08310 10918 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668283.1 protein_id gnl|my_center|LOCUS_08310 11269 12414 gene locus_tag LOCUS_08320 11269 12414 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679870.1 protein_id gnl|my_center|LOCUS_08320 12424 13452 gene locus_tag LOCUS_08330 gene rlmN 12424 13452 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679871.1 protein_id gnl|my_center|LOCUS_08330 13522 13731 gene locus_tag LOCUS_08340 13522 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 13738 14682 gene locus_tag LOCUS_08350 13738 14682 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_08350 14757 16043 gene locus_tag LOCUS_08360 14757 16043 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_08360 16073 16606 gene locus_tag LOCUS_08370 16073 16606 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_08370 16866 17705 gene locus_tag LOCUS_08380 16866 17705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 17707 19062 gene locus_tag LOCUS_08390 17707 19062 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_08390 19084 20484 gene locus_tag LOCUS_08400 19084 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 20615 22612 gene locus_tag LOCUS_08410 20615 22612 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_08410 23152 22655 gene locus_tag LOCUS_08420 23152 22655 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674498.1 protein_id gnl|my_center|LOCUS_08420 24638 23334 gene locus_tag LOCUS_08430 24638 23334 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_08430 25002 26477 gene locus_tag LOCUS_08440 25002 26477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 28473 26896 gene locus_tag LOCUS_08450 gene gltX 28473 26896 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681104.1 protein_id gnl|my_center|LOCUS_08450 29067 29795 gene locus_tag LOCUS_08460 29067 29795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669611.1 protein_id gnl|my_center|LOCUS_08460 29815 30192 gene locus_tag LOCUS_08470 29815 30192 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 protein_id gnl|my_center|LOCUS_08470 30496 30197 gene locus_tag LOCUS_08480 30496 30197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 31094 30543 gene locus_tag LOCUS_08490 31094 30543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 31284 31075 gene locus_tag LOCUS_08500 31284 31075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 31391 31464 gene locus_tag LOCUS_t00270 31391 31464 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31533 32717 gene locus_tag LOCUS_08510 gene ugd 31533 32717 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 protein_id gnl|my_center|LOCUS_08510 32727 33782 gene locus_tag LOCUS_08520 32727 33782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 33975 34835 gene locus_tag LOCUS_08530 33975 34835 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668952.1 protein_id gnl|my_center|LOCUS_08530 35184 36038 gene locus_tag LOCUS_08540 35184 36038 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668950.1 protein_id gnl|my_center|LOCUS_08540 36185 36562 gene locus_tag LOCUS_08550 36185 36562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 36562 38646 gene locus_tag LOCUS_08560 gene fliD 36562 38646 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679139.1 protein_id gnl|my_center|LOCUS_08560 38656 39255 gene locus_tag LOCUS_08570 38656 39255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 39261 40337 gene locus_tag LOCUS_08580 39261 40337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 40358 40627 gene locus_tag LOCUS_08590 40358 40627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 40644 41090 gene locus_tag LOCUS_08600 gene tsaE 40644 41090 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_08600 41092 41775 gene locus_tag LOCUS_08610 gene tsaB 41092 41775 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978604.1 protein_id gnl|my_center|LOCUS_08610 42014 41796 gene locus_tag LOCUS_08620 gene csrA 42014 41796 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667708.1 protein_id gnl|my_center|LOCUS_08620 42457 42014 gene locus_tag LOCUS_08630 42457 42014 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_08630 43740 42493 gene locus_tag LOCUS_08640 43740 42493 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680271.1 protein_id gnl|my_center|LOCUS_08640 45636 43765 gene locus_tag LOCUS_08650 gene flgK 45636 43765 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957216.1 protein_id gnl|my_center|LOCUS_08650 46095 45652 gene locus_tag LOCUS_08660 46095 45652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 46851 46291 gene locus_tag LOCUS_08670 46851 46291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 47850 47056 gene locus_tag LOCUS_08680 gene flgG 47850 47056 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670463.1 protein_id gnl|my_center|LOCUS_08680 48667 47867 gene locus_tag LOCUS_08690 gene flgF 48667 47867 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_08690 48832 50244 gene locus_tag LOCUS_08700 48832 50244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 50410 51702 gene locus_tag LOCUS_08710 50410 51702 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_08710 53692 51923 gene locus_tag LOCUS_08720 53692 51923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 54361 53945 gene locus_tag LOCUS_08730 54361 53945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 54772 54398 gene locus_tag LOCUS_08740 54772 54398 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669390.1 protein_id gnl|my_center|LOCUS_08740 55054 54776 gene locus_tag LOCUS_08750 gene rpsT 55054 54776 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669392.1 protein_id gnl|my_center|LOCUS_08750 55279 55106 gene locus_tag LOCUS_08760 55279 55106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667639.1 protein_id gnl|my_center|LOCUS_08760 56279 55515 gene locus_tag LOCUS_08770 56279 55515 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679729.1 protein_id gnl|my_center|LOCUS_08770 58319 56307 gene locus_tag LOCUS_08780 58319 56307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 60037 58475 gene locus_tag LOCUS_08790 60037 58475 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682434.1 protein_id gnl|my_center|LOCUS_08790 60548 60045 gene locus_tag LOCUS_08800 60548 60045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 62100 60802 gene locus_tag LOCUS_08810 62100 60802 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_08810 62983 62759 gene locus_tag LOCUS_08820 62983 62759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 63828 63280 gene locus_tag LOCUS_08830 63828 63280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 64106 64330 gene locus_tag LOCUS_08840 64106 64330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence12 2117 270 gene locus_tag LOCUS_08850 2117 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2851 2177 gene locus_tag LOCUS_08860 2851 2177 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680480.1 protein_id gnl|my_center|LOCUS_08860 4001 2877 gene locus_tag LOCUS_08870 gene hisC 4001 2877 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208421.1 protein_id gnl|my_center|LOCUS_08870 5308 4076 gene locus_tag LOCUS_08880 5308 4076 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_08880 6133 5432 gene locus_tag LOCUS_08890 6133 5432 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679167.1 protein_id gnl|my_center|LOCUS_08890 6287 7117 gene locus_tag LOCUS_08900 6287 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 7764 7114 gene locus_tag LOCUS_08910 7764 7114 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680767.1 protein_id gnl|my_center|LOCUS_08910 11111 7767 gene locus_tag LOCUS_08920 11111 7767 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682402.1 protein_id gnl|my_center|LOCUS_08920 11349 11999 gene locus_tag LOCUS_08930 11349 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681839.1 protein_id gnl|my_center|LOCUS_08930 13390 11996 gene locus_tag LOCUS_08940 gene ffh 13390 11996 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668253.1 protein_id gnl|my_center|LOCUS_08940 14470 13415 gene locus_tag LOCUS_08950 14470 13415 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679888.1 protein_id gnl|my_center|LOCUS_08950 15076 14651 gene locus_tag LOCUS_08960 gene ndk 15076 14651 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809738.1 protein_id gnl|my_center|LOCUS_08960 15178 15810 gene locus_tag LOCUS_08970 15178 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 16238 15807 gene locus_tag LOCUS_08980 gene fabZ 16238 15807 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_08980 17490 16243 gene locus_tag LOCUS_08990 gene fabF 17490 16243 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_08990 18287 17544 gene locus_tag LOCUS_09000 gene fabG 18287 17544 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681771.1 protein_id gnl|my_center|LOCUS_09000 19261 18305 gene locus_tag LOCUS_09010 19261 18305 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681776.1 protein_id gnl|my_center|LOCUS_09010 19878 19432 gene locus_tag LOCUS_09020 19878 19432 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_09020 20853 19966 gene locus_tag LOCUS_09030 20853 19966 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_09030 21000 23771 gene locus_tag LOCUS_09040 21000 23771 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_09040 23879 24148 gene locus_tag LOCUS_09050 23879 24148 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_09050 24713 24297 gene locus_tag LOCUS_09060 24713 24297 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963907.1 protein_id gnl|my_center|LOCUS_09060 25290 24721 gene locus_tag LOCUS_09070 25290 24721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 27072 25531 gene locus_tag LOCUS_09080 gene gatB 27072 25531 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681743.1 protein_id gnl|my_center|LOCUS_09080 28580 27075 gene locus_tag LOCUS_09090 gene gatA 28580 27075 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956776.1 protein_id gnl|my_center|LOCUS_09090 28896 28582 gene locus_tag LOCUS_09100 gene gatC 28896 28582 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665812.1 protein_id gnl|my_center|LOCUS_09100 29043 29807 gene locus_tag LOCUS_09110 29043 29807 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679454.1 protein_id gnl|my_center|LOCUS_09110 29827 30606 gene locus_tag LOCUS_09120 gene map 29827 30606 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670900.1 protein_id gnl|my_center|LOCUS_09120 30644 31846 gene locus_tag LOCUS_09130 30644 31846 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_09130 32702 31866 gene locus_tag LOCUS_09140 gene murI 32702 31866 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679098.1 protein_id gnl|my_center|LOCUS_09140 34169 32730 gene locus_tag LOCUS_09150 34169 32730 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682292.1 protein_id gnl|my_center|LOCUS_09150 35233 34172 gene locus_tag LOCUS_09160 gene aroC 35233 34172 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_09160 37396 35276 gene locus_tag LOCUS_09170 37396 35276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 37766 38680 gene locus_tag LOCUS_09180 gene dapA 37766 38680 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878410.1 protein_id gnl|my_center|LOCUS_09180 38730 39824 gene locus_tag LOCUS_09190 gene asd 38730 39824 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_09190 39910 40320 gene locus_tag LOCUS_09200 gene arfB 39910 40320 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463517.1 protein_id gnl|my_center|LOCUS_09200 41306 40368 gene locus_tag LOCUS_09210 41306 40368 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669381.1 protein_id gnl|my_center|LOCUS_09210 42028 41303 gene locus_tag LOCUS_09220 42028 41303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 42645 42403 gene locus_tag LOCUS_09230 42645 42403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 42836 45328 gene locus_tag LOCUS_09240 gene thrA 42836 45328 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262570.1 protein_id gnl|my_center|LOCUS_09240 45441 47381 gene locus_tag LOCUS_09250 45441 47381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 47415 47906 gene locus_tag LOCUS_09260 gene ilvN 47415 47906 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_09260 48356 47910 gene locus_tag LOCUS_09270 48356 47910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 48492 50153 gene locus_tag LOCUS_09280 48492 50153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 50723 50157 gene locus_tag LOCUS_09290 50723 50157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678723.1 protein_id gnl|my_center|LOCUS_09290 51388 50720 gene locus_tag LOCUS_09300 51388 50720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 53683 51461 gene locus_tag LOCUS_09310 53683 51461 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957228.1 protein_id gnl|my_center|LOCUS_09310 54838 53702 gene locus_tag LOCUS_09320 54838 53702 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680821.1 protein_id gnl|my_center|LOCUS_09320 54971 55480 gene locus_tag LOCUS_09330 gene lepB 54971 55480 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956947.1 protein_id gnl|my_center|LOCUS_09330 55477 57351 gene locus_tag LOCUS_09340 55477 57351 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678847.1 protein_id gnl|my_center|LOCUS_09340 57332 59149 gene locus_tag LOCUS_09350 57332 59149 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678848.1 protein_id gnl|my_center|LOCUS_09350 59424 60893 gene locus_tag LOCUS_09360 59424 60893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 61687 60905 gene locus_tag LOCUS_09370 61687 60905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 63236 61782 gene locus_tag LOCUS_09380 63236 61782 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence13 1170 1880 gene locus_tag LOCUS_09390 1170 1880 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_09390 2017 2229 gene locus_tag LOCUS_09400 2017 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2242 2472 gene locus_tag LOCUS_09410 2242 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2562 2846 gene locus_tag LOCUS_09420 2562 2846 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_09420 2848 3060 gene locus_tag LOCUS_09430 2848 3060 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_09430 3474 3785 gene locus_tag LOCUS_09440 3474 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4528 4055 gene locus_tag LOCUS_09450 4528 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 4821 4672 gene locus_tag LOCUS_09460 4821 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 5236 5982 gene locus_tag LOCUS_09470 5236 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5979 6668 gene locus_tag LOCUS_09480 gene fabG 5979 6668 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837456.1 protein_id gnl|my_center|LOCUS_09480 6875 7684 gene locus_tag LOCUS_09490 6875 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 8537 7701 gene locus_tag LOCUS_09500 8537 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 9798 8551 gene locus_tag LOCUS_09510 9798 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09510 9989 11260 gene locus_tag LOCUS_09520 gene argJ 9989 11260 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_09520 11276 12178 gene locus_tag LOCUS_09530 gene argB 11276 12178 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_09530 12187 13344 gene locus_tag LOCUS_09540 12187 13344 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_09540 13458 15179 gene locus_tag LOCUS_09550 13458 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 15176 15952 gene locus_tag LOCUS_09560 15176 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 16066 17430 gene locus_tag LOCUS_09570 16066 17430 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_09570 17969 18718 gene locus_tag LOCUS_09580 gene tpiA 17969 18718 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678731.1 protein_id gnl|my_center|LOCUS_09580 18816 19388 gene locus_tag LOCUS_09590 18816 19388 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_09590 19385 19948 gene locus_tag LOCUS_09600 19385 19948 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_09600 19949 21283 gene locus_tag LOCUS_09610 19949 21283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 21355 22440 gene locus_tag LOCUS_09620 gene prfA 21355 22440 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_09620 22449 23381 gene locus_tag LOCUS_09630 gene prmC 22449 23381 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680454.1 protein_id gnl|my_center|LOCUS_09630 23359 24648 gene locus_tag LOCUS_09640 23359 24648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 25790 24645 gene locus_tag LOCUS_09650 25790 24645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 25935 26867 gene locus_tag LOCUS_09660 25935 26867 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_09660 26867 27688 gene locus_tag LOCUS_09670 26867 27688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189439.1 protein_id gnl|my_center|LOCUS_09670 27706 28551 gene locus_tag LOCUS_09680 27706 28551 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_09680 28553 29200 gene locus_tag LOCUS_09690 28553 29200 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_09690 29197 31776 gene locus_tag LOCUS_09700 29197 31776 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679109.1 protein_id gnl|my_center|LOCUS_09700 32243 31773 gene locus_tag LOCUS_09710 32243 31773 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_09710 34711 32306 gene locus_tag LOCUS_09720 34711 32306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 34832 36421 gene locus_tag LOCUS_09730 34832 36421 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_09730 37375 36482 gene locus_tag LOCUS_09740 37375 36482 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679808.1 protein_id gnl|my_center|LOCUS_09740 37515 37428 gene locus_tag LOCUS_t00280 37515 37428 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 37950 37591 gene locus_tag LOCUS_09750 37950 37591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 38263 38099 gene locus_tag LOCUS_09760 38263 38099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 38629 38267 gene locus_tag LOCUS_09770 38629 38267 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675753.1 protein_id gnl|my_center|LOCUS_09770 38886 38626 gene locus_tag LOCUS_09780 38886 38626 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 protein_id gnl|my_center|LOCUS_09780 39917 38883 gene locus_tag LOCUS_09790 39917 38883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 40485 40012 gene locus_tag LOCUS_09800 40485 40012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 41307 40495 gene locus_tag LOCUS_09810 gene trmD 41307 40495 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670221.1 protein_id gnl|my_center|LOCUS_09810 41918 41313 gene locus_tag LOCUS_09820 gene rimM 41918 41313 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670218.1 protein_id gnl|my_center|LOCUS_09820 42151 41918 gene locus_tag LOCUS_09830 42151 41918 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_09830 42435 42169 gene locus_tag LOCUS_09840 gene rpsP 42435 42169 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670213.1 protein_id gnl|my_center|LOCUS_09840 42937 44121 gene locus_tag LOCUS_09850 42937 44121 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680060.1 protein_id gnl|my_center|LOCUS_09850 44419 45954 gene locus_tag LOCUS_09860 gene rny 44419 45954 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681149.1 protein_id gnl|my_center|LOCUS_09860 46060 47253 gene locus_tag LOCUS_09870 46060 47253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 47314 48624 gene locus_tag LOCUS_09880 47314 48624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 48638 50254 gene locus_tag LOCUS_09890 48638 50254 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_09890 50287 51792 gene locus_tag