>Feature sequence01 860 360 gene locus_tag LOCUS_00010 860 360 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_00010 1016 1849 gene locus_tag LOCUS_00020 1016 1849 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776771.1 protein_id gnl|my_center|LOCUS_00020 2625 1891 gene locus_tag LOCUS_00030 2625 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2888 2802 gene locus_tag LOCUS_t00010 2888 2802 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3124 3609 gene locus_tag LOCUS_00040 3124 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4312 3764 gene locus_tag LOCUS_00050 4312 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4611 4913 gene locus_tag LOCUS_00060 4611 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4892 5197 gene locus_tag LOCUS_00070 4892 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5143 5523 gene locus_tag LOCUS_00080 5143 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6469 5621 gene locus_tag LOCUS_00090 6469 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6849 6466 gene locus_tag LOCUS_00100 6849 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7552 6830 gene locus_tag LOCUS_00110 7552 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10334 7566 gene locus_tag LOCUS_00120 10334 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11235 10369 gene locus_tag LOCUS_00130 11235 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12312 11251 gene locus_tag LOCUS_00140 12312 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12732 12331 gene locus_tag LOCUS_00150 12732 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13284 12757 gene locus_tag LOCUS_00160 13284 12757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13426 13295 gene locus_tag LOCUS_00170 13426 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14163 13444 gene locus_tag LOCUS_00180 14163 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15982 14078 gene locus_tag LOCUS_00190 15982 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17363 15996 gene locus_tag LOCUS_00200 17363 15996 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_00200 17647 17360 gene locus_tag LOCUS_00210 17647 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19331 18009 gene locus_tag LOCUS_00220 19331 18009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20549 19560 gene locus_tag LOCUS_00230 20549 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 20940 21836 gene locus_tag LOCUS_00240 20940 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22180 23076 gene locus_tag LOCUS_00250 22180 23076 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_00250 23088 23675 gene locus_tag LOCUS_00260 23088 23675 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_00260 23677 24228 gene locus_tag LOCUS_00270 23677 24228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24242 25591 gene locus_tag LOCUS_00280 gene rimO 24242 25591 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_00280 25610 26338 gene locus_tag LOCUS_00290 gene pgsA 25610 26338 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_00290 26634 26897 gene locus_tag LOCUS_00300 gene rpsO 26634 26897 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229392.1 protein_id gnl|my_center|LOCUS_00300 27040 29169 gene locus_tag LOCUS_00310 gene pnp 27040 29169 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_00310 29293 30135 gene locus_tag LOCUS_00320 29293 30135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 32293 30392 gene locus_tag LOCUS_00330 gene htpG 32293 30392 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_00330 33510 32422 gene locus_tag LOCUS_00340 33510 32422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34401 33529 gene locus_tag LOCUS_00350 34401 33529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 35278 34634 gene locus_tag LOCUS_00360 35278 34634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35651 35920 gene locus_tag LOCUS_00370 35651 35920 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965126.1 protein_id gnl|my_center|LOCUS_00370 36137 37966 gene locus_tag LOCUS_00380 gene uvrC 36137 37966 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_00380 37963 38565 gene locus_tag LOCUS_00390 gene rsmD 37963 38565 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460510.1 protein_id gnl|my_center|LOCUS_00390 38534 39022 gene locus_tag LOCUS_00400 gene coaD 38534 39022 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_00400 39629 40972 gene locus_tag LOCUS_00410 39629 40972 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_00410 41032 41721 gene locus_tag LOCUS_00420 41032 41721 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_00420 42325 41852 gene locus_tag LOCUS_00430 42325 41852 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_00430 42463 43602 gene locus_tag LOCUS_00440 42463 43602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 43840 43655 gene locus_tag LOCUS_00450 gene rpmB 43840 43655 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_00450 43999 44208 gene locus_tag LOCUS_00460 43999 44208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44795 45742 gene locus_tag LOCUS_00470 44795 45742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 45754 46095 gene locus_tag LOCUS_00480 45754 46095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 46098 47225 gene locus_tag LOCUS_00490 gene mutY 46098 47225 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171397.1 protein_id gnl|my_center|LOCUS_00490 47219 47998 gene locus_tag LOCUS_00500 47219 47998 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304811.1 protein_id gnl|my_center|LOCUS_00500 48077 48625 gene locus_tag LOCUS_00510 48077 48625 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_00510 48720 49358 gene locus_tag LOCUS_00520 48720 49358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_00520 49355 51277 gene locus_tag LOCUS_00530 49355 51277 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_00530 51274 51906 gene locus_tag LOCUS_00540 gene pth 51274 51906 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_00540 51911 55438 gene locus_tag LOCUS_00550 gene mfd 51911 55438 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_00550 55428 56573 gene locus_tag LOCUS_00560 55428 56573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58104 57013 gene locus_tag LOCUS_00570 58104 57013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58233 59222 gene locus_tag LOCUS_00580 gene dusB 58233 59222 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_00580 60286 59288 gene locus_tag LOCUS_00590 gene trpS 60286 59288 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_00590 60396 60539 gene locus_tag LOCUS_00600 60396 60539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 60690 64313 gene locus_tag LOCUS_00610 gene nifJ 60690 64313 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_00610 65309 65764 gene locus_tag LOCUS_00620 65309 65764 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245063.1 protein_id gnl|my_center|LOCUS_00620 66191 65913 gene locus_tag LOCUS_00630 66191 65913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 66327 67070 gene locus_tag LOCUS_00640 66327 67070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00640 67215 67481 gene locus_tag LOCUS_00650 67215 67481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00650 67523 68032 gene locus_tag LOCUS_00660 67523 68032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 68339 70126 gene locus_tag LOCUS_00670 68339 70126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 70123 70938 gene locus_tag LOCUS_00680 70123 70938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71121 77267 gene locus_tag LOCUS_00690 71121 77267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 77264 78415 gene locus_tag LOCUS_00700 77264 78415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 78730 80745 gene locus_tag LOCUS_00710 78730 80745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 80752 81342 gene locus_tag LOCUS_00720 80752 81342 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461824.1 protein_id gnl|my_center|LOCUS_00720 81342 82016 gene locus_tag LOCUS_00730 gene nth 81342 82016 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814299.1 protein_id gnl|my_center|LOCUS_00730 82006 82569 gene locus_tag LOCUS_00740 gene rnmV 82006 82569 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989372.1 protein_id gnl|my_center|LOCUS_00740 82805 83785 gene locus_tag LOCUS_00750 82805 83785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_00750 83786 84490 gene locus_tag LOCUS_00760 83786 84490 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_00760 84502 86037 gene locus_tag LOCUS_00770 84502 86037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 86037 87725 gene locus_tag LOCUS_00780 86037 87725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 87735 90881 gene locus_tag LOCUS_00790 87735 90881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 91012 93165 gene locus_tag LOCUS_00800 91012 93165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 93236 93736 gene locus_tag LOCUS_00810 gene rnhA 93236 93736 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392156.1 protein_id gnl|my_center|LOCUS_00810 93733 95154 gene locus_tag LOCUS_00820 93733 95154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 95497 95219 gene locus_tag LOCUS_00830 95497 95219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 95638 97263 gene locus_tag LOCUS_00840 95638 97263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 97912 97352 gene locus_tag LOCUS_00850 97912 97352 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_00850 98721 97909 gene locus_tag LOCUS_00860 gene dpsA 98721 97909 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_00860 99576 108977 gene locus_tag LOCUS_00870 99576 108977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 109276 110352 gene locus_tag LOCUS_00880 109276 110352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 110399 111439 gene locus_tag LOCUS_00890 110399 111439 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_00890 111446 112345 gene locus_tag LOCUS_00900 111446 112345 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_00900 112342 114348 gene locus_tag LOCUS_00910 112342 114348 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582649.1 protein_id gnl|my_center|LOCUS_00910 114361 117240 gene locus_tag LOCUS_00920 114361 117240 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_00920 117237 120011 gene locus_tag LOCUS_00930 117237 120011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 120078 125129 gene locus_tag LOCUS_00940 120078 125129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 128398 125243 gene locus_tag LOCUS_00950 128398 125243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 135425 128388 gene locus_tag LOCUS_00960 135425 128388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 135758 135480 gene locus_tag LOCUS_00970 135758 135480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 136822 135755 gene locus_tag LOCUS_00980 136822 135755 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966903.1 protein_id gnl|my_center|LOCUS_00980 138122 136812 gene locus_tag LOCUS_00990 138122 136812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_00990 139388 138141 gene locus_tag LOCUS_01000 139388 138141 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963502.1 protein_id gnl|my_center|LOCUS_01000 140395 139403 gene locus_tag LOCUS_01010 140395 139403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860738.1 protein_id gnl|my_center|LOCUS_01010 143108 140562 gene locus_tag LOCUS_01020 143108 140562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 144266 143151 gene locus_tag LOCUS_01030 144266 143151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 145937 144975 gene locus_tag LOCUS_01040 145937 144975 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_01040 146930 145941 gene locus_tag LOCUS_01050 146930 145941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 147625 146927 gene locus_tag LOCUS_01060 147625 146927 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_01060 148712 147642 gene locus_tag LOCUS_01070 gene tsaD 148712 147642 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_01070 149161 148700 gene locus_tag LOCUS_01080 gene rimI 149161 148700 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142061.1 protein_id gnl|my_center|LOCUS_01080 150800 149346 gene locus_tag LOCUS_01090 150800 149346 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_01090 151052 151882 gene locus_tag LOCUS_01100 151052 151882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 152103 155321 gene locus_tag LOCUS_01110 152103 155321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 155390 157195 gene locus_tag LOCUS_01120 155390 157195 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_01120 157931 157362 gene locus_tag LOCUS_01130 157931 157362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 158130 159338 gene locus_tag LOCUS_01140 158130 159338 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_01140 159505 161478 gene locus_tag LOCUS_01150 159505 161478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 161505 162086 gene locus_tag LOCUS_01160 161505 162086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 162287 163582 gene locus_tag LOCUS_01170 162287 163582 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289234.1 protein_id gnl|my_center|LOCUS_01170 163652 164716 gene locus_tag LOCUS_01180 163652 164716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_01180 164713 165474 gene locus_tag LOCUS_01190 164713 165474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 165785 166402 gene locus_tag LOCUS_01200 165785 166402 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048167.1 protein_id gnl|my_center|LOCUS_01200 166473 166886 gene locus_tag LOCUS_01210 166473 166886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 166883 168631 gene locus_tag LOCUS_01220 166883 168631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016884.1 protein_id gnl|my_center|LOCUS_01220 168857 170668 gene locus_tag LOCUS_01230 gene feoB 168857 170668 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903695.1 protein_id gnl|my_center|LOCUS_01230 172047 170782 gene locus_tag LOCUS_01240 172047 170782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 174085 172208 gene locus_tag LOCUS_01250 174085 172208 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_01250 174364 174146 gene locus_tag LOCUS_01260 174364 174146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 174845 174480 gene locus_tag LOCUS_01270 174845 174480 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986887.1 protein_id gnl|my_center|LOCUS_01270 175139 176530 gene locus_tag LOCUS_01280 175139 176530 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640460.1 protein_id gnl|my_center|LOCUS_01280 178080 176641 gene locus_tag LOCUS_01290 178080 176641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 180966 178153 gene locus_tag LOCUS_01300 gene uvrA 180966 178153 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045563.1 protein_id gnl|my_center|LOCUS_01300 182971 180989 gene locus_tag LOCUS_01310 gene uvrB 182971 180989 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_01310 183223 183903 gene locus_tag LOCUS_01320 183223 183903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 >Feature sequence02 638 45 gene locus_tag LOCUS_01330 638 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 896 971 gene locus_tag LOCUS_t00020 896 971 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2024 1116 gene locus_tag LOCUS_01340 2024 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 2555 3082 gene locus_tag LOCUS_01350 2555 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 3280 3903 gene locus_tag LOCUS_01360 3280 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 3905 4288 gene locus_tag LOCUS_01370 3905 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 4281 4571 gene locus_tag LOCUS_01380 4281 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5997 5002 gene locus_tag LOCUS_01390 gene mgrA 5997 5002 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_01390 6494 6039 gene locus_tag LOCUS_01400 gene bcp 6494 6039 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_01400 8350 6596 gene locus_tag LOCUS_01410 8350 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 9458 8589 gene locus_tag LOCUS_01420 9458 8589 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_01420 10833 9532 gene locus_tag LOCUS_01430 10833 9532 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_01430 11359 11853 gene locus_tag LOCUS_01440 gene purE 11359 11853 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_01440 11945 12652 gene locus_tag LOCUS_01450 11945 12652 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016809.1 protein_id gnl|my_center|LOCUS_01450 12660 14096 gene locus_tag LOCUS_01460 gene purF 12660 14096 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_01460 14093 15133 gene locus_tag LOCUS_01470 gene purM 14093 15133 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813914.1 protein_id gnl|my_center|LOCUS_01470 15145 15765 gene locus_tag LOCUS_01480 gene purN 15145 15765 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_01480 15767 16486 gene locus_tag LOCUS_01490 15767 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 16495 17679 gene locus_tag LOCUS_01500 16495 17679 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_01500 17750 19015 gene locus_tag LOCUS_01510 gene purD 17750 19015 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_01510 19018 22710 gene locus_tag LOCUS_01520 19018 22710 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_01520 22744 24417 gene locus_tag LOCUS_01530 22744 24417 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_01530 25133 24564 gene locus_tag LOCUS_01540 25133 24564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 26498 25506 gene locus_tag LOCUS_01550 26498 25506 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261688.1 protein_id gnl|my_center|LOCUS_01550 28509 26599 gene locus_tag LOCUS_01560 28509 26599 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594519.1 protein_id gnl|my_center|LOCUS_01560 29186 28641 gene locus_tag LOCUS_01570 29186 28641 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_01570 29583 31175 gene locus_tag LOCUS_01580 29583 31175 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 protein_id gnl|my_center|LOCUS_01580 32102 31326 gene locus_tag LOCUS_01590 32102 31326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 32326 33339 gene locus_tag LOCUS_01600 32326 33339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 33459 34460 gene locus_tag LOCUS_01610 33459 34460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 34870 34778 gene locus_tag LOCUS_t00030 34870 34778 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35182 35550 gene locus_tag LOCUS_01620 35182 35550 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244448.1 protein_id gnl|my_center|LOCUS_01620 35672 36103 gene locus_tag LOCUS_01630 35672 36103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 37719 36349 gene locus_tag LOCUS_01640 37719 36349 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_01640 39106 38168 gene locus_tag LOCUS_01650 gene arcC 39106 38168 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363186.1 protein_id gnl|my_center|LOCUS_01650 40217 39108 gene locus_tag LOCUS_01660 gene aguA 40217 39108 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262731.1 protein_id gnl|my_center|LOCUS_01660 41623 40229 gene locus_tag LOCUS_01670 41623 40229 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262732.1 protein_id gnl|my_center|LOCUS_01670 42702 41671 gene locus_tag LOCUS_01680 gene ptcA 42702 41671 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355587.1 protein_id gnl|my_center|LOCUS_01680 42886 43389 gene locus_tag LOCUS_01690 42886 43389 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_01690 44630 43464 gene locus_tag LOCUS_01700 44630 43464 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_01700 46569 44635 gene locus_tag LOCUS_01710 46569 44635 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_01710 47956 46574 gene locus_tag LOCUS_01720 47956 46574 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_01720 48729 48196 gene locus_tag LOCUS_01730 48729 48196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 49156 48710 gene locus_tag LOCUS_01740 gene perR 49156 48710 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_01740 49669 49307 gene locus_tag LOCUS_01750 gene rplQ 49669 49307 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_01750 50677 49700 gene locus_tag LOCUS_01760 50677 49700 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641267.1 protein_id gnl|my_center|LOCUS_01760 51463 50837 gene locus_tag LOCUS_01770 gene rpsD 51463 50837 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_01770 51885 51484 gene locus_tag LOCUS_01780 gene rpsK 51885 51484 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_01780 52265 51897 gene locus_tag LOCUS_01790 gene rpsM 52265 51897 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_01790 52660 52439 gene locus_tag LOCUS_01800 gene infA 52660 52439 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_01800 53440 52682 gene locus_tag LOCUS_01810 gene map 53440 52682 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_01810 54074 53445 gene locus_tag LOCUS_01820 54074 53445 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_01820 55538 54102 gene locus_tag LOCUS_01830 gene secY 55538 54102 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_01830 55982 55539 gene locus_tag LOCUS_01840 gene rplO 55982 55539 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_01840 56177 56001 gene locus_tag LOCUS_01850 gene rpmD 56177 56001 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810130.1 protein_id gnl|my_center|LOCUS_01850 56692 56189 gene locus_tag LOCUS_01860 gene rpsE 56692 56189 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356219.1 protein_id gnl|my_center|LOCUS_01860 57107 56748 gene locus_tag LOCUS_01870 gene rplR 57107 56748 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_01870 57662 57126 gene locus_tag LOCUS_01880 gene rplF 57662 57126 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_01880 58076 57678 gene locus_tag LOCUS_01890 gene rpsH 58076 57678 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_01890 58370 58185 gene locus_tag LOCUS_01900 58370 58185 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_01900 58927 58388 gene locus_tag LOCUS_01910 gene rplE 58927 58388 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_01910 59303 58944 gene locus_tag LOCUS_01920 gene rplX 59303 58944 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943475.1 protein_id gnl|my_center|LOCUS_01920 59686 59318 gene locus_tag LOCUS_01930 gene rplN 59686 59318 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_01930 60009 59749 gene locus_tag LOCUS_01940 gene rpsQ 60009 59749 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_01940 60212 60024 gene locus_tag LOCUS_01950 gene rpmC 60212 60024 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_01950 60639 60226 gene locus_tag LOCUS_01960 gene rplP 60639 60226 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_01960 61418 60639 gene locus_tag LOCUS_01970 gene rpsC 61418 60639 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_01970 61761 61420 gene locus_tag LOCUS_01980 gene rplV 61761 61420 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_01980 62057 61773 gene locus_tag LOCUS_01990 gene rpsS 62057 61773 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_01990 62906 62076 gene locus_tag LOCUS_02000 gene rplB 62906 62076 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_02000 63218 62925 gene locus_tag LOCUS_02010 63218 62925 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129966.1 protein_id gnl|my_center|LOCUS_02010 63841 63215 gene locus_tag LOCUS_02020 gene rplD 63841 63215 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_02020 64492 63860 gene locus_tag LOCUS_02030 gene rplC 64492 63860 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_02030 64942 64628 gene locus_tag LOCUS_02040 gene rpsJ 64942 64628 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_02040 65510 66472 gene locus_tag LOCUS_02050 65510 66472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 66476 69004 gene locus_tag LOCUS_02060 gene polA 66476 69004 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_02060 70740 69214 gene locus_tag LOCUS_02070 70740 69214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 71186 73858 gene locus_tag LOCUS_02080 71186 73858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 73978 74952 gene locus_tag LOCUS_02090 73978 74952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 74949 75806 gene locus_tag LOCUS_02100 74949 75806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 76725 75901 gene locus_tag LOCUS_02110 gene rhaD 76725 75901 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 protein_id gnl|my_center|LOCUS_02110 77943 76738 gene locus_tag LOCUS_02120 77943 76738 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392456.1 protein_id gnl|my_center|LOCUS_02120 78692 78033 gene locus_tag LOCUS_02130 78692 78033 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_02130 81454 78689 gene locus_tag LOCUS_02140 81454 78689 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_02140 81586 82311 gene locus_tag LOCUS_02150 81586 82311 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721880.1 protein_id gnl|my_center|LOCUS_02150 82438 83460 gene locus_tag LOCUS_02160 gene pheS 82438 83460 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_02160 83473 85881 gene locus_tag LOCUS_02170 gene pheT 83473 85881 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_02170 85909 87195 gene locus_tag LOCUS_02180 gene serS 85909 87195 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_02180 87832 87756 gene locus_tag LOCUS_t00040 87832 87756 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 88030 88779 gene locus_tag LOCUS_02190 gene rnc 88030 88779 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919434.1 protein_id gnl|my_center|LOCUS_02190 89564 88839 gene locus_tag LOCUS_02200 89564 88839 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_02200 91318 89600 gene locus_tag LOCUS_02210 gene argS 91318 89600 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_02210 92139 91318 gene locus_tag LOCUS_02220 92139 91318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 93072 92332 gene locus_tag LOCUS_02230 gene rsmG 93072 92332 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886662.1 protein_id gnl|my_center|LOCUS_02230 94714 93104 gene locus_tag LOCUS_02240 94714 93104 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_02240 95046 96350 gene locus_tag LOCUS_02250 95046 96350 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_02250 96363 97121 gene locus_tag LOCUS_02260 gene tpiA 96363 97121 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_02260 97952 97263 gene locus_tag LOCUS_02270 97952 97263 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948613.1 protein_id gnl|my_center|LOCUS_02270 99057 98119 gene locus_tag LOCUS_02280 99057 98119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 99580 99104 gene locus_tag LOCUS_02290 gene rlmH 99580 99104 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_02290 99692 99883 gene locus_tag LOCUS_02300 99692 99883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 101123 99969 gene locus_tag LOCUS_02310 101123 99969 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_02310 102256 101135 gene locus_tag LOCUS_02320 102256 101135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 103506 102253 gene locus_tag LOCUS_02330 103506 102253 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 protein_id gnl|my_center|LOCUS_02330 104850 103561 gene locus_tag LOCUS_02340 gene murD 104850 103561 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_02340 106400 105534 gene locus_tag LOCUS_02350 106400 105534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 107239 106568 gene locus_tag LOCUS_02360 107239 106568 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_02360 107455 109287 gene locus_tag LOCUS_02370 gene typA 107455 109287 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_02370 110168 109803 gene locus_tag LOCUS_02380 110168 109803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 111849 110635 gene locus_tag LOCUS_02390 111849 110635 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_02390 >Feature sequence03 2804 57 gene locus_tag LOCUS_02400 2804 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 3660 4238 gene locus_tag LOCUS_02410 3660 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4240 7542 gene locus_tag LOCUS_02420 gene addB 4240 7542 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_02420 8260 7664 gene locus_tag LOCUS_02430 8260 7664 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816420.1 protein_id gnl|my_center|LOCUS_02430 9582 8281 gene locus_tag LOCUS_02440 9582 8281 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964854.1 protein_id gnl|my_center|LOCUS_02440 10027 9617 gene locus_tag LOCUS_02450 10027 9617 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_02450 10773 10039 gene locus_tag LOCUS_02460 gene deoD 10773 10039 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_02460 11451 10792 gene locus_tag LOCUS_02470 gene deoC 11451 10792 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_02470 12598 11570 gene locus_tag LOCUS_02480 gene gap 12598 11570 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_02480 13705 12686 gene locus_tag LOCUS_02490 13705 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 15428 13884 gene locus_tag LOCUS_02500 15428 13884 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_02500 16749 15691 gene locus_tag LOCUS_02510 16749 15691 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_02510 17733 16762 gene locus_tag LOCUS_02520 17733 16762 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_02520 21904 17750 gene locus_tag LOCUS_02530 21904 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 24184 21926 gene locus_tag LOCUS_02540 24184 21926 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583939.1 protein_id gnl|my_center|LOCUS_02540 25088 24198 gene locus_tag LOCUS_02550 25088 24198 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_02550 26178 25090 gene locus_tag LOCUS_02560 26178 25090 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_02560 29381 26211 gene locus_tag LOCUS_02570 29381 26211 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_02570 30178 31137 gene locus_tag LOCUS_02580 30178 31137 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_02580 31980 31348 gene locus_tag LOCUS_02590 31980 31348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 35696 31980 gene locus_tag LOCUS_02600 35696 31980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 37830 35887 gene locus_tag LOCUS_02610 37830 35887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_02610 38456 37965 gene locus_tag LOCUS_02620 38456 37965 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_02620 38522 38761 gene locus_tag LOCUS_02630 38522 38761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 38751 39119 gene locus_tag LOCUS_02640 38751 39119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 39134 39499 gene locus_tag LOCUS_02650 39134 39499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 43965 39517 gene locus_tag LOCUS_02660 43965 39517 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_02660 45056 43962 gene locus_tag LOCUS_02670 gene ispG 45056 43962 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_02670 46194 45100 gene locus_tag LOCUS_02680 gene rseP 46194 45100 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_02680 47362 46208 gene locus_tag LOCUS_02690 47362 46208 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_02690 48279 47386 gene locus_tag LOCUS_02700 48279 47386 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_02700 48997 48281 gene locus_tag LOCUS_02710 48997 48281 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_02710 49565 49011 gene locus_tag LOCUS_02720 gene frr 49565 49011 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_02720 50321 49614 gene locus_tag LOCUS_02730 gene pyrH 50321 49614 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_02730 51892 50966 gene locus_tag LOCUS_02740 gene tsf 51892 50966 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_02740 52668 51904 gene locus_tag LOCUS_02750 gene rpsB 52668 51904 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_02750 53722 52853 gene locus_tag LOCUS_02760 53722 52853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 53851 54582 gene locus_tag LOCUS_02770 53851 54582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 54628 55017 gene locus_tag LOCUS_02780 54628 55017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 55854 55084 gene locus_tag LOCUS_02790 55854 55084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 56378 55860 gene locus_tag LOCUS_02800 56378 55860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 56563 57513 gene locus_tag LOCUS_02810 56563 57513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 58142 57639 gene locus_tag LOCUS_02820 gene greA 58142 57639 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182999.1 protein_id gnl|my_center|LOCUS_02820 58658 58146 gene locus_tag LOCUS_02830 58658 58146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 60169 58772 gene locus_tag LOCUS_02840 60169 58772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 60532 60606 gene locus_tag LOCUS_t00050 60532 60606 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 61540 60740 gene locus_tag LOCUS_02850 gene proC 61540 60740 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363318.1 protein_id gnl|my_center|LOCUS_02850 62792 61551 gene locus_tag LOCUS_02860 62792 61551 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_02860 64012 62825 gene locus_tag LOCUS_02870 gene proB 64012 62825 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922103.1 protein_id gnl|my_center|LOCUS_02870 64499 64110 gene locus_tag LOCUS_02880 64499 64110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 64774 64496 gene locus_tag LOCUS_02890 64774 64496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 66486 64771 gene locus_tag LOCUS_02900 66486 64771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 66785 66585 gene locus_tag LOCUS_02910 66785 66585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence04 4217 2727 gene locus_tag LOCUS_02920 4217 2727 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743599.1 protein_id gnl|my_center|LOCUS_02920 4415 4786 gene locus_tag LOCUS_02930 4415 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 4798 4986 gene locus_tag LOCUS_02940 4798 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 7466 5058 gene locus_tag LOCUS_02950 gene leuS 7466 5058 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_02950 7877 7482 gene locus_tag LOCUS_02960 gene rsfS 7877 7482 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_02960 8506 7886 gene locus_tag LOCUS_02970 gene yqeK 8506 7886 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721995.1 protein_id gnl|my_center|LOCUS_02970 9107 8496 gene locus_tag LOCUS_02980 9107 8496 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699801.1 protein_id gnl|my_center|LOCUS_02980 9393 9100 gene locus_tag LOCUS_02990 gene yhbY 9393 9100 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 protein_id gnl|my_center|LOCUS_02990 10001 9387 gene locus_tag LOCUS_03000 10001 9387 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_03000 10903 9998 gene locus_tag LOCUS_03010 gene ftsY 10903 9998 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_03010 14521 10907 gene locus_tag LOCUS_03020 gene smc 14521 10907 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_03020 15257 14553 gene locus_tag LOCUS_03030 gene rnc 15257 14553 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_03030 16386 15271 gene locus_tag LOCUS_03040 gene plsX 16386 15271 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_03040 17736 16399 gene locus_tag LOCUS_03050 gene trmFO 17736 16399 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_03050 20006 17736 gene locus_tag LOCUS_03060 gene topA 20006 17736 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_03060 21274 20003 gene locus_tag LOCUS_03070 21274 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 22146 21298 gene locus_tag LOCUS_03080 22146 21298 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_03080 22673 22320 gene locus_tag LOCUS_03090 gene rplT 22673 22320 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 protein_id gnl|my_center|LOCUS_03090 22891 22697 gene locus_tag LOCUS_03100 gene rpmI 22891 22697 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_03100 23409 22930 gene locus_tag LOCUS_03110 gene infC 23409 22930 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_03110 23804 26221 gene locus_tag LOCUS_03120 gene lon 23804 26221 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_03120 26218 26823 gene locus_tag LOCUS_03130 gene yihA 26218 26823 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_03130 26836 27579 gene locus_tag LOCUS_03140 26836 27579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 27589 28503 gene locus_tag LOCUS_03150 27589 28503 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_03150 28475 29278 gene locus_tag LOCUS_03160 28475 29278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 29306 30004 gene locus_tag LOCUS_03170 29306 30004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 30006 30455 gene locus_tag LOCUS_03180 gene ytfJ 30006 30455 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_03180 30504 31586 gene locus_tag LOCUS_03190 gene dacB 30504 31586 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_03190 31597 32349 gene locus_tag LOCUS_03200 31597 32349 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_03200 32343 32762 gene locus_tag LOCUS_03210 32343 32762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 33473 32826 gene locus_tag LOCUS_03220 gene rpe 33473 32826 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975097.1 protein_id gnl|my_center|LOCUS_03220 34143 33658 gene locus_tag LOCUS_03230 gene ispF 34143 33658 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_03230 34897 34136 gene locus_tag LOCUS_03240 gene ispD 34897 34136 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288284.1 protein_id gnl|my_center|LOCUS_03240 35224 34904 gene locus_tag LOCUS_03250 35224 34904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 35609 36034 gene locus_tag LOCUS_03260 gene mraZ 35609 36034 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_03260 36038 36979 gene locus_tag LOCUS_03270 gene rsmH 36038 36979 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_03270 37008 37508 gene locus_tag LOCUS_03280 37008 37508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 37600 39861 gene locus_tag LOCUS_03290 37600 39861 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 protein_id gnl|my_center|LOCUS_03290 39872 41410 gene locus_tag LOCUS_03300 39872 41410 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_03300 41400 42806 gene locus_tag LOCUS_03310 41400 42806 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457113.1 protein_id gnl|my_center|LOCUS_03310 42818 43816 gene locus_tag LOCUS_03320 gene mraY 42818 43816 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286639.1 protein_id gnl|my_center|LOCUS_03320 43806 45008 gene locus_tag LOCUS_03330 gene spoVE 43806 45008 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_03330 45011 46126 gene locus_tag LOCUS_03340 gene murG 45011 46126 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_03340 46268 47575 gene locus_tag LOCUS_03350 46268 47575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 47724 48716 gene locus_tag LOCUS_03360 47724 48716 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_03360 48726 49481 gene locus_tag LOCUS_03370 48726 49481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 51426 49516 gene locus_tag LOCUS_03380 51426 49516 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083312.1 protein_id gnl|my_center|LOCUS_03380 52182 51430 gene locus_tag LOCUS_03390 52182 51430 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529695.1 protein_id gnl|my_center|LOCUS_03390 53498 52179 gene locus_tag LOCUS_03400 53498 52179 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_03400 53764 53543 gene locus_tag LOCUS_03410 53764 53543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 53645 54493 gene locus_tag LOCUS_03420 53645 54493 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_03420 54637 54719 gene locus_tag LOCUS_t00060 54637 54719 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55233 54994 gene locus_tag LOCUS_03430 55233 54994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 55400 55876 gene locus_tag LOCUS_03440 55400 55876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 55788 56132 gene locus_tag LOCUS_03450 55788 56132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 56357 57136 gene locus_tag LOCUS_03460 56357 57136 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321472.1 protein_id gnl|my_center|LOCUS_03460 57725 57285 gene locus_tag LOCUS_03470 57725 57285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 57906 58196 gene locus_tag LOCUS_03480 57906 58196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 60305 58233 gene locus_tag LOCUS_03490 gene fusA 60305 58233 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_03490 <61686 60480 gene locus_tag LOCUS_03500 <61686 60480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459079.1:DNA repair protein RadA >Feature sequence05 1259 441 gene locus_tag LOCUS_03510 gene noc 1259 441 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226829.1 protein_id gnl|my_center|LOCUS_03510 1409 2947 gene locus_tag LOCUS_03520 1409 2947 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392657.1 protein_id gnl|my_center|LOCUS_03520 3010 4347 gene locus_tag LOCUS_03530 3010 4347 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_03530 4344 5636 gene locus_tag LOCUS_03540 4344 5636 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_03540 5629 6102 gene locus_tag LOCUS_03550 5629 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6767 6294 gene locus_tag LOCUS_03560 6767 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 6994 8820 gene locus_tag LOCUS_03570 gene asnB 6994 8820 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807776.1 protein_id gnl|my_center|LOCUS_03570 8960 9853 gene locus_tag LOCUS_03580 8960 9853 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224044.1 protein_id gnl|my_center|LOCUS_03580 9855 10772 gene locus_tag LOCUS_03590 9855 10772 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461526.1 protein_id gnl|my_center|LOCUS_03590 11794 10877 gene locus_tag LOCUS_03600 gene metA 11794 10877 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_03600 13088 11796 gene locus_tag LOCUS_03610 13088 11796 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_03610 13524 13324 gene locus_tag LOCUS_03620 13524 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 13669 13986 gene locus_tag LOCUS_03630 13669 13986 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_03630 14827 16218 gene locus_tag LOCUS_03640 14827 16218 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125286.1 protein_id gnl|my_center|LOCUS_03640 16220 18667 gene locus_tag LOCUS_03650 16220 18667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 18683 19492 gene locus_tag LOCUS_03660 18683 19492 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_03660 19840 22107 gene locus_tag LOCUS_03670 19840 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 22439 24733 gene locus_tag LOCUS_03680 22439 24733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 24748 25821 gene locus_tag LOCUS_03690 24748 25821 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_03690 25818 26486 gene locus_tag LOCUS_03700 25818 26486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_03700 26505 26711 gene locus_tag LOCUS_03710 26505 26711 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_03710 26724 27785 gene locus_tag LOCUS_03720 26724 27785 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_03720 27785 28537 gene locus_tag LOCUS_03730 27785 28537 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_03730 28534 29067 gene locus_tag LOCUS_03740 28534 29067 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_03740 30402 29209 gene locus_tag LOCUS_03750 30402 29209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 30508 32955 gene locus_tag LOCUS_03760 30508 32955 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_03760 32958 34823 gene locus_tag LOCUS_03770 32958 34823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 34876 37440 gene locus_tag LOCUS_03780 34876 37440 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_03780 38628 37516 gene locus_tag LOCUS_03790 gene alr 38628 37516 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_03790 39406 38747 gene locus_tag LOCUS_03800 39406 38747 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_03800 39769 40815 gene locus_tag LOCUS_03810 39769 40815 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920869.1 protein_id gnl|my_center|LOCUS_03810 40812 41792 gene locus_tag LOCUS_03820 40812 41792 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_03820 42030 43025 gene locus_tag LOCUS_03830 42030 43025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 43048 44700 gene locus_tag LOCUS_03840 43048 44700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 45718 44951 gene locus_tag LOCUS_03850 45718 44951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 46083 45748 gene locus_tag LOCUS_03860 46083 45748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 46747 46004 gene locus_tag LOCUS_03870 46747 46004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 