LOCUS_09900 50287 51792 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_09900 51779 52948 gene locus_tag LOCUS_09910 gene lysA 51779 52948 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_09910 52967 53188 gene locus_tag LOCUS_09920 52967 53188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 54079 53195 gene locus_tag LOCUS_09930 54079 53195 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_09930 54359 54159 gene locus_tag LOCUS_09940 54359 54159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 55459 54626 gene locus_tag LOCUS_09950 55459 54626 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142195.1 protein_id gnl|my_center|LOCUS_09950 56646 55456 gene locus_tag LOCUS_09960 56646 55456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 56939 57307 gene locus_tag LOCUS_09970 56939 57307 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_09970 57300 58397 gene locus_tag LOCUS_09980 57300 58397 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575178.1 protein_id gnl|my_center|LOCUS_09980 58406 59320 gene locus_tag LOCUS_09990 58406 59320 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence14 145 486 gene locus_tag LOCUS_10000 145 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 676 1971 gene locus_tag LOCUS_10010 gene dcm 676 1971 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057142.1 protein_id gnl|my_center|LOCUS_10010 1982 3154 gene locus_tag LOCUS_10020 1982 3154 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203405.1 protein_id gnl|my_center|LOCUS_10020 3439 4575 gene locus_tag LOCUS_10030 3439 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4674 5126 gene locus_tag LOCUS_10040 4674 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681408.1 protein_id gnl|my_center|LOCUS_10040 5123 5662 gene locus_tag LOCUS_10050 5123 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681409.1 protein_id gnl|my_center|LOCUS_10050 5670 6353 gene locus_tag LOCUS_10060 5670 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6480 6944 gene locus_tag LOCUS_10070 6480 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 7013 7294 gene locus_tag LOCUS_10080 7013 7294 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_10080 7269 7586 gene locus_tag LOCUS_10090 7269 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 7790 8227 gene locus_tag LOCUS_10100 7790 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8304 8501 gene locus_tag LOCUS_10110 8304 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676626.1 protein_id gnl|my_center|LOCUS_10110 8498 8899 gene locus_tag LOCUS_10120 8498 8899 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681217.1 protein_id gnl|my_center|LOCUS_10120 9320 8991 gene locus_tag LOCUS_10130 9320 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 9513 9782 gene locus_tag LOCUS_10140 9513 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 9792 10235 gene locus_tag LOCUS_10150 9792 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 12352 10874 gene locus_tag LOCUS_10160 gene ilvC 12352 10874 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024919.1 protein_id gnl|my_center|LOCUS_10160 13935 12760 gene locus_tag LOCUS_10170 gene cytX 13935 12760 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_10170 14729 13938 gene locus_tag LOCUS_10180 gene thiD 14729 13938 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_10180 15548 14877 gene locus_tag LOCUS_10190 gene thiE 15548 14877 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_10190 16353 15535 gene locus_tag LOCUS_10200 gene thiM 16353 15535 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_10200 16696 16926 gene locus_tag LOCUS_10210 16696 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 16883 18139 gene locus_tag LOCUS_10220 16883 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 18318 19925 gene locus_tag LOCUS_10230 18318 19925 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_10230 19913 21064 gene locus_tag LOCUS_10240 19913 21064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 22083 21073 gene locus_tag LOCUS_10250 22083 21073 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680474.1 protein_id gnl|my_center|LOCUS_10250 22506 22090 gene locus_tag LOCUS_10260 22506 22090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 22542 23108 gene locus_tag LOCUS_10270 22542 23108 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_10270 23098 23379 gene locus_tag LOCUS_10280 23098 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 23429 23500 gene locus_tag LOCUS_t00290 23429 23500 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 23788 23642 gene locus_tag LOCUS_10290 23788 23642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 23787 25343 gene locus_tag LOCUS_10300 23787 25343 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680883.1 protein_id gnl|my_center|LOCUS_10300 25699 25391 gene locus_tag LOCUS_10310 25699 25391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 25911 25714 gene locus_tag LOCUS_10320 25911 25714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 26167 28239 gene locus_tag LOCUS_10330 26167 28239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 28239 29255 gene locus_tag LOCUS_10340 28239 29255 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920600.1 protein_id gnl|my_center|LOCUS_10340 30385 29252 gene locus_tag LOCUS_10350 30385 29252 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183278.1 protein_id gnl|my_center|LOCUS_10350 32014 30404 gene locus_tag LOCUS_10360 gene murJ 32014 30404 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681318.1 protein_id gnl|my_center|LOCUS_10360 32097 33827 gene locus_tag LOCUS_10370 32097 33827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 33806 35305 gene locus_tag LOCUS_10380 33806 35305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 35401 36210 gene locus_tag LOCUS_10390 35401 36210 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582520.1 protein_id gnl|my_center|LOCUS_10390 36203 37882 gene locus_tag LOCUS_10400 36203 37882 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_10400 38612 38007 gene locus_tag LOCUS_10410 gene thrH 38612 38007 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_10410 38720 40318 gene locus_tag LOCUS_10420 gene cimA 38720 40318 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_10420 40416 41501 gene locus_tag LOCUS_10430 gene leuB 40416 41501 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_10430 41639 43756 gene locus_tag LOCUS_10440 41639 43756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 43900 45168 gene locus_tag LOCUS_10450 gene lysA 43900 45168 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_10450 45206 45616 gene locus_tag LOCUS_10460 45206 45616 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948264.1 protein_id gnl|my_center|LOCUS_10460 46158 46367 gene locus_tag LOCUS_10470 46158 46367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 46430 46651 gene locus_tag LOCUS_10480 46430 46651 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_10480 46653 48920 gene locus_tag LOCUS_10490 gene feoB 46653 48920 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_10490 49163 49321 gene locus_tag LOCUS_10500 49163 49321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 49572 50993 gene locus_tag LOCUS_10510 49572 50993 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891501.1 protein_id gnl|my_center|LOCUS_10510 51106 51432 gene locus_tag LOCUS_10520 51106 51432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680234.1 protein_id gnl|my_center|LOCUS_10520 51456 52031 gene locus_tag LOCUS_10530 51456 52031 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680233.1 protein_id gnl|my_center|LOCUS_10530 52028 52480 gene locus_tag LOCUS_10540 52028 52480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680232.1 protein_id gnl|my_center|LOCUS_10540 52501 54642 gene locus_tag LOCUS_10550 gene glgX 52501 54642 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680950.1 protein_id gnl|my_center|LOCUS_10550 54746 57193 gene locus_tag LOCUS_10560 54746 57193 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence15 253 1191 gene locus_tag LOCUS_10570 253 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667094.1 protein_id gnl|my_center|LOCUS_10570 1232 3976 gene locus_tag LOCUS_10580 gene greA 1232 3976 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673498.1 protein_id gnl|my_center|LOCUS_10580 4000 4935 gene locus_tag LOCUS_10590 4000 4935 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081221.1 protein_id gnl|my_center|LOCUS_10590 4932 5642 gene locus_tag LOCUS_10600 gene deoC 4932 5642 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130468.1 protein_id gnl|my_center|LOCUS_10600 5996 5646 gene locus_tag LOCUS_10610 5996 5646 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566249.1 protein_id gnl|my_center|LOCUS_10610 6185 9130 gene locus_tag LOCUS_10620 6185 9130 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680747.1 protein_id gnl|my_center|LOCUS_10620 9174 9953 gene locus_tag LOCUS_10630 9174 9953 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_10630 9979 11436 gene locus_tag LOCUS_10640 9979 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 12931 11483 gene locus_tag LOCUS_10650 gene mtaB 12931 11483 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679581.1 protein_id gnl|my_center|LOCUS_10650 13571 12942 gene locus_tag LOCUS_10660 13571 12942 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679583.1 protein_id gnl|my_center|LOCUS_10660 13965 13603 gene locus_tag LOCUS_10670 13965 13603 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669698.1 protein_id gnl|my_center|LOCUS_10670 16159 14060 gene locus_tag LOCUS_10680 16159 14060 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957152.1 protein_id gnl|my_center|LOCUS_10680 16475 17887 gene locus_tag LOCUS_10690 16475 17887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 18027 20123 gene locus_tag LOCUS_10700 gene fusA 18027 20123 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_10700 20325 21008 gene locus_tag LOCUS_10710 20325 21008 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_10710 22159 21536 gene locus_tag LOCUS_10720 22159 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 24227 22299 gene locus_tag LOCUS_10730 24227 22299 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_10730 24540 24322 gene locus_tag LOCUS_10740 24540 24322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 24706 25440 gene locus_tag LOCUS_10750 24706 25440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 25864 25448 gene locus_tag LOCUS_10760 25864 25448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 26313 25861 gene locus_tag LOCUS_10770 26313 25861 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_10770 26745 26314 gene locus_tag LOCUS_10780 26745 26314 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966530.1 protein_id gnl|my_center|LOCUS_10780 26896 27261 gene locus_tag LOCUS_10790 26896 27261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 27242 27919 gene locus_tag LOCUS_10800 27242 27919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 28261 28188 gene locus_tag LOCUS_t00300 28261 28188 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 28371 28296 gene locus_tag LOCUS_t00310 28371 28296 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28546 28845 gene locus_tag LOCUS_10810 28546 28845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 28847 29863 gene locus_tag LOCUS_10820 28847 29863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 29883 31514 gene locus_tag LOCUS_10830 29883 31514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 31590 32381 gene locus_tag LOCUS_10840 31590 32381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 33804 32359 gene locus_tag LOCUS_10850 33804 32359 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681057.1 protein_id gnl|my_center|LOCUS_10850 34707 33919 gene locus_tag LOCUS_10860 34707 33919 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_10860 34828 35919 gene locus_tag LOCUS_10870 34828 35919 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678712.1 protein_id gnl|my_center|LOCUS_10870 35942 36775 gene locus_tag LOCUS_10880 35942 36775 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679999.1 protein_id gnl|my_center|LOCUS_10880 36871 38127 gene locus_tag LOCUS_10890 36871 38127 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_10890 38572 38129 gene locus_tag LOCUS_10900 38572 38129 CDS product DUF188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679987.1 protein_id gnl|my_center|LOCUS_10900 38871 38569 gene locus_tag LOCUS_10910 38871 38569 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668137.1 protein_id gnl|my_center|LOCUS_10910 39365 38892 gene locus_tag LOCUS_10920 39365 38892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 39728 39369 gene locus_tag LOCUS_10930 gene rplT 39728 39369 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668132.1 protein_id gnl|my_center|LOCUS_10930 39944 39744 gene locus_tag LOCUS_10940 gene rpmI 39944 39744 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679992.1 protein_id gnl|my_center|LOCUS_10940 40479 39949 gene locus_tag LOCUS_10950 gene infC 40479 39949 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668127.1 protein_id gnl|my_center|LOCUS_10950 40905 41132 gene locus_tag LOCUS_10960 40905 41132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 42335 41331 gene locus_tag LOCUS_10970 42335 41331 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_10970 42562 43296 gene locus_tag LOCUS_10980 42562 43296 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668794.1 protein_id gnl|my_center|LOCUS_10980 43317 44042 gene locus_tag LOCUS_10990 43317 44042 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668795.1 protein_id gnl|my_center|LOCUS_10990 44135 45067 gene locus_tag LOCUS_11000 44135 45067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 45064 45723 gene locus_tag LOCUS_11010 gene ruvA 45064 45723 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679554.1 protein_id gnl|my_center|LOCUS_11010 45720 46862 gene locus_tag LOCUS_11020 gene ruvB 45720 46862 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679608.1 protein_id gnl|my_center|LOCUS_11020 46892 47932 gene locus_tag LOCUS_11030 gene queA 46892 47932 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_11030 48766 47963 gene locus_tag LOCUS_11040 48766 47963 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681967.1 protein_id gnl|my_center|LOCUS_11040 49244 48753 gene locus_tag LOCUS_11050 49244 48753 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669971.1 protein_id gnl|my_center|LOCUS_11050 51534 49216 gene locus_tag LOCUS_11060 51534 49216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 52726 51527 gene locus_tag LOCUS_11070 52726 51527 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681964.1 protein_id gnl|my_center|LOCUS_11070 54252 52726 gene locus_tag LOCUS_11080 54252 52726 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681937.1 protein_id gnl|my_center|LOCUS_11080 54784 54326 gene locus_tag LOCUS_11090 gene nrdR 54784 54326 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678882.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence16 1528 251 gene locus_tag LOCUS_11100 1528 251 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_11100 2203 1532 gene locus_tag LOCUS_11110 gene radC 2203 1532 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682286.1 protein_id gnl|my_center|LOCUS_11110 3683 2265 gene locus_tag LOCUS_11120 3683 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4382 3687 gene locus_tag LOCUS_11130 4382 3687 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_11130 6532 4469 gene locus_tag LOCUS_11140 6532 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7066 7761 gene locus_tag LOCUS_11150 7066 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8972 7857 gene locus_tag LOCUS_11160 8972 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 9852 9193 gene locus_tag LOCUS_11170 gene phoU 9852 9193 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_11170 10653 9898 gene locus_tag LOCUS_11180 gene pstB 10653 9898 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_11180 11482 10646 gene locus_tag LOCUS_11190 gene pstA 11482 10646 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_11190 12342 11491 gene locus_tag LOCUS_11200 gene pstC 12342 11491 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_11200 13302 12424 gene locus_tag LOCUS_11210 13302 12424 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_11210 14526 13477 gene locus_tag LOCUS_11220 14526 13477 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_11220 14845 15801 gene locus_tag LOCUS_11230 14845 15801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_11230 15860 16822 gene locus_tag LOCUS_11240 15860 16822 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_11240 16815 17618 gene locus_tag LOCUS_11250 16815 17618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_11250 17626 17886 gene locus_tag LOCUS_11260 17626 17886 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428433.1 protein_id gnl|my_center|LOCUS_11260 18780 17965 gene locus_tag LOCUS_11270 18780 17965 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_11270 19661 18777 gene locus_tag LOCUS_11280 19661 18777 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_11280 21021 19741 gene locus_tag LOCUS_11290 21021 19741 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_11290 21228 24314 gene locus_tag LOCUS_11300 21228 24314 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084830245.1 protein_id gnl|my_center|LOCUS_11300 24594 25337 gene locus_tag LOCUS_11310 24594 25337 CDS product DUF4469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670345.1 protein_id gnl|my_center|LOCUS_11310 25590 26900 gene locus_tag LOCUS_11320 25590 26900 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 protein_id gnl|my_center|LOCUS_11320 28705 27041 gene locus_tag LOCUS_11330 gene gpmI 28705 27041 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_11330 28879 29049 gene locus_tag LOCUS_11340 28879 29049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 29383 29153 gene locus_tag LOCUS_11350 29383 29153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 32035 29435 gene locus_tag LOCUS_11360 32035 29435 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164979579.1 protein_id gnl|my_center|LOCUS_11360 33097 32474 gene locus_tag LOCUS_11370 33097 32474 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963498.1 protein_id gnl|my_center|LOCUS_11370 33919 33101 gene locus_tag LOCUS_11380 33919 33101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 34568 33933 gene locus_tag LOCUS_11390 34568 33933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 35235 34699 gene locus_tag LOCUS_11400 35235 34699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 35893 35315 gene locus_tag LOCUS_11410 35893 35315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11410 36076 35951 gene locus_tag LOCUS_11420 36076 35951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 37730 36459 gene locus_tag LOCUS_11430 37730 36459 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_11430 38220 37873 gene locus_tag LOCUS_11440 38220 37873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 38354 39484 gene locus_tag LOCUS_11450 38354 39484 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202468.1 protein_id gnl|my_center|LOCUS_11450 39848 40291 gene locus_tag LOCUS_11460 39848 40291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 40345 40677 gene locus_tag LOCUS_11470 40345 40677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11470 40613 42454 gene locus_tag LOCUS_11480 40613 42454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11480 42709 44058 gene locus_tag LOCUS_11490 42709 44058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 44055 44765 gene locus_tag LOCUS_11500 44055 44765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 