47552 47468 gene locus_tag LOCUS_t00070 47552 47468 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 47921 48700 gene locus_tag LOCUS_03880 47921 48700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 48697 49377 gene locus_tag LOCUS_03890 48697 49377 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938482.1 protein_id gnl|my_center|LOCUS_03890 50406 49690 gene locus_tag LOCUS_03900 gene tepA 50406 49690 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_03900 50537 51100 gene locus_tag LOCUS_03910 50537 51100 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861641.1 protein_id gnl|my_center|LOCUS_03910 51125 51826 gene locus_tag LOCUS_03920 51125 51826 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_03920 51844 52845 gene locus_tag LOCUS_03930 51844 52845 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_03930 53185 53841 gene locus_tag LOCUS_03940 53185 53841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 54052 54273 gene locus_tag LOCUS_03950 54052 54273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 55732 54479 gene locus_tag LOCUS_03960 55732 54479 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_03960 56024 55770 gene locus_tag LOCUS_03970 56024 55770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 56623 56021 gene locus_tag LOCUS_03980 gene lexA 56623 56021 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_03980 56854 57603 gene locus_tag LOCUS_03990 56854 57603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 59724 57745 gene locus_tag LOCUS_04000 59724 57745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 60779 59721 gene locus_tag LOCUS_04010 60779 59721 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence06 1684 1421 gene locus_tag LOCUS_04020 1684 1421 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_04020 2598 1681 gene locus_tag LOCUS_04030 2598 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 3544 2651 gene locus_tag LOCUS_04040 3544 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 3661 5103 gene locus_tag LOCUS_04050 3661 5103 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_04050 5119 7617 gene locus_tag LOCUS_04060 5119 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 8329 8129 gene locus_tag LOCUS_04070 8329 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 8560 8847 gene locus_tag LOCUS_04080 8560 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 8906 9901 gene locus_tag LOCUS_04090 8906 9901 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861524.1 protein_id gnl|my_center|LOCUS_04090 10280 9942 gene locus_tag LOCUS_04100 10280 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04100 11635 11075 gene locus_tag LOCUS_04110 gene pdxT 11635 11075 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_04110 12519 11635 gene locus_tag LOCUS_04120 gene pdxS 12519 11635 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138517.1 protein_id gnl|my_center|LOCUS_04120 13488 12634 gene locus_tag LOCUS_04130 13488 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 13665 13579 gene locus_tag LOCUS_t00080 13665 13579 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15465 13804 gene locus_tag LOCUS_04140 15465 13804 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965008.1 protein_id gnl|my_center|LOCUS_04140 16127 15462 gene locus_tag LOCUS_04150 16127 15462 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_04150 16825 16172 gene locus_tag LOCUS_04160 gene phoU 16825 16172 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_04160 17630 16860 gene locus_tag LOCUS_04170 gene pstB 17630 16860 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_04170 18484 17627 gene locus_tag LOCUS_04180 gene pstA 18484 17627 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_04180 19385 18471 gene locus_tag LOCUS_04190 gene pstC 19385 18471 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_04190 20312 19440 gene locus_tag LOCUS_04200 20312 19440 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_04200 21141 20620 gene locus_tag LOCUS_04210 gene raiA 21141 20620 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_04210 21384 21232 gene locus_tag LOCUS_04220 21384 21232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 23364 21475 gene locus_tag LOCUS_04230 gene dxs 23364 21475 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_04230 24135 23368 gene locus_tag LOCUS_04240 24135 23368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 25708 24119 gene locus_tag LOCUS_04250 25708 24119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 26849 25710 gene locus_tag LOCUS_04260 gene tgt 26849 25710 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_04260 28915 26867 gene locus_tag LOCUS_04270 gene mutL 28915 26867 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378991.1 protein_id gnl|my_center|LOCUS_04270 31549 28931 gene locus_tag LOCUS_04280 gene mutS 31549 28931 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541545.1 protein_id gnl|my_center|LOCUS_04280 32006 31599 gene locus_tag LOCUS_04290 32006 31599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 33385 32003 gene locus_tag LOCUS_04300 gene miaB 33385 32003 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_04300 33852 33385 gene locus_tag LOCUS_04310 33852 33385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 34568 33849 gene locus_tag LOCUS_04320 34568 33849 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_04320 35383 34712 gene locus_tag LOCUS_04330 35383 34712 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_04330 35583 36440 gene locus_tag LOCUS_04340 35583 36440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 37095 36484 gene locus_tag LOCUS_04350 37095 36484 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578704.1 protein_id gnl|my_center|LOCUS_04350 38068 37190 gene locus_tag LOCUS_04360 38068 37190 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255171.1 protein_id gnl|my_center|LOCUS_04360 38762 38052 gene locus_tag LOCUS_04370 38762 38052 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_04370 39688 38831 gene locus_tag LOCUS_04380 39688 38831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 41393 39999 gene locus_tag LOCUS_04390 gene argH 41393 39999 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_04390 42672 41452 gene locus_tag LOCUS_04400 42672 41452 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_04400 44923 42911 gene locus_tag LOCUS_04410 44923 42911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 47701 44975 gene locus_tag LOCUS_04420 47701 44975 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_04420 48373 47828 gene locus_tag LOCUS_04430 48373 47828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 49119 48373 gene locus_tag LOCUS_04440 49119 48373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 49343 49894 gene locus_tag LOCUS_04450 49343 49894 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_04450 49964 50149 gene locus_tag LOCUS_04460 gene rpmF 49964 50149 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_04460 51473 50298 gene locus_tag LOCUS_04470 51473 50298 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_04470 52295 51657 gene locus_tag LOCUS_04480 52295 51657 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 protein_id gnl|my_center|LOCUS_04480 54180 52474 gene locus_tag LOCUS_04490 54180 52474 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_04490 55750 54368 gene locus_tag LOCUS_04500 gene mgtE 55750 54368 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_04500 56589 55990 gene locus_tag LOCUS_04510 56589 55990 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_04510 56818 56894 gene locus_tag LOCUS_t00090 56818 56894 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 417 1205 gene locus_tag LOCUS_04520 417 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1568 1338 gene locus_tag LOCUS_04530 1568 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2924 1635 gene locus_tag LOCUS_04540 2924 1635 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_04540 3627 3043 gene locus_tag LOCUS_04550 3627 3043 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_04550 5907 3706 gene locus_tag LOCUS_04560 5907 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 8523 5938 gene locus_tag LOCUS_04570 8523 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 9366 8707 gene locus_tag LOCUS_04580 9366 8707 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_04580 10778 9486 gene locus_tag LOCUS_04590 10778 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12392 10926 gene locus_tag LOCUS_04600 12392 10926 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_04600 16909 12407 gene locus_tag LOCUS_04610 gene gltB 16909 12407 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_04610 18506 16923 gene locus_tag LOCUS_04620 gene asnB 18506 16923 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_04620 20302 18530 gene locus_tag LOCUS_04630 20302 18530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 22516 20423 gene locus_tag LOCUS_04640 22516 20423 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_04640 23010 24206 gene locus_tag LOCUS_04650 gene glnA 23010 24206 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_04650 24219 24803 gene locus_tag LOCUS_04660 24219 24803 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_04660 24843 26453 gene locus_tag LOCUS_04670 24843 26453 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_04670 26647 26722 gene locus_tag LOCUS_t00100 26647 26722 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29148 27031 gene locus_tag LOCUS_04680 29148 27031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 30668 29709 gene locus_tag LOCUS_04690 30668 29709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 30974 31774 gene locus_tag LOCUS_04700 30974 31774 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 protein_id gnl|my_center|LOCUS_04700 31873 32205 gene locus_tag LOCUS_04710 31873 32205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 32392 32634 gene locus_tag LOCUS_04720 32392 32634 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_04720 32631 33005 gene locus_tag LOCUS_04730 32631 33005 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_04730 33389 36298 gene locus_tag LOCUS_04740 33389 36298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 36318 37373 gene locus_tag LOCUS_04750 36318 37373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 38610 37531 gene locus_tag LOCUS_04760 38610 37531 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 protein_id gnl|my_center|LOCUS_04760 38889 39515 gene locus_tag LOCUS_04770 38889 39515 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_04770 39691 40809 gene locus_tag LOCUS_04780 39691 40809 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_04780 40952 41028 gene locus_tag LOCUS_t00110 40952 41028 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 41032 41106 gene locus_tag LOCUS_t00120 41032 41106 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 42700 41198 gene locus_tag LOCUS_04790 42700 41198 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_04790 43110 42940 gene locus_tag LOCUS_04800 43110 42940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 43915 44856 gene locus_tag LOCUS_04810 43915 44856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 45292 45522 gene locus_tag LOCUS_04820 45292 45522 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_04820 45522 48761 gene locus_tag LOCUS_04830 45522 48761 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_04830 48777 49379 gene locus_tag LOCUS_04840 48777 49379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 49383 50237 gene locus_tag LOCUS_04850 49383 50237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 50252 52270 gene locus_tag LOCUS_04860 50252 52270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 52270 52959 gene locus_tag LOCUS_04870 52270 52959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 52956 56060 gene locus_tag LOCUS_04880 52956 56060 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239259.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence08 882 127 gene locus_tag LOCUS_04890 gene truA 882 127 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_04890 1718 879 gene locus_tag LOCUS_04900 1718 879 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966381.1 protein_id gnl|my_center|LOCUS_04900 2578 1715 gene locus_tag LOCUS_04910 2578 1715 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_04910 3438 2575 gene locus_tag LOCUS_04920 3438 2575 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_04920 4315 3443 gene locus_tag LOCUS_04930 4315 3443 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_04930 4822 4325 gene locus_tag LOCUS_04940 gene ruvC 4822 4325 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_04940 4992 5600 gene locus_tag LOCUS_04950 gene ruvA 4992 5600 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772102.1 protein_id gnl|my_center|LOCUS_04950 5610 6665 gene locus_tag LOCUS_04960 gene ruvB 5610 6665 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_04960 7089 6955 gene locus_tag LOCUS_04970 7089 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8122 7082 gene locus_tag LOCUS_04980 8122 7082 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_04980 10428 8209 gene locus_tag LOCUS_04990 10428 8209 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_04990 11656 10472 gene locus_tag LOCUS_05000 gene metK 11656 10472 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_05000 14260 11873 gene locus_tag LOCUS_05010 14260 11873 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_05010 15054 14269 gene locus_tag LOCUS_05020 15054 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15938 15051 gene locus_tag LOCUS_05030 gene era 15938 15051 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964607.1 protein_id gnl|my_center|LOCUS_05030 16447 15935 gene locus_tag LOCUS_05040 gene ybeY 16447 15935 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_05040 17469 16444 gene locus_tag LOCUS_05050 17469 16444 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_05050 18687 17536 gene locus_tag LOCUS_05060 18687 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 18989 18684 gene locus_tag LOCUS_05070 18989 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 19050 19955 gene locus_tag LOCUS_05080 19050 19955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 20000 20236 gene locus_tag LOCUS_05090 20000 20236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 22877 20376 gene locus_tag LOCUS_05100 22877 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 25197 22870 gene locus_tag LOCUS_05110 25197 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 26251 25280 gene locus_tag LOCUS_05120 26251 25280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 26388 27755 gene locus_tag LOCUS_05130 gene pepV 26388 27755 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_05130 28405 27815 gene locus_tag LOCUS_05140 28405 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 29682 28417 gene locus_tag LOCUS_05150 29682 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 31514 29721 gene locus_tag LOCUS_05160 31514 29721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 31827 32648 gene locus_tag LOCUS_05170 31827 32648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 32635 33570 gene locus_tag LOCUS_05180 32635 33570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 33630 34640 gene locus_tag LOCUS_05190 gene rfbB 33630 34640 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_05190 34708 35280 gene locus_tag LOCUS_05200 34708 35280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 36637 35753 gene locus_tag LOCUS_05210 36637 35753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 40195 36656 gene locus_tag LOCUS_05220 40195 36656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 42108 40273 gene locus_tag LOCUS_05230 42108 40273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 44878 42680 gene locus_tag LOCUS_05240 44878 42680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 45408 45824 gene locus_tag LOCUS_05250 45408 45824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 46185 45937 gene locus_tag LOCUS_05260 46185 45937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 48917 46329 gene locus_tag LOCUS_05270 48917 46329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 49276 48914 gene locus_tag LOCUS_05280 49276 48914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 51953 49326 gene locus_tag LOCUS_05290 51953 49326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence09 644 486 gene locus_tag LOCUS_05300 644 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 1158 745 gene locus_tag LOCUS_05310 1158 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 2885 1155 gene locus_tag LOCUS_05320 2885 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5049 2863 gene locus_tag LOCUS_05330 5049 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 6639 5053 gene locus_tag LOCUS_05340 6639 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 7627 6641 gene locus_tag LOCUS_05350 7627 6641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470381.1 protein_id gnl|my_center|LOCUS_05350 10250 7716 gene locus_tag LOCUS_05360 10250 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 11438 10665 gene locus_tag LOCUS_05370 11438 10665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_05370 11816 11892 gene locus_tag LOCUS_t00130 11816 11892 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12588 13496 gene locus_tag LOCUS_05380 12588 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 20061 14092 gene locus_tag LOCUS_05390 20061 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 21269 20865 gene locus_tag LOCUS_05400 21269 20865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 21500 22387 gene locus_tag LOCUS_05410 21500 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 22497 23741 gene locus_tag LOCUS_05420 22497 23741 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_05420 25473 23854 gene locus_tag LOCUS_05430 25473 23854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_05430 26201 25476 gene locus_tag LOCUS_05440 26201 25476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_05440 27262 26219 gene locus_tag LOCUS_05450 27262 26219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 28372 27407 gene locus_tag LOCUS_05460 28372 27407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 29180 28581 gene locus_tag LOCUS_05470 29180 28581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 30273 29170 gene locus_tag LOCUS_05480 gene recA 30273 29170 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_05480 31657 30380 gene locus_tag LOCUS_05490 31657 30380 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729265.1 protein_id gnl|my_center|LOCUS_05490 32640 31693 gene locus_tag LOCUS_05500 gene miaA 32640 31693 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_05500 33567 32641 gene locus_tag LOCUS_05510 33567 32641 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804230.1 protein_id gnl|my_center|LOCUS_05510 35923 33617 gene locus_tag LOCUS_05520 35923 33617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 36636 35920 gene locus_tag LOCUS_05530 36636 35920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 39939 37063 gene locus_tag LOCUS_05540 39939 37063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 40155 39955 gene locus_tag LOCUS_05550 40155 39955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 40553 40284 gene locus_tag LOCUS_05560 40553 40284 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_05560 41582 40557 gene locus_tag LOCUS_05570 gene nusA 41582 40557 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_05570 42099 41638 gene locus_tag LOCUS_05580 gene rimP 42099 41638 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986793.1 protein_id gnl|my_center|LOCUS_05580 42637 42197 gene locus_tag LOCUS_05590 42637 42197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 43075 42659 gene locus_tag LOCUS_05600 43075 42659 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_05600 43908 43072 gene locus_tag LOCUS_05610 gene coaW 43908 43072 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862728.1 protein_id gnl|my_center|LOCUS_05610 44104 44235 gene locus_tag LOCUS_05620 44104 44235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 44608 45294 gene locus_tag LOCUS_05630 44608 45294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 45272 46555 gene locus_tag LOCUS_05640 45272 46555 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132113.1 protein_id gnl|my_center|LOCUS_05640 46559 47218 gene locus_tag LOCUS_05650 46559 47218 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924376.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence10 506 709 gene locus_tag LOCUS_05660 506 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 791 2485 gene locus_tag LOCUS_05670 791 2485 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_05670 3039 2740 gene locus_tag LOCUS_05680 gene spoVG 3039 2740 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_05680 3167 4525 gene locus_tag LOCUS_05690 gene murC 3167 4525 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880875.1 protein_id gnl|my_center|LOCUS_05690 5389 4580 gene locus_tag LOCUS_05700 5389 4580 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_05700 6558 5386 gene locus_tag LOCUS_05710 6558 5386 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_05710 6719 8083 gene locus_tag LOCUS_05720 6719 8083 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_05720 8193 9029 gene locus_tag LOCUS_05730 gene dapF 8193 9029 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_05730 9867 9103 gene locus_tag LOCUS_05740 9867 9103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_05740 10646 9864 gene locus_tag LOCUS_05750 10646 9864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836790.1 protein_id gnl|my_center|LOCUS_05750 10860 10633 gene locus_tag LOCUS_05760 10860 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 11288 12721 gene locus_tag LOCUS_05770 gene malQ 11288 12721 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_05770 12839 13096 gene locus_tag LOCUS_05780 12839 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14872 13211 gene locus_tag LOCUS_05790 gene gpmI 14872 13211 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_05790 16922 14895 gene locus_tag LOCUS_05800 gene gyrB 16922 14895 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_05800 17087 17284 gene locus_tag LOCUS_05810 17087 17284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 21979 17516 gene locus_tag LOCUS_05820 21979 17516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05820 22913 21984 gene locus_tag LOCUS_05830 22913 21984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 23232 24443 gene locus_tag LOCUS_05840 23232 24443 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_05840 25372 24533 gene locus_tag LOCUS_05850 25372 24533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 26691 25453 gene locus_tag LOCUS_05860 26691 25453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 27924 26740 gene locus_tag LOCUS_05870 27924 26740 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284165.1 protein_id gnl|my_center|LOCUS_05870 28754 27912 gene locus_tag LOCUS_05880 gene dapF 28754 27912 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_05880 29563 28751 gene locus_tag LOCUS_05890 gene dapB 29563 28751 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_05890 30662 29682 gene locus_tag LOCUS_05900 30662 29682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_05900 31836 30664 gene locus_tag LOCUS_05910 31836 30664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_05910 33529 31826 gene locus_tag LOCUS_05920 33529 31826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330490.1 protein_id gnl|my_center|LOCUS_05920 34911 33628 gene locus_tag LOCUS_05930 34911 33628 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_05930 35566 34991 gene locus_tag LOCUS_05940 35566 34991 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866485.1 protein_id gnl|my_center|LOCUS_05940 36124 36049 gene locus_tag LOCUS_t00140 36124 36049 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 36370 37344 gene locus_tag LOCUS_05950 gene bsh 36370 37344 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_05950 37410 38459 gene locus_tag LOCUS_05960 37410 38459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 40284 38884 gene locus_tag LOCUS_05970 40284 38884 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_05970 41674 40346 gene locus_tag LOCUS_05980 gene mtaB 41674 40346 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 protein_id gnl|my_center|LOCUS_05980 41886 42020 gene locus_tag LOCUS_05990 41886 42020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 42108 42485 gene locus_tag LOCUS_06000 42108 42485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 42482 42790 gene locus_tag LOCUS_06010 42482 42790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 42783 43826 gene locus_tag LOCUS_06020 42783 43826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 43844 44881 gene locus_tag LOCUS_06030 43844 44881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 44874 46262 gene locus_tag LOCUS_06040 gene mnmE 44874 46262 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_06040 46275 46625 gene locus_tag LOCUS_06050 46275 46625 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888516.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence11 637 1218 gene locus_tag LOCUS_06060 637 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 1712 2026 gene locus_tag LOCUS_06070 1712 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2736 3446 gene locus_tag LOCUS_06080 2736 3446 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674361.1 protein_id gnl|my_center|LOCUS_06080 3443 4231 gene locus_tag LOCUS_06090 3443 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4228 5079 gene locus_tag LOCUS_06100 4228 5079 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594027.1 protein_id gnl|my_center|LOCUS_06100 5072 6850 gene locus_tag LOCUS_06110 5072 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 8500 7385 gene locus_tag LOCUS_06120 8500 7385 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_06120 8686 9609 gene locus_tag LOCUS_06130 gene ribF 8686 9609 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 protein_id gnl|my_center|LOCUS_06130 9585 10505 gene locus_tag LOCUS_06140 gene prmA 9585 10505 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922698.1 protein_id gnl|my_center|LOCUS_06140 10521 11282 gene locus_tag LOCUS_06150 10521 11282 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_06150 11414 12499 gene locus_tag LOCUS_06160 11414 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 12629 13975 gene locus_tag LOCUS_06170 12629 13975 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_06170 14071 14832 gene locus_tag LOCUS_06180 14071 14832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 14842 16341 gene locus_tag LOCUS_06190 gene lysS 14842 16341 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_06190 16472 17068 gene locus_tag LOCUS_06200 16472 17068 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_06200 17437 18672 gene locus_tag LOCUS_06210 17437 18672 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966655.1 protein_id gnl|my_center|LOCUS_06210 18669 19577 gene locus_tag LOCUS_06220 18669 19577 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_06220 19973 21181 gene locus_tag LOCUS_06230 19973 21181 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_06230 21219 22691 gene locus_tag LOCUS_06240 21219 22691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 22799 22999 gene locus_tag LOCUS_06250 22799 22999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 23248 24663 gene locus_tag LOCUS_06260 23248 24663 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_06260 24716 25465 gene locus_tag LOCUS_06270 24716 25465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 29550 25915 gene locus_tag LOCUS_06280 29550 25915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 31992 30097 gene locus_tag LOCUS_06290 gene mnmG 31992 30097 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_06290 32626 32075 gene locus_tag LOCUS_06300 32626 32075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 33425 32766 gene locus_tag LOCUS_06310 33425 32766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 34150 33422 gene locus_tag LOCUS_06320 34150 33422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 35031 34156 gene locus_tag LOCUS_06330 35031 34156 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_06330 36141 35380 gene locus_tag LOCUS_06340 36141 35380 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_06340 37294 37485 gene locus_tag LOCUS_06350 37294 37485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 38506 39159 gene locus_tag LOCUS_06360 38506 39159 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_06360 39400 40281 gene locus_tag LOCUS_06370 39400 40281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 44630 40872 gene locus_tag LOCUS_06380 gene addA 44630 40872 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_06380 45653 44712 gene locus_tag LOCUS_06390 gene truB 45653 44712 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222326.1 protein_id gnl|my_center|LOCUS_06390 46167 45631 gene locus_tag LOCUS_06400 46167 45631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence12 725 898 gene locus_tag LOCUS_06410 725 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1066 1830 gene locus_tag LOCUS_06420 1066 1830 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_06420 3588 2242 gene locus_tag LOCUS_06430 3588 2242 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_06430 3917 4633 gene locus_tag LOCUS_06440 3917 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4646 5503 gene locus_tag LOCUS_06450 4646 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5669 6577 gene locus_tag LOCUS_06460 5669 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 6711 8945 gene locus_tag LOCUS_06470 6711 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 8977 9129 gene locus_tag LOCUS_06480 8977 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 9170 11137 gene locus_tag LOCUS_06490 9170 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 12136 11333 gene locus_tag LOCUS_06500 12136 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 12334 13383 gene locus_tag LOCUS_06510 12334 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 13442 14575 gene locus_tag LOCUS_06520 13442 14575 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192812.1 protein_id gnl|my_center|LOCUS_06520 14572 15561 gene locus_tag LOCUS_06530 14572 15561 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_06530 15572 17014 gene locus_tag LOCUS_06540 15572 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 17026 18729 gene locus_tag LOCUS_06550 17026 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 18726 20282 gene locus_tag LOCUS_06560 18726 20282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 20310 22256 gene locus_tag LOCUS_06570 20310 22256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 22261 23154 gene locus_tag LOCUS_06580 22261 23154 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_06580 23144 24028 gene locus_tag LOCUS_06590 23144 24028 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 protein_id gnl|my_center|LOCUS_06590 24093 25019 gene locus_tag LOCUS_06600 24093 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 26275 25316 gene locus_tag LOCUS_06610 26275 25316 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965544.1 protein_id gnl|my_center|LOCUS_06610 27642 26272 gene locus_tag LOCUS_06620 27642 26272 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_06620 28072 28974 gene locus_tag LOCUS_06630 28072 28974 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_06630 29312 31342 gene locus_tag LOCUS_06640 29312 31342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 32086 31520 gene locus_tag LOCUS_06650 32086 31520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 32563 32174 gene locus_tag LOCUS_06660 32563 32174 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_06660 33721 32822 gene locus_tag LOCUS_06670 33721 32822 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_06670 33889 35448 gene locus_tag LOCUS_06680 33889 35448 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965780.1 protein_id gnl|my_center|LOCUS_06680 35494 35724 gene locus_tag LOCUS_06690 35494 35724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 35859 35683 gene locus_tag LOCUS_06700 35859 35683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 36198 36123 gene locus_tag LOCUS_t00150 36198 36123 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 36296 36448 gene locus_tag LOCUS_06710 36296 36448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 36566 38020 gene locus_tag LOCUS_06720 36566 38020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 39512 38103 gene locus_tag LOCUS_06730 39512 38103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 40240 39509 gene locus_tag LOCUS_06740 40240 39509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 43356 40225 gene locus_tag LOCUS_06750 43356 40225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 43568 44059 gene locus_tag LOCUS_06760 gene trmL 43568 44059 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_06760 44305 44388 gene locus_tag LOCUS_t00160 44305 44388 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 1370 237 gene locus_tag LOCUS_06770 1370 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 1685 1398 gene locus_tag LOCUS_06780 1685 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3041 1827 gene locus_tag LOCUS_06790 3041 1827 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_06790 3126 4331 gene locus_tag LOCUS_06800 3126 4331 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_06800 4467 5090 gene locus_tag LOCUS_06810 gene coaE 4467 5090 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_06810 5083 6471 gene locus_tag LOCUS_06820 5083 6471 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667252.1 protein_id gnl|my_center|LOCUS_06820 6462 7550 gene locus_tag LOCUS_06830 gene prfA 6462 7550 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583170.1 protein_id gnl|my_center|LOCUS_06830 7547 8596 gene locus_tag LOCUS_06840 7547 8596 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_06840 8635 10833 gene locus_tag LOCUS_06850 gene gyrA 8635 10833 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877972.1 protein_id gnl|my_center|LOCUS_06850 10999 11307 gene locus_tag LOCUS_06860 gene rplU 10999 11307 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830820.1 protein_id gnl|my_center|LOCUS_06860 11311 11676 gene locus_tag LOCUS_06870 11311 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 11705 11983 gene locus_tag LOCUS_06880 gene rpmA 11705 11983 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 protein_id gnl|my_center|LOCUS_06880 12043 13062 gene locus_tag LOCUS_06890 gene galE 12043 13062 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156535.1 protein_id gnl|my_center|LOCUS_06890 14043 13132 gene locus_tag LOCUS_06900 gene trxB 14043 13132 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_06900 16426 14036 gene locus_tag LOCUS_06910 16426 14036 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_06910 17148 16441 gene locus_tag LOCUS_06920 17148 16441 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_06920 18101 17328 gene locus_tag LOCUS_06930 18101 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 18156 18461 gene locus_tag LOCUS_06940 gene spoIIID 18156 18461 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393849.1 protein_id gnl|my_center|LOCUS_06940 20766 19450 gene locus_tag LOCUS_06950 20766 19450 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_06950 20945 21035 gene locus_tag LOCUS_t00170 20945 21035 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21322 22167 gene locus_tag LOCUS_06960 21322 22167 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458873.1 protein_id gnl|my_center|LOCUS_06960 23083 22220 gene locus_tag LOCUS_06970 23083 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 23573 23169 gene locus_tag LOCUS_06980 23573 23169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_06980 25004 23658 gene locus_tag LOCUS_06990 25004 23658 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722393.1 protein_id gnl|my_center|LOCUS_06990 26303 25089 gene locus_tag LOCUS_07000 gene dacF 26303 25089 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831996.1 protein_id gnl|my_center|LOCUS_07000 26959 26372 gene locus_tag LOCUS_07010 26959 26372 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582845.1 protein_id gnl|my_center|LOCUS_07010 27089 28102 gene locus_tag LOCUS_07020 27089 28102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 28908 28147 gene locus_tag LOCUS_07030 gene pdaA 28908 28147 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_07030 29197 29021 gene locus_tag LOCUS_07040 29197 29021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 30152 29289 gene locus_tag LOCUS_07050 gene folD 30152 29289 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_07050 31143 30139 gene locus_tag LOCUS_07060 31143 30139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 31801 31241 gene locus_tag LOCUS_07070 gene spoVT 31801 31241 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_07070 33095 31941 gene locus_tag LOCUS_07080 33095 31941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 34383 33193 gene locus_tag LOCUS_07090 34383 33193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 35540 34452 gene locus_tag LOCUS_07100 gene rpoD 35540 34452 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_07100 37332 35542 gene locus_tag LOCUS_07110 gene dnaG 37332 35542 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_07110 38342 37329 gene locus_tag LOCUS_07120 38342 37329 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_07120 39058 38438 gene locus_tag LOCUS_07130 39058 38438 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813016.1 protein_id gnl|my_center|LOCUS_07130 40326 39070 gene locus_tag LOCUS_07140 gene hflX 40326 39070 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_07140 40602 40387 gene locus_tag LOCUS_07150 gene rpmE 40602 40387 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 protein_id gnl|my_center|LOCUS_07150 41409 40684 gene locus_tag LOCUS_07160 gene sigE 41409 40684 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_07160 42226 41411 gene locus_tag LOCUS_07170 42226 41411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 44159 42426 gene locus_tag LOCUS_07180 44159 42426 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_07180 44701 44177 gene locus_tag LOCUS_07190 44701 44177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence14 1047 382 gene locus_tag LOCUS_07200 1047 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1266 2072 gene locus_tag LOCUS_07210 1266 2072 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355679.1 protein_id gnl|my_center|LOCUS_07210 2076 2735 gene locus_tag LOCUS_07220 2076 2735 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_07220 2759 3571 gene locus_tag LOCUS_07230 gene nocP 2759 3571 CDS product nopaline ABC transporter ATP-binding protein NocP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974830.1 protein_id gnl|my_center|LOCUS_07230 4235 3726 gene locus_tag LOCUS_07240 4235 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 6754 4232 gene locus_tag LOCUS_07250 6754 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 7886 6756 gene locus_tag LOCUS_07260 7886 6756 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_07260 8513 7899 gene locus_tag LOCUS_07270 8513 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 8907 8719 gene locus_tag LOCUS_07280 8907 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 9777 9109 gene locus_tag LOCUS_07290 9777 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10353 11027 gene locus_tag LOCUS_07300 10353 11027 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_07300 11114 11539 gene locus_tag LOCUS_07310 11114 11539 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_07310 11549 12367 gene locus_tag LOCUS_07320 11549 12367 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993515.1 protein_id gnl|my_center|LOCUS_07320 12575 13762 gene locus_tag LOCUS_07330 gene nifS 12575 13762 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_07330 13782 14240 gene locus_tag LOCUS_07340 gene nifU 13782 14240 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_07340 15741 14416 gene locus_tag LOCUS_07350 15741 14416 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_07350 17047 15827 gene locus_tag LOCUS_07360 gene tyrS 17047 15827 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_07360 17854 17096 gene locus_tag LOCUS_07370 17854 17096 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905742.1 protein_id gnl|my_center|LOCUS_07370 18537 17851 gene locus_tag LOCUS_07380 18537 17851 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288335.1 protein_id gnl|my_center|LOCUS_07380 18739 18539 gene locus_tag LOCUS_07390 18739 18539 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_07390 18934 20043 gene locus_tag LOCUS_07400 gene prfB 18934 20043 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_07400 20054 20350 gene locus_tag LOCUS_07410 20054 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 20863 20465 gene locus_tag LOCUS_07420 20863 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 21311 20880 gene locus_tag LOCUS_07430 gene ruvX 21311 20880 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719835.1 protein_id gnl|my_center|LOCUS_07430 21502 22332 gene locus_tag LOCUS_07440 gene rlmA 21502 22332 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010128.1 protein_id gnl|my_center|LOCUS_07440 22388 22762 gene locus_tag LOCUS_07450 22388 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 24228 23149 gene locus_tag LOCUS_07460 gene queA 24228 23149 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_07460 24309 25193 gene locus_tag LOCUS_07470 gene dapA 24309 25193 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_07470 25276 25944 gene locus_tag LOCUS_07480 gene trmB 25276 25944 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239385.1 protein_id gnl|my_center|LOCUS_07480 26239 25946 gene locus_tag LOCUS_07490 26239 25946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 26369 26614 gene locus_tag LOCUS_07500 26369 26614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 26752 27477 gene locus_tag LOCUS_07510 gene radC 26752 27477 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688801.1 protein_id gnl|my_center|LOCUS_07510 27470 28189 gene locus_tag LOCUS_07520 gene radC 27470 28189 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_07520 28363 31308 gene locus_tag LOCUS_07530 28363 31308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 33192 31768 gene locus_tag LOCUS_07540 gene pyk 33192 31768 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_07540 33344 33658 gene locus_tag LOCUS_07550 gene trxA 33344 33658 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211990.1 protein_id gnl|my_center|LOCUS_07550 33655 33846 gene locus_tag LOCUS_07560 33655 33846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 33852 35762 gene locus_tag LOCUS_07570 33852 35762 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 protein_id gnl|my_center|LOCUS_07570 36457 35903 gene locus_tag LOCUS_07580 36457 35903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 36598 38463 gene locus_tag LOCUS_07590 gene guaA 36598 38463 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_07590 39191 38634 gene locus_tag LOCUS_07600 39191 38634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 39356 39544 gene locus_tag LOCUS_07610 39356 39544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_07610 39557 40633 gene locus_tag LOCUS_07620 39557 40633 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_07620 40637 40957 gene locus_tag LOCUS_07630 40637 40957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 41097 42119 gene locus_tag LOCUS_07640 41097 42119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence15 1076 237 gene locus_tag LOCUS_07650 1076 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2002 1073 gene locus_tag LOCUS_07660 2002 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3702 2050 gene locus_tag LOCUS_07670 3702 2050 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_07670 4353 3736 gene locus_tag LOCUS_07680 4353 3736 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_07680 4475 4699 gene locus_tag LOCUS_07690 4475 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4696 5832 gene locus_tag LOCUS_07700 4696 5832 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_07700 8189 6252 gene locus_tag LOCUS_07710 8189 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10660 8186 gene locus_tag LOCUS_07720 10660 8186 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_07720 12124 10694 gene locus_tag LOCUS_07730 gene glgA 12124 10694 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_07730 13306 12176 gene locus_tag LOCUS_07740 gene glgD 13306 12176 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_07740 14450 13308 gene locus_tag LOCUS_07750 14450 13308 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_07750 16473 14464 gene locus_tag LOCUS_07760 gene glgB 16473 14464 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_07760 17514 16702 gene locus_tag LOCUS_07770 17514 16702 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925297.1 protein_id gnl|my_center|LOCUS_07770 18103 17480 gene locus_tag LOCUS_07780 18103 17480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 18381 18103 gene locus_tag LOCUS_07790 18381 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 18675 18430 gene locus_tag LOCUS_07800 18675 