44762 48013 gene locus_tag LOCUS_11510 44762 48013 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_11510 48015 49247 gene locus_tag LOCUS_11520 48015 49247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 49400 50332 gene locus_tag LOCUS_11530 49400 50332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 50658 51113 gene locus_tag LOCUS_11540 50658 51113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 51447 51665 gene locus_tag LOCUS_11550 51447 51665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 51896 52486 gene locus_tag LOCUS_11560 51896 52486 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434301.1 protein_id gnl|my_center|LOCUS_11560 52510 53034 gene locus_tag LOCUS_11570 52510 53034 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429214.1 protein_id gnl|my_center|LOCUS_11570 53080 53763 gene locus_tag LOCUS_11580 53080 53763 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_11580 53919 54356 gene locus_tag LOCUS_11590 53919 54356 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_11590 54353 54565 gene locus_tag LOCUS_11600 54353 54565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence17 438 1355 gene locus_tag LOCUS_11610 438 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2018 2320 gene locus_tag LOCUS_11620 2018 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3611 2415 gene locus_tag LOCUS_11630 3611 2415 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_11630 4008 5330 gene locus_tag LOCUS_11640 4008 5330 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_11640 5552 6385 gene locus_tag LOCUS_11650 5552 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6698 7342 gene locus_tag LOCUS_11660 6698 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 8591 7446 gene locus_tag LOCUS_11670 8591 7446 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_11670 9469 8714 gene locus_tag LOCUS_11680 9469 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11680 9675 9472 gene locus_tag LOCUS_11690 9675 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 9931 11040 gene locus_tag LOCUS_11700 gene purM 9931 11040 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099415.1 protein_id gnl|my_center|LOCUS_11700 11033 11659 gene locus_tag LOCUS_11710 gene purN 11033 11659 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_11710 12372 11656 gene locus_tag LOCUS_11720 12372 11656 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_11720 13846 12374 gene locus_tag LOCUS_11730 13846 12374 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674553.1 protein_id gnl|my_center|LOCUS_11730 14355 16403 gene locus_tag LOCUS_11740 14355 16403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 16637 16888 gene locus_tag LOCUS_11750 16637 16888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 16917 18983 gene locus_tag LOCUS_11760 gene oadA 16917 18983 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_11760 19037 20464 gene locus_tag LOCUS_11770 19037 20464 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417780.1 protein_id gnl|my_center|LOCUS_11770 20944 21339 gene locus_tag LOCUS_11780 20944 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 22228 21386 gene locus_tag LOCUS_11790 22228 21386 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 protein_id gnl|my_center|LOCUS_11790 22441 22755 gene locus_tag LOCUS_11800 gene rplU 22441 22755 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669481.1 protein_id gnl|my_center|LOCUS_11800 22771 23088 gene locus_tag LOCUS_11810 22771 23088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 23119 23379 gene locus_tag LOCUS_11820 gene rpmA 23119 23379 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669471.1 protein_id gnl|my_center|LOCUS_11820 23481 24602 gene locus_tag LOCUS_11830 gene obgE 23481 24602 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679468.1 protein_id gnl|my_center|LOCUS_11830 24605 25261 gene locus_tag LOCUS_11840 24605 25261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11840 25245 25853 gene locus_tag LOCUS_11850 25245 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11850 25872 27092 gene locus_tag LOCUS_11860 25872 27092 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669467.1 protein_id gnl|my_center|LOCUS_11860 27099 27446 gene locus_tag LOCUS_11870 gene rsfS 27099 27446 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679464.1 protein_id gnl|my_center|LOCUS_11870 28440 27451 gene locus_tag LOCUS_11880 28440 27451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 29450 28440 gene locus_tag LOCUS_11890 29450 28440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668143.1 protein_id gnl|my_center|LOCUS_11890 29628 30074 gene locus_tag LOCUS_11900 29628 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 30061 31872 gene locus_tag LOCUS_11910 30061 31872 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682360.1 protein_id gnl|my_center|LOCUS_11910 32027 32452 gene locus_tag LOCUS_11920 32027 32452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 32445 34181 gene locus_tag LOCUS_11930 gene secD 32445 34181 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681894.1 protein_id gnl|my_center|LOCUS_11930 34181 35431 gene locus_tag LOCUS_11940 gene secF 34181 35431 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681892.1 protein_id gnl|my_center|LOCUS_11940 35565 36419 gene locus_tag LOCUS_11950 gene ispH 35565 36419 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682405.1 protein_id gnl|my_center|LOCUS_11950 36483 37553 gene locus_tag LOCUS_11960 36483 37553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 37557 40718 gene locus_tag LOCUS_11970 37557 40718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 42634 40835 gene locus_tag LOCUS_11980 gene pepF 42634 40835 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971600.1 protein_id gnl|my_center|LOCUS_11980 42759 44045 gene locus_tag LOCUS_11990 42759 44045 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678992.1 protein_id gnl|my_center|LOCUS_11990 44118 46052 gene locus_tag LOCUS_12000 44118 46052 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678989.1 protein_id gnl|my_center|LOCUS_12000 46156 47136 gene locus_tag LOCUS_12010 gene galE 46156 47136 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_12010 47213 48442 gene locus_tag LOCUS_12020 47213 48442 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680921.1 protein_id gnl|my_center|LOCUS_12020 49242 48445 gene locus_tag LOCUS_12030 49242 48445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 49374 50150 gene locus_tag LOCUS_12040 49374 50150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence18 1712 1885 gene locus_tag LOCUS_12050 1712 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1885 2499 gene locus_tag LOCUS_12060 1885 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_12060 3934 3092 gene locus_tag LOCUS_12070 3934 3092 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 protein_id gnl|my_center|LOCUS_12070 5253 3931 gene locus_tag LOCUS_12080 5253 3931 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804062.1 protein_id gnl|my_center|LOCUS_12080 6759 5560 gene locus_tag LOCUS_12090 6759 5560 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_12090 7808 6810 gene locus_tag LOCUS_12100 7808 6810 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518875.1 protein_id gnl|my_center|LOCUS_12100 8049 8708 gene locus_tag LOCUS_12110 8049 8708 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263803.1 protein_id gnl|my_center|LOCUS_12110 10137 8782 gene locus_tag LOCUS_12120 gene gdhA 10137 8782 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_12120 10313 10804 gene locus_tag LOCUS_12130 10313 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 10874 12589 gene locus_tag LOCUS_12140 10874 12589 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_12140 13964 12807 gene locus_tag LOCUS_12150 13964 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 15530 14106 gene locus_tag LOCUS_12160 15530 14106 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666804.1 protein_id gnl|my_center|LOCUS_12160 15673 16254 gene locus_tag LOCUS_12170 15673 16254 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_12170 16270 17067 gene locus_tag LOCUS_12180 16270 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 18408 17218 gene locus_tag LOCUS_12190 18408 17218 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677016.1 protein_id gnl|my_center|LOCUS_12190 19259 18438 gene locus_tag LOCUS_12200 19259 18438 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669892.1 protein_id gnl|my_center|LOCUS_12200 20383 19385 gene locus_tag LOCUS_12210 20383 19385 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667792.1 protein_id gnl|my_center|LOCUS_12210 20997 20392 gene locus_tag LOCUS_12220 20997 20392 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_12220 21190 23127 gene locus_tag LOCUS_12230 21190 23127 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957030.1 protein_id gnl|my_center|LOCUS_12230 24485 23124 gene locus_tag LOCUS_12240 24485 23124 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680936.1 protein_id gnl|my_center|LOCUS_12240 24820 24485 gene locus_tag LOCUS_12250 24820 24485 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680938.1 protein_id gnl|my_center|LOCUS_12250 26373 24820 gene locus_tag LOCUS_12260 gene der 26373 24820 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680939.1 protein_id gnl|my_center|LOCUS_12260 28098 26389 gene locus_tag LOCUS_12270 gene ptsP 28098 26389 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966368.1 protein_id gnl|my_center|LOCUS_12270 28224 30194 gene locus_tag LOCUS_12280 28224 30194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 30191 30685 gene locus_tag LOCUS_12290 30191 30685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 30872 31639 gene locus_tag LOCUS_12300 30872 31639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 32484 31636 gene locus_tag LOCUS_12310 32484 31636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 33128 32484 gene locus_tag LOCUS_12320 33128 32484 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272632.1 protein_id gnl|my_center|LOCUS_12320 34645 33125 gene locus_tag LOCUS_12330 34645 33125 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_12330 35418 34933 gene locus_tag LOCUS_12340 35418 34933 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173597.1 protein_id gnl|my_center|LOCUS_12340 36095 35442 gene locus_tag LOCUS_12350 36095 35442 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_12350 37429 36095 gene locus_tag LOCUS_12360 37429 36095 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_12360 37570 38190 gene locus_tag LOCUS_12370 37570 38190 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680200.1 protein_id gnl|my_center|LOCUS_12370 38183 39364 gene locus_tag LOCUS_12380 gene ispD 38183 39364 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_12380 39415 39693 gene locus_tag LOCUS_12390 39415 39693 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_12390 39690 39989 gene locus_tag LOCUS_12400 39690 39989 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_12400 40307 40044 gene locus_tag LOCUS_12410 40307 40044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 40518 40871 gene locus_tag LOCUS_12420 40518 40871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 40952 41308 gene locus_tag LOCUS_12430 40952 41308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 41341 42234 gene locus_tag LOCUS_12440 41341 42234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681400.1 protein_id gnl|my_center|LOCUS_12440 42276 42575 gene locus_tag LOCUS_12450 42276 42575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 42596 42889 gene locus_tag LOCUS_12460 42596 42889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 43011 43376 gene locus_tag LOCUS_12470 43011 43376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 43400 44647 gene locus_tag LOCUS_12480 43400 44647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 44785 45249 gene locus_tag LOCUS_12490 44785 45249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 45920 45492 gene locus_tag LOCUS_12500 45920 45492 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_12500 46222 45911 gene locus_tag LOCUS_12510 46222 45911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 46985 46479 gene locus_tag LOCUS_12520 46985 46479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 47833 47063 gene locus_tag LOCUS_12530 47833 47063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence19 <1 1321 gene locus_tag LOCUS_12540 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966175.1:CTP synthase 2074 1490 gene locus_tag LOCUS_12550 2074 1490 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_12550 3294 2086 gene locus_tag LOCUS_12560 gene glnA 3294 2086 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_12560 3491 4372 gene locus_tag LOCUS_12570 3491 4372 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_12570 4861 6954 gene locus_tag LOCUS_12580 4861 6954 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_12580 7112 7546 gene locus_tag LOCUS_12590 7112 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7569 8561 gene locus_tag LOCUS_12600 7569 8561 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679909.1 protein_id gnl|my_center|LOCUS_12600 8799 10550 gene locus_tag LOCUS_12610 8799 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 12262 10955 gene locus_tag LOCUS_12620 12262 10955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 12554 12306 gene locus_tag LOCUS_12630 12554 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 14097 12880 gene locus_tag LOCUS_12640 14097 12880 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_12640 15983 14394 gene locus_tag LOCUS_12650 15983 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 17423 16269 gene locus_tag LOCUS_12660 17423 16269 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071664104.1 protein_id gnl|my_center|LOCUS_12660 17641 17420 gene locus_tag LOCUS_12670 17641 17420 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016100.1 protein_id gnl|my_center|LOCUS_12670 17787 18764 gene locus_tag LOCUS_12680 17787 18764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 18761 20248 gene locus_tag LOCUS_12690 18761 20248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 20241 21809 gene locus_tag LOCUS_12700 20241 21809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 21806 22843 gene locus_tag LOCUS_12710 gene xylF 21806 22843 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_12710 22888 23877 gene locus_tag LOCUS_12720 22888 23877 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666315.1 protein_id gnl|my_center|LOCUS_12720 23874 24752 gene locus_tag LOCUS_12730 23874 24752 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678741.1 protein_id gnl|my_center|LOCUS_12730 24762 25808 gene locus_tag LOCUS_12740 24762 25808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 25944 26945 gene locus_tag LOCUS_12750 25944 26945 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678753.1 protein_id gnl|my_center|LOCUS_12750 26942 28558 gene locus_tag LOCUS_12760 26942 28558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 28510 29892 gene locus_tag LOCUS_12770 28510 29892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 29907 30464 gene locus_tag LOCUS_12780 29907 30464 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678761.1 protein_id gnl|my_center|LOCUS_12780 30526 31032 gene locus_tag LOCUS_12790 30526 31032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 31055 31513 gene locus_tag LOCUS_12800 gene rnhA 31055 31513 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_12800 32053 31556 gene locus_tag LOCUS_12810 32053 31556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 33369 32050 gene locus_tag LOCUS_12820 gene hflX 33369 32050 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667011.1 protein_id gnl|my_center|LOCUS_12820 33569 33778 gene locus_tag LOCUS_12830 33569 33778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 34173 33781 gene locus_tag LOCUS_12840 34173 33781 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680077.1 protein_id gnl|my_center|LOCUS_12840 35722 34190 gene locus_tag LOCUS_12850 35722 34190 CDS product DUF5312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680918.1 protein_id gnl|my_center|LOCUS_12850 35763 38027 gene locus_tag LOCUS_12860 35763 38027 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680923.1 protein_id gnl|my_center|LOCUS_12860 40522 38249 gene locus_tag LOCUS_12870 gene metE 40522 38249 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905853.1 protein_id gnl|my_center|LOCUS_12870 41047 42216 gene locus_tag LOCUS_12880 41047 42216 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670664.1 protein_id gnl|my_center|LOCUS_12880 42414 42953 gene locus_tag LOCUS_12890 42414 42953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666906.1 protein_id gnl|my_center|LOCUS_12890 42963 44222 gene locus_tag LOCUS_12900 42963 44222 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583659.1 protein_id gnl|my_center|LOCUS_12900 46765 44468 gene locus_tag LOCUS_12910 gene pheT 46765 44468 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_12910 47465 47202 gene locus_tag LOCUS_12920 47465 47202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence20 280 3921 gene locus_tag LOCUS_12930 gene dnaE 280 3921 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957315.1 protein_id gnl|my_center|LOCUS_12930 3943 4524 gene locus_tag LOCUS_12940 3943 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4525 6711 gene locus_tag LOCUS_12950 gene recG 4525 6711 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680562.1 protein_id gnl|my_center|LOCUS_12950 7543 6692 gene locus_tag LOCUS_12960 7543 6692 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670326.1 protein_id gnl|my_center|LOCUS_12960 7600 7776 gene locus_tag LOCUS_12970 7600 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 8067 7795 gene locus_tag LOCUS_12980 8067 7795 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670325.1 protein_id gnl|my_center|LOCUS_12980 10064 8202 gene locus_tag LOCUS_12990 10064 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 10546 10061 gene locus_tag LOCUS_13000 gene nusB 10546 10061 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679351.1 protein_id gnl|my_center|LOCUS_13000 11635 10556 gene locus_tag LOCUS_13010 11635 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 13514 11697 gene locus_tag LOCUS_13020 13514 11697 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_13020 14240 13605 gene locus_tag LOCUS_13030 gene upp 14240 13605 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 protein_id gnl|my_center|LOCUS_13030 15540 14245 gene locus_tag LOCUS_13040 15540 14245 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_13040 17276 15783 gene locus_tag LOCUS_13050 17276 15783 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_13050 17437 17273 gene locus_tag LOCUS_13060 17437 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 18286 17465 gene locus_tag LOCUS_13070 18286 17465 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669703.1 protein_id gnl|my_center|LOCUS_13070 18882 18304 gene locus_tag LOCUS_13080 18882 18304 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670118.1 protein_id gnl|my_center|LOCUS_13080 19496 18879 gene locus_tag LOCUS_13090 19496 18879 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670120.1 protein_id gnl|my_center|LOCUS_13090 20100 19498 gene locus_tag LOCUS_13100 20100 19498 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670122.1 protein_id gnl|my_center|LOCUS_13100 21128 20097 gene locus_tag LOCUS_13110 21128 20097 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002685644.1 protein_id gnl|my_center|LOCUS_13110 22438 21125 gene locus_tag LOCUS_13120 gene rsxC 22438 21125 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682097.1 protein_id gnl|my_center|LOCUS_13120 23056 