18430 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_07800 18957 18682 gene locus_tag LOCUS_07810 18957 18682 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_07810 20793 19201 gene locus_tag LOCUS_07820 20793 19201 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_07820 22436 20895 gene locus_tag LOCUS_07830 22436 20895 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_07830 22897 22433 gene locus_tag LOCUS_07840 gene dtd 22897 22433 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_07840 25120 22898 gene locus_tag LOCUS_07850 25120 22898 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_07850 27267 25117 gene locus_tag LOCUS_07860 gene recJ 27267 25117 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_07860 28968 27337 gene locus_tag LOCUS_07870 28968 27337 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 protein_id gnl|my_center|LOCUS_07870 29804 28965 gene locus_tag LOCUS_07880 29804 28965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 30049 30750 gene locus_tag LOCUS_07890 30049 30750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 30777 31763 gene locus_tag LOCUS_07900 30777 31763 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_07900 31767 32552 gene locus_tag LOCUS_07910 31767 32552 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_07910 32533 33123 gene locus_tag LOCUS_07920 32533 33123 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_07920 34678 33182 gene locus_tag LOCUS_07930 34678 33182 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_07930 34843 36309 gene locus_tag LOCUS_07940 gene gltX 34843 36309 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_07940 36365 37222 gene locus_tag LOCUS_07950 36365 37222 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_07950 37209 38444 gene locus_tag LOCUS_07960 37209 38444 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_07960 38457 39134 gene locus_tag LOCUS_07970 gene cmk 38457 39134 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130902.1 protein_id gnl|my_center|LOCUS_07970 39131 39796 gene locus_tag LOCUS_07980 39131 39796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 39784 41883 gene locus_tag LOCUS_07990 39784 41883 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence16 1894 1819 gene locus_tag LOCUS_t00180 1894 1819 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1975 1902 gene locus_tag LOCUS_t00190 1975 1902 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2110 2622 gene locus_tag LOCUS_08000 2110 2622 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460298.1 protein_id gnl|my_center|LOCUS_08000 2622 3479 gene locus_tag LOCUS_08010 2622 3479 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_08010 3481 4545 gene locus_tag LOCUS_08020 3481 4545 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722481.1 protein_id gnl|my_center|LOCUS_08020 4716 5282 gene locus_tag LOCUS_08030 gene efp 4716 5282 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_08030 5294 5710 gene locus_tag LOCUS_08040 5294 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_08040 5809 6753 gene locus_tag LOCUS_08050 5809 6753 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846779.1 protein_id gnl|my_center|LOCUS_08050 7998 6832 gene locus_tag LOCUS_08060 7998 6832 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_08060 8066 8413 gene locus_tag LOCUS_08070 8066 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 8733 8506 gene locus_tag LOCUS_08080 gene acpP 8733 8506 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_08080 8971 8750 gene locus_tag LOCUS_08090 8971 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 8958 9293 gene locus_tag LOCUS_08100 8958 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9369 9445 gene locus_tag LOCUS_t00200 9369 9445 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9454 9530 gene locus_tag LOCUS_t00210 9454 9530 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12291 9865 gene locus_tag LOCUS_08110 12291 9865 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_08110 12964 12416 gene locus_tag LOCUS_08120 12964 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 14367 12961 gene locus_tag LOCUS_08130 14367 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 14804 14376 gene locus_tag LOCUS_08140 14804 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 15017 16135 gene locus_tag LOCUS_08150 15017 16135 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_08150 16917 16225 gene locus_tag LOCUS_08160 16917 16225 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_08160 17114 18208 gene locus_tag LOCUS_08170 gene ychF 17114 18208 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_08170 20604 18352 gene locus_tag LOCUS_08180 20604 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 21845 20601 gene locus_tag LOCUS_08190 21845 20601 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861165.1 protein_id gnl|my_center|LOCUS_08190 23977 21857 gene locus_tag LOCUS_08200 gene recG 23977 21857 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_08200 24157 26190 gene locus_tag LOCUS_08210 24157 26190 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 protein_id gnl|my_center|LOCUS_08210 26203 26646 gene locus_tag LOCUS_08220 gene rplI 26203 26646 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429267.1 protein_id gnl|my_center|LOCUS_08220 26646 28010 gene locus_tag LOCUS_08230 gene dnaB 26646 28010 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_08230 27985 29376 gene locus_tag LOCUS_08240 gene tilS 27985 29376 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_08240 29369 29911 gene locus_tag LOCUS_08250 29369 29911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08250 29951 31990 gene locus_tag LOCUS_08260 gene ftsH 29951 31990 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_08260 33596 32196 gene locus_tag LOCUS_08270 33596 32196 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635474.1 protein_id gnl|my_center|LOCUS_08270 35020 33617 gene locus_tag LOCUS_08280 35020 33617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 35417 35031 gene locus_tag LOCUS_08290 35417 35031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 35828 35430 gene locus_tag LOCUS_08300 35828 35430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 37200 35845 gene locus_tag LOCUS_08310 gene mmdA 37200 35845 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879706.1 protein_id gnl|my_center|LOCUS_08310 38266 37418 gene locus_tag LOCUS_08320 38266 37418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 38796 38263 gene locus_tag LOCUS_08330 38796 38263 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_08330 39897 38800 gene locus_tag LOCUS_08340 39897 38800 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_08340 40054 40656 gene locus_tag LOCUS_08350 40054 40656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 40711 41448 gene locus_tag LOCUS_08360 gene cwlD 40711 41448 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_08360 41441 41629 gene locus_tag LOCUS_08370 41441 41629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence17 650 1726 gene locus_tag LOCUS_08380 gene asd 650 1726 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_08380 2825 1812 gene locus_tag LOCUS_08390 2825 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2977 3816 gene locus_tag LOCUS_08400 2977 3816 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_08400 3850 5121 gene locus_tag LOCUS_08410 gene aroB 3850 5121 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_08410 5118 6221 gene locus_tag LOCUS_08420 gene aroC 5118 6221 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_08420 6335 7576 gene locus_tag LOCUS_08430 6335 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 7567 8013 gene locus_tag LOCUS_08440 gene aroQ 7567 8013 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860435.1 protein_id gnl|my_center|LOCUS_08440 8010 9224 gene locus_tag LOCUS_08450 gene aroA 8010 9224 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_08450 9217 10071 gene locus_tag LOCUS_08460 9217 10071 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_08460 10082 11110 gene locus_tag LOCUS_08470 10082 11110 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_08470 11308 11769 gene locus_tag LOCUS_08480 11308 11769 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048323.1 protein_id gnl|my_center|LOCUS_08480 12111 13484 gene locus_tag LOCUS_08490 gene asnS 12111 13484 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_08490 13540 14547 gene locus_tag LOCUS_08500 gene asnA 13540 14547 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284917.1 protein_id gnl|my_center|LOCUS_08500 14642 14806 gene locus_tag LOCUS_08510 14642 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 14803 15036 gene locus_tag LOCUS_08520 14803 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 15852 15319 gene locus_tag LOCUS_08530 15852 15319 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_08530 16023 16592 gene locus_tag LOCUS_08540 16023 16592 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704380.1 protein_id gnl|my_center|LOCUS_08540 17441 16671 gene locus_tag LOCUS_08550 gene trmD 17441 16671 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_08550 17953 17438 gene locus_tag LOCUS_08560 gene rimM 17953 17438 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083314.1 protein_id gnl|my_center|LOCUS_08560 18432 17950 gene locus_tag LOCUS_08570 gene tadA 18432 17950 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_08570 19277 18420 gene locus_tag LOCUS_08580 19277 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 21745 19535 gene locus_tag LOCUS_08590 gene rnr 21745 19535 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654875.1 protein_id gnl|my_center|LOCUS_08590 22191 21868 gene locus_tag LOCUS_08600 22191 21868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 23756 22293 gene locus_tag LOCUS_08610 23756 22293 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939558.1 protein_id gnl|my_center|LOCUS_08610 23954 25105 gene locus_tag LOCUS_08620 23954 25105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 26351 25293 gene locus_tag LOCUS_08630 26351 25293 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_08630 26557 26481 gene locus_tag LOCUS_t00220 26557 26481 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26655 26579 gene locus_tag LOCUS_t00230 26655 26579 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26783 29155 gene locus_tag LOCUS_08640 26783 29155 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930732.1 protein_id gnl|my_center|LOCUS_08640 29243 29623 gene locus_tag LOCUS_08650 29243 29623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 30961 29690 gene locus_tag LOCUS_08660 30961 29690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 31171 31944 gene locus_tag LOCUS_08670 31171 31944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 32185 32493 gene locus_tag LOCUS_08680 32185 32493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 32490 33008 gene locus_tag LOCUS_08690 32490 33008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 33005 33976 gene locus_tag LOCUS_08700 33005 33976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 34051 34350 gene locus_tag LOCUS_08710 gene atpE 34051 34350 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_08710 34388 34909 gene locus_tag LOCUS_08720 34388 34909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 34902 35438 gene locus_tag LOCUS_08730 34902 35438 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_08730 35457 36980 gene locus_tag LOCUS_08740 gene atpA 35457 36980 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_08740 36977 37819 gene locus_tag LOCUS_08750 gene atpG 36977 37819 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_08750 37852 39252 gene locus_tag LOCUS_08760 gene atpD 37852 39252 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_08760 39258 39536 gene locus_tag LOCUS_08770 gene atpC 39258 39536 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425849.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence18 359 3559 gene locus_tag LOCUS_08780 359 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3610 4164 gene locus_tag LOCUS_08790 3610 4164 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656771.1 protein_id gnl|my_center|LOCUS_08790 6435 4999 gene locus_tag LOCUS_08800 6435 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7253 6432 gene locus_tag LOCUS_08810 7253 6432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_08810 8041 7253 gene locus_tag LOCUS_08820 8041 7253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_08820 9261 8098 gene locus_tag LOCUS_08830 9261 8098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964158.1 protein_id gnl|my_center|LOCUS_08830 10112 9477 gene locus_tag LOCUS_08840 10112 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 11751 10315 gene locus_tag LOCUS_08850 gene proS 11751 10315 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_08850 12107 13369 gene locus_tag LOCUS_08860 12107 13369 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_08860 13566 13691 gene locus_tag LOCUS_08870 13566 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 13902 14750 gene locus_tag LOCUS_08880 13902 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 14808 15824 gene locus_tag LOCUS_08890 gene metN 14808 15824 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095679.1 protein_id gnl|my_center|LOCUS_08890 15814 16524 gene locus_tag LOCUS_08900 15814 16524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009571.1 protein_id gnl|my_center|LOCUS_08900 16542 17474 gene locus_tag LOCUS_08910 gene cysK 16542 17474 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_08910 17534 18643 gene locus_tag LOCUS_08920 gene mnmA 17534 18643 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_08920 18690 19121 gene locus_tag LOCUS_08930 18690 19121 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_08930 21608 19266 gene locus_tag LOCUS_08940 21608 19266 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_08940 23803 21908 gene locus_tag LOCUS_08950 23803 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 25295 24000 gene locus_tag LOCUS_08960 25295 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 27422 25392 gene locus_tag LOCUS_08970 gene ligA 27422 25392 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_08970 28168 27431 gene locus_tag LOCUS_08980 28168 27431 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_08980 28226 28789 gene locus_tag LOCUS_08990 28226 28789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 29597 28911 gene locus_tag LOCUS_09000 29597 28911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393882.1 protein_id gnl|my_center|LOCUS_09000 30202 29615 gene locus_tag LOCUS_09010 30202 29615 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_09010 30735 30199 gene locus_tag LOCUS_09020 30735 30199 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_09020 34038 30787 gene locus_tag LOCUS_09030 34038 30787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 34280 35710 gene locus_tag LOCUS_09040 34280 35710 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_09040 35863 36432 gene locus_tag LOCUS_09050 35863 36432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 36992 36537 gene locus_tag LOCUS_09060 gene rpiB 36992 36537 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_09060 37724 37005 gene locus_tag LOCUS_09070 gene tsaB 37724 37005 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_09070 38161 37721 gene locus_tag LOCUS_09080 gene tsaE 38161 37721 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_09080 <38949 38158 gene locus_tag LOCUS_09090 <38949 38158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681116.1:SAM-dependent methyltransferase >Feature sequence19 358 1827 gene locus_tag LOCUS_09100 358 1827 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_09100 1850 3100 gene locus_tag LOCUS_09110 gene rhaA 1850 3100 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602491.1 protein_id gnl|my_center|LOCUS_09110 3195 4892 gene locus_tag LOCUS_09120 3195 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_09120 6895 5966 gene locus_tag LOCUS_09130 6895 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 7481 7101 gene locus_tag LOCUS_09140 7481 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 8435 7539 gene locus_tag LOCUS_09150 8435 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 9346 8432 gene locus_tag LOCUS_09160 9346 8432 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_09160 10999 9392 gene locus_tag LOCUS_09170 10999 9392 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251419.1 protein_id gnl|my_center|LOCUS_09170 12157 11093 gene locus_tag LOCUS_09180 gene nagA 12157 11093 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_09180 12872 12150 gene locus_tag LOCUS_09190 gene nagB 12872 12150 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987104.1 protein_id gnl|my_center|LOCUS_09190 13106 14050 gene locus_tag LOCUS_09200 13106 14050 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183386.1 protein_id gnl|my_center|LOCUS_09200 14043 15032 gene locus_tag LOCUS_09210 14043 15032 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989747.1 protein_id gnl|my_center|LOCUS_09210 15029 15757 gene locus_tag LOCUS_09220 gene surE 15029 15757 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_09220 15810 16295 gene locus_tag LOCUS_09230 15810 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 16310 16846 gene locus_tag LOCUS_09240 16310 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 16951 17349 gene locus_tag LOCUS_09250 16951 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 17346 18113 gene locus_tag LOCUS_09260 17346 18113 CDS product DpnI domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678771.1 protein_id gnl|my_center|LOCUS_09260 18191 18370 gene locus_tag LOCUS_09270 18191 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 19231 18494 gene locus_tag LOCUS_09280 19231 18494 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 protein_id gnl|my_center|LOCUS_09280 19994 19233 gene locus_tag LOCUS_09290 19994 19233 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_09290 20866 20027 gene locus_tag LOCUS_09300 20866 20027 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814503.1 protein_id gnl|my_center|LOCUS_09300 22180 21437 gene locus_tag LOCUS_09310 22180 21437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 22288 23517 gene locus_tag LOCUS_09320 22288 23517 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_09320 23791 24306 gene locus_tag LOCUS_09330 23791 24306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 24693 28700 gene locus_tag LOCUS_09340 gene cas9 24693 28700 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_09340 28675 29550 gene locus_tag LOCUS_09350 gene cas1 28675 29550 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_09350 29543 29863 gene locus_tag LOCUS_09360 gene cas2 29543 29863 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_09360 29914 30528 gene locus_tag LOCUS_09370 29914 30528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 30648 31541 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgagagtagtgtaattctatacggtagtcaaac 31629 31704 gene locus_tag LOCUS_t00240 31629 31704 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 33361 31940 gene locus_tag LOCUS_09380 33361 31940 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_09380 34545 33373 gene locus_tag LOCUS_09390 34545 33373 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_09390 36214 34538 gene locus_tag LOCUS_09400 36214 34538 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986398.1 protein_id gnl|my_center|LOCUS_09400 36483 36220 gene locus_tag LOCUS_09410 36483 36220 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_09410 36726 36487 gene locus_tag LOCUS_09420 36726 36487 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_09420 37504 36755 gene locus_tag LOCUS_09430 37504 36755 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence20 781 176 gene locus_tag LOCUS_09440 gene recR 781 176 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_09440 1145 783 gene locus_tag LOCUS_09450 1145 783 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_09450 2792 1158 gene locus_tag LOCUS_09460 2792 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 5012 3378 gene locus_tag LOCUS_09470 5012 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5818 5102 gene locus_tag LOCUS_09480 5818 5102 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_09480 5959 6636 gene locus_tag LOCUS_09490 5959 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 6727 7437 gene locus_tag LOCUS_09500 gene sigK 6727 7437 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_09500 7507 7722 gene locus_tag LOCUS_09510 7507 7722 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_09510 7912 8319 gene locus_tag LOCUS_09520 7912 8319 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_09520 8421 9137 gene locus_tag LOCUS_09530 8421 9137 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431305.1 protein_id gnl|my_center|LOCUS_09530 9288 10220 gene locus_tag LOCUS_09540 9288 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 10275 10958 gene locus_tag LOCUS_09550 10275 10958 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_09550 10998 13541 gene locus_tag LOCUS_09560 10998 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 14866 13616 gene locus_tag LOCUS_09570 14866 13616 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_09570 15971 14856 gene locus_tag LOCUS_09580 15971 14856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 16046 16384 gene locus_tag LOCUS_09590 16046 16384 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_09590 16816 16475 gene locus_tag LOCUS_09600 gene rplS 16816 16475 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_09600 17061 18266 gene locus_tag LOCUS_09610 17061 18266 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_09610 18287 18964 gene locus_tag LOCUS_09620 gene lepB 18287 18964 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861178.1 protein_id gnl|my_center|LOCUS_09620 18964 19842 gene locus_tag LOCUS_09630 gene ylqF 18964 19842 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965068.1 protein_id gnl|my_center|LOCUS_09630 19845 20450 gene locus_tag LOCUS_09640 19845 20450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 20447 20869 gene locus_tag LOCUS_09650 20447 20869 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_09650 20902 21792 gene locus_tag LOCUS_09660 20902 21792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 21843 23330 gene locus_tag LOCUS_09670 gene thrC 21843 23330 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774945.1 protein_id gnl|my_center|LOCUS_09670 23514 23332 gene locus_tag LOCUS_09680 23514 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 23600 24334 gene locus_tag LOCUS_09690 23600 24334 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_09690 24479 25792 gene locus_tag LOCUS_09700 gene tig 24479 