22574 gene locus_tag LOCUS_13130 gene ybaK 23056 22574 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_13130 24000 23062 gene locus_tag LOCUS_13140 24000 23062 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679323.1 protein_id gnl|my_center|LOCUS_13140 24710 24114 gene locus_tag LOCUS_13150 gene coaE 24710 24114 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679322.1 protein_id gnl|my_center|LOCUS_13150 27502 24710 gene locus_tag LOCUS_13160 gene polA 27502 24710 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679321.1 protein_id gnl|my_center|LOCUS_13160 27602 28369 gene locus_tag LOCUS_13170 27602 28369 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682132.1 protein_id gnl|my_center|LOCUS_13170 28919 28377 gene locus_tag LOCUS_13180 28919 28377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 31003 28940 gene locus_tag LOCUS_13190 31003 28940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 31741 31007 gene locus_tag LOCUS_13200 31741 31007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_13200 32681 31719 gene locus_tag LOCUS_13210 32681 31719 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_13210 32978 33331 gene locus_tag LOCUS_13220 32978 33331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 34987 33338 gene locus_tag LOCUS_13230 34987 33338 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_13230 35132 35057 gene locus_tag LOCUS_t00320 35132 35057 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 35959 35201 gene locus_tag LOCUS_13240 35959 35201 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_13240 36617 35943 gene locus_tag LOCUS_13250 36617 35943 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_13250 37455 36685 gene locus_tag LOCUS_13260 37455 36685 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_13260 38917 37478 gene locus_tag LOCUS_13270 gene argH 38917 37478 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_13270 39293 38919 gene locus_tag LOCUS_13280 39293 38919 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_13280 40220 39489 gene locus_tag LOCUS_13290 40220 39489 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_13290 42290 40320 gene locus_tag LOCUS_13300 gene htpG 42290 40320 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 protein_id gnl|my_center|LOCUS_13300 42544 42471 gene locus_tag LOCUS_t00330 42544 42471 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 43626 42592 gene locus_tag LOCUS_13310 43626 42592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 45020 43614 gene locus_tag LOCUS_13320 45020 43614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 45694 45089 gene locus_tag LOCUS_13330 gene lpoB 45694 45089 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706416.1 protein_id gnl|my_center|LOCUS_13330 46441 45695 gene locus_tag LOCUS_13340 46441 45695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence21 1202 2836 gene locus_tag LOCUS_13350 gene groL 1202 2836 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670719.1 protein_id gnl|my_center|LOCUS_13350 2973 4718 gene locus_tag LOCUS_13360 2973 4718 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_13360 4711 5193 gene locus_tag LOCUS_13370 4711 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 5171 5614 gene locus_tag LOCUS_13380 5171 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 6214 5729 gene locus_tag LOCUS_13390 6214 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6832 6458 gene locus_tag LOCUS_13400 6832 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 7205 6825 gene locus_tag LOCUS_13410 7205 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 7895 7290 gene locus_tag LOCUS_13420 7895 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 8770 7898 gene locus_tag LOCUS_13430 8770 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 9879 8770 gene locus_tag LOCUS_13440 9879 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 10903 10184 gene locus_tag LOCUS_13450 10903 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 11527 11799 gene locus_tag LOCUS_13460 11527 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 11858 12289 gene locus_tag LOCUS_13470 11858 12289 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817440.1 protein_id gnl|my_center|LOCUS_13470 12671 13369 gene locus_tag LOCUS_13480 12671 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 13861 13376 gene locus_tag LOCUS_13490 13861 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 16039 13862 gene locus_tag LOCUS_13500 gene nrdD 16039 13862 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_13500 16284 16036 gene locus_tag LOCUS_13510 16284 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 17307 16333 gene locus_tag LOCUS_13520 17307 16333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 protein_id gnl|my_center|LOCUS_13520 19402 17324 gene locus_tag LOCUS_13530 19402 17324 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 protein_id gnl|my_center|LOCUS_13530 20386 19409 gene locus_tag LOCUS_13540 20386 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 21497 20403 gene locus_tag LOCUS_13550 21497 20403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081376.1 protein_id gnl|my_center|LOCUS_13550 23331 21508 gene locus_tag LOCUS_13560 23331 21508 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_13560 25051 23333 gene locus_tag LOCUS_13570 gene dnaX 25051 23333 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957269.1 protein_id gnl|my_center|LOCUS_13570 25255 25182 gene locus_tag LOCUS_t00340 25255 25182 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27382 25319 gene locus_tag LOCUS_13580 27382 25319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 27506 28381 gene locus_tag LOCUS_13590 27506 28381 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000530036.1 protein_id gnl|my_center|LOCUS_13590 29013 28390 gene locus_tag LOCUS_13600 29013 28390 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044977646.1 protein_id gnl|my_center|LOCUS_13600 30858 29092 gene locus_tag LOCUS_13610 gene asnB 30858 29092 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202957.1 protein_id gnl|my_center|LOCUS_13610 31220 31924 gene locus_tag LOCUS_13620 31220 31924 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_13620 32022 33236 gene locus_tag LOCUS_13630 32022 33236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 34046 33618 gene locus_tag LOCUS_13640 34046 33618 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_13640 35109 34405 gene locus_tag LOCUS_13650 35109 34405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 35551 35327 gene locus_tag LOCUS_13660 35551 35327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 36256 35567 gene locus_tag LOCUS_13670 36256 35567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 36859 36545 gene locus_tag LOCUS_13680 36859 36545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 36995 37315 gene locus_tag LOCUS_13690 36995 37315 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667543.1 protein_id gnl|my_center|LOCUS_13690 37437 40307 gene locus_tag LOCUS_13700 gene ppdK 37437 40307 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861547.1 protein_id gnl|my_center|LOCUS_13700 40417 41211 gene locus_tag LOCUS_13710 40417 41211 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682046.1 protein_id gnl|my_center|LOCUS_13710 41701 41147 gene locus_tag LOCUS_13720 41701 41147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 42037 42393 gene locus_tag LOCUS_13730 42037 42393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 43123 42395 gene locus_tag LOCUS_13740 43123 42395 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_13740 45070 43157 gene locus_tag LOCUS_13750 45070 43157 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049207.1 protein_id gnl|my_center|LOCUS_13750 45164 45239 gene locus_tag LOCUS_t00350 45164 45239 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence22 245 1777 gene locus_tag LOCUS_13760 245 1777 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_13760 1783 1995 gene locus_tag LOCUS_13770 1783 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2910 2053 gene locus_tag LOCUS_13780 2910 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4349 3099 gene locus_tag LOCUS_13790 gene gguB 4349 3099 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287993.1 protein_id gnl|my_center|LOCUS_13790 5906 4374 gene locus_tag LOCUS_13800 gene gguA 5906 4374 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_13800 7052 5988 gene locus_tag LOCUS_13810 gene chvE 7052 5988 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_13810 8684 7395 gene locus_tag LOCUS_13820 gene eno 8684 7395 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_13820 8867 10159 gene locus_tag LOCUS_13830 8867 10159 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_13830 10143 11408 gene locus_tag LOCUS_13840 10143 11408 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674509.1 protein_id gnl|my_center|LOCUS_13840 11505 11906 gene locus_tag LOCUS_13850 11505 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 13265 11910 gene locus_tag LOCUS_13860 13265 11910 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_13860 15399 13282 gene locus_tag LOCUS_13870 15399 13282 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886474.1 protein_id gnl|my_center|LOCUS_13870 16076 15402 gene locus_tag LOCUS_13880 16076 15402 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386618.1 protein_id gnl|my_center|LOCUS_13880 16848 16078 gene locus_tag LOCUS_13890 16848 16078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 17905 16952 gene locus_tag LOCUS_13900 17905 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 19120 17930 gene locus_tag LOCUS_13910 19120 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 19592 19122 gene locus_tag LOCUS_13920 19592 19122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 19665 22511 gene locus_tag LOCUS_13930 19665 22511 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682238.1 protein_id gnl|my_center|LOCUS_13930 23037 22657 gene locus_tag LOCUS_13940 23037 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 23487 23065 gene locus_tag LOCUS_13950 23487 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 23835 25343 gene locus_tag LOCUS_13960 23835 25343 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_13960 26149 25433 gene locus_tag LOCUS_13970 26149 25433 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_13970 27922 26324 gene locus_tag LOCUS_13980 27922 26324 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_13980 28150 29079 gene locus_tag LOCUS_13990 28150 29079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 29205 30719 gene locus_tag LOCUS_14000 29205 30719 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_14000 30716 31810 gene locus_tag LOCUS_14010 30716 31810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_14010 31811 32860 gene locus_tag LOCUS_14020 gene yjfF 31811 32860 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_14020 33126 33911 gene locus_tag LOCUS_14030 33126 33911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 34842 33982 gene locus_tag LOCUS_14040 34842 33982 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670454.1 protein_id gnl|my_center|LOCUS_14040 35526 34981 gene locus_tag LOCUS_14050 35526 34981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 35520 36458 gene locus_tag LOCUS_14060 35520 36458 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_14060 36452 37642 gene locus_tag LOCUS_14070 gene coaBC 36452 37642 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_14070 37654 38463 gene locus_tag LOCUS_14080 37654 38463 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680208.1 protein_id gnl|my_center|LOCUS_14080 38515 39000 gene locus_tag LOCUS_14090 38515 39000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 39049 40179 gene locus_tag LOCUS_14100 39049 40179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957140.1 protein_id gnl|my_center|LOCUS_14100 41720 40176 gene locus_tag LOCUS_14110 41720 40176 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957136.1 protein_id gnl|my_center|LOCUS_14110 43145 41739 gene locus_tag LOCUS_14120 43145 41739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679821.1 protein_id gnl|my_center|LOCUS_14120 44209 43307 gene locus_tag LOCUS_14130 44209 43307 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680076.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence23 1008 163 gene locus_tag LOCUS_14140 1008 163 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_14140 1716 1072 gene locus_tag LOCUS_14150 1716 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1903 3921 gene locus_tag LOCUS_14160 1903 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3949 7593 gene locus_tag LOCUS_14170 3949 7593 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957290.1 protein_id gnl|my_center|LOCUS_14170 8878 7559 gene locus_tag LOCUS_14180 8878 7559 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673523.1 protein_id gnl|my_center|LOCUS_14180 9184 8966 gene locus_tag LOCUS_14190 9184 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 9252 9899 gene locus_tag LOCUS_14200 gene hisH 9252 9899 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_14200 9901 10668 gene locus_tag LOCUS_14210 gene hisF 9901 10668 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_14210 12476 10677 gene locus_tag LOCUS_14220 gene pyk 12476 10677 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869581.1 protein_id gnl|my_center|LOCUS_14220 12882 12496 gene locus_tag LOCUS_14230 gene queD 12882 12496 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_14230 13078 13584 gene locus_tag LOCUS_14240 13078 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 13667 14119 gene locus_tag LOCUS_14250 13667 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 14136 14591 gene locus_tag LOCUS_14260 14136 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 15584 14640 gene locus_tag LOCUS_14270 gene argC 15584 14640 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_14270 15690 16100 gene locus_tag LOCUS_14280 15690 16100 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679984.1 protein_id gnl|my_center|LOCUS_14280 17299 16097 gene locus_tag LOCUS_14290 17299 16097 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681086.1 protein_id gnl|my_center|LOCUS_14290 17603 18700 gene locus_tag LOCUS_14300 17603 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679444.1 protein_id gnl|my_center|LOCUS_14300 18729 19316 gene locus_tag LOCUS_14310 18729 19316 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430090.1 protein_id gnl|my_center|LOCUS_14310 21046 20039 gene locus_tag LOCUS_14320 21046 20039 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_14320 21519 21803 gene locus_tag LOCUS_14330 21519 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14330 21784 23565 gene locus_tag LOCUS_14340 21784 23565 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681568.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 23569 23865 gene locus_tag LOCUS_14350 23569 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681569.1 protein_id gnl|my_center|LOCUS_14350 23935 24537 gene locus_tag LOCUS_14360 23935 24537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 24680 24781 gene locus_tag LOCUS_r00010 24680 24781 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 25262 25068 gene locus_tag LOCUS_14370 25262 25068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 25416 25739 gene locus_tag LOCUS_14380 25416 25739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 25752 27560 gene locus_tag LOCUS_14390 25752 27560 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_14390 27580 30489 gene locus_tag LOCUS_14400 27580 30489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 30490 31542 gene locus_tag LOCUS_14410 30490 31542 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_14410 31532 33451 gene locus_tag LOCUS_14420 31532 33451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 33460 35250 gene locus_tag LOCUS_14430 33460 35250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 35252 35890 gene locus_tag LOCUS_14440 35252 35890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence24 595 2850 gene locus_tag LOCUS_14450 gene pflB 595 2850 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_14450 4113 2947 gene locus_tag LOCUS_14460 4113 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4889 4134 gene locus_tag LOCUS_14470 4889 4134 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_14470 5273 4992 gene locus_tag LOCUS_14480 5273 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5453 5857 gene locus_tag LOCUS_14490 5453 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 6004 6750 gene locus_tag LOCUS_14500 gene pflA 6004 6750 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_14500 6871 8004 gene locus_tag LOCUS_14510 6871 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8121 8927 gene locus_tag LOCUS_14520 8121 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 8995 10263 gene locus_tag LOCUS_14530 gene pepT 8995 10263 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723986.1 protein_id gnl|my_center|LOCUS_14530 10295 11578 gene locus_tag LOCUS_14540 gene murA 10295 11578 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_14540 11651 13408 gene locus_tag LOCUS_14550 gene thrS 11651 13408 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682400.1 protein_id gnl|my_center|LOCUS_14550 14067 13405 gene locus_tag LOCUS_14560 14067 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 14675 14097 gene locus_tag LOCUS_14570 14675 14097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 15069 16286 gene locus_tag LOCUS_14580 15069 16286 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681770.1 protein_id gnl|my_center|LOCUS_14580 16368 17381 gene locus_tag LOCUS_14590 16368 17381 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082568.1 protein_id gnl|my_center|LOCUS_14590 18562 17417 gene locus_tag LOCUS_14600 18562 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 18959 19981 gene locus_tag LOCUS_14610 18959 19981 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_14610 20618 19959 gene locus_tag LOCUS_14620 20618 19959 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_14620 21472 20621 gene locus_tag LOCUS_14630 21472 20621 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 protein_id gnl|my_center|LOCUS_14630 21743 22807 gene locus_tag LOCUS_14640 21743 22807 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_14640 22855 25260 gene locus_tag LOCUS_14650 22855 25260 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971495.1 protein_id gnl|my_center|LOCUS_14650 25257 26645 gene locus_tag LOCUS_14660 gene mnmE 25257 26645 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680027.1 protein_id gnl|my_center|LOCUS_14660 26680 27477 gene locus_tag LOCUS_14670 26680 27477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957218.1 protein_id gnl|my_center|LOCUS_14670 27568 27984 gene locus_tag LOCUS_14680 27568 27984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670484.1 protein_id gnl|my_center|LOCUS_14680 28924 28031 gene locus_tag LOCUS_14690 28924 28031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 29865 28984 gene locus_tag LOCUS_14700 29865 28984 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680625.1 protein_id gnl|my_center|LOCUS_14700 29982 31262 gene locus_tag LOCUS_14710 29982 31262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 31928 31368 gene locus_tag LOCUS_14720 31928 31368 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_14720 32256 32768 gene locus_tag LOCUS_14730 32256 32768 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_14730 35012 32772 gene locus_tag LOCUS_14740 35012 32772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 35142 35441 gene locus_tag LOCUS_14750 35142 35441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence25 321 1229 gene locus_tag LOCUS_14760 321 1229 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_14760 1487 1987 gene locus_tag LOCUS_14770 1487 1987 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_14770 2053 3867 gene locus_tag LOCUS_14780 2053 3867 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 protein_id gnl|my_center|LOCUS_14780 4220 4627 gene locus_tag LOCUS_14790 4220 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4651 5367 gene locus_tag LOCUS_14800 4651 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5420 5857 gene locus_tag LOCUS_14810 5420 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 6817 5963 gene locus_tag LOCUS_14820 6817 5963 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_14820 6995 7486 gene locus_tag LOCUS_14830 6995 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 7636 8712 gene locus_tag LOCUS_14840 7636 8712 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211257.1 protein_id gnl|my_center|LOCUS_14840 8714 9427 gene locus_tag LOCUS_14850 8714 9427 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477521.1 protein_id gnl|my_center|LOCUS_14850 9427 9969 gene locus_tag LOCUS_14860 9427 9969 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477396.1 protein_id gnl|my_center|LOCUS_14860 9991 10542 gene locus_tag LOCUS_14870 9991 10542 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_14870 10551 11102 gene locus_tag LOCUS_14880 10551 11102 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_14880 11099 11728 gene locus_tag LOCUS_14890 11099 11728 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211251.1 protein_id gnl|my_center|LOCUS_14890 11968 12408 gene locus_tag LOCUS_14900 11968 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 12415 13002 gene locus_tag LOCUS_14910 12415 13002 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_14910 13255 13422 gene locus_tag LOCUS_14920 13255 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 13352 13639 gene locus_tag LOCUS_14930 13352 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 14323 13658 gene locus_tag LOCUS_14940 14323 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 14699 14337 gene locus_tag LOCUS_14950 14699 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 15633 14815 gene locus_tag LOCUS_14960 15633 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 17221 15749 gene locus_tag LOCUS_14970 17221 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 18542 17223 gene locus_tag LOCUS_14980 18542 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 18749 18552 gene locus_tag LOCUS_14990 18749 18552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 18977 18822 gene locus_tag LOCUS_15000 18977 18822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 20136 19087 gene locus_tag LOCUS_15010 20136 19087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 21717 20317 gene locus_tag LOCUS_15020 21717 20317 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_15020 22329 21805 gene locus_tag LOCUS_15030 22329 21805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 23163 22342 gene locus_tag LOCUS_15040 23163 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 24391 23747 gene locus_tag LOCUS_15050 24391 23747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_15050 24858 25397 gene locus_tag LOCUS_15060 24858 25397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15060 25446 25745 gene locus_tag LOCUS_15070 25446 25745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15070 26447 27007 gene locus_tag LOCUS_15080 26447 27007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 27119 27331 gene locus_tag LOCUS_15090 27119 27331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 27790 27458 gene locus_tag LOCUS_15100 27790 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 29044 27947 gene locus_tag LOCUS_15110 29044 27947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 29401 29060 gene locus_tag LOCUS_15120 29401 29060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 29563 30171 gene locus_tag LOCUS_15130 29563 30171 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794442.1 protein_id gnl|my_center|LOCUS_15130 30939 31130 gene locus_tag LOCUS_15140 30939 31130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 31334 32311 gene locus_tag LOCUS_15150 31334 32311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 32515 32835 gene locus_tag LOCUS_15160 32515 32835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15160 32922 33707 gene locus_tag LOCUS_15170 32922 33707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence26 125 216 gene locus_tag LOCUS_r00020 125 216 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 77 percent of the 5S ribosomal RNA 441 623 gene locus_tag LOCUS_15180 441 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2328 637 gene locus_tag LOCUS_15190 2328 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3049 2387 gene locus_tag LOCUS_15200 3049 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3815 3018 gene locus_tag LOCUS_15210 3815 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5838 3976 gene locus_tag LOCUS_15220 5838 3976 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272416.1 protein_id gnl|my_center|LOCUS_15220 7068 6157 gene locus_tag LOCUS_15230 7068 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 7452 7234 gene locus_tag LOCUS_15240 7452 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 7891 9039 gene locus_tag LOCUS_15250 7891 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 9036 9737 gene locus_tag LOCUS_15260 gene larB 9036 9737 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_15260 9734 11128 gene locus_tag LOCUS_15270 gene larC 9734 11128 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_15270 11333 11749 gene locus_tag LOCUS_15280 11333 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 11749 12063 gene locus_tag LOCUS_15290 11749 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 12451 12993 gene locus_tag LOCUS_15300 12451 12993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 13092 13367 gene locus_tag LOCUS_15310 13092 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 13690 14586 gene locus_tag LOCUS_15320 13690 14586 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_15320 14599 15138 gene locus_tag LOCUS_15330 14599 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 15149 16009 gene locus_tag LOCUS_15340 15149 16009 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_15340 16031 16501 gene locus_tag LOCUS_15350 16031 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 16510 17040 gene locus_tag LOCUS_15360 16510 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 17042 17920 gene locus_tag LOCUS_15370 17042 17920 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233875.1 protein_id gnl|my_center|LOCUS_15370 17991 18905 gene locus_tag LOCUS_15380 17991 18905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 18909 19610 gene locus_tag LOCUS_15390 18909 19610 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_15390 19614 20972 gene locus_tag LOCUS_15400 19614 20972 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948710.1 protein_id gnl|my_center|LOCUS_15400 22183 20993 gene locus_tag LOCUS_15410 22183 20993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 22982 22197 gene locus_tag LOCUS_15420 22982 22197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 23779 23126 gene locus_tag LOCUS_15430 23779 23126 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_15430 24959 24249 gene locus_tag LOCUS_15440 24959 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 25446 25835 gene locus_tag LOCUS_15450 25446 25835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 25829 26071 gene locus_tag LOCUS_15460 25829 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 26068 26574 gene locus_tag LOCUS_15470 26068 26574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 26788 27057 gene locus_tag LOCUS_15480 26788 27057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 27931 27515 gene locus_tag LOCUS_15490 27931 27515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 29418 28123 gene locus_tag LOCUS_15500 29418 28123 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_15500 30425 29829 gene locus_tag LOCUS_15510 30425 29829 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_15510 31719 30499 gene locus_tag LOCUS_15520 31719 30499 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_15520 31952 32200 gene locus_tag LOCUS_15530 31952 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 33015 32317 gene locus_tag LOCUS_15540 33015 32317 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence27 194 2191 gene locus_tag LOCUS_15550 gene uvrB 194 2191 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678935.1 protein_id gnl|my_center|LOCUS_15550 2214 2519 gene locus_tag LOCUS_15560 2214 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2625 4028 gene locus_tag LOCUS_15570 2625 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 4426 4196 gene locus_tag LOCUS_15580 4426 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4326 4943 gene locus_tag LOCUS_15590 4326 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 5254 5484 gene locus_tag LOCUS_15600 gene rpmB 5254 5484 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670427.1 protein_id gnl|my_center|LOCUS_15600 5627 6580 gene locus_tag LOCUS_15610 5627 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 7554 6652 gene locus_tag LOCUS_15620 7554 6652 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_15620 8745 7927 gene locus_tag LOCUS_15630 8745 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 9300 10760 gene locus_tag LOCUS_15640 gene asnS 9300 10760 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682293.1 protein_id gnl|my_center|LOCUS_15640 10893 11792 gene locus_tag LOCUS_15650 10893 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 11789 13066 gene locus_tag LOCUS_15660 11789 13066 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681017.1 protein_id gnl|my_center|LOCUS_15660 13397 15283 gene locus_tag LOCUS_15670 gene guaA 13397 15283 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_15670 15355 17121 gene locus_tag LOCUS_15680 15355 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 17567 17127 gene locus_tag LOCUS_15690 17567 17127 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680619.1 protein_id gnl|my_center|LOCUS_15690 17608 18813 gene locus_tag LOCUS_15700 17608 18813 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681866.1 protein_id gnl|my_center|LOCUS_15700 18883 19545 gene locus_tag LOCUS_15710 18883 19545 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 protein_id gnl|my_center|LOCUS_15710 19523 20227 gene locus_tag LOCUS_15720 19523 20227 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_15720 20244 20996 gene locus_tag LOCUS_15730 20244 20996 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_15730 21064 21900 gene locus_tag LOCUS_15740 21064 21900 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765262.1 protein_id gnl|my_center|LOCUS_15740 21958 22380 gene locus_tag LOCUS_15750 21958 22380 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_15750 23378 22395 gene locus_tag LOCUS_15760 23378 22395 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680508.1 protein_id gnl|my_center|LOCUS_15760 23764 23375 gene locus_tag LOCUS_15770 23764 23375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 25499 23766 gene locus_tag LOCUS_15780 gene ilvB 25499 23766 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_15780 27299 25608 gene locus_tag LOCUS_15790 gene ilvD 27299 25608 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_15790 28513 27476 gene locus_tag LOCUS_15800 gene tsaD 28513 27476 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_15800 29569 28541 gene locus_tag LOCUS_15810 29569 28541 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680471.1 protein_id gnl|my_center|LOCUS_15810 30693 29740 gene locus_tag LOCUS_15820 30693 29740 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_15820 31441 30686 gene locus_tag LOCUS_15830 31441 30686 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_15830 32884 31526 gene locus_tag LOCUS_15840 32884 31526 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence28 201 629 gene locus_tag LOCUS_15850 201 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 818 633 gene locus_tag LOCUS_15860 818 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2997 904 gene locus_tag LOCUS_15870 2997 904 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680161.1 protein_id gnl|my_center|LOCUS_15870 3481 4989 gene locus_tag LOCUS_15880 3481 4989 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_15880 5035 6261 gene locus_tag LOCUS_15890 5035 6261 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_15890 7687 6338 gene locus_tag LOCUS_15900 7687 6338 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482935.1 protein_id gnl|my_center|LOCUS_15900 8390 7734 gene locus_tag LOCUS_15910 8390 7734 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 protein_id gnl|my_center|LOCUS_15910 9643 8405 gene locus_tag LOCUS_15920 9643 8405 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680777.1 protein_id gnl|my_center|LOCUS_15920 10982 9729 gene locus_tag LOCUS_15930 10982 9729 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667047.1 protein_id gnl|my_center|LOCUS_15930 11636 12481 gene locus_tag LOCUS_15940 11636 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 12672 13778 gene locus_tag LOCUS_15950 12672 13778 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681927.1 protein_id gnl|my_center|LOCUS_15950 13780 15132 gene locus_tag LOCUS_15960 13780 15132 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_15960 16214 15192 gene locus_tag LOCUS_15970 16214 15192 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_15970 16582 16857 gene locus_tag LOCUS_15980 16582 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 18209 16869 gene locus_tag LOCUS_15990 18209 16869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 18821 18896 gene locus_tag LOCUS_t00360 18821 18896 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18928 19959 gene locus_tag LOCUS_16000 gene pta 18928 19959 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_16000 20485 20006 gene locus_tag LOCUS_16010 20485 20006 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_16010 21176 20490 gene locus_tag LOCUS_16020 21176 20490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 22834 21218 gene locus_tag LOCUS_16030 gene lysS 22834 21218 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680521.1 protein_id gnl|my_center|LOCUS_16030 23092 24807 gene locus_tag LOCUS_16040 23092 24807 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682136.1 protein_id gnl|my_center|LOCUS_16040 25650 24811 gene locus_tag LOCUS_16050 25650 24811 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_16050 26161 26280 gene locus_tag LOCUS_16060 26161 26280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 28092 26353 gene locus_tag LOCUS_16070 gene ettA 28092 26353 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_16070 29022 28246 gene locus_tag LOCUS_16080 29022 28246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 30225 29434 gene locus_tag LOCUS_16090 30225 29434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 30864 30244 gene locus_tag LOCUS_16100 30864 30244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 31182 >32887 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttaatcccttaaatcaggtctatgtttttaat >Feature sequence29 1792 305 gene locus_tag LOCUS_16110 1792 305 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_16110 6336 1813 gene locus_tag LOCUS_16120 gene gltB 6336 1813 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_16120 6966 6547 gene locus_tag LOCUS_16130 6966 6547 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015709088.1 protein_id gnl|my_center|LOCUS_16130 7134 7847 gene locus_tag LOCUS_16140 7134 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 7932 9014 gene locus_tag LOCUS_16150 7932 9014 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_16150 9076 9855 gene locus_tag LOCUS_16160 9076 9855 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682131.1 protein_id gnl|my_center|LOCUS_16160 9866 10522 gene locus_tag LOCUS_16170 9866 10522 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_16170 10579 11346 gene locus_tag LOCUS_16180 10579 11346 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_16180 11348 12190 gene locus_tag LOCUS_16190 11348 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 13191 12193 gene locus_tag LOCUS_16200 13191 12193 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813556.1 protein_id gnl|my_center|LOCUS_16200 13422 14318 gene locus_tag LOCUS_16210 13422 14318 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675533.1 protein_id gnl|my_center|LOCUS_16210 15379 14321 gene locus_tag LOCUS_16220 15379 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680074.1 protein_id gnl|my_center|LOCUS_16220 17217 15406 gene locus_tag LOCUS_16230 17217 15406 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957184.1 protein_id gnl|my_center|LOCUS_16230 17371 17829 gene locus_tag LOCUS_16240 17371 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 17888 18376 gene locus_tag LOCUS_16250 17888 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680977.1 protein_id gnl|my_center|LOCUS_16250 18398 19033 gene locus_tag LOCUS_16260 18398 19033 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296332.1 protein_id gnl|my_center|LOCUS_16260 19096 21189 gene locus_tag LOCUS_16270 19096 21189 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_16270 21200 23179 gene locus_tag LOCUS_16280 21200 23179 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_16280 23202 24104 gene locus_tag LOCUS_16290 23202 24104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 24088 24675 gene locus_tag LOCUS_16300 24088 24675 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678865.1 protein_id gnl|my_center|LOCUS_16300 24666 25463 gene locus_tag LOCUS_16310 24666 25463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 25522 26742 gene locus_tag LOCUS_16320 gene mnmA 25522 26742 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_16320 27602 26739 gene locus_tag LOCUS_16330 27602 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 28670 27693 gene locus_tag LOCUS_16340 28670 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 29037 30536 gene locus_tag LOCUS_16350 29037 30536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 31775 30777 gene locus_tag LOCUS_16360 gene rhuM 31775 30777 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence30 423 211 gene locus_tag LOCUS_16370 423 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 549 1880 gene locus_tag LOCUS_16380 549 1880 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_16380 2023 2871 gene locus_tag LOCUS_16390 2023 2871 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 protein_id gnl|my_center|LOCUS_16390 2868 3713 gene locus_tag LOCUS_16400 2868 3713 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 protein_id gnl|my_center|LOCUS_16400 3807 4844 gene locus_tag LOCUS_16410 3807 4844 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294322.1 protein_id gnl|my_center|LOCUS_16410 4869 6353 gene locus_tag LOCUS_16420 gene malQ 4869 6353 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747291.1 protein_id gnl|my_center|LOCUS_16420 6554 8713 gene locus_tag LOCUS_16430 6554 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 8774 10099 gene locus_tag LOCUS_16440 8774 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10223 12055 gene locus_tag LOCUS_16450 gene aspS 10223 12055 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679265.1 protein_id gnl|my_center|LOCUS_16450 12230 12862 gene locus_tag LOCUS_16460 12230 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 12874 14037 gene locus_tag LOCUS_16470 12874 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 14517 14092 gene locus_tag LOCUS_16480 14517 