25792 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_09700 25842 26426 gene locus_tag LOCUS_09710 gene clpP 25842 26426 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_09710 26517 27833 gene locus_tag LOCUS_09720 gene clpX 26517 27833 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896045.1 protein_id gnl|my_center|LOCUS_09720 28758 27928 gene locus_tag LOCUS_09730 28758 27928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 31492 28862 gene locus_tag LOCUS_09740 31492 28862 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_09740 32160 31840 gene locus_tag LOCUS_09750 32160 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 33389 32259 gene locus_tag LOCUS_09760 gene hemW 33389 32259 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_09760 35190 33376 gene locus_tag LOCUS_09770 gene lepA 35190 33376 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_09770 36008 35214 gene locus_tag LOCUS_09780 36008 35214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence21 512 213 gene locus_tag LOCUS_09790 512 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2048 735 gene locus_tag LOCUS_09800 2048 735 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_09800 2346 3944 gene locus_tag LOCUS_09810 2346 3944 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_09810 5322 3976 gene locus_tag LOCUS_09820 gene gdhA 5322 3976 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_09820 7568 5433 gene locus_tag LOCUS_09830 gene feoB 7568 5433 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_09830 7815 7579 gene locus_tag LOCUS_09840 7815 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 8011 9228 gene locus_tag LOCUS_09850 8011 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 10240 9386 gene locus_tag LOCUS_09860 10240 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 10810 10247 gene locus_tag LOCUS_09870 10810 10247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 11333 10989 gene locus_tag LOCUS_09880 11333 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 13474 11330 gene locus_tag LOCUS_09890 13474 11330 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 protein_id gnl|my_center|LOCUS_09890 13678 15303 gene locus_tag LOCUS_09900 13678 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 15300 16145 gene locus_tag LOCUS_09910 15300 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 16330 17151 gene locus_tag LOCUS_09920 16330 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 17844 17290 gene locus_tag LOCUS_09930 17844 17290 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986538.1 protein_id gnl|my_center|LOCUS_09930 18096 17854 gene locus_tag LOCUS_09940 18096 17854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 18062 18784 gene locus_tag LOCUS_09950 18062 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 20330 19005 gene locus_tag LOCUS_09960 20330 19005 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_09960 21088 25023 gene locus_tag LOCUS_09970 gene rpoB 21088 25023 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_09970 25094 28828 gene locus_tag LOCUS_09980 gene rpoC 25094 28828 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429485.1 protein_id gnl|my_center|LOCUS_09980 29049 29465 gene locus_tag LOCUS_09990 gene rpsL 29049 29465 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142341.1 protein_id gnl|my_center|LOCUS_09990 29621 30091 gene locus_tag LOCUS_10000 gene rpsG 29621 30091 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421180.1 protein_id gnl|my_center|LOCUS_10000 30122 32245 gene locus_tag LOCUS_10010 gene fusA 30122 32245 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_10010 32327 33529 gene locus_tag LOCUS_10020 gene tuf 32327 33529 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_10020 33876 34667 gene locus_tag LOCUS_10030 33876 34667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence22 321 246 gene locus_tag LOCUS_t00250 321 246 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 706 891 gene locus_tag LOCUS_10040 706 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1135 2562 gene locus_tag LOCUS_10050 1135 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2559 3881 gene locus_tag LOCUS_10060 2559 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3886 4797 gene locus_tag LOCUS_10070 3886 4797 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 protein_id gnl|my_center|LOCUS_10070 4898 8572 gene locus_tag LOCUS_10080 4898 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 8587 9564 gene locus_tag LOCUS_10090 8587 9564 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_10090 9627 10979 gene locus_tag LOCUS_10100 9627 10979 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254171.1 protein_id gnl|my_center|LOCUS_10100 11082 12113 gene locus_tag LOCUS_10110 11082 12113 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546228.1 protein_id gnl|my_center|LOCUS_10110 12115 13044 gene locus_tag LOCUS_10120 12115 13044 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819520.1 protein_id gnl|my_center|LOCUS_10120 13053 15611 gene locus_tag LOCUS_10130 13053 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 15626 18193 gene locus_tag LOCUS_10140 15626 18193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 18209 18364 gene locus_tag LOCUS_10150 18209 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 18414 21296 gene locus_tag LOCUS_10160 18414 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 21346 22701 gene locus_tag LOCUS_10170 21346 22701 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055010987.1 protein_id gnl|my_center|LOCUS_10170 23450 23142 gene locus_tag LOCUS_10180 23450 23142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 24347 23532 gene locus_tag LOCUS_10190 24347 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 25813 24794 gene locus_tag LOCUS_10200 25813 24794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 25986 26786 gene locus_tag LOCUS_10210 25986 26786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 27252 26872 gene locus_tag LOCUS_10220 gene rbfA 27252 26872 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 protein_id gnl|my_center|LOCUS_10220 28082 27315 gene locus_tag LOCUS_10230 gene murI 28082 27315 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880160.1 protein_id gnl|my_center|LOCUS_10230 29095 28076 gene locus_tag LOCUS_10240 29095 28076 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933013.1 protein_id gnl|my_center|LOCUS_10240 29952 29146 gene locus_tag LOCUS_10250 gene prmC 29952 29146 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640077.1 protein_id gnl|my_center|LOCUS_10250 31193 29949 gene locus_tag LOCUS_10260 31193 29949 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_10260 33792 31375 gene locus_tag LOCUS_10270 33792 31375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence23 538 2007 gene locus_tag LOCUS_10280 538 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2047 3045 gene locus_tag LOCUS_10290 2047 3045 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_10290 3894 3154 gene locus_tag LOCUS_10300 3894 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4069 5343 gene locus_tag LOCUS_10310 4069 5343 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783481.1 protein_id gnl|my_center|LOCUS_10310 5410 6180 gene locus_tag LOCUS_10320 5410 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 6177 7082 gene locus_tag LOCUS_10330 6177 7082 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_10330 7079 9265 gene locus_tag LOCUS_10340 7079 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 9519 10712 gene locus_tag LOCUS_10350 9519 10712 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_10350 10764 12188 gene locus_tag LOCUS_10360 10764 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 12185 13594 gene locus_tag LOCUS_10370 12185 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 13640 14440 gene locus_tag LOCUS_10380 gene licD 13640 14440 CDS product lipopolysaccharide cholinephosphotransferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693564.1 protein_id gnl|my_center|LOCUS_10380 14540 15241 gene locus_tag LOCUS_10390 14540 15241 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638485.1 protein_id gnl|my_center|LOCUS_10390 15238 16275 gene locus_tag LOCUS_10400 15238 16275 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969792.1 protein_id gnl|my_center|LOCUS_10400 16443 17219 gene locus_tag LOCUS_10410 gene sigG 16443 17219 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_10410 18379 17300 gene locus_tag LOCUS_10420 gene spoIVB 18379 17300 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_10420 19239 18709 gene locus_tag LOCUS_10430 19239 18709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 20336 19236 gene locus_tag LOCUS_10440 20336 19236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 20487 21428 gene locus_tag LOCUS_10450 gene hprK 20487 21428 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_10450 21849 22325 gene locus_tag LOCUS_10460 21849 22325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 22500 23840 gene locus_tag LOCUS_10470 22500 23840 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906329.1 protein_id gnl|my_center|LOCUS_10470 25363 24155 gene locus_tag LOCUS_10480 25363 24155 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence24 1242 10 gene locus_tag LOCUS_10490 gene xseA 1242 10 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_10490 2241 1297 gene locus_tag LOCUS_10500 2241 1297 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_10500 2651 2238 gene locus_tag LOCUS_10510 gene nusB 2651 2238 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965384.1 protein_id gnl|my_center|LOCUS_10510 2860 3318 gene locus_tag LOCUS_10520 2860 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4185 3490 gene locus_tag LOCUS_10530 4185 3490 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_10530 5551 4196 gene locus_tag LOCUS_10540 5551 4196 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_10540 6887 5658 gene locus_tag LOCUS_10550 6887 5658 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_10550 7827 6889 gene locus_tag LOCUS_10560 gene hslO 7827 6889 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460517.1 protein_id gnl|my_center|LOCUS_10560 8591 7824 gene locus_tag LOCUS_10570 8591 7824 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_10570 10816 8588 gene locus_tag LOCUS_10580 10816 8588 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459225.1 protein_id gnl|my_center|LOCUS_10580 12172 10826 gene locus_tag LOCUS_10590 12172 10826 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272228.1 protein_id gnl|my_center|LOCUS_10590 13794 12154 gene locus_tag LOCUS_10600 13794 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 14799 13939 gene locus_tag LOCUS_10610 gene ispE 14799 13939 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638870.1 protein_id gnl|my_center|LOCUS_10610 14931 16268 gene locus_tag LOCUS_10620 14931 16268 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_10620 16265 17869 gene locus_tag LOCUS_10630 16265 17869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 18003 18413 gene locus_tag LOCUS_10640 18003 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 18434 18907 gene locus_tag LOCUS_10650 gene ssb 18434 18907 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_10650 19005 19253 gene locus_tag LOCUS_10660 gene rpsR 19005 19253 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_10660 19676 19413 gene locus_tag LOCUS_10670 gene rpsT 19676 19413 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358111.1 protein_id gnl|my_center|LOCUS_10670 19936 20283 gene locus_tag LOCUS_10680 19936 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 20294 21643 gene locus_tag LOCUS_10690 gene ffh 20294 21643 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_10690 21687 21929 gene locus_tag LOCUS_10700 gene rpsP 21687 21929 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_10700 21951 22184 gene locus_tag LOCUS_10710 21951 22184 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_10710 23095 22214 gene locus_tag LOCUS_10720 gene rsmA 23095 22214 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_10720 23161 23235 gene locus_tag LOCUS_t00260 23161 23235 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23279 23352 gene locus_tag LOCUS_t00270 23279 23352 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23967 23518 gene locus_tag LOCUS_10730 23967 23518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 24373 24765 gene locus_tag LOCUS_10740 24373 24765 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_10740 26155 25208 gene locus_tag LOCUS_10750 26155 25208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 26436 26167 gene locus_tag LOCUS_10760 26436 26167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence25 522 274 gene locus_tag LOCUS_10770 522 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 778 1677 gene locus_tag LOCUS_10780 778 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1778 4438 gene locus_tag LOCUS_10790 1778 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4695 6212 gene locus_tag LOCUS_10800 4695 6212 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_10800 6231 6911 gene locus_tag LOCUS_10810 6231 6911 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_10810 7169 7870 gene locus_tag LOCUS_10820 7169 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 8257 8706 gene locus_tag LOCUS_10830 8257 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 9944 9462 gene locus_tag LOCUS_10840 9944 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 10681 9992 gene locus_tag LOCUS_10850 10681 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 10909 11352 gene locus_tag LOCUS_10860 10909 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 11781 12224 gene locus_tag LOCUS_10870 gene spoVAC 11781 12224 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_10870 12256 13260 gene locus_tag LOCUS_10880 gene spoVAD 12256 13260 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437476.1 protein_id gnl|my_center|LOCUS_10880 13288 13662 gene locus_tag LOCUS_10890 gene spoVAE 13288 13662 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_10890 14230 15654 gene locus_tag LOCUS_10900 gene dnaA 14230 15654 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_10900 15925 17073 gene locus_tag LOCUS_10910 gene dnaN 15925 17073 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_10910 17075 18172 gene locus_tag LOCUS_10920 gene recF 17075 18172 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815135.1 protein_id gnl|my_center|LOCUS_10920 18153 18422 gene locus_tag LOCUS_10930 18153 18422 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_10930 18425 20374 gene locus_tag LOCUS_10940 gene gyrB 18425 20374 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_10940 20401 22974 gene locus_tag LOCUS_10950 gene gyrA 20401 22974 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_10950 22967 23677 gene locus_tag LOCUS_10960 22967 23677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 23664 24032 gene locus_tag LOCUS_10970 23664 24032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 24126 24401 gene locus_tag LOCUS_10980 24126 24401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 24594 26375 gene locus_tag LOCUS_10990 24594 26375 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence26 574 2379 gene locus_tag LOCUS_11000 574 2379 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862455.1 protein_id gnl|my_center|LOCUS_11000 2379 4151 gene locus_tag LOCUS_11010 2379 4151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_11010 4387 7464 gene locus_tag LOCUS_11020 4387 7464 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_11020 9816 8410 gene locus_tag LOCUS_11030 9816 8410 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896230.1 protein_id gnl|my_center|LOCUS_11030 10043 10615 gene locus_tag LOCUS_11040 10043 10615 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_11040 10783 12075 gene locus_tag LOCUS_11050 10783 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 12072 15002 gene locus_tag LOCUS_11060 12072 15002 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_11060 15377 15453 gene locus_tag LOCUS_t00280 15377 15453 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16052 15555 gene locus_tag LOCUS_11070 16052 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 17085 16456 gene locus_tag LOCUS_11080 17085 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 17929 17225 gene locus_tag LOCUS_11090 17929 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 19875 18007 gene locus_tag LOCUS_11100 19875 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 20089 20403 gene locus_tag LOCUS_11110 20089 20403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 20491 21003 gene locus_tag LOCUS_11120 20491 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 21211 23220 gene locus_tag LOCUS_11130 21211 23220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 23304 24029 gene locus_tag LOCUS_11140 23304 24029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 24172 24474 gene locus_tag LOCUS_11150 24172 24474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 26287 24785 gene locus_tag LOCUS_11160 26287 24785 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence27 23 1096 gene locus_tag LOCUS_11170 gene mnmA 23 1096 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_11170 2357 1221 gene locus_tag LOCUS_11180 gene ugpC 2357 1221 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_11180 4768 2600 gene locus_tag LOCUS_11190 4768 2600 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_11190 5994 4885 gene locus_tag LOCUS_11200 gene serC 5994 4885 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 protein_id gnl|my_center|LOCUS_11200 6983 6183 gene locus_tag LOCUS_11210 6983 6183 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_11210 7190 7957 gene locus_tag LOCUS_11220 7190 7957 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_11220 7954 8817 gene locus_tag LOCUS_11230 7954 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 8805 9980 gene locus_tag LOCUS_11240 8805 9980 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_11240 9977 10972 gene locus_tag LOCUS_11250 9977 10972 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 protein_id gnl|my_center|LOCUS_11250 10985 12313 gene locus_tag LOCUS_11260 gene uxaC 10985 12313 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187445.1 protein_id gnl|my_center|LOCUS_11260 12310 13359 gene locus_tag LOCUS_11270 gene uxuA 12310 13359 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_11270 13356 14186 gene locus_tag LOCUS_11280 13356 14186 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027123.1 protein_id gnl|my_center|LOCUS_11280 15195 14317 gene locus_tag LOCUS_11290 15195 14317 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874373.1 protein_id gnl|my_center|LOCUS_11290 15329 16003 gene locus_tag LOCUS_11300 15329 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 16921 16157 gene locus_tag LOCUS_11310 16921 16157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 17749 17045 gene locus_tag LOCUS_11320 17749 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 18467 17742 gene locus_tag LOCUS_11330 18467 17742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 19317 18469 gene locus_tag LOCUS_11340 19317 18469 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362363.1 protein_id gnl|my_center|LOCUS_11340 20143 19328 gene locus_tag LOCUS_11350 gene accD 20143 19328 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_11350 21079 20159 gene locus_tag LOCUS_11360 gene fabD 21079 20159 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_11360 21544 21092 gene locus_tag LOCUS_11370 gene fabZ 21544 21092 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_11370 22272 21541 gene locus_tag LOCUS_11380 gene fabG 22272 21541 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_11380 24693 22291 gene locus_tag LOCUS_11390 24693 22291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 25023 24772 gene locus_tag LOCUS_11400 25023 24772 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148686.1 protein_id gnl|my_center|LOCUS_11400 25759 25049 gene locus_tag LOCUS_11410 25759 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence28 271 615 gene locus_tag LOCUS_11420 271 615 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_11420 612 1091 gene locus_tag LOCUS_11430 612 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1492 1677 gene locus_tag LOCUS_11440 1492 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1702 1920 gene locus_tag LOCUS_11450 1702 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2018 2275 gene locus_tag LOCUS_11460 2018 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2418 2600 gene locus_tag LOCUS_11470 2418 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2680 2928 gene locus_tag LOCUS_11480 2680 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 3472 3708 gene locus_tag LOCUS_11490 3472 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 5793 3799 gene locus_tag LOCUS_11500 5793 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7489 6074 gene locus_tag LOCUS_11510 7489 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 7799 8104 gene locus_tag LOCUS_11520 7799 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 8141 10768 gene locus_tag LOCUS_11530 8141 10768 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_11530 12060 10912 gene locus_tag LOCUS_11540 gene fucO 12060 10912 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_11540 12942 12139 gene locus_tag LOCUS_11550 12942 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 13096 14433 gene locus_tag LOCUS_11560 13096 14433 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_11560 15417 14560 gene locus_tag LOCUS_11570 15417 14560 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_11570 17014 15677 gene locus_tag LOCUS_11580 17014 15677 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_11580 18405 17011 gene locus_tag LOCUS_11590 gene scfB 18405 17011 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_11590 18720 18568 gene locus_tag LOCUS_11600 gene scfA 18720 18568 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_11600 20257 18839 gene locus_tag LOCUS_11610 gene gltA 20257 18839 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_11610 21101 20259 gene locus_tag LOCUS_11620 21101 20259 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_11620 24061 21371 gene locus_tag LOCUS_11630 gene ppdK 24061 21371 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_11630 25410 24607 gene locus_tag LOCUS_11640 25410 24607 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence29 281 913 gene locus_tag LOCUS_11650 281 913 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_11650 1634 1059 gene locus_tag LOCUS_11660 1634 1059 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 protein_id gnl|my_center|LOCUS_11660 1869 3281 gene locus_tag LOCUS_11670 1869 3281 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_11670 3278 3739 gene locus_tag LOCUS_11680 3278 3739 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_11680 3741 4439 gene locus_tag LOCUS_11690 3741 4439 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_11690 5521 4544 gene locus_tag LOCUS_11700 5521 4544 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_11700 6566 5544 gene locus_tag LOCUS_11710 6566 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 7582 6563 gene locus_tag LOCUS_11720 7582 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 8415 7708 gene locus_tag LOCUS_11730 8415 7708 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389336.1 protein_id gnl|my_center|LOCUS_11730 8581 9228 gene locus_tag LOCUS_11740 8581 9228 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_11740 9306 11099 gene locus_tag LOCUS_11750 9306 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 12785 11205 gene locus_tag LOCUS_11760 12785 11205 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_11760 13750 12815 gene locus_tag LOCUS_11770 13750 12815 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_11770 14360 13728 gene locus_tag LOCUS_11780 14360 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 14652 14371 gene locus_tag LOCUS_11790 14652 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 15052 14654 gene locus_tag LOCUS_11800 15052 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 15783 15085 gene locus_tag LOCUS_11810 15783 15085 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286628.1 protein_id gnl|my_center|LOCUS_11810 16548 15928 gene locus_tag LOCUS_11820 16548 15928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 16873 18117 gene locus_tag LOCUS_11830 gene hisS 16873 18117 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258794.1 protein_id gnl|my_center|LOCUS_11830 18138 18533 gene locus_tag LOCUS_11840 18138 18533 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982672.1 protein_id gnl|my_center|LOCUS_11840 19523 19611 gene locus_tag LOCUS_t00290 19523 19611 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19740 19600 gene locus_tag LOCUS_11850 19740 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 19865 20998 gene locus_tag LOCUS_11860 19865 20998 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_11860 22076 21141 gene locus_tag LOCUS_11870 22076 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 23267 22248 gene locus_tag LOCUS_11880 23267 22248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 23863 23264 gene locus_tag LOCUS_11890 23863 23264 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704295.