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 14748 16559 gene locus_tag LOCUS_16490 14748 16559 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_16490 16806 19271 gene locus_tag LOCUS_16500 16806 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 19283 20668 gene locus_tag LOCUS_16510 19283 20668 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545202.1 protein_id gnl|my_center|LOCUS_16510 20698 21993 gene locus_tag LOCUS_16520 gene hisF 20698 21993 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592610.1 protein_id gnl|my_center|LOCUS_16520 22008 23180 gene locus_tag LOCUS_16530 22008 23180 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_16530 24028 23252 gene locus_tag LOCUS_16540 24028 23252 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_16540 25001 24000 gene locus_tag LOCUS_16550 gene lgt 25001 24000 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678985.1 protein_id gnl|my_center|LOCUS_16550 26158 25007 gene locus_tag LOCUS_16560 26158 25007 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678981.1 protein_id gnl|my_center|LOCUS_16560 26297 27016 gene locus_tag LOCUS_16570 26297 27016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 27255 28007 gene locus_tag LOCUS_16580 27255 28007 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_16580 28004 28615 gene locus_tag LOCUS_16590 28004 28615 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082686.1 protein_id gnl|my_center|LOCUS_16590 28826 29005 gene locus_tag LOCUS_16600 28826 29005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 29108 30055 gene locus_tag LOCUS_16610 29108 30055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 30312 31679 gene locus_tag LOCUS_16620 30312 31679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence31 1593 757 gene locus_tag LOCUS_16630 1593 757 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679585.1 protein_id gnl|my_center|LOCUS_16630 2469 1654 gene locus_tag LOCUS_16640 2469 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3469 2546 gene locus_tag LOCUS_16650 gene ricT 3469 2546 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680971.1 protein_id gnl|my_center|LOCUS_16650 4040 3498 gene locus_tag LOCUS_16660 4040 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 4458 4042 gene locus_tag LOCUS_16670 4458 4042 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680969.1 protein_id gnl|my_center|LOCUS_16670 5473 4460 gene locus_tag LOCUS_16680 5473 4460 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666722.1 protein_id gnl|my_center|LOCUS_16680 5744 6529 gene locus_tag LOCUS_16690 5744 6529 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_16690 6526 7536 gene locus_tag LOCUS_16700 gene dusB 6526 7536 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680788.1 protein_id gnl|my_center|LOCUS_16700 7605 9185 gene locus_tag LOCUS_16710 7605 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 9187 10344 gene locus_tag LOCUS_16720 9187 10344 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956680.1 protein_id gnl|my_center|LOCUS_16720 10341 10964 gene locus_tag LOCUS_16730 10341 10964 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666681.1 protein_id gnl|my_center|LOCUS_16730 10955 11683 gene locus_tag LOCUS_16740 10955 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666686.1 protein_id gnl|my_center|LOCUS_16740 11707 12141 gene locus_tag LOCUS_16750 11707 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 12232 13803 gene locus_tag LOCUS_16760 12232 13803 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_16760 13858 15927 gene locus_tag LOCUS_16770 13858 15927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 17273 15924 gene locus_tag LOCUS_16780 gene radA 17273 15924 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680482.1 protein_id gnl|my_center|LOCUS_16780 17340 18002 gene locus_tag LOCUS_16790 gene pgsA 17340 18002 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667297.1 protein_id gnl|my_center|LOCUS_16790 18176 18550 gene locus_tag LOCUS_16800 18176 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 19333 18596 gene locus_tag LOCUS_16810 19333 18596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 19420 19959 gene locus_tag LOCUS_16820 19420 19959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 20841 20005 gene locus_tag LOCUS_16830 gene thyX 20841 20005 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_16830 22877 20865 gene locus_tag LOCUS_16840 22877 20865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 23914 22904 gene locus_tag LOCUS_16850 23914 22904 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680516.1 protein_id gnl|my_center|LOCUS_16850 25542 24301 gene locus_tag LOCUS_16860 25542 24301 CDS product IS110-like element ISDha12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808714.1 protein_id gnl|my_center|LOCUS_16860 26121 25762 gene locus_tag LOCUS_16870 26121 25762 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence32 468 160 gene locus_tag LOCUS_16880 468 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2513 564 gene locus_tag LOCUS_16890 2513 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 4195 2633 gene locus_tag LOCUS_16900 4195 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 4312 4644 gene locus_tag LOCUS_16910 4312 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 5031 5363 gene locus_tag LOCUS_16920 5031 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 5363 6094 gene locus_tag LOCUS_16930 5363 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 6301 7071 gene locus_tag LOCUS_16940 6301 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 7206 7994 gene locus_tag LOCUS_16950 7206 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 8069 9583 gene locus_tag LOCUS_16960 8069 9583 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_16960 9695 9907 gene locus_tag LOCUS_16970 gene rpsU 9695 9907 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673965.1 protein_id gnl|my_center|LOCUS_16970 9993 10700 gene locus_tag LOCUS_16980 9993 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 11826 10714 gene locus_tag LOCUS_16990 11826 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 12095 12841 gene locus_tag LOCUS_17000 12095 12841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 16642 12845 gene locus_tag LOCUS_17010 16642 12845 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680941.1 protein_id gnl|my_center|LOCUS_17010 19518 16639 gene locus_tag LOCUS_17020 19518 16639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 21801 19741 gene locus_tag LOCUS_17030 21801 19741 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044978168.1 protein_id gnl|my_center|LOCUS_17030 22098 23309 gene locus_tag LOCUS_17040 22098 23309 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062984.1 protein_id gnl|my_center|LOCUS_17040 23366 24406 gene locus_tag LOCUS_17050 23366 24406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 24403 25119 gene locus_tag LOCUS_17060 24403 25119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 25189 25851 gene locus_tag LOCUS_17070 gene pth 25189 25851 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672368.1 protein_id gnl|my_center|LOCUS_17070 25864 26700 gene locus_tag LOCUS_17080 gene mazG 25864 26700 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680184.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence33 350 4864 gene locus_tag LOCUS_17090 350 4864 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_17090 4904 6289 gene locus_tag LOCUS_17100 4904 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679186.1 protein_id gnl|my_center|LOCUS_17100 6276 9161 gene locus_tag LOCUS_17110 6276 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 9168 10817 gene locus_tag LOCUS_17120 9168 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 10856 11470 gene locus_tag LOCUS_17130 10856 11470 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_17130 11472 11882 gene locus_tag LOCUS_17140 11472 11882 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_17140 11879 12880 gene locus_tag LOCUS_17150 11879 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 12904 13575 gene locus_tag LOCUS_17160 12904 13575 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_17160 13617 19052 gene locus_tag LOCUS_17170 13617 19052 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889758.1 protein_id gnl|my_center|LOCUS_17170 19561 19920 gene locus_tag LOCUS_17180 19561 19920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 19895 20023 gene locus_tag LOCUS_17190 19895 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 20016 21428 gene locus_tag LOCUS_17200 20016 21428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 21458 21895 gene locus_tag LOCUS_17210 21458 21895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 22673 22203 gene locus_tag LOCUS_17220 22673 22203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 22839 22567 gene locus_tag LOCUS_17230 22839 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 23515 23042 gene locus_tag LOCUS_17240 23515 23042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 24102 23665 gene locus_tag LOCUS_17250 24102 23665 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788828.1 protein_id gnl|my_center|LOCUS_17250 24760 24323 gene locus_tag LOCUS_17260 24760 24323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680353.1 protein_id gnl|my_center|LOCUS_17260 25334 24774 gene locus_tag LOCUS_17270 25334 24774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 26474 25338 gene locus_tag LOCUS_17280 26474 25338 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence34 263 856 gene locus_tag LOCUS_17290 gene rpsD 263 856 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401493.1 protein_id gnl|my_center|LOCUS_17290 1944 928 gene locus_tag LOCUS_17300 gene holA 1944 928 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681969.1 protein_id gnl|my_center|LOCUS_17300 2560 1946 gene locus_tag LOCUS_17310 gene lexA 2560 1946 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_17310 2866 2564 gene locus_tag LOCUS_17320 2866 2564 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_17320 3852 2863 gene locus_tag LOCUS_17330 gene hprK 3852 2863 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_17330 3901 4665 gene locus_tag LOCUS_17340 3901 4665 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667426.1 protein_id gnl|my_center|LOCUS_17340 4767 6857 gene locus_tag LOCUS_17350 4767 6857 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665246.1 protein_id gnl|my_center|LOCUS_17350 6995 8578 gene locus_tag LOCUS_17360 6995 8578 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681501.1 protein_id gnl|my_center|LOCUS_17360 11366 8490 gene locus_tag LOCUS_17370 11366 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 14005 11486 gene locus_tag LOCUS_17380 14005 11486 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_17380 14419 14057 gene locus_tag LOCUS_17390 14419 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 14751 14440 gene locus_tag LOCUS_17400 14751 14440 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461875.1 protein_id gnl|my_center|LOCUS_17400 16117 14939 gene locus_tag LOCUS_17410 16117 14939 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_17410 17253 16132 gene locus_tag LOCUS_17420 gene serC 17253 16132 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_17420 18367 17510 gene locus_tag LOCUS_17430 18367 17510 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681579.1 protein_id gnl|my_center|LOCUS_17430 19052 18396 gene locus_tag LOCUS_17440 19052 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 20103 19294 gene locus_tag LOCUS_17450 20103 19294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 20533 20414 gene locus_tag LOCUS_17460 20533 20414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 20826 20614 gene locus_tag LOCUS_17470 20826 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 21152 21000 gene locus_tag LOCUS_17480 21152 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 21156 21521 gene locus_tag LOCUS_17490 21156 21521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 21889 21539 gene locus_tag LOCUS_17500 21889 21539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 22575 22162 gene locus_tag LOCUS_17510 22575 22162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 23544 22900 gene locus_tag LOCUS_17520 23544 22900 CDS product LytS/YhcK type 5TM receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289479.1 protein_id gnl|my_center|LOCUS_17520 24218 23541 gene locus_tag LOCUS_17530 24218 23541 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101433.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence35 363 1340 gene locus_tag LOCUS_17540 gene hflK 363 1340 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_17540 1324 2328 gene locus_tag LOCUS_17550 gene hflC 1324 2328 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_17550 2325 3947 gene locus_tag LOCUS_17560 2325 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 4079 5575 gene locus_tag LOCUS_17570 4079 5575 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_17570 5658 5730 gene locus_tag LOCUS_t00370 5658 5730 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7465 6023 gene locus_tag LOCUS_17580 7465 6023 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680943.1 protein_id gnl|my_center|LOCUS_17580 8926 7475 gene locus_tag LOCUS_17590 gene trkA 8926 7475 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676352.1 protein_id gnl|my_center|LOCUS_17590 9057 9890 gene locus_tag LOCUS_17600 gene uppP 9057 9890 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_17600 11368 10016 gene locus_tag LOCUS_17610 gene purD 11368 10016 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964705.1 protein_id gnl|my_center|LOCUS_17610 12021 11443 gene locus_tag LOCUS_17620 12021 11443 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681594.1 protein_id gnl|my_center|LOCUS_17620 12755 12024 gene locus_tag LOCUS_17630 gene pyrH 12755 12024 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_17630 14484 12775 gene locus_tag LOCUS_17640 14484 12775 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680944.1 protein_id gnl|my_center|LOCUS_17640 15202 14486 gene locus_tag LOCUS_17650 15202 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 15740 15186 gene locus_tag LOCUS_17660 15740 15186 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666766.1 protein_id gnl|my_center|LOCUS_17660 17309 15777 gene locus_tag LOCUS_17670 17309 15777 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_17670 17495 18361 gene locus_tag LOCUS_17680 gene murB 17495 18361 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680945.1 protein_id gnl|my_center|LOCUS_17680 18370 19569 gene locus_tag LOCUS_17690 18370 19569 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673293.1 protein_id gnl|my_center|LOCUS_17690 19559 20104 gene locus_tag LOCUS_17700 19559 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680920.1 protein_id gnl|my_center|LOCUS_17700 20108 20560 gene locus_tag LOCUS_17710 20108 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 21721 20567 gene locus_tag LOCUS_17720 21721 20567 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681112.1 protein_id gnl|my_center|LOCUS_17720 22641 21739 gene locus_tag LOCUS_17730 22641 21739 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681114.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence36 28 119 gene locus_tag LOCUS_r00030 28 119 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 77 percent of the 5S ribosomal RNA 784 248 gene locus_tag LOCUS_17740 784 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2331 781 gene locus_tag LOCUS_17750 gene lnt 2331 781 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680216.1 protein_id gnl|my_center|LOCUS_17750 2611 3825 gene locus_tag LOCUS_17760 2611 3825 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667821.1 protein_id gnl|my_center|LOCUS_17760 3822 4628 gene locus_tag LOCUS_17770 gene surE 3822 4628 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082178.1 protein_id gnl|my_center|LOCUS_17770 4640 5338 gene locus_tag LOCUS_17780 4640 5338 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680214.1 protein_id gnl|my_center|LOCUS_17780 5338 7386 gene locus_tag LOCUS_17790 5338 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680210.1 protein_id gnl|my_center|LOCUS_17790 8560 7337 gene locus_tag LOCUS_17800 gene dinB 8560 7337 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956849.1 protein_id gnl|my_center|LOCUS_17800 10535 8544 gene locus_tag LOCUS_17810 10535 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 10882 12048 gene locus_tag LOCUS_17820 10882 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670701.1 protein_id gnl|my_center|LOCUS_17820 12178 12678 gene locus_tag LOCUS_17830 12178 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 12702 13433 gene locus_tag LOCUS_17840 gene trmB 12702 13433 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_17840 13438 15393 gene locus_tag LOCUS_17850 gene ligA 13438 15393 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679195.1 protein_id gnl|my_center|LOCUS_17850 16370 15390 gene locus_tag LOCUS_17860 16370 15390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 18565 16400 gene locus_tag LOCUS_17870 gene recJ 18565 16400 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680035.1 protein_id gnl|my_center|LOCUS_17870 19890 18565 gene locus_tag LOCUS_17880 19890 18565 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680036.1 protein_id gnl|my_center|LOCUS_17880 20222 20944 gene locus_tag LOCUS_17890 20222 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 21793 21041 gene locus_tag LOCUS_17900 21793 21041 CDS product DNA repair protein RecO C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681503.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence37 259 177 gene locus_tag LOCUS_t00380 259 177 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 337 265 gene locus_tag LOCUS_t00390 337 265 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 531 1736 gene locus_tag LOCUS_17910 531 1736 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_17910 1733 3214 gene locus_tag LOCUS_17920 gene glgA 1733 3214 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679256.1 protein_id gnl|my_center|LOCUS_17920 3319 4404 gene locus_tag LOCUS_17930 gene trpS 3319 4404 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_17930 4474 5403 gene locus_tag LOCUS_17940 4474 5403 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_17940 6524 5400 gene locus_tag LOCUS_17950 gene pcnB 6524 5400 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669419.1 protein_id gnl|my_center|LOCUS_17950 7473 6610 gene locus_tag LOCUS_17960 7473 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_17960 8421 7477 gene locus_tag LOCUS_17970 8421 7477 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678971.1 protein_id gnl|my_center|LOCUS_17970 8636 8941 gene locus_tag LOCUS_17980 8636 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8943 10337 gene locus_tag LOCUS_17990 8943 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 10398 11672 gene locus_tag LOCUS_18000 10398 11672 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678974.1 protein_id gnl|my_center|LOCUS_18000 11683 12759 gene locus_tag LOCUS_18010 11683 12759 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678975.1 protein_id gnl|my_center|LOCUS_18010 12761 13264 gene locus_tag LOCUS_18020 12761 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 13292 13906 gene locus_tag LOCUS_18030 13292 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 13908 14465 gene locus_tag LOCUS_18040 13908 14465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 14462 15064 gene locus_tag LOCUS_18050 14462 15064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 15074 17053 gene locus_tag LOCUS_18060 15074 17053 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956965.1 protein_id gnl|my_center|LOCUS_18060 18186 17059 gene locus_tag LOCUS_18070 18186 17059 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658082.1 protein_id gnl|my_center|LOCUS_18070 20532 18205 gene locus_tag LOCUS_18080 gene metG 20532 18205 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682373.1 protein_id gnl|my_center|LOCUS_18080 21067 20744 gene locus_tag LOCUS_18090 21067 20744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence38 283 894 gene locus_tag LOCUS_18100 283 894 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667667.1 protein_id gnl|my_center|LOCUS_18100 905 1834 gene locus_tag LOCUS_18110 905 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1905 2765 gene locus_tag LOCUS_18120 1905 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2762 3427 gene locus_tag LOCUS_18130 2762 3427 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680333.1 protein_id gnl|my_center|LOCUS_18130 5707 3638 gene locus_tag LOCUS_18140 gene ftsH 5707 3638 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666001.1 protein_id gnl|my_center|LOCUS_18140 6756 5845 gene locus_tag LOCUS_18150 6756 5845 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_18150 7745 6768 gene locus_tag LOCUS_18160 7745 6768 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_18160 9243 7909 gene locus_tag LOCUS_18170 9243 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 9447 10088 gene locus_tag LOCUS_18180 9447 10088 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943184.1 protein_id gnl|my_center|LOCUS_18180 10105 10716 gene locus_tag LOCUS_18190 gene yihX 10105 10716 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209011.1 protein_id gnl|my_center|LOCUS_18190 11543 10713 gene locus_tag LOCUS_18200 11543 10713 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681821.1 protein_id gnl|my_center|LOCUS_18200 11868 11536 gene locus_tag LOCUS_18210 11868 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 14155 11903 gene locus_tag LOCUS_18220 14155 11903 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681817.1 protein_id gnl|my_center|LOCUS_18220 15559 14159 gene locus_tag LOCUS_18230 15559 14159 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672386.1 protein_id gnl|my_center|LOCUS_18230 16841 15693 gene locus_tag LOCUS_18240 gene dnaJ 16841 15693 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002686888.1 protein_id gnl|my_center|LOCUS_18240 18868 16919 gene locus_tag LOCUS_18250 gene dnaK 18868 16919 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681815.1 protein_id gnl|my_center|LOCUS_18250 19573 18914 gene locus_tag LOCUS_18260 19573 18914 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681814.1 protein_id gnl|my_center|LOCUS_18260 21025 19661 gene locus_tag LOCUS_18270 21025 19661 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence39 508 317 gene locus_tag LOCUS_18280 508 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 687 466 gene locus_tag LOCUS_18290 687 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 3451 866 gene locus_tag LOCUS_18300 gene clpB 3451 866 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680241.1 protein_id gnl|my_center|LOCUS_18300 4694 3513 gene locus_tag LOCUS_18310 4694 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 5033 4812 gene locus_tag LOCUS_18320 5033 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 8059 5075 gene locus_tag LOCUS_18330 8059 5075 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679557.1 protein_id gnl|my_center|LOCUS_18330 9330 8056 gene locus_tag LOCUS_18340 9330 8056 CDS product FliG C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678791.1 protein_id gnl|my_center|LOCUS_18340 9483 10970 gene locus_tag LOCUS_18350 9483 10970 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674333.1 protein_id gnl|my_center|LOCUS_18350 11301 11831 gene locus_tag LOCUS_18360 11301 11831 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_18360 12842 11844 gene locus_tag LOCUS_18370 12842 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 13866 12829 gene locus_tag LOCUS_18380 gene asnA 13866 12829 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_18380 15415 13907 gene locus_tag LOCUS_18390 gene galT 15415 13907 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_18390 15539 16408 gene locus_tag LOCUS_18400 15539 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 16418 17596 gene locus_tag LOCUS_18410 16418 17596 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679158.1 protein_id gnl|my_center|LOCUS_18410 17587 20169 gene locus_tag LOCUS_18420 17587 20169 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971578.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence40 1 216 gene locus_tag LOCUS_18430 1 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 257 1078 gene locus_tag LOCUS_18440 257 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1145 1897 gene locus_tag LOCUS_18450 1145 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1921 2646 gene locus_tag LOCUS_18460 1921 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3986 2859 gene locus_tag LOCUS_18470 3986 2859 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_18470 4521 4060 gene locus_tag LOCUS_18480 4521 4060 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966759.1 protein_id gnl|my_center|LOCUS_18480 4663 5532 gene locus_tag LOCUS_18490 4663 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 5542 6480 gene locus_tag LOCUS_18500 5542 6480 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_18500 6548 7357 gene locus_tag LOCUS_18510 6548 7357 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_18510 7550 8455 gene locus_tag LOCUS_18520 7550 8455 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_18520 10029 9349 gene locus_tag LOCUS_18530 10029 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 10257 10042 gene locus_tag LOCUS_18540 10257 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 11532 10306 gene locus_tag LOCUS_18550 11532 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 12353 11556 gene locus_tag LOCUS_18560 12353 11556 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878650.1 protein_id gnl|my_center|LOCUS_18560 12955 12599 gene locus_tag LOCUS_18570 12955 12599 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263342.1 protein_id gnl|my_center|LOCUS_18570 13600 13040 gene locus_tag LOCUS_18580 13600 13040 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_18580 14133 13699 gene locus_tag LOCUS_18590 14133 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 15937 14168 gene locus_tag LOCUS_18600 15937 14168 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_18600 16159 16878 gene locus_tag LOCUS_18610 16159 16878 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_18610 16902 17672 gene locus_tag LOCUS_18620 16902 17672 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815081.1 protein_id gnl|my_center|LOCUS_18620 18675 17806 gene locus_tag LOCUS_18630 18675 17806 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_18630 19355 18840 gene locus_tag LOCUS_18640 19355 18840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence41 2341 287 gene locus_tag LOCUS_18650 2341 287 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_18650 2906 2514 gene locus_tag LOCUS_18660 2906 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3994 3044 gene locus_tag LOCUS_18670 3994 3044 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_18670 5062 4100 gene locus_tag LOCUS_18680 5062 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5169 6179 gene locus_tag LOCUS_18690 5169 6179 CDS product ATP/GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616490.1 protein_id gnl|my_center|LOCUS_18690 6176 6814 gene locus_tag LOCUS_18700 6176 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 7204 7437 gene locus_tag LOCUS_18710 7204 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 7383 7721 gene locus_tag LOCUS_18720 7383 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 9154 7952 gene locus_tag LOCUS_18730 9154 7952 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203519.1 protein_id gnl|my_center|LOCUS_18730 10720 9158 gene locus_tag LOCUS_18740 10720 9158 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103238290.1 protein_id gnl|my_center|LOCUS_18740 12435 10732 gene locus_tag LOCUS_18750 12435 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 12562 12644 gene locus_tag LOCUS_t00400 12562 12644 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12765 12935 gene locus_tag LOCUS_18760 12765 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 12932 13564 gene locus_tag LOCUS_18770 12932 13564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 13667 15397 gene locus_tag LOCUS_18780 gene ade 13667 15397 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_18780 15450 17855 gene locus_tag LOCUS_18790 gene lon 15450 17855 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681876.1 protein_id gnl|my_center|LOCUS_18790 17859 18581 gene locus_tag LOCUS_18800 17859 18581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 18810 18529 gene locus_tag LOCUS_18810 18810 18529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence42 13 669 gene locus_tag LOCUS_18820 13 669 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 protein_id gnl|my_center|LOCUS_18820 824 1234 gene locus_tag LOCUS_18830 824 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1263 1589 gene locus_tag LOCUS_18840 1263 1589 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438776.1 protein_id gnl|my_center|LOCUS_18840 1634 1762 gene locus_tag LOCUS_18850 1634 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3320 2202 gene locus_tag LOCUS_18860 3320 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 4597 3317 gene locus_tag LOCUS_18870 gene dcm 4597 3317 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963014.1 protein_id gnl|my_center|LOCUS_18870 6169 4784 gene locus_tag LOCUS_18880 6169 4784 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_18880 8198 6522 gene locus_tag LOCUS_18890 8198 6522 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_18890 9151 8198 gene locus_tag LOCUS_18900 9151 8198 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167364873.1 protein_id gnl|my_center|LOCUS_18900 10000 9182 gene locus_tag LOCUS_18910 10000 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 10357 10061 gene locus_tag LOCUS_18920 10357 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 10729 11532 gene locus_tag LOCUS_18930 10729 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 11545 12225 gene locus_tag LOCUS_18940 11545 12225 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_18940 12493 13971 gene locus_tag LOCUS_18950 12493 13971 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_18950 14089 14244 gene locus_tag LOCUS_18960 14089 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 14320 15282 gene locus_tag LOCUS_18970 14320 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 15438 16265 gene locus_tag LOCUS_18980 15438 16265 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_18980 16284 17774 gene locus_tag LOCUS_18990 gene gltA 16284 17774 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_18990 18734 17808 gene locus_tag LOCUS_19000 18734 17808 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence43 673 2853 gene locus_tag LOCUS_19010 673 2853 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_19010 3058 3972 gene locus_tag LOCUS_19020 3058 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3984 5015 gene locus_tag LOCUS_19030 gene cmr1 3984 5015 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880201.1 protein_id gnl|my_center|LOCUS_19030 5012 7789 gene locus_tag LOCUS_19040 gene cas10 5012 7789 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274454.1 protein_id gnl|my_center|LOCUS_19040 7786 8760 gene locus_tag LOCUS_19050 7786 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 8789 9685 gene locus_tag LOCUS_19060 gene cmr4 8789 9685 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_19060 9687 10082 gene locus_tag LOCUS_19070 9687 10082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 10072 11259 gene locus_tag LOCUS_19080 10072 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 11271 12731 gene locus_tag LOCUS_19090 11271 12731 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016217.1 protein_id gnl|my_center|LOCUS_19090 12744 13865 gene locus_tag LOCUS_19100 12744 13865 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545976.1 protein_id gnl|my_center|LOCUS_19100 13877 14266 gene locus_tag LOCUS_19110 13877 14266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 14370 14588 gene locus_tag LOCUS_19120 14370 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 14588 15079 gene locus_tag LOCUS_19130 14588 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 15076 15291 gene locus_tag LOCUS_19140 15076 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 15315 16415 gene locus_tag LOCUS_19150 15315 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 16412 16687 gene locus_tag LOCUS_19160 16412 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 16695 16988 gene locus_tag LOCUS_19170 16695 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 17241 >18918 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attaaaaacatagacctgatttaagggattaaaa >Feature sequence44 661 152 gene locus_tag LOCUS_19180 661 152 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_19180 882 658 gene locus_tag LOCUS_19190 882 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1220 1005 gene locus_tag LOCUS_19200 1220 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2259 1522 gene locus_tag LOCUS_19210 2259 1522 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682279.1 protein_id gnl|my_center|LOCUS_19210 2382 2603 gene locus_tag LOCUS_19220 2382 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670390.1 protein_id gnl|my_center|LOCUS_19220 3556 2600 gene locus_tag LOCUS_19230 gene miaA 3556 2600 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_19230 4808 3561 gene locus_tag LOCUS_19240 4808 3561 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_19240 6193 4922 gene locus_tag LOCUS_19250 6193 4922 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679428.1 protein_id gnl|my_center|LOCUS_19250 8423 6288 gene locus_tag LOCUS_19260 8423 6288 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678736.1 protein_id gnl|my_center|LOCUS_19260 9236 8454 gene locus_tag LOCUS_19270 9236 8454 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678735.1 protein_id gnl|my_center|LOCUS_19270 9739 9245 gene locus_tag LOCUS_19280 gene ybeY 9739 9245 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668517.1 protein_id gnl|my_center|LOCUS_19280 11541 9739 gene locus_tag LOCUS_19290 11541 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 12460 11528 gene locus_tag LOCUS_19300 12460 11528 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678733.1 protein_id gnl|my_center|LOCUS_19300 13150 12530 gene locus_tag LOCUS_19310 13150 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669375.1 protein_id gnl|my_center|LOCUS_19310 15928 13190 gene locus_tag LOCUS_19320 15928 13190 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678931.1 protein_id gnl|my_center|LOCUS_19320 17684 16887 gene locus_tag LOCUS_19330 17684 16887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence45 1100 84 gene locus_tag LOCUS_19340 1100 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1415 1125 gene locus_tag LOCUS_19350 1415 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2032 2340 gene locus_tag LOCUS_19360 2032 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2475 3455 gene locus_tag LOCUS_19370 2475 3455 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_19370 3484 3726 gene locus_tag LOCUS_19380 3484 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 3668 5056 gene locus_tag LOCUS_19390 3668 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 6813 5236 gene locus_tag LOCUS_19400 gene modF 6813 5236 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096881.1 protein_id gnl|my_center|LOCUS_19400 7729 6836 gene locus_tag LOCUS_19410 gene ilvY 7729 6836 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_19410 7808 8632 gene locus_tag LOCUS_19420 7808 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 8771 9844 gene locus_tag LOCUS_19430 8771 9844 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920597.1 protein_id gnl|my_center|LOCUS_19430 9837 10361 gene locus_tag LOCUS_19440 9837 10361 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671188.1 protein_id gnl|my_center|LOCUS_19440 10382 10792 gene locus_tag LOCUS_19450 10382 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 10800 11360 gene locus_tag LOCUS_19460 10800 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 11350 12078 gene locus_tag LOCUS_19470 11350 12078 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669890.1 protein_id gnl|my_center|LOCUS_19470 12062 12808 gene locus_tag LOCUS_19480 gene lptB 12062 12808 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681841.1 protein_id gnl|my_center|LOCUS_19480 13005 12919 gene locus_tag LOCUS_t00410 13005 12919 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13144 13070 gene locus_tag LOCUS_t00420 13144 13070 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13265 13179 gene locus_tag LOCUS_t00430 13265 13179 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13357 13270 gene locus_tag LOCUS_t00440 13357 13270 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13566 15725 gene locus_tag LOCUS_19490 13566 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 15748 16827 gene locus_tag LOCUS_19500 15748 16827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 17096 17815 gene locus_tag LOCUS_19510 17096 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence46 651 217 gene locus_tag LOCUS_19520 651 217 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668975.1 protein_id gnl|my_center|LOCUS_19520 1149 667 gene locus_tag LOCUS_19530 1149 667 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668974.1 protein_id gnl|my_center|LOCUS_19530 2592 1183 gene locus_tag LOCUS_19540 2592 1183 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671242.1 protein_id gnl|my_center|LOCUS_19540 4986 2596 gene locus_tag LOCUS_19550 4986 2596 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671244.1 protein_id gnl|my_center|LOCUS_19550 5158 6408 gene locus_tag LOCUS_19560 5158 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 7032 6412 gene locus_tag LOCUS_19570 7032 6412 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_19570 7715 7218 gene locus_tag LOCUS_19580 7715 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 8335 7712 gene locus_tag LOCUS_19590 8335 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 9723 8338 gene locus_tag LOCUS_19600 9723 8338 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_19600 11510 9720 gene locus_tag LOCUS_19610 11510 9720 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_19610 12145 11507 gene locus_tag LOCUS_19620 12145 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 12638 12309 gene locus_tag LOCUS_19630 12638 12309 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_19630 13040 12714 gene locus_tag LOCUS_19640 13040 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 15090 13102 gene locus_tag LOCUS_19650 15090 13102 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_19650 16114 15083 gene locus_tag LOCUS_19660 16114 15083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 16432 16124 gene locus_tag LOCUS_19670 16432 16124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 16923 16465 gene locus_tag LOCUS_19680 16923 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 17306 16965 gene locus_tag LOCUS_19690 17306 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence47 161 427 gene locus_tag LOCUS_19700 161 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2292 430 gene locus_tag LOCUS_19710 2292 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2894 2364 gene locus_tag