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence30 503 664 gene locus_tag LOCUS_11900 503 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 913 2244 gene locus_tag LOCUS_11910 gene der 913 2244 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_11910 2248 3534 gene locus_tag LOCUS_11920 gene obgE 2248 3534 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_11920 4007 4465 gene locus_tag LOCUS_11930 gene nrdR 4007 4465 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_11930 4465 5349 gene locus_tag LOCUS_11940 4465 5349 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_11940 5359 5631 gene locus_tag LOCUS_11950 gene remA 5359 5631 CDS product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 protein_id gnl|my_center|LOCUS_11950 5774 6046 gene locus_tag LOCUS_11960 5774 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6110 8359 gene locus_tag LOCUS_11970 gene priA 6110 8359 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_11970 8387 8848 gene locus_tag LOCUS_11980 gene def 8387 8848 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_11980 8876 9814 gene locus_tag LOCUS_11990 gene fmt 8876 9814 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_11990 9811 11121 gene locus_tag LOCUS_12000 gene rsmB 9811 11121 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_12000 11118 12170 gene locus_tag LOCUS_12010 gene rlmN 11118 12170 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_12010 12176 13117 gene locus_tag LOCUS_12020 gene rsgA 12176 13117 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460520.1 protein_id gnl|my_center|LOCUS_12020 15669 13354 gene locus_tag LOCUS_12030 15669 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 16397 15750 gene locus_tag LOCUS_12040 16397 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 18780 16390 gene locus_tag LOCUS_12050 18780 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 20425 18851 gene locus_tag LOCUS_12060 20425 18851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 21267 20506 gene locus_tag LOCUS_12070 21267 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 23146 21341 gene locus_tag LOCUS_12080 23146 21341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence31 1472 231 gene locus_tag LOCUS_12090 gene pepT 1472 231 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_12090 2683 1460 gene locus_tag LOCUS_12100 2683 1460 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_12100 4142 2712 gene locus_tag LOCUS_12110 4142 2712 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680081.1 protein_id gnl|my_center|LOCUS_12110 4353 5663 gene locus_tag LOCUS_12120 4353 5663 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_12120 6020 6940 gene locus_tag LOCUS_12130 6020 6940 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411603.1 protein_id gnl|my_center|LOCUS_12130 6937 7788 gene locus_tag LOCUS_12140 6937 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7920 8750 gene locus_tag LOCUS_12150 7920 8750 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_12150 8751 9692 gene locus_tag LOCUS_12160 8751 9692 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_12160 11772 10039 gene locus_tag LOCUS_12170 11772 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 12229 13611 gene locus_tag LOCUS_12180 gene rlmD 12229 13611 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_12180 13630 13776 gene locus_tag LOCUS_12190 13630 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 13844 14209 gene locus_tag LOCUS_12200 13844 14209 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_12200 14206 14727 gene locus_tag LOCUS_12210 14206 14727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 14770 15645 gene locus_tag LOCUS_12220 14770 15645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 15661 16269 gene locus_tag LOCUS_12230 15661 16269 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_12230 16427 17056 gene locus_tag LOCUS_12240 gene upp 16427 17056 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_12240 17056 18030 gene locus_tag LOCUS_12250 17056 18030 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_12250 18120 18341 gene locus_tag LOCUS_12260 18120 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 19604 18378 gene locus_tag LOCUS_12270 19604 18378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 21085 19601 gene locus_tag LOCUS_12280 21085 19601 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_12280 21217 22383 gene locus_tag LOCUS_12290 21217 22383 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence32 3300 169 gene locus_tag LOCUS_12300 gene ileS 3300 169 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_12300 6892 4265 gene locus_tag LOCUS_12310 gene alaS 6892 4265 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_12310 7854 7075 gene locus_tag LOCUS_12320 7854 7075 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_12320 9550 8009 gene locus_tag LOCUS_12330 gene rny 9550 8009 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_12330 10159 11208 gene locus_tag LOCUS_12340 gene hrcA 10159 11208 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_12340 11218 11772 gene locus_tag LOCUS_12350 gene grpE 11218 11772 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_12350 11911 13752 gene locus_tag LOCUS_12360 gene dnaK 11911 13752 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_12360 13852 15012 gene locus_tag LOCUS_12370 gene dnaJ 13852 15012 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_12370 16153 15473 gene locus_tag LOCUS_12380 16153 15473 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_12380 16869 16150 gene locus_tag LOCUS_12390 16869 16150 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006715.1 protein_id gnl|my_center|LOCUS_12390 17098 18564 gene locus_tag LOCUS_12400 gene spoVAF 17098 18564 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_12400 18769 18844 gene locus_tag LOCUS_t00300 18769 18844 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19949 19554 gene locus_tag LOCUS_12410 19949 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 21238 20303 gene locus_tag LOCUS_12420 21238 20303 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584138.1 protein_id gnl|my_center|LOCUS_12420 21360 21530 gene locus_tag LOCUS_12430 21360 21530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence33 207 1997 gene locus_tag LOCUS_12440 207 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1990 4746 gene locus_tag LOCUS_12450 1990 4746 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_12450 5718 5317 gene locus_tag LOCUS_12460 gene rpsI 5718 5317 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_12460 6168 5743 gene locus_tag LOCUS_12470 gene rplM 6168 5743 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638098.1 protein_id gnl|my_center|LOCUS_12470 6420 6241 gene locus_tag LOCUS_12480 6420 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 7486 6476 gene locus_tag LOCUS_12490 7486 6476 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_12490 7652 8173 gene locus_tag LOCUS_12500 7652 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 9921 8446 gene locus_tag LOCUS_12510 gene spoIVA 9921 8446 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_12510 10819 9983 gene locus_tag LOCUS_12520 gene gpr 10819 9983 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_12520 11127 13019 gene locus_tag LOCUS_12530 gene dppE 11127 13019 CDS product dipeptide ABC transporter substrate-binding protein DppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886494.1 protein_id gnl|my_center|LOCUS_12530 13080 13619 gene locus_tag LOCUS_12540 13080 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 13719 14318 gene locus_tag LOCUS_12550 13719 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 14331 14403 gene locus_tag LOCUS_t00310 14331 14403 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14432 14710 gene locus_tag LOCUS_12560 14432 14710 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_12560 14938 15642 gene locus_tag LOCUS_12570 gene rlmB 14938 15642 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_12570 15673 18780 gene locus_tag LOCUS_12580 15673 18780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 19782 19399 gene locus_tag LOCUS_12590 19782 19399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 20429 19779 gene locus_tag LOCUS_12600 20429 19779 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence34 1639 350 gene locus_tag LOCUS_12610 1639 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2196 1654 gene locus_tag LOCUS_12620 2196 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3465 2209 gene locus_tag LOCUS_12630 3465 2209 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966338.1 protein_id gnl|my_center|LOCUS_12630 4115 3462 gene locus_tag LOCUS_12640 gene gmhA 4115 3462 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_12640 5386 4112 gene locus_tag LOCUS_12650 5386 4112 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_12650 6435 5425 gene locus_tag LOCUS_12660 6435 5425 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_12660 7916 6756 gene locus_tag LOCUS_12670 7916 6756 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_12670 9939 8137 gene locus_tag LOCUS_12680 9939 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 11968 10172 gene locus_tag LOCUS_12690 gene glmS 11968 10172 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_12690 13376 11970 gene locus_tag LOCUS_12700 gene glmM 13376 11970 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521461.1 protein_id gnl|my_center|LOCUS_12700 14028 13378 gene locus_tag LOCUS_12710 14028 13378 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_12710 15225 14143 gene locus_tag LOCUS_12720 15225 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 15623 15228 gene locus_tag LOCUS_12730 gene zur 15623 15228 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899290.1 protein_id gnl|my_center|LOCUS_12730 16172 16723 gene locus_tag LOCUS_12740 16172 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 16720 17409 gene locus_tag LOCUS_12750 16720 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 18717 17539 gene locus_tag LOCUS_12760 18717 17539 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_12760 18930 20213 gene locus_tag LOCUS_12770 gene aspS 18930 20213 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence35 1209 394 gene locus_tag LOCUS_12780 gene plsY 1209 394 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_12780 1623 2654 gene locus_tag LOCUS_12790 1623 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3047 3499 gene locus_tag LOCUS_12800 3047 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 3490 4260 gene locus_tag LOCUS_12810 3490 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4365 5600 gene locus_tag LOCUS_12820 4365 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6757 6056 gene locus_tag LOCUS_12830 6757 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7353 7631 gene locus_tag LOCUS_12840 7353 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 7767 9161 gene locus_tag LOCUS_12850 7767 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 9568 10410 gene locus_tag LOCUS_12860 9568 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10422 14432 gene locus_tag LOCUS_12870 10422 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 14456 15145 gene locus_tag LOCUS_12880 14456 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 16498 15731 gene locus_tag LOCUS_12890 16498 15731 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_12890 17325 16579 gene locus_tag LOCUS_12900 17325 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 18202 18639 gene locus_tag LOCUS_12910 18202 18639 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_12910 18636 19325 gene locus_tag LOCUS_12920 18636 19325 CDS product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence36 807 2408 gene locus_tag LOCUS_12930 807 2408 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906091.1 protein_id gnl|my_center|LOCUS_12930 4588 3374 gene locus_tag LOCUS_12940 gene ugpC 4588 3374 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_12940 5498 4608 gene locus_tag LOCUS_12950 5498 4608 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262978.1 protein_id gnl|my_center|LOCUS_12950 7033 5498 gene locus_tag LOCUS_12960 7033 5498 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_12960 8710 7157 gene locus_tag LOCUS_12970 8710 7157 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_12970 10957 8984 gene locus_tag LOCUS_12980 10957 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 11194 13242 gene locus_tag LOCUS_12990 11194 13242 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 protein_id gnl|my_center|LOCUS_12990 13897 13316 gene locus_tag LOCUS_13000 13897 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 14384 13884 gene locus_tag LOCUS_13010 14384 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 17203 14486 gene locus_tag LOCUS_13020 gene pulA 17203 14486 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167514.1 protein_id gnl|my_center|LOCUS_13020 18796 17294 gene locus_tag LOCUS_13030 gene malQ 18796 17294 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence37 601 473 gene locus_tag LOCUS_13040 601 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3093 625 gene locus_tag LOCUS_13050 3093 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7889 3783 gene locus_tag LOCUS_13060 7889 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 12937 8165 gene locus_tag LOCUS_13070 12937 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 14258 13269 gene locus_tag LOCUS_13080 14258 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 14431 14264 gene locus_tag LOCUS_13090 14431 14264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 15210 14452 gene locus_tag LOCUS_13100 15210 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 16320 15490 gene locus_tag LOCUS_13110 16320 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 16826 18376 gene locus_tag LOCUS_13120 16826 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence38 990 121 gene locus_tag LOCUS_13130 990 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2041 1097 gene locus_tag LOCUS_13140 2041 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2169 3710 gene locus_tag LOCUS_13150 2169 3710 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_13150 3984 4059 gene locus_tag LOCUS_t00320 3984 4059 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4086 4162 gene locus_tag LOCUS_t00330 4086 4162 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4172 4247 gene locus_tag LOCUS_t00340 4172 4247 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4277 4352 gene locus_tag LOCUS_t00350 4277 4352 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4391 4465 gene locus_tag LOCUS_t00360 4391 4465 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4705 5058 gene locus_tag LOCUS_13160 4705 5058 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_13160 5994 5260 gene locus_tag LOCUS_13170 5994 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 6317 6009 gene locus_tag LOCUS_13180 6317 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_13180 6848 9415 gene locus_tag LOCUS_13190 6848 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 10867 9650 gene locus_tag LOCUS_13200 10867 9650 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_13200 12184 11138 gene locus_tag LOCUS_13210 12184 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 12618 12181 gene locus_tag LOCUS_13220 12618 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 13141 12716 gene locus_tag LOCUS_13230 13141 12716 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_13230 13990 13196 gene locus_tag LOCUS_13240 gene minD 13990 13196 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869949.1 protein_id gnl|my_center|LOCUS_13240 14168 15418 gene locus_tag LOCUS_13250 14168 15418 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_13250 15470 16534 gene locus_tag LOCUS_13260 gene pfkA 15470 16534 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 protein_id gnl|my_center|LOCUS_13260 16534 16809 gene locus_tag LOCUS_13270 16534 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 17144 17335 gene locus_tag LOCUS_13280 17144 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence39 139 1011 gene locus_tag LOCUS_13290 gene ispA 139 1011 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 protein_id gnl|my_center|LOCUS_13290 1014 1751 gene locus_tag LOCUS_13300 1014 1751 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_13300 1748 2620 gene locus_tag LOCUS_13310 1748 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2631 3083 gene locus_tag LOCUS_13320 2631 3083 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_13320 3086 4777 gene locus_tag LOCUS_13330 gene recN 3086 4777 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_13330 4835 5734 gene locus_tag LOCUS_13340 gene murB 4835 5734 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111588.1 protein_id gnl|my_center|LOCUS_13340 5761 6648 gene locus_tag LOCUS_13350 5761 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6658 10086 gene locus_tag LOCUS_13360 6658 10086 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_13360 10170 10880 gene locus_tag LOCUS_13370 10170 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 10910 13243 gene locus_tag LOCUS_13380 10910 13243 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_13380 13254 14105 gene locus_tag LOCUS_13390 13254 14105 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_13390 15454 14186 gene locus_tag LOCUS_13400 15454 14186 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_13400 15691 16188 gene locus_tag LOCUS_13410 gene nuoE 15691 16188 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence40 460 383 gene locus_tag LOCUS_t00370 460 383 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 694 782 gene locus_tag LOCUS_t00380 694 782 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 950 1447 gene locus_tag LOCUS_13420 950 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1724 2377 gene locus_tag LOCUS_13430 1724 2377 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_13430 2638 3738 gene locus_tag LOCUS_13440 2638 3738 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139014079.1 protein_id gnl|my_center|LOCUS_13440 4398 3988 gene locus_tag LOCUS_13450 4398 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5326 4712 gene locus_tag LOCUS_13460 gene udk 5326 4712 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_13460 5532 5870 gene locus_tag LOCUS_13470 gene spoIIAA 5532 5870 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059133.1 protein_id gnl|my_center|LOCUS_13470 5867 6313 gene locus_tag LOCUS_13480 gene spoIIAB 5867 6313 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_13480 6335 7060 gene locus_tag LOCUS_13490 gene sigF 6335 7060 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_13490 7247 7531 gene locus_tag LOCUS_13500 7247 7531 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_13500 7543 9171 gene locus_tag LOCUS_13510 gene groL 7543 9171 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_13510 9558 9286 gene locus_tag LOCUS_13520 9558 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9774 10073 gene locus_tag LOCUS_13530 9774 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 10278 11267 gene locus_tag LOCUS_13540 gene ansA 10278 11267 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_13540 11932 11336 gene locus_tag LOCUS_13550 11932 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 13132 11948 gene locus_tag LOCUS_13560 gene thiI 13132 11948 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_13560 13702 16332 gene locus_tag LOCUS_13570 13702 16332 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence41 601 251 gene locus_tag LOCUS_13580 601 251 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027987.1 protein_id gnl|my_center|LOCUS_13580 1985 645 gene locus_tag LOCUS_13590 1985 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 3215 5920 gene locus_tag LOCUS_13600 3215 5920 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 protein_id gnl|my_center|LOCUS_13600 7235 6060 gene locus_tag LOCUS_13610 7235 6060 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_13610 7711 7232 gene locus_tag LOCUS_13620 7711 7232 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_13620 7888 8157 gene locus_tag LOCUS_13630 7888 8157 