LOCUS_19720 2894 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 3622 2951 gene locus_tag LOCUS_19730 3622 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4440 3529 gene locus_tag LOCUS_19740 4440 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5989 4670 gene locus_tag LOCUS_19750 5989 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 6520 7173 gene locus_tag LOCUS_19760 6520 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 8657 7170 gene locus_tag LOCUS_19770 8657 7170 CDS product pallilysin-related adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682100.1 protein_id gnl|my_center|LOCUS_19770 9634 9002 gene locus_tag LOCUS_19780 9634 9002 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670667.1 protein_id gnl|my_center|LOCUS_19780 10944 9712 gene locus_tag LOCUS_19790 gene tyrS 10944 9712 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_19790 11133 11062 gene locus_tag LOCUS_t00450 11133 11062 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11241 11169 gene locus_tag LOCUS_t00460 11241 11169 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12104 11631 gene locus_tag LOCUS_19800 12104 11631 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_19800 13375 12131 gene locus_tag LOCUS_19810 13375 12131 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_19810 14438 13386 gene locus_tag LOCUS_19820 gene sufD 14438 13386 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_19820 15864 14449 gene locus_tag LOCUS_19830 gene sufB 15864 14449 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_19830 16718 15879 gene locus_tag LOCUS_19840 gene sufC 16718 15879 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence48 481 2169 gene locus_tag LOCUS_19850 481 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3103 2678 gene locus_tag LOCUS_19860 3103 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3273 3124 gene locus_tag LOCUS_19870 3273 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 6003 3988 gene locus_tag LOCUS_19880 6003 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 7655 6369 gene locus_tag LOCUS_19890 7655 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 8776 7697 gene locus_tag LOCUS_19900 8776 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 8973 8788 gene locus_tag LOCUS_19910 8973 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 9219 8992 gene locus_tag LOCUS_19920 9219 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 10034 9285 gene locus_tag LOCUS_19930 10034 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 10418 10233 gene locus_tag LOCUS_19940 10418 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 10682 12013 gene locus_tag LOCUS_19950 10682 12013 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_19950 12091 12693 gene locus_tag LOCUS_19960 12091 12693 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357892.1 protein_id gnl|my_center|LOCUS_19960 13130 12873 gene locus_tag LOCUS_19970 13130 12873 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679244.1 protein_id gnl|my_center|LOCUS_19970 13405 13605 gene locus_tag LOCUS_19980 13405 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 13939 14916 gene locus_tag LOCUS_19990 13939 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence49 143 1342 gene locus_tag LOCUS_20000 143 1342 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_20000 1402 3183 gene locus_tag LOCUS_20010 1402 3183 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679748.1 protein_id gnl|my_center|LOCUS_20010 3244 3894 gene locus_tag LOCUS_20020 3244 3894 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669823.1 protein_id gnl|my_center|LOCUS_20020 3945 5300 gene locus_tag LOCUS_20030 3945 5300 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_20030 6199 5327 gene locus_tag LOCUS_20040 6199 5327 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678797.1 protein_id gnl|my_center|LOCUS_20040 7038 6247 gene locus_tag LOCUS_20050 gene dapB 7038 6247 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933509.1 protein_id gnl|my_center|LOCUS_20050 8382 7057 gene locus_tag LOCUS_20060 8382 7057 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_20060 9752 8397 gene locus_tag LOCUS_20070 9752 8397 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_20070 9803 11236 gene locus_tag LOCUS_20080 gene rpoN 9803 11236 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680335.1 protein_id gnl|my_center|LOCUS_20080 11601 11311 gene locus_tag LOCUS_20090 11601 11311 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671537.1 protein_id gnl|my_center|LOCUS_20090 11785 12099 gene locus_tag LOCUS_20100 11785 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 13769 12180 gene locus_tag LOCUS_20110 13769 12180 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_20110 15023 14478 gene locus_tag LOCUS_20120 15023 14478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 <15949 15286 gene locus_tag LOCUS_20130 <15949 15286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973998.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence50 273 1124 gene locus_tag LOCUS_20140 273 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3604 1178 gene locus_tag LOCUS_20150 3604 1178 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108570.1 protein_id gnl|my_center|LOCUS_20150 4153 3653 gene locus_tag LOCUS_20160 4153 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 4486 4256 gene locus_tag LOCUS_20170 4486 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 4559 4870 gene locus_tag LOCUS_20180 4559 4870 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_20180 4821 5105 gene locus_tag LOCUS_20190 4821 5105 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957057.1 protein_id gnl|my_center|LOCUS_20190 5173 5295 gene locus_tag LOCUS_20200 5173 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 5337 6461 gene locus_tag LOCUS_20210 5337 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 6958 6794 gene locus_tag LOCUS_20220 6958 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 8528 7317 gene locus_tag LOCUS_20230 8528 7317 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_20230 9731 8910 gene locus_tag LOCUS_20240 9731 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 10791 9754 gene locus_tag LOCUS_20250 10791 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 11904 10807 gene locus_tag LOCUS_20260 11904 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 12912 11950 gene locus_tag LOCUS_20270 12912 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 13065 13412 gene locus_tag LOCUS_20280 13065 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 13460 13627 gene locus_tag LOCUS_20290 13460 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 14235 13552 gene locus_tag LOCUS_20300 14235 13552 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378947.1 protein_id gnl|my_center|LOCUS_20300 14480 14232 gene locus_tag LOCUS_20310 14480 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 14668 14880 gene locus_tag LOCUS_20320 14668 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 14877 15215 gene locus_tag LOCUS_20330 14877 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 15453 15280 gene locus_tag LOCUS_20340 15453 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence51 2111 282 gene locus_tag LOCUS_20350 gene argS 2111 282 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_20350 3438 2380 gene locus_tag LOCUS_20360 3438 2380 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724006.1 protein_id gnl|my_center|LOCUS_20360 3862 4701 gene locus_tag LOCUS_20370 3862 4701 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_20370 4698 5201 gene locus_tag LOCUS_20380 4698 5201 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_20380 5198 6193 gene locus_tag LOCUS_20390 5198 6193 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680981.1 protein_id gnl|my_center|LOCUS_20390 7290 6358 gene locus_tag LOCUS_20400 7290 6358 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677008.1 protein_id gnl|my_center|LOCUS_20400 9957 7291 gene locus_tag LOCUS_20410 gene leuS 9957 7291 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_20410 10557 10051 gene locus_tag LOCUS_20420 10557 10051 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_20420 10790 11230 gene locus_tag LOCUS_20430 10790 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 11703 12326 gene locus_tag LOCUS_20440 11703 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 12350 12856 gene locus_tag LOCUS_20450 12350 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 13454 12921 gene locus_tag LOCUS_20460 13454 12921 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_20460 13725 15110 gene locus_tag LOCUS_20470 13725 15110 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence52 232 1128 gene locus_tag LOCUS_20480 232 1128 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869154.1 protein_id gnl|my_center|LOCUS_20480 1252 2556 gene locus_tag LOCUS_20490 1252 2556 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779465.1 protein_id gnl|my_center|LOCUS_20490 4520 2553 gene locus_tag LOCUS_20500 gene uvrC 4520 2553 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657940.1 protein_id gnl|my_center|LOCUS_20500 4605 6011 gene locus_tag LOCUS_20510 4605 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920589.1 protein_id gnl|my_center|LOCUS_20510 6021 8696 gene locus_tag LOCUS_20520 6021 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 8744 9244 gene locus_tag LOCUS_20530 gene purE 8744 9244 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357851.1 protein_id gnl|my_center|LOCUS_20530 9271 10758 gene locus_tag LOCUS_20540 gene purF 9271 10758 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_20540 11726 10923 gene locus_tag LOCUS_20550 11726 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 11835 12080 gene locus_tag LOCUS_20560 11835 12080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 12661 12068 gene locus_tag LOCUS_20570 12661 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 <13897 12725 gene locus_tag LOCUS_20580 <13897 12725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458936.1:ATP-binding protein >Feature sequence53 182 2275 gene locus_tag LOCUS_20590 182 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2345 3133 gene locus_tag LOCUS_20600 2345 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3264 4412 gene locus_tag LOCUS_20610 3264 4412 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680953.1 protein_id gnl|my_center|LOCUS_20610 4409 5584 gene locus_tag LOCUS_20620 4409 5584 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680952.1 protein_id gnl|my_center|LOCUS_20620 5691 6131 gene locus_tag LOCUS_20630 5691 6131 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672091.1 protein_id gnl|my_center|LOCUS_20630 6727 6128 gene locus_tag LOCUS_20640 6727 6128 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956988.1 protein_id gnl|my_center|LOCUS_20640 8808 6733 gene locus_tag LOCUS_20650 8808 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 9422 8814 gene locus_tag LOCUS_20660 9422 8814 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679200.1 protein_id gnl|my_center|LOCUS_20660 10628 9504 gene locus_tag LOCUS_20670 10628 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667248.1 protein_id gnl|my_center|LOCUS_20670 11846 10629 gene locus_tag LOCUS_20680 11846 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 12745 11846 gene locus_tag LOCUS_20690 12745 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 13371 12736 gene locus_tag LOCUS_20700 gene rpe 13371 12736 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957271.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence54 426 1424 gene locus_tag LOCUS_20710 426 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1575 3521 gene locus_tag LOCUS_20720 1575 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3761 5467 gene locus_tag LOCUS_20730 3761 5467 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682087.1 protein_id gnl|my_center|LOCUS_20730 5464 6594 gene locus_tag LOCUS_20740 5464 6594 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680316.1 protein_id gnl|my_center|LOCUS_20740 6619 8214 gene locus_tag LOCUS_20750 gene murD 6619 8214 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956725.1 protein_id gnl|my_center|LOCUS_20750 8521 8715 gene locus_tag LOCUS_20760 8521 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 9086 9349 gene locus_tag LOCUS_20770 9086 9349 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681992.1 protein_id gnl|my_center|LOCUS_20770 9346 9612 gene locus_tag LOCUS_20780 9346 9612 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681991.1 protein_id gnl|my_center|LOCUS_20780 9626 10237 gene locus_tag LOCUS_20790 9626 10237 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461761.1 protein_id gnl|my_center|LOCUS_20790 10608 10940 gene locus_tag LOCUS_20800 10608 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 11987 11136 gene locus_tag LOCUS_20810 11987 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20810 12258 12046 gene locus_tag LOCUS_20820 12258 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20820 12393 12845 gene locus_tag LOCUS_20830 12393 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence55 1078 356 gene locus_tag LOCUS_20840 1078 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1330 1091 gene locus_tag LOCUS_20850 1330 1091 CDS product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667298.1 protein_id gnl|my_center|LOCUS_20850 1611 2609 gene locus_tag LOCUS_20860 1611 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2609 3301 gene locus_tag LOCUS_20870 2609 3301 CDS product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674029.1 protein_id gnl|my_center|LOCUS_20870 3840 3298 gene locus_tag LOCUS_20880 3840 3298 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_20880 3965 4789 gene locus_tag LOCUS_20890 3965 4789 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956669.1 protein_id gnl|my_center|LOCUS_20890 6761 4920 gene locus_tag LOCUS_20900 gene glmS 6761 4920 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048324.1 protein_id gnl|my_center|LOCUS_20900 6980 8173 gene locus_tag LOCUS_20910 6980 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 8807 8163 gene locus_tag LOCUS_20920 gene nth 8807 8163 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965134.1 protein_id gnl|my_center|LOCUS_20920 9987 8809 gene locus_tag LOCUS_20930 gene metK 9987 8809 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_20930 10804 10262 gene locus_tag LOCUS_20940 10804 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence56 467 835 gene locus_tag LOCUS_20950 467 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 848 1438 gene locus_tag LOCUS_20960 848 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1685 2452 gene locus_tag LOCUS_20970 1685 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 3781 2537 gene locus_tag LOCUS_20980 3781 2537 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_20980 4964 3936 gene locus_tag LOCUS_20990 4964 3936 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_20990 7171 4961 gene locus_tag LOCUS_21000 7171 4961 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680253.1 protein_id gnl|my_center|LOCUS_21000 8622 7168 gene locus_tag LOCUS_21010 gene rimO 8622 7168 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680609.1 protein_id gnl|my_center|LOCUS_21010 9730 8615 gene locus_tag LOCUS_21020 9730 8615 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680601.1 protein_id gnl|my_center|LOCUS_21020 10399 9734 gene locus_tag LOCUS_21030 10399 9734 CDS product outer-membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673641.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence57 846 469 gene locus_tag LOCUS_21040 gene crcB 846 469 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927153.1 protein_id gnl|my_center|LOCUS_21040 1826 951 gene locus_tag LOCUS_21050 1826 951 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680498.1 protein_id gnl|my_center|LOCUS_21050 1927 2373 gene locus_tag LOCUS_21060 1927 2373 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775651.1 protein_id gnl|my_center|LOCUS_21060 2548 3816 gene locus_tag LOCUS_21070 2548 3816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_21070 4098 3823 gene locus_tag LOCUS_21080 4098 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 4248 4895 gene locus_tag LOCUS_21090 4248 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 4922 5866 gene locus_tag LOCUS_21100 4922 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 6194 5910 gene locus_tag LOCUS_21110 6194 5910 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678786.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence58 1782 727 gene locus_tag LOCUS_21120 1782 727 CDS product HaeII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686885.1 protein_id gnl|my_center|LOCUS_21120 2779 1796 gene locus_tag LOCUS_21130 2779 1796 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 protein_id gnl|my_center|LOCUS_21130 3343 2873 gene locus_tag LOCUS_21140 3343 2873 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence59 1629 316 gene locus_tag LOCUS_21150 1629 316 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_21150 2677 1976 gene locus_tag LOCUS_21160 2677 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2936 3172 gene locus_tag LOCUS_21170 2936 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3169 3564 gene locus_tag LOCUS_21180 3169 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 3561 3983 gene locus_tag LOCUS_21190 3561 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3877 4194 gene locus_tag LOCUS_21200 3877 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence60 1070 369 gene locus_tag LOCUS_21210 1070 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21210 1200 1072 gene locus_tag LOCUS_21220 1200 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21220 1489 1893 gene locus_tag LOCUS_21230 1489 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1874 2539 gene locus_tag LOCUS_21240 1874 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2834 3592 gene locus_tag LOCUS_21250 2834 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence61 1227 244 gene locus_tag LOCUS_21260 1227 244 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679142.1 protein_id gnl|my_center|LOCUS_21260 1760 1317 gene locus_tag LOCUS_21270 1760 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2739 1789 gene locus_tag LOCUS_21280 gene argF 2739 1789 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080343.1 protein_id gnl|my_center|LOCUS_21280 3013 2939 gene locus_tag LOCUS_t00470 3013 2939 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence62 168 788 gene locus_tag LOCUS_21290 168 788 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_21290 1864 902 gene locus_tag LOCUS_21300 1864 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 2151 1921 gene locus_tag LOCUS_21310 2151 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21310 2695 2351 gene locus_tag LOCUS_21320 2695 2351 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956916.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence63 403 579 gene locus_tag LOCUS_21330 403 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 581 721 gene locus_tag LOCUS_21340 581 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21340 725 1030 gene locus_tag LOCUS_21350 725 1030 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005643896.1 protein_id gnl|my_center|LOCUS_21350 2368 1142 gene locus_tag LOCUS_21360 2368 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence64 <1 703 gene locus_tag LOCUS_21370 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000593905.1:hydratase 837 1319 gene locus_tag LOCUS_21380 837 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108568.1 protein_id gnl|my_center|LOCUS_21380 1432 1647 gene locus_tag LOCUS_21390 1432 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390