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_13630 8169 9527 gene locus_tag LOCUS_13640 8169 9527 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_13640 9702 10271 gene locus_tag LOCUS_13650 9702 10271 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_13650 11452 10394 gene locus_tag LOCUS_13660 11452 10394 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_13660 12123 11449 gene locus_tag LOCUS_13670 12123 11449 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_13670 12346 12693 gene locus_tag LOCUS_13680 12346 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 13014 13664 gene locus_tag LOCUS_13690 13014 13664 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_13690 13769 15520 gene locus_tag LOCUS_13700 13769 15520 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_13700 15551 16123 gene locus_tag LOCUS_13710 15551 16123 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 protein_id gnl|my_center|LOCUS_13710 16294 16995 gene locus_tag LOCUS_13720 16294 16995 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence42 3030 523 gene locus_tag LOCUS_13730 3030 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 4742 3027 gene locus_tag LOCUS_13740 4742 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 5648 4746 gene locus_tag LOCUS_13750 5648 4746 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_13750 6590 5658 gene locus_tag LOCUS_13760 6590 5658 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_13760 8329 6611 gene locus_tag LOCUS_13770 8329 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 9666 8359 gene locus_tag LOCUS_13780 gene melA 9666 8359 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_13780 10576 9704 gene locus_tag LOCUS_13790 gene nanA 10576 9704 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703468.1 protein_id gnl|my_center|LOCUS_13790 11462 10563 gene locus_tag LOCUS_13800 11462 10563 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_13800 12142 11459 gene locus_tag LOCUS_13810 12142 11459 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936718.1 protein_id gnl|my_center|LOCUS_13810 13271 12144 gene locus_tag LOCUS_13820 13271 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 13442 14326 gene locus_tag LOCUS_13830 13442 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 14921 14601 gene locus_tag LOCUS_13840 14921 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 15332 15631 gene locus_tag LOCUS_13850 15332 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 15628 16431 gene locus_tag LOCUS_13860 15628 16431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence43 1084 92 gene locus_tag LOCUS_13870 1084 92 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095354.1 protein_id gnl|my_center|LOCUS_13870 2027 1143 gene locus_tag LOCUS_13880 2027 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2146 3483 gene locus_tag LOCUS_13890 2146 3483 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_13890 3495 4223 gene locus_tag LOCUS_13900 3495 4223 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445421.1 protein_id gnl|my_center|LOCUS_13900 4242 5141 gene locus_tag LOCUS_13910 4242 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 7251 5380 gene locus_tag LOCUS_13920 7251 5380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360293.1 protein_id gnl|my_center|LOCUS_13920 8855 7248 gene locus_tag LOCUS_13930 8855 7248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357553.1 protein_id gnl|my_center|LOCUS_13930 8736 9020 gene locus_tag LOCUS_13940 8736 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10134 9280 gene locus_tag LOCUS_13950 10134 9280 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_13950 12130 10199 gene locus_tag LOCUS_13960 12130 10199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_13960 13884 12127 gene locus_tag LOCUS_13970 13884 12127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_13970 14841 14143 gene locus_tag LOCUS_13980 14841 14143 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896360.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence44 2075 855 gene locus_tag LOCUS_13990 2075 855 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_13990 3570 2098 gene locus_tag LOCUS_14000 3570 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3873 3948 gene locus_tag LOCUS_t00390 3873 3948 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4085 4891 gene locus_tag LOCUS_14010 4085 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 6320 5055 gene locus_tag LOCUS_14020 gene eno 6320 5055 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_14020 6408 7439 gene locus_tag LOCUS_14030 6408 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 8178 7396 gene locus_tag LOCUS_14040 8178 7396 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_14040 10163 8178 gene locus_tag LOCUS_14050 gene metG 10163 8178 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_14050 10351 11376 gene locus_tag LOCUS_14060 10351 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 11388 12302 gene locus_tag LOCUS_14070 11388 12302 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_14070 12404 12577 gene locus_tag LOCUS_14080 12404 12577 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_14080 12699 13445 gene locus_tag LOCUS_14090 12699 13445 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_14090 13438 14310 gene locus_tag LOCUS_14100 gene rsmI 13438 14310 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence45 865 206 gene locus_tag LOCUS_14110 865 206 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_14110 1001 1186 gene locus_tag LOCUS_14120 1001 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1213 3612 gene locus_tag LOCUS_14130 1213 3612 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021036893.1 protein_id gnl|my_center|LOCUS_14130 3896 4453 gene locus_tag LOCUS_14140 3896 4453 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_14140 6501 5575 gene locus_tag LOCUS_14150 6501 5575 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_14150 8187 6685 gene locus_tag LOCUS_14160 gene glpK 8187 6685 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705539.1 protein_id gnl|my_center|LOCUS_14160 8382 9026 gene locus_tag LOCUS_14170 8382 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 9026 9967 gene locus_tag LOCUS_14180 9026 9967 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_14180 10029 10709 gene locus_tag LOCUS_14190 10029 10709 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_14190 12016 10796 gene locus_tag LOCUS_14200 12016 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 12165 12557 gene locus_tag LOCUS_14210 12165 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 12554 13177 gene locus_tag LOCUS_14220 12554 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 13653 13579 gene locus_tag LOCUS_t00400 13653 13579 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence46 1500 949 gene locus_tag LOCUS_14230 1500 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1712 3241 gene locus_tag LOCUS_14240 gene cls 1712 3241 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837633.1 protein_id gnl|my_center|LOCUS_14240 6453 3562 gene locus_tag LOCUS_14250 6453 3562 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_14250 7987 6446 gene locus_tag LOCUS_14260 7987 6446 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_14260 8576 7980 gene locus_tag LOCUS_14270 8576 7980 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_14270 8817 8608 gene locus_tag LOCUS_14280 8817 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9804 8851 gene locus_tag LOCUS_14290 9804 8851 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_14290 10217 10684 gene locus_tag LOCUS_14300 10217 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 10671 11870 gene locus_tag LOCUS_14310 10671 11870 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_14310 11867 13246 gene locus_tag LOCUS_14320 11867 13246 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_14320 13635 13790 gene locus_tag LOCUS_14330 13635 13790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence47 845 1759 gene locus_tag LOCUS_14340 845 1759 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806274.1 protein_id gnl|my_center|LOCUS_14340 1996 2253 gene locus_tag LOCUS_14350 1996 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2244 3917 gene locus_tag LOCUS_14360 2244 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3914 5209 gene locus_tag LOCUS_14370 3914 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5202 5867 gene locus_tag LOCUS_14380 5202 5867 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030074.1 protein_id gnl|my_center|LOCUS_14380 6262 6645 gene locus_tag LOCUS_14390 6262 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 6715 7614 gene locus_tag LOCUS_14400 6715 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 7636 10332 gene locus_tag LOCUS_14410 7636 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 10624 10415 gene locus_tag LOCUS_14420 10624 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 <13757 10788 gene locus_tag LOCUS_14430 <13757 10788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein >Feature sequence48 1745 666 gene locus_tag LOCUS_14440 1745 666 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767017.1 protein_id gnl|my_center|LOCUS_14440 3612 1825 gene locus_tag LOCUS_14450 3612 1825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_14450 5333 3609 gene locus_tag LOCUS_14460 5333 3609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 protein_id gnl|my_center|LOCUS_14460 6240 5575 gene locus_tag LOCUS_14470 gene upp 6240 5575 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048712.1 protein_id gnl|my_center|LOCUS_14470 6328 6762 gene locus_tag LOCUS_14480 6328 6762 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083256.1 protein_id gnl|my_center|LOCUS_14480 8348 6831 gene locus_tag LOCUS_14490 8348 6831 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 protein_id gnl|my_center|LOCUS_14490 9347 8799 gene locus_tag LOCUS_14500 gene pyrR 9347 8799 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_14500 9547 10110 gene locus_tag LOCUS_14510 9547 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 10267 10671 gene locus_tag LOCUS_14520 10267 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 11907 10675 gene locus_tag LOCUS_14530 11907 10675 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_14530 12163 12867 gene locus_tag LOCUS_14540 12163 12867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779440.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence49 304 6585 gene locus_tag LOCUS_14550 304 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 6731 7597 gene locus_tag LOCUS_14560 gene fba 6731 7597 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_14560 8791 7805 gene locus_tag LOCUS_14570 8791 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 10005 8872 gene locus_tag LOCUS_14580 10005 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 10511 10002 gene locus_tag LOCUS_14590 10511 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 10771 11436 gene locus_tag LOCUS_14600 10771 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 <13457 11775 gene locus_tag LOCUS_14610 <13457 11775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000786083.1:threonine--tRNA ligase >Feature sequence50 87 1244 gene locus_tag LOCUS_14620 87 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2595 1825 gene locus_tag LOCUS_14630 gene spo0A 2595 1825 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_14630 3303 5087 gene locus_tag LOCUS_14640 3303 5087 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933885.1 protein_id gnl|my_center|LOCUS_14640 5262 6113 gene locus_tag LOCUS_14650 5262 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 6238 6879 gene locus_tag LOCUS_14660 gene cps4B 6238 6879 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 protein_id gnl|my_center|LOCUS_14660 6893 8686 gene locus_tag LOCUS_14670 6893 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8744 10993 gene locus_tag LOCUS_14680 8744 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence51 2295 379 gene locus_tag LOCUS_14690 2295 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2465 2316 gene locus_tag LOCUS_14700 2465 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 5822 3315 gene locus_tag LOCUS_14710 5822 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7724 6222 gene locus_tag LOCUS_14720 7724 6222 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_14720 9204 7774 gene locus_tag LOCUS_14730 gene purB 9204 7774 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_14730 9450 10163 gene locus_tag LOCUS_14740 9450 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 10216 10482 gene locus_tag LOCUS_14750 10216 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 10487 10939 gene locus_tag LOCUS_14760 10487 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence52 2715 2790 gene locus_tag LOCUS_t00410 2715 2790 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3147 3395 gene locus_tag LOCUS_14770 3147 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3655 4413 gene locus_tag LOCUS_14780 3655 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4479 5579 gene locus_tag LOCUS_14790 4479 5579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_14790 5581 6624 gene locus_tag LOCUS_14800 5581 6624 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_14800 6662 7561 gene locus_tag LOCUS_14810 6662 7561 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_14810 7627 9042 gene locus_tag LOCUS_14820 7627 9042 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_14820 9063 10406 gene locus_tag LOCUS_14830 9063 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence53 465 1220 gene locus_tag LOCUS_14840 465 1220 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_14840 1253 1498 gene locus_tag LOCUS_14850 1253 1498 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_14850 1587 3008 gene locus_tag LOCUS_14860 1587 3008 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_14860 3046 4749 gene locus_tag LOCUS_14870 3046 4749 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_14870 6519 4918 gene locus_tag LOCUS_14880 6519 4918 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_14880 7616 6522 gene locus_tag LOCUS_14890 gene glf 7616 6522 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272486.1 protein_id gnl|my_center|LOCUS_14890 8415 7636 gene locus_tag LOCUS_14900 8415 7636 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193820707.1 protein_id gnl|my_center|LOCUS_14900 9472 8432 gene locus_tag LOCUS_14910 9472 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence54 459 16 gene locus_tag LOCUS_14920 459 16 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_14920 903 547 gene locus_tag LOCUS_14930 903 547 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_14930 1157 1303 gene locus_tag LOCUS_14940 1157 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3744 1279 gene locus_tag LOCUS_14950 gene pcrA 3744 1279 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 protein_id gnl|my_center|LOCUS_14950 3946 4599 gene locus_tag LOCUS_14960 3946 4599 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796158.1 protein_id gnl|my_center|LOCUS_14960 4691 5605 gene locus_tag LOCUS_14970 4691 5605 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_14970 5666 6568 gene locus_tag LOCUS_14980 5666 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 6637 7539 gene locus_tag LOCUS_14990 6637 7539 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460597.1 protein_id gnl|my_center|LOCUS_14990 9287 7671 gene locus_tag LOCUS_15000 9287 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence55 614 426 gene locus_tag LOCUS_15010 614 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1140 979 gene locus_tag LOCUS_15020 1140 979 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_15020 2966 1302 gene locus_tag LOCUS_15030 2966 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 3307 3597 gene locus_tag LOCUS_15040 3307 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3594 5600 gene locus_tag LOCUS_15050 gene feoB 3594 5600 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_15050 5597 5953 gene locus_tag LOCUS_15060 5597 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 8496 6085 gene locus_tag LOCUS_15070 8496 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence56 1277 465 gene locus_tag LOCUS_15080 1277 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2132 1365 gene locus_tag LOCUS_15090 2132 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2923 2129 gene locus_tag LOCUS_15100 2923 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 4302 3220 gene locus_tag LOCUS_15110 4302 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5536 5841 gene locus_tag LOCUS_15120 5536 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 6027 6545 gene locus_tag LOCUS_15130 gene rplJ 6027 6545 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_15130 6592 6972 gene locus_tag LOCUS_15140 gene rplL 6592 6972 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_15140 7204 7707 gene locus_tag LOCUS_15150 7204 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence57 1046 1303 gene locus_tag LOCUS_15160 1046 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1367 2968 gene locus_tag LOCUS_15170 1367 2968 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_15170 3460 3218 gene locus_tag LOCUS_15180 3460 3218 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965244.1 protein_id gnl|my_center|LOCUS_15180 3615 3457 gene locus_tag LOCUS_15190 3615 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3582 4436 gene locus_tag LOCUS_15200 gene spoIIIAA 3582 4436 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665906.1 protein_id gnl|my_center|LOCUS_15200 4421 4900 gene locus_tag LOCUS_15210 4421 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4910 5104 gene locus_tag LOCUS_15220 gene spoIIIAC 4910 5104 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965391.1 protein_id gnl|my_center|LOCUS_15220 5101 5496 gene locus_tag LOCUS_15230 5101 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 5493 6677 gene locus_tag LOCUS_15240 5493 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6695 7147 gene locus_tag LOCUS_15250 6695 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 7134 7571 gene locus_tag LOCUS_15260 7134 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence58 1487 645 gene locus_tag LOCUS_15270 1487 645 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_15270 2145 1525 gene locus_tag LOCUS_15280 2145 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2302 2886 gene locus_tag LOCUS_15290 gene spoIIR 2302 2886 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460947.1 protein_id gnl|my_center|LOCUS_15290 3018 3494 gene locus_tag LOCUS_15300 gene smpB 3018 3494 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_15300 3503 3871 gene locus_tag LOCUS_tm00010 3503 3871 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4096 4278 gene locus_tag LOCUS_15310 4096 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 4474 4776 gene locus_tag LOCUS_15320 4474 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4773 5009 gene locus_tag LOCUS_15330 4773 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 7243 5225 gene locus_tag LOCUS_15340 7243 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence59 515 1372 gene locus_tag LOCUS_15350 515 1372 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_15350 1391 2554 gene locus_tag LOCUS_15360 1391 2554 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_15360 4230 2686 gene locus_tag LOCUS_15370 4230 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4400 4474 gene locus_tag LOCUS_t00420 4400 4474 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6068 4566 gene locus_tag LOCUS_15380 6068 4566 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_15380 6433 6278 gene locus_tag LOCUS_15390 6433 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence60 3156 2458 gene locus_tag LOCUS_15400 3156 2458 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 protein_id gnl|my_center|LOCUS_15400 3367 4509 gene locus_tag LOCUS_15410 3367 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence61 <1 1077 gene locus_tag LOCUS_15420 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860956.1:transglycosylase domain-containing protein 1201 1662 gene locus_tag LOCUS_15430 1201 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1659 3413 gene locus_tag LOCUS_15440 1659 3413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389612.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence62 483 238 gene locus_tag LOCUS_15450 483 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2902 488 gene locus_tag LOCUS_15460 2902 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3191 2970 gene locus_tag LOCUS_15470 3191 2970 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_15470 3412 3203 gene locus_tag LOCUS_15480 3412 3203 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419939.1 protein_id gnl|my_center|LOCUS_15480 3708 4127 gene locus_tag LOCUS_15490 3708 4127 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence63 442 113 gene locus_tag LOCUS_15500 442 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 607 458 gene locus_tag LOCUS_15510 gene rpmG 607 458 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_15510 957 3431 gene locus_tag LOCUS_15520 957 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3823 3735 gene locus_tag LOCUS_t00430 3823 3735 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence64 714 295 gene locus_tag LOCUS_15530 714 295 CDS product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111798.1 protein_id gnl|my_center|LOCUS_15530 960 1292 gene locus_tag LOCUS_15540 960 1292 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_15540 2513 1401 gene locus_tag LOCUS_15550 2513 1401 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_15550 3175 3882 gene locus_tag LOCUS_15560 3175 3882 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence65 310 1092 gene locus_tag LOCUS_15570 310 1092 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_15570 2683 1289 gene locus_tag LOCUS_15580 2683 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3099 2821 gene locus_tag LOCUS_15590 3099 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3652 3440 gene locus_tag LOCUS_15600 3652 3440 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence66 536 961 gene locus_tag LOCUS_15610 gene rplK 536 961 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_15610 977 1660 gene locus_tag LOCUS_15620 gene rplA 977 1660 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_15620 1733 2593 gene locus_tag LOCUS_15630 1733 2593 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence67 <1 1990 gene locus_tag LOCUS_15640 <1 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010706591.1:ABC transporter permease >Feature sequence68 1688 981 gene locus_tag LOCUS_15650 1688 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650